Home

Cryopreserving Neural Stem Cells

1. 101 Life Technologies Products ceecccccccececesncceceeceneeceeeeeceeneceeeeeceneeceeeeecenceeeeeeesseceeeeeeeesesesaeeeeeseeneaes 101 RESOUPEES for More MOMMA DEI cc sua qlua ac cg emt nietas napaa Ema zr ta cid 106 TechmicalSuppo jp PEE S 108 Introduction Introduction Neural Stem Cells and Neural Development Overview Stem Cells It has long been thought that the adult mammalian nervous system was incapable of regeneration after injury However recent advances in our understanding of stem cell biology and neuroscience have opened up new avenues of research for developing potential treatments for incurable neurodegenerative diseases and neuronal injuries Because stem cells have the capacity to self renew and generate differentiated cells stem cell replacement therapy for central and peripheral nervous system disorders and injuries strives at repopulating the affected neural tissue with neurons and other neural cells One of the main strategies towards this end aims to recapitulate the normal development of the nervous system by activating the endogenous regenerative capacity of the neural stem cells or by transplanting neural or embryonic cells This chapter defines the key concepts in stem cell biology with respect to the nervous system presents an overview of neural development and summarizes the involvement of neural cell types in specific neural diseases
2. Neural Induction Medium To prepare 100 mL of neural induction medium aseptically mix the following components For larger volumes increase the component amounts proportionally Neural induction medium lasts for up to 7 days at 4 C Component Amount D MEM F 12 98 mL N 2 Supplement 1mL NEAA 1mL Basic FGF Solution 200 uL Heparin Solution 100 uL 46 Neural Expansion Medium DA Neuronal Differentiation Medium Neural Cell Culture and Differentiation To prepare 100 mL of neural expansion medium aseptically mix the following components For larger volumes increase the component amounts proportionally Neural expansion medium lasts for up to 7 days at 4 C Component Amount D MEM F 12 96 mL N 2 Supplement 1mL B 27 Supplement 2mL NEAA 1mL Basic FGF Solution 200 uL Heparin Solution 100 uL To prepare 100 mL of DA neural differentiation medium aseptically mix the following components For larger volumes increase the component amounts proportionally DA neural differentiation medium lasts for up to 7 days at 4 C Component Amount Neurobasal Medium 96 mL L Glutamine 1mL B 27 Supplement 2mL NEAA 1mL GDNF Solution 100 uL BDNF Solution 100 uL Ascorbic Acid Solution 100 uL dcAMP Solution 100 uM Add GDNF BDNF ascorbic acid and dcAMP at the time of medium change Preparing MEF
3. 4 Spin down the cells by centrifugation at 1 200 rpm for 4 minutes Aspirate and discard the supernatant 5 Resuspend the cells in StemPro NSC SFM complete medium 6 Count the cell number using a hemacytometer N Plate cells in fresh medium on a CELLstart CTS or Fibronectin coated plate at a density of 1 x 10 1 x 10 cells cm or split the cells at a 1 4 ratio Passaging Neural Stem Cells Suspension Culture 1 Transfer medium containing neurospheres into a 15 or 50 mL conical tube 2 Leave the tube at room temperature and allow the neurosphere to settle to the bottom of tube Alternatively spin down the cells by centrifugation at 500 rpm 200 x g for 2 minutes 3 Aspirate the supernatant carefully and leave the neurospheres in a minimum volume of medium 4 Wash the neurospheres with 10 mL D PBS without Ca and Mg aspirate the D PBS supernatant carefully and leave the neurospheres in a minimum volume of D PBS 5 Add 1 mL of TrypLE Express to the spheres and gently triturate neurospheres using a Pasteur pipette to create a single cell suspension 6 Neutralize the treatment by adding 4 mL of medium 7 Spin down the cells by centrifugation at 1 200 rpm for 4 minutes Aspirate and discard the supernatant 8 Resuspend the cells in StemPro NSC SFM complete medium 9 Count cell number using hemacytometer 10 Seed the cells in fresh medium in a suspension dish a non coated flask can b
4. GIBCO NEUROBIOLOGY PROTOCOL HANDBOOK gibco cell culture by lik technologies the heart of neuroscience ld technologies Table of Contents PAPO Tis PER 4 Neural Stem Cells and Neural Development aerae rrr nahe re tre nente ees 4 Neural Cell Types in Neurological Diseases ic o eres gbn oreet nce ete tta rr e etna ntreina panes y Neural Cell Culture and Differentiation eee eee eeeeeeeeeeeeeeee eere eeeeeee nennen nnn nnns 10 Culturing Human Neural Stem Cells ssssssssssssssssseseee eene 10 Culturing Rat Fetal Neural Stem Cells sssssssssssssssssseseee eene eene 16 Xeno free Culture or Neural Stem Cella aoctor tocca amec cAb eru acc dat etn eb acd ea aus 21 Differentiating Neural Stem Cells into Neurons and Glial Cells 24 Differentiating Glial Precursor Cells into Astrocytes and Oligodendrocytes sssssss 33 Derivation and Culture of Cortical Astrocytes sssssssssssssssssssseeeemenen eene nennen 36 Isolation Culture and Characterization of Cortical and Hippocampal Neurons 39 Derivation of Dopaminergic Neurons from Human Embryonic Stem Cells 45 Derivation and Culture of Dopaminergic Neurons from Midbrains of Rodents 55 Cryopreserving Neural Stem Cells dete Gee uela ctc v a t Rd der as 60 Cryopreservation and Re
5. number efficiency y tip 1100 30 1 92 97 7 3 1 10 cells ml 1200 40 1 93 97 V Rat Primary Cortical Astrocytes GIBCO Rat Primary Cortical Astrocytes Cat no N7745 100 were transfected using the Neon Transfection Device and 0 5 ug of a plasmid encoding the Emerald Green Fluorescent Protein EGFP 24 hours post electroporation the cells were analyzed by light Panel A and fluorescence microscopy Panel B Cell densit Pulse Pulse Pulse Transfection Viabilit Neon y voltage V width ms number efficiency y tip 1400 20 2 6996 87 0 5 x 10 cells mL 1400 30 1 7196 89 10 uL 1700 20 1 7196 9096 Gibco Neurobiology Protocols Handbook 89 Transfecting Neural Cells Using the Neon Transfection System Rat Glial Precursor Cells GIBCO Rat Glial Precursor Cells Cat no N7746 100 were transfected using the Neon Transfection Device and 0 5 ug of a plasmid encoding the Emerald Green Fluorescent Protein EGFP 24 hours post electroporation the cells were analyzed by light Panel A and fluorescence microscopy Panel B Cell densit Pulse Pulse Pulse Transfection Viabilit Neon y voltage V width ms number efficiency y tip 1300 10 3 49 78 7 3 1 10 cells ml 1500 20 1 44 64 v 90 Transfection Troubleshooting For troubleshooting tips regarding the culture and passaging of your cells refer to the manual provided w
6. C 5 CO and 90 humidity Neurosphere suspension cultures should not be maintained for more than 3 passages Important If you are re feeding rat fetal NSCs in a growth medium other than complete StemPro NSC SEM ensure that the medium is supplemented with 10 ng mL bFGF to maintain the undifferentiated state of the rat fetal NSCs Gibco Neurobiology Protocols Handbook 19 Xeno free Culture of Neural Stem Cells Xeno free Culture of Neural Stem Cells Summary Neural stem cells NSCs derived from human embryonic stem cells hESCs have the potential to help provide understanding for human neurogenesis and for potential cell therapy applications to treat Parkinson s Disease or spinal cord injuries Standard methods of culturing NSCs raise concerns about pathogen cross transfer from non human sources or contamination with non neural cells limiting the efficiency and specificity of the differentiation protocols These concerns have led to the development of xenofree conditions for maintaining and expanding NSCs which are described in this protocol Required Materials Cells e Neural stem cells Media and Reagents e CELLstart CTS Cat no A10142 01 e Neurobasal Medium Cat no 21103 049 e p 279 Supplement XenoFree Cat no A115765A e FGF basic AA 10 155 Recombinant Human Cat no PHG0026 e EGF Recombinant Human Cat no PHG0311 e GlutaMAX I Cat no 35050 e TrypLE Select 10X Cat no A12177 Dulbec
7. Pluripotent vs Adult Stem Cells Neural Stem Cells The classical definition of a stem cell requires that it has the capacity to self renew and that it possesses potency Self renewal is defined as the ability of the stem cell to go through multiple cycles of cell division while maintaining its undifferentiated state i e to generate daughter cells that are identical to their mother Potency is the ability of the stem cell to differentiate into specialized cell types A stem cell can divide to generate one daughter cell that is a stem cell maintaining its capacity for self renewal and potency and another daughter cell that can further divide produce differentiated cells While some pluripotent stem cells including Embryonic Stem Cells ESC and Induced Pluripotent Stem Cells iPSCs have the capacity for multilineage differentiation to construct a complete viable organism i e they are totipotent adult stem cells can generate only one specific lineage of differentiated cells to reconstitute tissues or organs Neural stem cells NSC are stem cells in the nervous system that can self renew and give rise to differentiated progenitor cells to generate lineages of neurons as well as glia such as astrocytes and oligodendrocytes This characteristic is known as multipotency NSCs and neural progenitor cells are present throughout development and persist in the adult nervous system Multiple classes of NSCs have been identified that differ fr
8. and Characterization of Cortical and Hippocampal Neurons page 40 Count the cell number using a hemocytometer Centrifuge the cells at 200 x g for 4 minutes Aspirate the supernatant Resuspend the cell pellet in cold Synth a Freeze at a concentration of 2 0 x 106 1 0 x 107 cells mL Make 1 mL aliquots of the cells in pre labeled pre chilled cryovials and place the vials in an isopropanol chamber at 4 C for 10 minutes Neural Cell Culture and Differentiation 6 Transfer the isopropanol chamber to 80 C for overnight 7 Transfer the frozen vials to the vapor phase of liquid nitrogen storage until use is required Cell Recovery Recovering Frozen Neural Cells Handle cells gently because they are extremely fragile upon recovery from cryopreservation It is important to rinse pipette tips and vials with complete Neurobasal B 27 medium before using them for transferring cell suspensions to avoid the cells sticking to the plastic Do not centrifuge cells upon recovery from cryopreservation 1 Remove one vial of frozen cells from liquid nitrogen 2 Thaw the vial in a 37 C water bath with gentle swirling 3 Wipe down the vial with ethanol and tap gently on a surface so that all of the medium collects at the bottom of the tube 4 Open the vial in a laminar flow hood 5 Rinse a pipette tip with medium and very gently transfer the cells from the vial to a pre rinsed 15 mL tube 6 Rinse the vial w
9. aspirate the supernatant from each chamber and rinse the cells twice with D PBS with calcium and magnesium Treat the cells with 4 paraformaldehyde for 20 minutes to fix them Rinse the cells three times with D PBS with calcium and magnesium Typical Results 10 11 12 13 14 15 Cell Analysis Permeabilize the cells with 0 3 Triton X diluted in D PBS with calcium and magnesium for 5 minutes at room temperature Rinse the cells three times with D PBS with calcium and magnesium Add enough 576 goat serum solution from step 1 to the cells to coat them and incubate for 60 minutes at room temperature Remove the solution from the wells and coat the cells with primary antibody mouse anti MAP2 10 pg mL and or rabbit anti GFAP 4 ug mL diluted in 5 goat serum solution Incubate the coated cells at 2 8 C overnight Rinse the cells three times with D PBS with calcium and magnesium Treat the cells with a secondary antibody Alexa Fluor 488 goat anti mouse H L 10 ug mL and or Alexa Fluor 594 goat anti rabbit H L 10 ng mL diluted in 5 goat serum solution Incubate for 60 minutes at room temperature Rinse the cells three times with D PBS with calcium and magnesium Stain the cells with a DAPI solution 3 ng mL for 10 minutes Mount the cells with ProLong Gold Antifade Reagent and observe them under the microscope using filters for FITC Cy5 and DAPI Thawed cortic
10. be passaged Cells cultured during expansion can be frozen down to create additional frozen stocks of higher passage number Prepare 10 mL of 1X KnockOut D MEM F 12 and warm to 37 C Transfer vial of frozen NSC from nitrogen tank to water bath It is important to make the transfer immediately to prevent crystal formation Transfer thawed cells into a 15 mL tube and add warmed 1X KnockOut D MEM F 12 to 10 mL Spin down the thawed cells by centrifugation at 1 000 rpm for 4 minutes Aspirate and discard the supernatant Resuspend the cells in StemPro NSC SFM complete medium and plate on a CELLstart CTS or Fibronectin coated plate at high density 1 x 10 cells cm Note Viability of thawed cells should be 80 if they were frozen following the cryopreservation protocol described here Gibco Neurobiology Protocols Handbook 11 Culturing Human Neural Stem Cells Passaging Neural Stem Cells Adherent Culture 1 Aspirate the medium and wash with D PBS without Ca and Mg TM 2 Add 1 mL of TrypLE Express or StemPro Accutase to the culture vessel Note The monolayer lifts off from the culture dish within 30 seconds of application of TrypLE Express or StemPro Accutase 3 Gently pipette to loosen monolayer into a single cell suspension Neutralize the treatment by adding 4 mL of medium Do not treat the cells for longer than 3 minutes after addition of TrypLE Express or StemPro Accutase
11. to 10 mL of sterile tissue culture grade D PBS Vortex to ensure thorough mixing This prepares a 4 uM EthD 1 solution Combine the reagents by adding 5 uL of the supplied 4 mM calcein AM stock solution Component A to the 10 mL of EthD 1 solution in D PBS Vortex the resulting solution to ensure thorough mixing Note This reagent mixture is suitable for most neural cells For cells with higher esterase activity you might need to start with a lower calcein AM concentration For further information refer to the user manual provided with the LIVE DEAD Viability Cytotoxicity Assay Kit The resulting working solution of 2 uM calcein AM and 4 uM EthD 1 is ready to be used The final concentration of DMSO is lt 0 1 a level generally innocuous to most cells Note Prepare a freshly coated culture vessel each time before plating cells There is no need to rinse the culture vessel before use Determining the Viability of Adherent Cells Adherent NSCs may be cultured on sterile glass coverslips or in a multiwell plate Aspirate the medium supernatant and wash the cells gently with the same volume of D PBS prior to the assay to remove or dilute any serum esterase activity Note Serum esterases could cause some increase in extracellular fluorescence by hydrolyzing calcein AM Fluorescence microscopy Transfer an aliquot of the cell suspension to a coverslip and allow the cells to settle on the surface at 37 C in
12. 01 Human GIBCO Human Astrocytes 1mL N7805 100 GIBCO Human Astrocytes Kit includes GIBCO Astrocyte 1 kit N7805 200 Medium GIBCO Human Neural Stem Cells H9 Derived 1mL N7800 100 GIBCO Human Neural Stem Cells H9 Derived Kit includes 1 kit N7800 200 StemPro NSC SFM Mouse GIBCO Mouse Embryonic Fibroblasts MEF irradiated 1mL 1520 100 100 Appendix Media Product Quantity Cat no Dulbecco s Modified Eagle Medium D MEM high glucose 500 mL 11995 065 GIBCO Astrocyte Medium 500 mL A12613 01 Hibernate A 500 mL A11473 DJ Hibernate A 500 mL A12475 01 KnockOut D MEM F 12 500 mL 12660 012 Neurobasal Medium 1X liquid without Phenol Red 500 mL 12348 017 Neurobasal Medium 1X liquid 500 mL 21103 049 Neurobasal A Medium 1X liquid without Phenol Red 500 mL 12349 015 Neurobasal A Medium 1X liquid 500 mL 10888 022 Opti MEM Reduced Serum Medium 1X liquid 100 mL 31985 062 StemPro NSC SFM 1 kit A10509 01 Synth a Freeze Cryopreservation Medium 50 mL R 005 50 Some of the products are also available in different quantities and packaging sizes Sera and Serum Replacement Products Product Quantity Cat no Fetal Bovine Serum ES Cell Qualified One Shot US 50 mL 16141 002 Fetal Bovine Serum ES Cell Qualified FBS US 100 mL 16141 061 Fetal Bovine Serum FBS Certified 500 mL 16000 044 Goat serum 100 mL
13. 0e 002 1 0e 003 f 1 0e 004 13 5 7 9 1113 15 17 19 21 23 25 27 29 31 33 35 37 39 41 43 45 47 49 Cycle Number Figure 2 qPCR detection of Sox1 transcripts in human embryonic stem cell derived NSCs 1 0e 001 1 0e 000 1 0e 001 Delta Rn 1 0e 002 1 0e 003 1 0e 004 13 5 7 9 11 1315 17 19 21 23 25 27 29 31 33 35 37 39 41 43 45 47 49 Cycle Number Gibco Neurobiology Protocols Handbook 83 Transfecting Neural Cells Using the Neon Transfection System Transfection Transfecting Neural Cells Using the Neon Transfection System Summary Required Materials The Neon Transfection System is a benchtop electroporation device that uses the pipette tip as an electroporation chamber to efficiently transfect mammalian cells including primary cells and stem cells Instructions for using the Neon Transfection System for transfecting of neural cells are described below For detailed instructions on using the Neon Transfection System refer to the manual supplied with the product or download the manual from www invitrogen com For detailed information on culture conditions for various neural cell lines refer to the instructions supplied with the specific cell line you are using 84 Neural cell line of interest Growth media and growth fact
14. 4 C Component Amount Neurobasal Medium 49 mL GlutaMAX I 2mM B 27 Supplement XenoFree 1mL bFGF 20 ng mL EGF 20 ng mL Thawing and Seeding NSCs 1 N Remove a vial of cells from liquid nitrogen and quickly thaw the vial in a 37 C water bath being careful not to immerse the vial above the level of the cap When just a small crystal of ice remains sterilize the outside of the vial with 95 ethanol Allow the ethanol to evaporate before opening the vial in a cell culture hood Gently pipet the cell suspension up and down once and place it into a 15 mL centrifuge tube Add 10 mL of warm culture medium to the tube dropwise to reduce osmotic shock Centrifuge the cell suspension at 200 x g for 5 minutes Remove the supernatant resuspend the pellet in 5 mL of culture medium and determine the total number of cells and percent viability Seed the cells at a concentration of 90 000 cells cm onto a dish or flask that has been TM TM treated with CELLstart CTS solution Aspirate the CELLstart CTS solution immediately before using the dish or flask Incubate at 36 38 C in a humidified atmosphere 90 of 5 CO in air Gibco Neurobiology Protocols Handbook 21 Xeno free Culture of Neural Stem Cells 22 Culture and Propagation 1 2 10 11 12 13 Twenty four hours after seeding the cells replace the culture medium Replace the spent medium every other d
15. CNTF Recombinant Human 20 ug PHC7015 EPO Recombinant Human 500 IU PHC2054 Epidermal Growth Factor EGF Recombinant Human 10 ug PHG0314 Epidermal Growth Factor EGF Natural Mouse 100 ug 53003 018 FGF basic Recombinant Human 10 ug 13256 029 FGF basic AA 10 155 Recombinant Human bFGF 10 ug PHG0024 FGF 8b Recombinant Human 100 ug PHG0271 G DNF Recombinant Human 100 ug PHC7041 G DNF Recombinant Human 5 ug PHC7044 G DNF Recombinant Human 10 ug PHC7045 NT 3 Recombinant Human 5 ug PHC7034 NT 4 Recombinant Human 5 ug PHC7024 Nerve Growth Factor 2 5S NGF 2 5S Natural Mouse 10 ug 13257 019 Nerve Growth Factor 7S NGF 7S Natural Mouse 100 ug 13290 010 Neurturin Recombinant Human 10 ug PHC7064 PDGF BB Recombinant Human 100 ug PH60041 PDGF BB Recombinant Human 1 mg PH60043 PDGF BB Recombinant Human 10 ug PH60045 PDGF BB Recombinant Human 50 ug PH60046 Buffers and Balanced Salt Solutions Product Quantity Cat no Dulbecco s Phosphate Buffered Saline D PBS 500 mL 14040 133 Dulbecco s Phosphate Buffered Saline D PBS without Ca 500 mL 14190 144 and Mg Hanks Balanced Salt Solution HBSS without Ca and Mg 500 mL 14170 112 Gibco Neurobiology Protocols Handbook 103 Life Technologies Products Accesory Products 104 Product Quantity Cat no Countess Automated Cell Counter 1 each C10227 Fluo 4 AM 10 x 50 ug F14201 LIVE DEAD Cell Vitality Ass
16. Cat no D1306 ProLong Gold antifade reagent Cat no P36930 EM grade paraformaldehyde Electron Microscopy Services Cat no 19208 Hibernate E Complete Medium Neurobasal Complete Medium Hibernate E is a serum free nutrient basal medium for the short term maintenance of cultured rat neurons and long term storage of viable brain tissue in ambient CO 0 2 conditions The complete medium consists of Hibernate E medium supplemented with B 27 Serum Free Supplement and GlutaMAX I Hibernate E complete medium is stable for 2 weeks when stored in the dark at 2 8 C To prepare 100 mL of Hibernate E complete medium aseptically mix the following components For larger volumes increase the component amounts proportionally Component Final concentration Amount Hibernate E Medium 1X 98 mL B 27 Serum Free Supplement 2 2mL GlutaMAX I Supplement 0 5 mM 250 uL Neurobasal complete medium requires supplementation of Neurobasal medium with B 27 Serum Free Supplement and GlutaMAX I Complete medium is stable for 2 weeks when stored in the dark at 2 8 C To prepare 100 mL of Neurobasal complete medium aseptically mix the following components For larger volumes increase the component amounts proportionally Component Final concentration Amount Neurobasal Medium 1X 98 mL B 27 Serum Free Supplement 2 2mL GlutaMAX I Supplement 0 5 mM 250 uL For primary rat hippocampus
17. Culture Vessels Gelatin Coating Culture Vessels 1 Cover the whole surface of each culture vessel with Attachment Factor solution 1 mL for each well of a 6 well plate 2 mL into each 60 mm dish or 4 mL into each 100 mm dish and incubate for 1 hour at room temperature Wash once with distilled water before plating the MEF Note AF is sterile 1X solution containing 0 176 gelatin available from Invitrogen Gibco Neurobiology Protocols Handbook 47 Derivation of Dopaminergic Neurons from Human Embryonic Stem Cells 48 Thawing MEFs 1 Plating MEFs N 1 Wearing eye protection and ultra low temperature cryo gloves remove the vials of irradiated MEF from the liquid nitrogen storage tank using metal forceps Note Transfer the vials into a container with a small amount of liquid nitrogen if the vials are exposed to ambient temperature for more than 15 seconds between removal and step 3 Briefly roll the vials containing MEF between your hands for about 10 15 seconds to remove frost and swirl them gently in a 37 C water bath Do not submerge the vials completely When only a small amount of ice remains in the vials remove them from the water bath Spray the outside of the vials with 70 ethanol before placing them in the cell culture hood Pipet the thawed cells gently into a 15 mL conical tube using a 1 mL pipette Rinse the cryovial with 1 mL of pre warmed MEF medium Transfer the medium to the
18. Integrate the acquired fluo 4 520 nm emission signal for each region of interest normalize to the first ten data points F F and then plot against time Set the response criteria For example a NSC might be considered responsive to a given neurotransmitter or ligand if the resulting normalized signal rises more than 1076 within 60 seconds following neurotransmitter addition compared to the baseline signal The number of NSCs that exhibit clear changes in intracellular Ca Ca depends on the neurotransmitter and differentiation state of the NSCs Gibco Neurobiology Protocols Handbook 75 PCR Primers for Molecular Charaterization of Neural Subtypes Molecular Characterization PCR Primers for Molecular Characterization of Neural Subtypes Summary After cells are isolated from tissue or differentiated from pluripotent precursors the resulting population needs to be characterized to confirm whether the target population has been obtained The table below lists PCR primers that can be used in quantitative polymerase chain reactions qPCR to measure the expression levels of specific genes for characterizing neural stem cells NSCs and their sublineages Target Primer Sequence Tm C Amplicon size bp Intron size bp Neural stem cells SOX1 F GCGGAAAGCGTTTTCTTG 53 0 406 No Intron SOX1 R TAATCTGACTTCTCCTCCC 50 2 SOX2 F ATGCACCGCTACGACGTGA
19. Mature Trans Reference disease model factor cell marker plantation Spinal cord Transplantation Oligo EGF bFGF OPC OLIG1 A2B5 GalC RIP O4 Yes Keirstead et injury of OPC into dendrocyte RA SOX10 NG2 al 2005 demyelination model Multiple Demyelinated axons Oligo EGF bFGF OPC PDGFR 04 01 MBP No Kang et al sclerosis co cultured with dendrocyte PDGF RA A2B5 NG2 PLP 2007 rat hippocampal neurons Remyelination Oligo RA EGF OPC PDGFR NG2 04 O1 MBP Yes Izrael et al models dendrocyte bFGF OLIG1 2 PL 2007 Noggin SOX10 Vitamin C Mouse laminin Amyotrophic Transplantation of Motoneuron BDNF GDNF Motoneuron BF1 HOXB4 NKX6 1 Yes Lee et aL lateral motoneuron progeny AA RA SHH Progenitor NKX6 1 6 2 OLIG2 NGN2 2007 sclerosis into the developing Noggin OLIG1 2 ISL1 ChAT and spinal chick embryo VAChT HB9 muscular LHX3 HOX atrophy in vitro studies only Motoneuron bFGF RA Motoneuron OLIG1 2 NKX6 1 No Li et aL SHH BDNF Progenitor NKX6 1 6 2 OLIG2 NGN2 2005 GDNF IGF 1 NGN2 ISL1 ChAT VAchT HB9 Synapsin Parkinson s Not applicable DA neuron SHH FGF8 DA PAX2 PAX5 MAP2 TH No Perrier et disease BDNF AA precursor LMX EN1 AADC VMAT al 2004 TGFp TGF 3 NURR1 PTX3 in vitro drug DA neuron FGF2 or DA EN1 OTX2 TH GABA No Yan et al screening FGF8 SHH precursor WNT1 PAX2 EN1 AADC 2005 BDNF GDNF GBX2 cAMP AA Transplantation into DA neuron FGF2 FGF8 DA EN1 P
20. age of the starting material in addition to how the material was collected and preserved Prepare the RNA samples for RNA gel analysis as follows Component Amount RNA sample 1 uL 2X BlueJuice gel loading buffer Tul DEPC treated water 8 uL Mix the components and load the samples onto individual wells of an agarose gel Use 10 uL of 0 1 kb and 1 kb molecular weight markers to estimate the molecular weight size of ribosomal RNA bands Use 10 uL DEPC water for empty wells Run samples for 30 minutes visualize the bands on an UV light box capture the gel image and perform band intensity measurements Store RNA samples at 70 C or process it further for cDNA synthesis First Strand cDNA Synthesis This protocol follows the methodologies described in the instructions for Superscript II First Strand Synthesis SuperMix Mix and briefly centrifuge each component before use Pre heat the thermocycler to 65 C Combine the following components on ice in a 0 2 mL thin walled PCR tube Use a volume containing up to 1 ug of total RNA for the reaction Component Amount Annealing buffer 1 uL Random hexamer 50 ng uL 1 uL RNA 1 ug x uL DEPC treated water to 8 uL 3 Incubate the reaction in the thermocycler at 65 C for 5 minutes and then immediately place on ice for at least 1 minute Collect the contents of the tube by brief centrifugation Gibco Neurobiology Protocols Ha
21. below Figure 1 Rat fetal NSCs at passage 3 in adherent culture using StemPro NSC SFM Gibco Neurobiology Protocols Handbook 17 Culturing Rat Fetal Neural Stem Cells g N 10 11 12 13 Neurosphere Suspension Cultures 1 When cells reach 75 90 confluency 3 4 days after seeding the rat fetal NSC cultures are ready to be passaged Rinse the culture vessel once with D PBS without calcium and magnesium then remove the medium Add pre warmed StemPro Accutase and let the cells detach from the culture surface within approximately 30 seconds After detachment gently pipet the cells up and down to break the clumps into a uniform cell suspension and add four volumes of complete StemPro NSC SFM to the culture vessel Disperse the cells by pipetting over the culture surface several times to generate a homogenous cell solution Transfer the cells to a sterile centrifuge tube and centrifuge at 300 x g for 4 minutes at room temperature Aspirate and discard the medium Resuspend the cell pellet in a minimal volume of pre warmed complete StemPro NSC SFM and remove a sample for counting Determine the total number of cells and percent viability using trypan blue stain or the LIVE DEAD Cell Vitality Assay Kit Add enough complete StemPro NSC SEM to tube for a final cell solution of 1 x 10 viable cells mL Incubate at 37 C 5 CO and 90 humidity Rat fetal NSC cultures should n
22. craniofacial mesenchyme that include bone cartilage teeth and smooth muscle while both cranial and caudal crests generate melanocytes Placodes which will form a subset of the peripheral nervous system and the cranial nerves arise at this stage as well These populations appear distinct from the CNS stem cell though similar media and culture conditions can be used to propagate them for limited time periods Neural Precursor Cells Introduction Stem Cells in Ventricular Zone Stem cells that will generate the CNS reside in the ventricular zone VZ throughout the rostrocaudal axis and appear to be regionally specified These stem cells proliferate at different rates and express different positional markers The anterior neural tube undergoes a dramatic expansion and can be delineated into three primary vesicles the forebrain prosencephalon the midbrain mesencephalon and the hindbrain rhombencephalon Differential growth and further segregation leads to additional delineation of the prosencephalon into the telencephalon and diencephalon and delineation of the rhombencephalon into the metencephalon and myelencephalon The caudal neural tube does not undergo a similar expansion but increases in size to parallel the growth of the embryo as it undergoes further differentiation to form the spinal cord The ventricular zone stem cells appear homogenous despite the acquisition of rostrocaudal and dorsoventral identity but differ in their d
23. culture vessel with D PBS without calcium or magnesium and store the vessel covered with D PBS until use Immediately before use remove all D PBS and replace it with complete StemPro NSC SFM Note You may coat the plates in advance and store them at room temperature wrapped tightly with Parafilm for up to 1 week Do not remove D PBS until just prior to use Make sure the plates do not dry out Differentiating Neural Stem Cells 28 Differentiation into Neurons Differentiation into Astrocytes 1 1 Neural stem cells NSCs will proliferate as progenitors a few times even after the complete growth medium is replaced with the appropriate differentiation medium If the cells reach 90 confluency it might be necessary to split the cells at a 1 2 ratio However do not split the cells once they reach day 9 10 of differentiation when they can get damaged during the passaging process Plate neural stem cells on a polyornithine and laminin coated culture dish in complete StemPro NSC SFM at 2 5 x 104 5 x 104 cells cm After 2 days change the medium to neural differentiation medium Change the spent medium every 3 4 days If expedited differentiation is desired add 0 5 mM of dibutyryl cAMP Sigma Cat no D0627 to the differentiation medium daily starting at day 7 of differentiation for 3 days IMPORTANT Do not expose cells to air at any time after they have differentiated into neurons Plate the NSCs on
24. help you clean the dead cells off the EB surface If the EBs attach to flask use a 5 mL pipette to blow the attached EBs off the bottom of the flask After culturing the EBs in EB medium for 4 days transfer the EBs from one T 75 flask into a 50 mL centrifuge tube and centrifuge for 3 minutes at 200 x g Aspirate the EB medium and resuspend the EBs in 10 mL of pre warmed neural induction medium Centrifuge the EBs for 3 minutes at 200 x g Gibco Neurobiology Protocols Handbook 51 Derivation of Dopaminergic Neurons from Human Embryonic Stem Cells 52 N 10 11 12 Isolating DA Progenitors 1 2 Aspirate the supernatant and resuspend the EBs in 40 mL of pre warmed neural induction medium Transfer the EBs into a fresh T 75 flask and incubate the EBs in neural induction medium for 2 days in a 37 C incubator with a humidified atmosphere of 5 CO After the EBs float in the neural induction medium for 2 days they are ready to be differentiated Note If the EB attach to the flask use a 5 mL pipette to blow the attached EBs off the bottom of the flask Dilute laminin in D PBS to 20 ug mL and coat ten 100 mm culture dishes using 2 5 3 mL of laminin for each dish Incubate the laminin coated culture dishes in a 37 C incubator for several hours Note Laminin may form a gel when thawed too rapidly To avoid this thaw slowly in the cold 2 C 8 C Once thawed aliquot into polypropylene tubes and
25. medium is stable for up to 2 weeks when stored in the dark at 4 C Component Concentration Amount D MEM 1X 89 mL N 2 Supplement 1X 1mL FBS 10 10 mL Note Adding EGF at a final concentration of 20 ng mL can increase proliferation but may result in morphological and phenotypic changes in human astrocytes 86 Use this procedure to transfect plasmid DNA into hNSCs in a 24 well format using the 10 uL Neon Kit All amounts and volumes are given on a per well basis Cultivate the required number of cells in the appropriate growth medium see table below such that the cells are 70 9076 confluent on the day of the experiment On the day of the experiment harvest and wash cells in phosphate buffered saline PBS without Ca and Mg Resuspend the cell pellet in Resuspension Buffer R included with Neon Kits at the appropriate final density see the following table Prepare 24 well plates by filling the wells with 0 5 mL of the appropriate growth medium without antibiotics and pre incubate plates at 37 C in a humidified 5 CO incubator If using other plate formats adjust the volume accordingly Turn on the Neon unit and enter the following electroporation parameters in the Input window Alternatively press the Database button and select the appropriate transfection protocol if you have already added the electroporation parameters for your cell type For detailed instructions re
26. plates Make sure the plates do not dry out 16 Neural Cell Culture and Differentiation Expanding and Passaging of Rat NSCs Adherent Cultures 1 Resuspend the rat fetal NSCs as follows For freshly prepared rat fetal NSCS after rinsing with D PBS resuspend in warmed complete StemPro NSC SFM at a density of 1 x 10 viable cells mL For thawed rat fetal NSCs after determining the viable cell count resuspend in warmed complete StemPro NSC SFM at a cell density of 1 x 107 viable cells mL 2 Plate rat fetal NSCs onto CELLstart CTS coated culture vessels at a density of 5 x 10 cells cm See the following table for recommended seeding densities for common culture vessels Vessel size Growth area Volume of media No of cells 96 well plate 0 32 cm well 0 1 mL 1 6 x 104 24 well plate 1 9 cm well 0 5 mL 1 0 x 10 12 well plate 3 8 cm well 1mL 1 9 x 105 35 mm dish 8 cm well 2mL 4 0 x 10 6 well plate 9 6 cm well 2mL 4 8 x 10 60 mm dish 19 5 cm 5mL 9 8 x 10 T 25 flask 25 cm 5mL 1 3 x 108 100 mm dish 55 cm 10 mL 2 8 x 10 T 75 flask 75 cm 15 mL 3 8 x 10 3 Add the appropriate volume of cells to each culture vessel and incubate at 37 C 5 CO and 90 humidity 4 Re feed the rat fetal NSC cultures every 2 3 days with fresh complete StemPro NSC SFM The morphology of rat fetal NSCs should exhibit short stellate like processes with uniform density see Figure 1
27. proportionally Component Final concentration Amount KnockOut D MEM F 12 1X 97 mL GlutaMAX I Supplement 2 mM 1 mL bFGF prepared as 100 ug mL stock 20 ng mL 20 uL EGF prepared as 100 pg mL stock 20 ng mL 20 pL StemPro Neural Supplement 2 2mL You may observe a white precipitate when thawing StemPro Neural Supplement this precipitate will disappear when the supplement is completely thawed or dissolved Coating Culture Vessels with CELLstart TM TM For adherent cultures prepare plates with CELLstart CTS as described below 1 Dilute CELLstart CTS 1 100 in D PBS with calcium and magnesium e g 50 uL of CELLstart CTS into 5 mL of D PBS Note CELLstart CTS should not be frozen vortexed or exposed to vigorous agitation due to potential gel formation 2 Coat the surface of the culture vessel with the working solution of CELLstart CTS 14 mL for a T 75 flask 7 mL for a T 25 flask 3 5 mL for a 60 mm dish 2 mL for a 35 mm dish 3 Incubate the culture vessel at 37 C in a humidified atmosphere of 5 CO for 1 hour 4 Remove the vessel from the incubator and store at 4 C until use Remove all CELLstart CTS solution immediately before use and fill the vessel with complete StemPro NSC SFM Note You may coat the plates in advance and store them at 4 C wrapped tightly with Parafilm for up to 2 weeks Do not remove CELLstart CTS solution until just prior to using the coated
28. store at 5 C to 20 C Do not freeze and thaw laminin repeatedly After incubation aspirate the laminin and add 10 mL of pre warmed neural induction medium into each 100 mm dish Transfer the EBs from the T 75 flask into a 50 mL tube and centrifuge for 3 minutes at 200 x g Aspirate the supernatant and resuspend the EBs in 10 mL of pre warmed neural induction medium Gently shake the 50 mL tube containing EBs to distribute the EBs evenly and add 1 mL of EB suspension into each laminin coated culture dish Move the culture dishes in several quick back and forth and side to side motions to disperse the EBs across the surface of the dishes Place the dishes gently in a 37 C incubator with a humidified atmosphere of 5 CO Feed the EBs every other day with fresh pre warmed neural induction medium until early rosettes form approximately 2 3 days To direct the neural precursors to the midbrain fate feed the differentiating EBs every other day with neural induction medium containing 100 ng mL FGF 8b and 200 ng mL sonic hedgehog SHH for 5 6 days Note Plate the EBs at a density of 200 250 per one 100 mm dish Generally all EBs from hESCs cultured in one 100 mm dish can be plated into eight to ten 100 mm dishes The variation is from the confluence of hESCs and efficacy of EB formation Label all differentiating colonies containing rosettes using a microscope marker Using a 200 uL pipette tip pointing to the ce
29. 0 11 12 fresh complete StemPro NSC SFM without removing any developing neurospheres The morphology of the neurospheres should exhibit spherical and transparent multi cellular complexes see Figure 2 Figure 2 Rat fetal NSCs at passage 3 in neurosphere culture using StemPro NSC SFM When the neurospheres reach a diameter of 3 5 mm or larger the rat fetal NSCs are ready to be passaged Transfer the neurosphere suspension into a sterile centrifuge tube and let the neurospheres settle by gravity or centrifuge at 200 x g for 2 minutes Aspirate the supernatant carefully to leave the neurospheres in a minimal volume of medium Rinse the neurospheres once with D PBS without calcium and magnesium and leave a minimal volume of D PBS Add 1 mL of pre warmed StemPro Accutase to the neurospheres and incubate for 10 minutes at room temperature After incubation gently pipette the cells up and down to get a single cell suspension and add 4 mL of complete StemPro NSC SFM to the tube Centrifuge at 300 x g for 4 minutes at room temperature carefully aspirate the supernatant resuspend in a minimal volume of pre warmed complete StemPro NSC SFM and remove a sample for counting on a hemacytometer or Countess Automated Cell Counter Determine the total number of cells and percent viability Add enough complete StemPro NSC SFM to the tube for a final cell solution of 1 x 10 viable cells mL Incubate at 37
30. 1 mg mL stock solution in D PBS with 0 1 BSA aliquot into sterilized tubes and store at 20 C Recombinant human BDNF Prepare a 25 ug mL stock solution in D PBS with 0 1 BSA aliquot into sterilized tubes and store at 20 C Recombinant human GDNF Prepare a 20 ug mL stock solution in D PBS with 0 1 BSA aliquot into sterilized tubes and store at 20 C Dibutyryl cyclic AMP dcAMP Prepare a 1 mM stock solution in distilled water aliquot 0 5 mL into sterilized tubes and store at 20 C Poly L Ornithine Prepare a 10 mg mL stock solution in distilled water aliquot 0 5 mL into sterilized tubes and store at 20 C Gibco Neurobiology Protocols Handbook 45 Derivation of Dopaminergic Neurons from Human Embryonic Stem Cells Mouse Embryonic Fibroblast MEF Medium To prepare 100 mL of MEF medium aseptically mix the following components For larger volumes increase the component amounts proportionally Component Amount D MEM 90 mL FBS 10 mL Human Embryonic Stem Cell hESC Medium To prepare 100 mL of hESC medium aseptically mix the following components For larger volumes increase the component amounts proportionally hESC medium lasts for up to 7 days at 4 C Component Amount D MEM F 12 79 mL Knockout Serum Replacement 20 mL NEAA 1mL Basic FGF Solution 40 uL B Mercaptoethanol 182 uL Add B Mercaptoethanol final 0 1 mM at the time of medium change
31. 16210 064 Heat inactivated Fetal Bovine Serum FBS 500 mL 10438 026 Knockout Serum Replacement 500 mL 10828 028 Some of the products are also available in different quantities and packaging sizes Substrates Matrices and Bio scaffolds Product Quantity Cat no CELLstart CTS 2mL A10142 01 Fibronectin Human Plasma 5 mg 33016 015 Fibronectin Bovine Plasma 1 mg 33010 018 Geltrex LDEV Free Reduced Growth Factor Basement 5mL A11343 01 Membrane Extract Geltrex Reduced Growth Factor Basement Membrane 1mL 12760 013 Matrix 5mL 12760 021 Natural Mouse Laminin 1 mg 23017 015 Gibco Neurobiology Protocols Handbook 101 Life Technologies Products Supplements Product Quantity Cat no B 27 Serum Free Supplement 50X liquid 10 mL 17504 044 B 27 Supplement 50X 10 mL 0080085 SA B 27 Supplement Minus AO 50X liquid 10 mL 10889 038 B 27 Supplement Minus Vitamin A 50X liquid 10 mL 12587 010 B 27 Supplement XenoFree 50X 10 mL A11576 SA Bovine Serum Albumin BSA 150 mg 15561 020 G 5 Supplement 100X liquid 1mL 17503 012 GlutaMAX 100 mL 35050 061 L Glutamine 200 mM 100X liquid 100 mL 25030 081 MEM Non essential Amino Acids Solution NEAA 10 mM 100 mL 11140 050 Myelin Basic Protein MBP 10 mg 13228 010 N 2 Supplement 100X liquid 5 mL 17502 048 Pluronic F 127 1mL P 3000MP StemPro Neural Supplement 10 m
32. 59 3 437 No Intron SOX2 R CTTTTGCACCCCTCCCATTT 56 0 NESTIN F CAGCGTTGGAACAGAGGTTGG 58 6 389 1 142 NESTIN R TGGCACAGGTGTCTCAAGGGTAG 60 7 Oligodendrocytes MAG F TCTGGATTATGATTTCAGCC 49 7 366 159 MAG R GCTCTGAGAAGGTGTACTGG 54 7 OSP F ACTGCTGCTGACTGTTCTTC 55 1 283 5 714 OSP R GTAGAAACGGTTTTCACCAA 50 8 Astrocytes ALDH1L1 F TCACAGAAGTCTAACCTGCC 55 5 398 21 837 ALDH1L1 R AGTGACGGGTGATAGATGAT 54 4 GFAP F GTACCAGGACCTGCTCAAT 55 0 321 2 989 GFAP R CAACTATCCTGCTTCTGCTC 55 3 Neurons MAP2 F CCACCTGAGATTAAGGATCA 55 1 482 11 798 MAP R GGCTTACTTTGCTTCTCTGA 55 0 ChAT F ACTGGGTGTCTGAGTACTGG 55 0 451 7 692 ChAT R TTGGAAGCCATTTTGACTAT 54 9 Endogeneous control ACTB F ACCATGGATGATGATATCGC 58 2 281 135 ACTB R TCATTGTAGAAGGTGTGGTG 54 4 GABAergic Glutaminergic GAD1 F GTCGAGGACTCTGGACAGTA 55 3 neurons 357 12 277 GAD1 R GGAAGCAGATCTCTAGCAAA 54 9 Serotonergic neurons SLC6A4 F GCCTTTTACATTGCTTCCTA 54 8 447 2 251 SLC6A4 R CCAATTGGGTTTCAAGTAGA 55 2 Cholinergic neurons ChAT F ACTGGGTGTCTGAGTACTGG 55 0 451 7 692 ChAT R TTGGAAGCCATTTTGACTAT 54 9 Dopaminergic neurons TH F TCATCACCTGGTCACCAAGTT 56 0 126 656 TH R GGTCGCCGTGCCTGTACT 60 0 76 Molecular Characterization RNA Isolation and cDNA Preparation from Neural Stem Cells Summary Required Materials A rapid method of analysis for determining the identity of neural stem cells NSCs and their sublineages involves the early detection of differentiation markers tracked at the RNA level
33. 9 C for 30 seconds with a 2 ramp rate with data collection from 45 99 C Note For the following steps do not touch the bottom of each tube and be sure to use powder free gloves to handle all reagents and plasticware Molecular Characterization 2 For each reaction add the following components to a 0 2 mL microcentrifuge tube or each well of a PCR plate Volumes for a single 20 uL reaction are listed For multiple reactions prepare a master mix of common components add the appropriate volume to each tube or plate well and then add the unique reaction components e g template For no template controls add an equivalent volume of water in lieu of template Component Amount Platinum SYBR Green qPCR SuperMix UDG 10 uL ROX Reference Dye amount specified for AB 7300 system 0 4 uL Forward primer 10 uL 0 4 uL Reverse primer 10 uL 0 4 uL Template cDNA 1 10 dilution series from 10 pg to 1 ug total RNA 1 2 uL DEPC treated water to 20 uL 3 Cap or seal the reaction tube PCR plate and gently mix Make sure that all components are at the bottom of the tube plate centrifuge briefly if needed 4 Place the reactions in a preheated real time instrument programmed as described in Step 1 Collect the data and analyze the results using the instrument software Figure 1 qPCR detection of Nestin transcripts in human embryonic stem cell derived NSCs 1 0e 001 1 0e 000 1 0e 001 Delta Rn 1
34. AX2 TH TUJ 1 Yes Roy et aL the neostriata of SHH BDNF precursor OTX2 2006 6 hydroxydopamine GDNF FBS lesioned Parkinsonian rats Transplantation DA neuron SHH FGF8 DA PAX2 EN1 TH EN1 Yes Park etal into the striatum of BDNF GDNF precursor NURR1 AADC 2005 hemi Parkinsonian AA IGF 1 LMX1B rats OPC oligodendrocyte progenitor cells DA dopaminergic Introduction Neural Experimental Cell type Growth Progenitor Marker Mature Trans Reference disease model factor cell marker plantation Glial related Astrocyte related Astrocyte Cyclopamine GFAP S100 No Lee et aL diseases disease human GLAST 2006 astrocyte BDNF GNDF medium CNS PNS Peripheral and Peripheral Noggin NGF Neural NCAM Peripherin No Brokhman diseases central nervous sensory precursor TUJ 1 BRN3 TH et al 2008 system neurons neurons SNAIL TRK A dHAND SOX9 Macular Not applicable Retinal Noggin Retinal RX PAX6 RPE 65 No Lambda et retinal de pigmented Dickkopf 1 progenitor LHX2 SIX3 al 2006 generation epithelium IGF 1 Huntington s Striatal Islet1 Molero et disease medium DARPP 32 al 2009 spiny neuron mGluR1 and specification NeuN References Trujillo C A Schwindt T T Martins et al 2009 Novel perspectives of neural stem cell differentiation from neurotransmitters to therapeutics Cytometry A 75 38 53 Brokhman I Gamarn
35. Adding antibiotics to media during transfection may result in cell death If you wish to use antibiotics during transfection test your conditions thoroughly Maintain the same seeding conditions between experiments Use low passage cells make sure that cells are healthy and greater than 90 viable before transfection Transfections can be performed both in the presence or absence of serum Test serum free media for compatibility with Lipofectamine LTX or Lipofectamine RNAiMAX Reagent e Using PLUS Reagent enhances transfection performance in human astrocytes e We recommend Opti MEM I Reduced Serum Medium to dilute the DNA and Lipofectamine LTX Reagent or the siRNA and Lipofectamine RNAiMAX Reagent before complexing Preparing Geltrex Coated Plates for Human Astrocytes Before thawing or passaging GIBCO Human Astrocytes prepare culture vessels coated with Geltrex as described below 1 Thaw a bottle of Geltrex Basement Membrane Matrix at 4 C overnight 2 On ice prepare a stock solution of Geltrex diluted 1 1 in D MEM Store in aliquots at 20 C until needed 3 Dilute the stock solution 1 100 in D MEM and coat the bottom of each culture vessel 200 uL of Geltrex per cm of culture vessel 4 Incubate the culture vessel at 37 C for 1 hour Dishes coated with Geltrex can be used immediately or stored at 4 C for up to a week sealed with Parafilm Do not allow dishes to dry When you are ready to add
36. BCO human neural stem cells References Trujillo C A Schwindt T T Martins A H Alves J M Mello L E and Ulrich H 2009 Novel perspectives of neural stem cell differentiation from neurotransmitters to therapeutics Cytometry A 75 38 53 Elkabetz Y and Studer L 2008 Human ESC derived neural rosettes and neural stem cell progression Cold Spring Harb Symp Quant Biol 73 377 387 Denham M and Dottori M 2009 Signals involved in neural differentiation of human embryonic stem cells Neurosignal 17 234 241 Gibco Neurobiology Protocols Handbook 31 Differentiating Glial Precursor Cells into Astrocytes and Oligodendrocytes Differentiating Glial Precursor Cells into Astrocytes and Oligodendrocytes Summary Required Materials Glial precursor cells GPCs also known as glial restricted progenitors GRP or oligodendrocyte progenitor cells OPCs are cells that have the potential to differentiate into oligodendrocytes or astrocytes The GPC population is derived from tissue or is generated from pluripotent cells by differentiation which is induced by exogenously applied factors Here we described a culture system that can be adjusted to favor differentiation into either astrocytes or oligodendrocytes Cells Media and Reagents 32 GIBCO Rat Glial Precursor Cells Cat no N7746 100 Neurobasal Medium Cat no 21103 049 D MEM Cat no 11995 GlutaMAX I Cat no 35050 B 27 Serum F
37. BS Aspirate the D PBS and discard TM Add 1 mL of pre warmed TrypLE Select to the culture vessel and incubate at 37 C for 2 minutes Note Do not incubate the NSCs in TrypLE Select for more than 2 minutes to avoid cell death Neutralize TrypLE Select by adding complete StemPro NSC SFM immediately after the incubation period see below Detach the NSCs from the culture vessel by pipetting off the cells or by tapping the culture vessel against the heel of your hand Stop the TrypLE Select treatment by adding 5 mL of complete StemPro NSC SFM Gently pipet the NSCs up and down to get a single cell suspension and transfer the cell suspension into a sterile 15 mL conical tube Centrifuge the NSCs at 200 x g for 5 minutes Aspirate the supernatant and discard Resuspend the cell pellet in a minimal volume of pre warmed complete StemPro NSC SFM and remove a sample for counting Determine the total number of cells using your method of choice Gently aspirate the medium from the conical tube and drop wise add pre chilled 4 C freezing medium to resuspend the cells at a concentration of 2 x 10 2 4 x 10 viable cells mL Transfer 1 mL of the NSC suspension in freezing medium into each pre labeled pre chilled 4 C cryovial Transfer the cryovials to the Cryo 1 C Freezing Container and place the container into a 80 C freezer This procedure ensures that the cells freeze slowly The next day transf
38. Category Antigen Type Working concentration Sox1 Rabbit IgG 1 200 Neural Stem Cells Sox2 Mouse IgG 2 ug mL CD133 Rabbit IgG 1 100 Ki67 Rabbit IgG 1 50 Proliferation EdU Chemical 1 1 000 Mouse IgM and IgG Do not dilute Isotype Control Rabbit IgG Do not dilute Rat IgM and IgG 1 50 Gibco Neurobiology Protocols Handbook 13 Culturing Human Neural Stem Cells Primers for NSC Characterization Use the primer sets listed in the following table to characterize NSC by PCR Refer to Chapter 21 Characterizing Neural Stem Cells by qPCR for details on the procedure page 81 Target Primer Sequence TS Ampuicon intron size size Sox1 F GCGGAAAGCGTTTTCTTG 53 0 No 406 Sox1 R TAATCTGACTTCTCCTCCC 50 2 Intron Sox2 F ATGCACCGCTACGACGTGA 59 3 Neural 437 No Stem Cells so R CTTTTGCACCCCTCCCATTT 56 0 Intron Nestin F CAGCGTTGGAACAGAGGTTGG 58 6 389 1142 Nestin R TGGCACAGGTGTCTCAAGGGTAG 60 7 Endogenous ACTB F ACCATGGATGATGATATCGC 58 2 m Control ACTB R TCATTGTAGAAGGTGTGGTG 54 4 14 Neural Cell Culture and Differentiation Culturing Rat Fetal Neural Stem Cells Summary Required Materials Rat neural stem cells NSCs serve as a well established model for investigating human brain development disease processes and treatment strategies for debilitating central nervous system CNS disorders This protocol describes the in vitro expansion passaging and morph
39. D PBS to each chamber of a multi chambered slide e g add 150 uL per chamber for an 8 chambered slide 300 uL per chamber for a 4 chambered slide Incubate slide at room temperature for 1 hour in a tissue culture hood Aspirate the poly D lysine solution and rinse 3 times with nuclease free water Note Rinse thoroughly since extra poly D lysine can be toxic to the cells Leave the plates uncovered in the hood until the wells are completely dry Plates can be used when dry or can be covered with Parafilm and stored at 4 C for up to two days Thaw cryopreserved primary rat cortex cells according to the instructions provided with the cells Plate the cells onto a multi chambered slide that has been treated with poly D lysine Seed 1 x 10 cells per chamber in 500 uL of medium Incubate the slide at 37 C in a humidified atmosphere of 5 CO in air After 24 hours of incubation aspirate half of the medium from each well and replace with fresh medium Return the slide to the incubator Feed the cells every third day by aspirating half of the medium from each well and replacing with fresh medium Before proceeding prepare a solution of 576 goat serum in D PBS with calcium and magnesium This solution will be used to coat the cells before antibody detection and to dilute the antibody Prepare enough solution to completely coat the cells twice When you are ready to perform the immunocytochemistry procedure
40. L A10508 01 B Mercaptoethanol 1 000X liquid 50 mL 21985 023 Some of the products are also available in different quantities and packaging sizes Reagents 102 Product Quantity Cat no Antibiotic Antimycotic solution 100X liquid 100 mL 15240 062 Gentamicir Amphotericin Solution 10 vials pkg 10x 1 mL R 015 10 Lipofectamine LTX Reagent and PLUS Reagents 1mL 15338 100 Lipofectamine RNAiMAX Transfection Reagent 1 5 mL 13778 150 Penicillin Streptomycin liquid 100 mL 15070 063 Ribonuclease H RNase H 120 units 18021 071 StemPro Accutase Cell Dissociation Reagent 100 mL A11105 01 TrypLE Express Stable Trypsin Replacement Enzyme 100 mL 12604 013 TrypLE Select 10X 100 mL A12177 01 Trypsin EDTA solution 0 0596 100 mL 25300 054 Trypan Blue Stain 100 mL 15250 061 TRizol Reagent 200 mL 15596 018 Some of the products are also available in different quantities and packaging sizes Appendix Growth Factors amp Purified Proteins Product Quantity Cat no a Synuclein Recombinant Human 200 ug PHB0044 Acidic Fibroblast Growth Factor aFGF Recombinant Human 10 ug 13241 013 B DNF Recombinant Human 10 ug PHC7074 BMP 4 Recombinant human 5 ug PHC7914 BMP 7 inactive Recombinant Human 10 ug PHC7104 Brain Derived Neurotrophic Factor BDNF Recombinant 5 ug 10908 010 Human
41. Lambda DG 4 Digital camera e g Hamamatsu ORCA ER Fluo 4 AM Loading Solution 74 Fluo 4 AM loading solution consists of 3 uM fluo 4 AM reconstituted in DMSO and 0 1 Pluronic F 127 in Hanks Balanced Salt Solution HBSS Use the fluo 4 AM loading solution as soon as possible after preparation to avoid decomposition with subsequent loss of cell loading capacity To reconstitute fluo 4 AM add 44 uL of DMSO to one vial of fluo 4 AM 50 ug and vortex thoroughly You may store the fluo 4 AM reconstituted in DMSO protected from light frozen and desiccated for up to one week Add 9 uL of Pluronic F 127 to the reconstituted fluo 4 AM and vortex thoroughly Note Because fluo 4 AM is relatively insoluble in aqueous solutions addition of the low toxicity dispersing agent Pluronic F 127 facilitates cell loading However Pluronic F 127 may decrease the stability of AM esters so it should only be added to working stocks i e the loading solution 3 Add 50 uL of the 860 uM fluo 4 AM Pluronic F 127 solution to 14 3 mL of HBSS Cell Analysis Loading NSCs with Fluo 4 AM Loading Solution Data Acquisition Wash the NSCs with 100 uL of Hanks Balanced Salt Solution HBSS Load the NSCs with 100 uL of fluo 4 AM loading solution per well of a 96 well plate You may adjust the volume as appropriate to other culture vessels Incubate the NSCs in the dark at room temperature for 60 minutes Wash
42. MAX I at 4 C Allow the tissue to settle to the bottom of the tube and then carefully remove the supernatant leaving only the tissue covered by the medium Enzymatically digest the tissue in 4 mL of Hibernate E medium without Ca containing 2 mg mL of filter sterilized papain for 30 minutes at 30 C Gently shake the tube every 5 minutes Add 6 mL of complete Hibernate E medium to the tube and centrifuge for 5 minutes at 150 x g Remove the supernatant and resuspend the tissue in 5 mL of complete Hibernate E medium by pipetting up and down with a fire polished glass Pasteur pipette Let the tube stand undisturbed for 2 minutes to allow for the cell debris if any to settle down Transfer the cells to a new tube leaving behind all the debris Count the cells using a hemacytometer cell counter and trypan blue or the Countess Automated Cell Counter Centrifuge the tube for 4 minutes at 200 x g Culturing Neurons Neural Cell Culture and Differentiation 11 Remove the supernatant and resuspend the cell pellet in Neurobasal medium with 2 B 27 Serum Free Supplement and 0 5 mM GlutaMAX I for culturing Note Plate the cells immediately after resuspension If you need to store the cells longer store them in Hibernate E medium supplemented with 2 B 27 Serum Free Supplement and 0 5 mM GlutaMAX Iat 4 C for up to 48 hours Do not expose the neurons to air at any time Plate 1 x 10 c
43. MEF medium from the culture vessel containing the MEFs and gently add the resuspended hESCs into the vessel Move the culture vessel in several quick back and forth and side to side motions to disperse the cells across the surface of the vessel Place the vessel gently into a 37 C incubator with a humidified atmosphere of 5 CO Replace the spent medium and examine the cells under a microscope daily If feeding cells in more than one vessel use a different pipette for each vessel to reduce the risk of contamination Note hESC colonies may not be visible in the first several days Observe the hESCs every day and passage the cells whenever the colonies are too big or too crowded The ratio of splitting depends on the total number of hESC in the culture vessel approximately 1 2 to 1 4 for hESCs at the first time of recovery Gibco Neurobiology Protocols Handbook 49 Derivation of Dopaminergic Neurons from Human Embryonic Stem Cells Passaging hESCs General Guidelines Passaging hESCs 1 2 N 10 11 50 n general split cells when the first of the following events occurs MEF feeder layer is two weeks old hESC colonies are becoming too dense or too large Increased differentiation occurs The split ratio varies but it is generally between 1 4 and 1 6 Occasionally hESCs grow at a different rate requiring the split ratio to be adjusted A general rule is to observe the last split ratio a
44. Medium Analyze the cells by flow cytometry Note Use the same cell number in every experiment Starting with larger numbers of cells is preferred since setting up parameters during flow cytometry analysis takes time and collecting 710 000 events produces more reliable data One Step Staining with Fluorescently Labeled Antibodies One Step Staining with Fluorescently labeled Antibody 1 Trypsinize cells and add Staining Medium Transfer the cells to a conical tube and centrifuge at 300 x g 4 C for 5 minutes Discard the supernatant Add 5 uL of diluted primary antibody conjugated to a fluorescent tag to the cell pellet Flick the tube to resuspend the cell pellet Mix well and incubate on ice for 25 30 minutes Wash the cells with 10 mL of cold Staining Medium Centrifuge the cells at 300 x g 4 C for 5 minutes Discard the supernatant and resuspend the cells with 0 5 mL of Staining Medium Filter the cell suspension through FACS filter tubes before analysis or sorting the cells by flow cytometry Note For negative controls prepare cells that have not been stained with antibody and cells stained with an isotype control Two Step Staining with Biotinylated Antibodies Two step Staining with Biotinylated Antibody 1 Trypsinize cells and add Staining Medium Transfer the cells to a conical tube and centrifuge at 300 x g 4 C for 5 minutes Discard the supernatant Add 5 uL of appropriately diluted biotin
45. Neural Stem Cells into Neurons and Glial Cells Summary Required Materials The protocols in this chapter describe the steps involved in differentiating neural stem cells NSC to neurons astrocytes and oligodendrocyte lineages in vitro NSCs are self renewing multipotent stem cells that can be proliferated in vitro in supportive culture systems such as Stempro NSC SFM and can further be differentiated into downstream lineages The protocols described are primarily optimized with NSCs derived from human embryonic stem cells ESC or induced pluripotent stem cells iPSC Some optimization in terms of reagent concentration and duration of in vitro differentiation is expected for NSCs from other species such as rat or mouse as well as with NSCs derived from patient specific iPSCs Cells Reagents e GIBCO Human Neural Stem Cells H9 hESC Derived Cat no N7800 e KnockOut D MEM F 12 Cat no 12660 Dulbecco s Modified Eagle Medium D MEM Cat no 11995 Dulbecco s Phosphate Buffered Saline D PBS Cat no 14040 e StemPro NSC SFM Cat no A10509 01 e N 2Supplement Cat no 17502 e B 27 Serum Free Supplement Cat no 17504 e Neurobasal Medium Cat no 21103 Antibiotic Antimycotic solution Cat no 15240 Fetal Bovine Serum ES Cell Qualified FBS Cat no 16141 e GlutaMAX I Cat no 35050 e FGF basic AA 10 155 Recombinant Human bFGF Cat no PHG0024 e EGF Recombinant Human Cat
46. This protocol follows methodologies described in the PureLink RNA Mini Kit manual for isolating total RNA from neural stem cells NSCs followed by cDNA synthesis using Superscript III reverse transcriptase The following protocol gives you a step by step procedure for template preparation required for RT PCR or qPCR Cells Reagents and Equipment Neural stem cells PureLink RNA Mini Kit Cat no 12183 018A RNA Lysis Solution Wash Buffer I Wash Buffer II RNase free water RNA spin cartridges Collection tubes RNA recovery tubes Superscript III First Strand Synthesis SuperMix Cat no 18080 400 Superscript III RNaseOUT Enzyme Mix 2X First strand Reaction Mix Annealing Buffer 50 mM Oligo dT Random hexamers 50 ng mL B Mercaptoethanol Cat no 21985 023 TrypLE Express Stable Trypsin Replacement Enzyme Cat no 12604 013 Dulbecco s Phosphate Buffered Saline D PBS without Ca and Mg Cat no 14190 Ribonuclease H RNase H Cat no 18021 071 10X BlueJuice Gel Loading Buffer Cat no 10816 015 Table top centrifuge Gibco Neurobiology Protocols Handbook 77 RNA Isolation and cDNA Preparation from Neural Stem Cells RNA Isolation 78 Isolating RNA N 10 11 12 Important Perform all steps on ice unless noted otherwise For all incubations heat the thermocyclers in advance Pre chill all reagents and thaw all frozen reagents and cel
47. a Cat no P4957 L Glutamine Cat no 25030 081 Neurobasal Medium Cat no 21103 049 B 27 Serum Free Supplement Cat no 17504 044 Heat inactivated Fetal Bovine Serum FBS Cat no 10438 Microdissecting instruments sterilized Small dissecting scissors Medium dissecting scissors Dumont forceps straight Dumont forceps angled or curved Curved microdissecting scissors Spatula Moria perforated spoon with holes e g Moria MC17 Dissecting microscope e g Leica MZ6 or Zeiss Stemi 2000 Curved scalpel blade e g BD Bard Parker no 23 or 24 Preparing Reagents Neural Cell Culture and Differentiation Poly L Ornithine Stock Solution Ascorbic Acid Stock Solution Dissection Buffer Preparing Media Make a 10 mg mL stock solution of poly L ornithine in distilled water Filter sterilize using a 0 22 um filter and store for up to 12 months at 20 C Make a 200 mM stock solution of ascorbic acid in D PBS Filter sterilize using a 0 22 um filter Protect from light and store for up to 12 months at 20 C For 100 mL of dissection buffer aseptically mix the following components The buffer can be stored at 4 C for 1 week Add ascorbic acid solution before use Component Amount HBSS 98 mL D Glucose 360 3 mg Penicillin Streptomycin 2mL Ascorbic Acid Solution 0 1 mL Differentiation Medium For 100 mL of differentiation medium aseptically mix the followi
48. a 5 mL pipette to break the cell clumps into smaller pieces Aspirate the MEF medium from each MEF culture vessel and replace it with an appropriate amount of pre warmed hESC medium 5 mL for each 60 mm dish or 10 mL for each 100 mm dish Gently shake the conical tube containing the hESCs to distribute the cell clumps evenly and add an appropriate amount of hESC suspension into each MEF culture vessel Note The volume of hESC suspension added into each dish depends on the ratio of splitting see General Guidelines above Move the culture vessels in several quick back and forth and side to side motions to disperse the hESCs across the surface of the vessels Place the culture vessels gently in a 37 C incubator with a humidified atmosphere of 5 CO Replace the spent medium daily hESCs need to be split every 4 10 days based upon their appearance Differentiating hESCs Neural Cell Culture and Differentiation Making Embryoid Bodies EBs 1 2 N Differentiating EBs Rosette Formation and Midbrain Specification 1 Culture the hESCs on MEF feeder cells until they are 90 100 confluent Roll the StemPro EZPassage Disposable Stem Cell Passaging Tool across the entire vessel in one direction left to right Rotate the culture vessel 90 degrees and roll the tool across the entire dish again Using a cell scraper gently detach the cells off the surface of the culture vessel Gently transfer the cell clumps
49. a Geltrex coated culture dish in complete StemPro NSC SFM at 2 5 x 10 cells cm After 2 days change medium to astrocyte differentiation medium Change the spent medium every 3 4 days Differentiation into Oligodendrocytes 1 Neural Cell Culture and Differentiation Plate the NSCs on a polyornithine and laminin coated culture dish in complete StemPro NSC SFM at 2 5 x 104 5 x 10 cells cm After 2 days change the medium to oligodendrocyte differentiation medium Change the spent medium every 3 4 days Characterizing NSCs and Differentiated Lineages by Immunocytochemistry Preparing Paraformaldehyde Fixing Solution Fixing Cells 1 20 paraformaldehyde PFA stock solution Add PBS to 20 g of EM grade paraformaldehyde Electron Microscopy Services Cat no 19208 and bring the volume up to 100 mL Add 0 25 mL of 10 N NaOH and heat the solution at 60 C using a magnetic stirrer until the solution is completely dissolved Filter the solution through a 0 22 um filter and cool on ice Make sure the pH is 7 5 8 0 Aliquot 2 mL in 15 mL tubes freeze the tubes on dry ice and store them at 20 C 4 PFA for fixing Add 8 mL of PBS into each 15 mL tube containing 2 mL of 20 PFA and thaw each tube in a 37 C water bath Once the solution has dissolved the tubes cool on ice Remove culture medium and gently rinse the cells once with D PBS without dislodging the cells Fix t
50. a covered petri dish Then add 100 150 uL of prepared LIVE DEAD reagent to the coverslip so that all cells are covered by solution Microplate reader Add an aliquot of the cell suspension to each microplate well in a sufficient volume to cover at least the bottom of each well Then add an approximately equal volume of prepared LIVE DEAD reagent Incubate the cells at room temperature for 10 30 minutes Measure fluorescence using the appropriate excitation and emission filters Analyze the sample under a fluorescence microscope or using a fluorescence microplate reader Gibco Neurobiology Protocols Handbook 65 Cell Viability Assays for Neural Stem Cells 66 Determining Viability of Cells in Suspension with Flow Cytometry Allow all the reagents to come to room temperature before proceeding Make an 80 fold dilution of calcein AM Component A in DMSO to make a 50 uM working solution e g add 2 mL of calcein AM to 158 mL DMSO Prepare a 1 mL suspension of cells with 0 1 x 10 to 5 x 10 cells mL for each assay Cells may be in culture medium or buffer Add 2 uL of a 50 uM calcein AM working solution and 4 uL of the 2 mM EthD 1 stock to each milliliter of cells Mix the sample Incubate the cells for 15 20 minutes at room temperature protected from light As soon as possible after the incubation period within 1 2 hours analyze the stained cells by flow cytometry using 488 nm excitation a
51. abase index html Blog and News Sites The Dana Foundation www dana org Neuroanatomy and Neuropathology on the Internet www neuropat dote hu Neuromuscular Disease Center at Washington University School of Medicine St Louis www neuromuscular wustl edu Neuroscience Information Framework www neuinfo org Parkinson s Disease Blog Business Exchange www bx businessweek com parkinsons disease blogs Neurology News amp Neuroscience News from Medical News Today www medicalnewstoday com sections neurology ScienceDaily Neuroscience News www sciencedaily com news mind brain neuroscience Alltop Top Neuroscience News www neuroscience alltop com Regulations for Cell Therapy 106 EMA http www ema europa eu ema FDA www fda gov BiologicsBloodVaccines CellularGeneTherapyProducts Technical Support Web Resources Appendix Visit the Invitrogen website at www invitrogen com for Technical resources including manuals vector maps and sequences application notes Safety Data Sheets SDSs FAQs formulations citations handbooks etc Complete technical support contact information e Access to the Invitrogen Online Catalog Additional product information and special offers Contact Us For more information or technical assistance call write fax or e mail Additional international offices are listed on our website www invitrogen com Corporate Headquarters Japanese Headquarters Euro
52. activity Transfer the cells to a 15 mL or 50 mL tube Rinse culture vessels with complete medium and add it to the tube Centrifuge the tube for 4 minutes at 200 x g Aspirate and discard the supernatant Gently resuspend the pellet in Complete Astrocyte Medium Count the live cells using a method of choice To replate human astrocytes remove a Geltrex coated plate from 4 C storage and tip slightly to aspirate the Geltrex solution Rinse the plate once with D PBS with calcium and magnesium Do not allow the plate to dry out Immediately seed the astrocytes at the desired concentration we recommend 22 x 10 cells cm Incubate the cells in an incubator at 37 C in a humidified atmosphere 90 of 5 CO in air Change the medium every 2 3 days with fresh Complete Astrocyte Medium Transfection Transfecting Plasmid DNA into Human Astrocytes Using Lipofectamine LTX Reagent Scaling Up or Down Transfections Using PLUS Reagent Mix PLUS Reagent gently before use then add 0 5 uL PLUS Use this procedure to transfect plasmid DNA into GIBCO Human Astrocytes using the Lipofectamine LTX Reagent in a 24 well format for other formats see Scaling Up or Down Transfections below All amounts and volumes are given on a per well basis The day before transfection prepare Human Astrocytes that have recovered from cryopreservation and have reached 80 confluency Use StemPro Accutase to detach the cells
53. ages of Neural Development The development of the central nervous system CNS is initiated early in the development by the induction of NSCs and neural progenitor cells this stage in development is called neural induction By studying neural induction and neural development we can determine the various factors that stimulate or inhibit the differentiation of NSCs and the requirements of these NSCs and their offspring for survival and proper function The nervous system is one of the earliest organ systems that differentiate from the blastula stage embryo This differentiation can be mimicked in culture and NSCs can be derived from human ESC cultures over a period of 2 3 weeks In vivo the primitive neural tube forms by approximately the fourth week of gestation by a process termed primary neurulation and neurogenesis commences by the fifth week of development in humans Separation of PNS and CNS During neurulation the neuroectoderm segregates from the ectoderm and the initially formed neural plate undergoes a stereotypic set of morphogenetic movements to form a hollow tube The neural crest which will form the peripheral nervous system PNS segregates from the CNS at this stage The neural crest stem cell generates the sympathetic and parasympathetic systems the dorsal root ganglia and the cranial nerves as well as the peripheral glia including Schwann cells and enteric glia In addition to neural derivatives the cranial crest generates
54. al cell culture 3rd edition edited by Sergey Fedoroff and Arleen Richardson Humana Press 2001 Journals Journal Neuron www cell com neuron Journal Development www dev biologists org Journal of Neuroscience www jneurosci org American Academy of Neurology www aan com European Journal of Neuroscience www onlinelibrary wiley com journal 10 1111 28ISSN 291460 9568 Journal of Neurobiology www interscience wiley com jpages 0022 3034 Developmental Neurobiology www onlinelibrary wiley com journal 10 1002 28ISSN 291097 4695 Nature Reviews Neuroscience www nature com nrn index html Organizations Society for Neuroscience www sfn org European Neuroscience and Society Network www se ac uk collections ENSN Federation of European Neuroscience Societies www fens mdc berlin de Japanese Society for Neuroscience www jnss org english index e html Gibco Neurobiology Protocols Handbook 105 Resources for More Information Government Sites Websites National Institute of Neurological Disorders and Stroke NINDS www ninds nih gov National Institute of Mental Health NIMH www nimh nih gov Food and Drug Administration FDA www fda gov National Institute of Child Health and Human Development NICHD www nichd nih gov NCBI PubMed www ncbi nlm nih gov pubmed National Institutes of Health Entrez Databases www ncbi nlm nih gov Database index html National Library of Medicine s MEDLINEplus www ncbi nlm nih gov Dat
55. al neurons cultured in Neurobasal Medium supplemented with B 27 Serum Free Supplement and GlutaMAX I Supplement show a gt 90 neuron population with a minimum number of astrocytes when stained with MAP2 antibody Within 3 4 days in culture the neurons display extensive neurite outgrowth that keeps on increasing as long as they are kept healthy in culture Results vary if neurons are cultured in the presence of serum Figure 1 Primary rat hippocampus neurons Immunofluorescence detection of primary neuronal cells stained with mouse anti MAP2 antibody green and astrocytes stained with rabbit anti GFAP antibody red Nuclei are stained with DAPI blue Gibco Neurobiology Protocols Handbook 73 Electrophysiology Electrophysiology Summary Required Materials The following protocol describes how to perform fluo 4 based measurements of cytosolic calcium changes in neural stem cells in response to neurotransmitter applications Cells Reagents Tools and Equipment Preparing Reagents Neural stem cells cultured on poly D lysine coated 96 well plate or other culture vessel e Hanks Balanced Salt Solution HBSS Cat no 14025 134 Fluo 4 AM Cat no F14201 e Pluronic F 127 Cat no P 3000MP DMSO Dimethylsulphoxide Sigma Cat no D2650 Neurotransmitters or ligands e g acetylcholine glutamate Inverted microscope e g Nikon T2000 Illumination system e g Sutter Instruments
56. ally Component Final concentration Amount KnockOut D MEM F 12 1X 97 mL GlutaMAX I Supplement 2mM 1 mL bFGF prepared as 100 ug mL stock 20 ng mL 20 uL EGF prepared as 100 pg mL stock 20 ng mL 20 uL StemPro Neural Supplement 2 2mL You may observe a white precipitate when thawing StemPro Neural Supplement this precipitate will disappear when the supplement is completely thawed or dissolved Preparing Matrix TM For culture of adherent cultures use either Fibronectin or CELLstart a matrix for coating your plates CTS to prepare Coating Culture Vessels with CELLstart CTS 1 Dilute CELLstart CTS 1 100 in D PBS with calcium and magnesium i e 50 uL of CELLstart CTS into 5 mL of D PBS Note CELLstart CIS should not be frozen vortex or exposed to vigorous agitation due to potential gel formation 2 Coat the surface of the culture vessel with the working solution of CELLstart CTS 14 mL for T 75 7 mL for T 25 3 5 mL for 60 mm dish 2 mL for 35 mm dish 3 Incubate the culture vessel at 37 C in a humidified atmosphere of 5 CO for 1 hour TM TM 4 Remove the vessel from the incubator and store it until use Remove all CELLstart CTS solution immediately before use and fill the vessel with complete StemPro NSC SFM Note You may coat the plates in advance and store them at 4 C wrapped tightly with Parafilm for up to 2 weeks Do not remove CELLstart CTS solution
57. and count the cells Plate 5 x 10 cells per well in 0 5 mL of complete growth medium Cell density should be 80 90 confluent on the day of transfection For each well of cells to be transfected dilute 0 5 ug of DNA into 100 uL of Opti MEM I Reduced Serum Medium without serum Reagent a 1 1 ratio to DNA directly to the diluted DNA Mix gently and incubate for 5 15 minutes at room temperature For each well of cells dilute 1 5 3 0 uL of Lipofectamine LTX into the above diluted DNA solution mix gently and incubate for 25 minutes at room temperature to form DNA Lipofectamine LTX complexes Remove growth medium from cells and replace with 0 5 mL of complete growth medium Add 100 uL of the DNA Lipofectamine LTX complexes directly to each well containing cells and mix gently by rocking the plate back and forth Complexes do not have to be removed following transfection Incubate the cells at 37 C in a CO incubator for 18 24 hours post transfection before assaying for transgene expression To transfect Human Astrocytes in different tissue culture formats vary the amounts of Lipofectamine LTX Reagent DNA cells medium and PLUS Reagent used in proportion to the relative surface area as shown in the table amounts given on a per well basis Culture Surface area volun Cells per Yom a Lipofectamine PLUS of plating dilution DNA vessel per well i well i LTX Reagent Reagent medium med
58. ately 80 250 bp Optimal results may require a titration of primer concentrations between 100 nM and 500 nM A final concentration of 200 nM per primer is effective for most reactions ROX Reference Dye is recommended to normalize the fluorescent reporter signal for instruments that are compatible with that option ROX is supplied as a separate tube in Platinum SYBR Green qPCR SuperMix UDG at a 25 uM concentration Use the following table to determine the amount of ROX to use with a particular instrument Instrument Amountiol RO per ook Final ROX concentration reaction Applied Biosystems 7300 7000 7700 7900HT and 7900HT Fast Tp SUM Applied Biosystems 7500 0 1 uL 50 nM For protocols for specific instruments visit www invitrogen com qpcr In this section we provide a step by step protocol for qPCR on the 7300 Real Time PCR System Applied Biosystems in 20 uL assays Program your real time instrument as shown below Optimal temperatures and incubation times may vary e 50 C for 2 minutes hold UDG incubation e 95 C for 2 minutes hold e 40 50 cycles of 95 C 15 seconds 60 C 30 seconds Melting Curve Analysis Program the instrument for melting curve analysis to identify the presence of primer dimers and analyze the specificity of the reaction A typical melting curve program is listed below see your instrument documentation for details e 95 C for 30 seconds e 45 C for 30 seconds e 9
59. ay Kit 1 kit L34951 LIVE DEAD Viability Cytotoxicity Assay Kit 1 kit L 3224 Neon Transfection system 1 each MPK5000 Neon Kit 10 uL 192 reactions MPK1096 Neon Kit 100 uL 192 reactions MPK10096 Platinum SYBR Green qPCR SuperMix UDG 100 reactions 11733 038 500 reactions 11733 046 ProLong Gold antifade reagent 10 mL P36930 PureLink HiPure Plasmid Miniprep Kit 100 preps K2100 03 PureLink HiPure Plasmid Midiprep Kit 25 preps K2100 04 PureLink HiPure Plasmid Maxiprep Kit 25 preps K2100 07 PureLink RNA Mini Kit 50 preps 12183 018A Qubit 2 0 Fluorometer 1 each Q32866 Qubit 2 0 Quantitation Starter Kit 1 kit Q32871 StemPro EZPassage Disposable Stem Cell Passaging 10 units 23181 010 Tool Superscript III First Strand Synthesis SuperMix 50 reactions 18080 400 Superscript III First Strand Synthesis SuperMix 50 reactions 11752 050 for qRT PCR SuperScript VILO cDNA Synthesis Kit 50 x 20 uL 11754 050 250 x 20 ug 11754 250 Water distilled 6x1L 15230 001 10X BlueJuice Gel Loading Buffer 3x1mL 10816 015 Appendix Resources for More Information Books Developmental Biology 9th edition edited by Scott F Gilbert Sinauer Associates 2010 Neural Stem Cells 2nd edition edited by Lesile P Weiner Humana Press 2008 Neural Development and Stem Cells 2nd edition edited by Mahendra S Rao Humana Press 2006 Protocols for neural cell culture 4th edition edited by Laurie C Doering Humana Press 2010 Protocols for neur
60. ay with an equal volume of fresh culture medium Note If the medium turns yellow change the medium daily Yellow medium will affect the NSC proliferation rate After 3 4 days the culture will become semi confluent To split the cell culture 1 2 aspirate the medium and wash the cells twice with 5 mL of D PBS without calcium and magnesium Add 1 mL of TrypLE Select to dissociate the cells and incubate for 2 minutes at 37 C Add 4 mL of culture media to neutralize the TrypLE Select activity and pipet up and down 2 3 times to get a uniform cell suspension Check the cells under a microscope Transfer the cell suspension to a 15 mL centrifuge tube Centrifuge the cells at 200 x g for 5 minutes Aspirate the supernatant and resuspend the cells in 10 mL of culture medium Split the cell suspension into two fresh T 25 flasks that have been treated with CELLstart CTS solution Seed each flask with 5 mL of cell suspension Incubate the flasks at 37 C in a humidified atmosphere 90 of 5 CO in air Grow the cells until semi confluent changing the medium once after 12 hours and every two days thereafter Passage the cells when the culture reaches 80 confluence Figure 1 Phase contrast microphotograph showing NSCs cultured in xenofree media 24 hours post thaw Panel A and semi confluent NSCs cultured in xenofree media for 3 days Panel B Neural Cell Culture and Differentiation Differentiating
61. bottom of the conical tube Aspirate the medium and fill the tube with fresh buffer Aspirate the buffer and add 1 mL StemPro Accutase for every 10 pieces of VM tissue Incubate the tissues 3 15 minutes at 37 C Observe the digestion process and determine the optimal duration by test dissociation and homogenization Avoid over digestion Using fire polished Pasteur pipets with decreasing diameter gently dissociate the tissue pieces by pipetting the tissue up and down for a total of 20 times Alternatively you may dissociate and homogenize the tissue by first using a pipettor with a 1000 uL tip followed with a 200 uL tip Avoid excessive formation of air bubbles during mechanical dissociation of VM tissue as it reduces cell viability If large pieces of tissue remain in the solution selectively homogenize the pieces separately Optional Pipet the cell suspension through a cell strainer cap or through a 35 to 70 um mesh To minimize loss of cells from this filtering step flush the filter membrane with a small volume of medium after the cell suspension is passed Centrifuge the cell suspension at 4 C for 3 5 minutes at 200 x g Aspirate the supernatant Gibco Neurobiology Protocols Handbook 57 Derivation of Dopaminergic Neurons from Midbrains of Rodents Culturing Midbrain Neural 58 Cells N 1 Resuspend the cells with differentiation medium Use 200 uL of differentiation medium for ever
62. cells aspirate the Geltrex solution and rinse the plates once with D PBS with Ca and Mg before adding the cell solution Gibco Neurobiology Protocols Handbook 93 Lipid Mediated Transfection of Human Astrocytes Preparing Media Aseptically mix the following components for preparing 100 mL of complete GIBCO Astrocyte Medium Complete Astrocyte Medium is stable for 2 weeks when stored at 4 C protected from light Component Amount per 100 mL Amount per 500 mL D MEM 89 mL 445 mL N 2 Supplement 1mL 5mL FBS 10 mL 50 mL Note Adding EGF at a final concentration of 20 ng mL can increase proliferation but may result in morphological and phenotypic changes in human astrocytes Handling and Harvesting Human Astrocytes 94 10 11 12 13 14 15 Warm Complete Astrocyte Medium and StemPro Accutase Cell Dissociation Reagent in a 37 C water bath before use Transfer conditioned medium from the cells to a new tube this will be used to stop the enzyme reaction in step 6 Wash cells once with 1X D PBS without calcium magnesium or phenol red Aspirate D PBS and add StemPro Accutase to the cells Incubate for 5 10 minutes at 37 C Rock the cells every 5 minutes and check under a microscope for detachment and dissociation toward single cells When the cells have detached add an equal volume 1 1 of conditioned medium from Step 2 to slow the Accutase
63. chieve a final concentration of 30 nM or your desired concentration 1 nM 100 nM in tubes or plates When applicable make master mixes for replicates to minimize variability at least one well overage For example with a 10 uM siRNA stock mix 0 39 uL of siRNA 3 9 pmols 19 61 uL of Opti MEM I per well or 1 56 uL of siRNA 78 44 uL of Opti MEM I for the master mix Plate siRNAs in a Geltrex coated plate using the proper method for coating as provided by the manufacturer Culture cells according to manufacturer s cell protocol Cells were in culture for about a week On the day of transfection harvest cells according to the protocol Count and dilute cells to the proper density We recommend performing an initial optimization experiment to determine your optimal cell density Based on our optimization we found 4 000 cells per well to be an optimal cell density We recommend performing an initial optimization experiment to determine the optimal amount of transfection agent to add that balances good knockdown and low toxicity Based on our optimizations we found 0 15 uL per well of Lipofectamine RNAiMAX to be the best condition Dilute 0 15 uL per well of Lipofectamine RNAiMAX in Opti MEM I for a total volume of 10 uL per well in a polystyrene 12 x 75 mm tube or a conical centrifuge tube Make a master mix of sufficient volume to treat all wells to be transfected plus an extra 10 for pipetting variability Mix the Lipofe
64. cifically developed for the transfection of siRNA and Stealth RNAi duplexes into eukaryotic cells 92 For transfecting plasmid DNA For transfecting siRNA GIBCO Human Astrocytes Cat no N7805 100 e GIBCO Astrocyte Medium Cat no A12613 01 Note The medium kit includes N 2 Supplement 100X Cat no 17502 048 Dulbecco s Modified Eagle Medium D MEM 1X liquid Cat no 10569 010 and One Shot Fetal Bovine Serum FBS Certified Cat no 16000 077 e Dulbecco s Phosphate Buffered Saline D PBS 1X liquid without Ca and Mg or phenol red Cat no 14190 144 e Dulbecco s Phosphate Buffered Saline D PBS 1X liquid with Ca and Mg Cat no 14040 133 Geltrex Reduced Growth Factor Basement Membrane Matrix Cat no 12760 StemPro Accutase Cell Dissociation Reagent Cat no A11105 e Opti MEM I Reduced Serum Medium Cat no 31985 062 Appropriate tissue culture plates and supplies e Plasmid DNA of interest 100 ng L or higher e Lipofectamine LTX Reagent and PLUS Reagents Cat no 15338 100 e Silencer Select siRNAs see www invitrogen com for ordering information Lipofectamine RNAiMAX Transfection Reagent Cat no 13778 075 or 13778 150 Transfection Important Guidelines for Lipid Mediated Transfection Follow these important guidelines when performing lipid mediated transfections of human astrocytes e Maintain human astrocytes on Geltrex coated plates
65. co s Phosphate Buffered Saline D PBS Cat no 14040 e Dulbecco s Phosphate Buffered Saline D PBS without Ca or Mg Cat no 14190 Special Tools 15 mL conical tube Microcentrifuge Preparing Media and Culture Vessels CELLstart CTS Coated Vessels Prepare culture dishes flasks with CELLstart CTS as described below 1 Dilute CELLstart CTS 1 100 in D PBS with calcium and magnesium e g 50 uL of CELLstart into 5 mL of D PBS Note CELLstart CTS should not be frozen vortexed or exposed to vigorous agitation due to potential gel formation 20 2 3 4 Culture Medium Methods Neural Cell Culture and Differentiation TM TM Coat the surface of the culture vessel with the working solution of CELLstart CTS 2 5 mL for a T 25 flask or 60 mm dish 1 5 mL for a 35 mm dish Incubate the culture vessel at 37 C in a humidified atmosphere of 5 CO for 1 hour TM Use the dish immediately after incubation Aspirate the CELLstart CTS solution immediately before use Note Prepare a freshly coated culture vessel each time before plating cells There is no need to rinse the culture vessel before use Prepare 50 mL of culture medium as follows The growth factors can be added immediately before use After the medium has been supplemented with growth factors aliquot the amount needed for the day and store the remaining medium at 4 C Formulated medium is stable for 2 weeks if properly stored at
66. collecting the uterine horns work under sterile conditions in a laminar flow hood or add antibiotics penicillin streptomycin at standard concentrations to reagents Perform the steps in a timely manner and keep the tissue cooled on ice and immersed in ice cold buffers throughout the procedure Using aseptic technique collect the uterine horns from a time pregnant rat staged to E14 of gestation or mouse staged to E13 of gestation Submerge uterine horns in a 100 mm petri dish containing ice cold sterile HBSS and carefully rinse 2 3 times with 15 mL ice cold sterile HBSS Transfer the uterine horns to a clean 100 mm petri dish containing dissection buffer Under a dissection microscope placed in a laminar flow hood dissect each embryo from the uterine sac and remove the amniotic membranes Use a Morian type perforated spoon to transfer the embryo to a clean sterile petri dish containing ice cold dissection buffer Confirm the gestational age by measuring and recording the crown rump length of the embryos 10 12 mm for E14 rat or E13 mouse embryos Exclude any malformed or otherwise damaged embryos Dissecting Brains 1 Dissecting the Ventral Midbrain Dissociating Cells 2 1 1 Neural Cell Culture and Differentiation Decapitate each fetus using microdissection scissors or a scalpel Hold the tissue with forceps near the forebrain or hindbrain region to avoid damage to the midbrain region
67. covery of Mature Differentiated Neural Cells seessessssse 63 Cell ANALYSIS 65 Cell Viability Assays for Neural Stem Cells 65 Markers for Characterizing Neural Subtypes sssssssssssssssenemenene eene nenne 68 Surface Marker Analysis by Flow Cytometry ssssssssssssssssseeeeeene eene 69 Irinn nocytoclie mililstly uere teet rro RR ne o Pe EN r dedaestants PER Fe damn P MR x RAS aE DRM uia d estu ius Ra 72 all Tenitojo ny esi Tel ioo REL 75 Molecular Chardcter TzallOH ioca ccuuiaca sodas catu abet bv K dU De ax E ua NAE dud Fb E KE CER IEEE RI IN RN EEEO CK Gd MEER 77 PCR Primers for Molecular Characterization of Neural Subtypes ssssssssssss 77 RNA Isolation and cDNA Preparation from Neural Stem Cells 78 Characterizing Neural Cells by qPCR ssssssssssssssssssesee eene eren ener nennen nenne 82 Gibco Neurobiology Protocols Handbook 1 Table of Contents TRANSIOCHON c 85 Transfecting Neural Cells Using the Neon Transfection System 85 Lipid Mediated Transfection of Human Astrocytes sssssssssssssssseeeeee eee 93 Using Neural Cells for Cell Therapy iuuucssezcc cans ouxasusezuh unu aur cuan run R ua au e Dnga Ub ap d esu sni cuta rau S dk v uduh 99 Modeling Parkinson s Disease in Rats ssssssssssssssssssseseeeeee eene nennen eene 99 pri cem
68. ctamine RNAiMAX Opti MEM I mixture by gently flicking the bottom of the tube Combine 10 uL of the Lipofectamine RNAiMAX Opti MEM I mixture per 20 uL of diluted and pre plated siRNA Mix by tapping the plate back and forth Incubate this mixture for 10 minutes at room temperature After the incubation add 80 uL of human astrocytes that have been diluted to the proper density to each well The final volume per well should be 110 uL per well Place the plate in a 37 C incubator under normal cell culture conditions Remove the cells and assay for the expression levels of the gene of interest at the desired time point typically 24 48 hours post transfection References Transfection Rothstein J D Dykes Hoberg M Pardo C A Bristol L A Jin L Kuncl R W et al 1996 Knockout of glutamate transporters reveals a major role for astroglial transport in excitotoxicity and clearance of glutamate Neuron 16 675 686 Rothstein J D Martin L Levey A I Dykes Hoberg M Jin L et al 1994 Localization of neuronal and glial glutamate transporters Neuron 13 713 725 Xu L Sapolsky R M and Giffard R G 2001 Differential sensitivity of murine astrocytes and neurons from different brain regions to injury Exp Neurol 169 416 424 Zhao G and Flavin M P 2000 Differential sensitivity of rat hippocampal and cortical astrocytes to oxygen glucose deprivation injury Neurosci Lett 285 177 180 G
69. dishes After plating the cells place the vessels in a 37 C incubator with a humidified atmosphere of 5 CO Use the MEF plates and dishes within 3 4 days of plating Neural Cell Culture and Differentiation Thawing and Plating hESCs N 10 11 12 Wearing eye protection and ultra low temperature cryo gloves remove a vial of hESCs from the liquid nitrogen storage tank using metal forceps Immerse the vial in a 37 C water bath without submerging the cap Swirl the vial gently When only a small amount of ice remains in the vial remove it from the water bath Spray the outside of the vial with 7076 ethanol before placing it in the cell culture hood Transfer the cells gently into a sterile 15 mL conical tube using a 1 mL pipette Rinse the vial with 1 mL of pre warmed hESC medium to collect the remaining cells in the vial and add them dropwise to the cells in the 15 mL conical tube Note Adding the medium slowly helps cells to avoid osmotic shock Add 4 mL of pre warmed hESC medium dropwise to the cells in the 15 mL conical tube While adding the medium gently move the tube back and forth to mix hESCs Centrifuge the cells for 5 minutes at 200 x g Aspirate the supernatant and resuspend the cell pellet in 5 mL of pre warmed hESC medium Label the culture vessel containing inactivated MEFs with the passage number of the hESCs from the vial the date and your initials Aspirate the
70. e the medium every 3 4 days Neural Cell Culture and Differentiation Derivation and Culture of Cortical Astrocytes Summary Required Materials Astrocytes are the most numerous cell type in the central nervous system CNS They play critical roles in adult CNS homeostasis provide biochemical and nutritional support of neurons and endothelial cells that form the blood brain barrier perform the vast majority of synaptic glutamate uptake and maintain extracellular potassium levels Astroglial dysfunction has been implicated in a number of CNS pathologies This protocol describes the preparation of primary cortical astrocytes from new born rats or mice Animals Media and Reagents Special Tools e Newborn rats or mice at 1 2 days after birth e Ether e 70 ethanol e Distilled water Cat no 15230 162 Acetic acid Sigma Cat no 34254 Collagen Fisher Scientific Cat no CB 40236 0 05 Trypsin EDTA solution Cat no 25300 054 Hanks balanced salt solution HBSS Cat no 14170 112 e Gibco Astrocyte Medium Cat no A12613 01 e EGF Recombinant Human Cat no PHG0314 e Dulbecco s Phosphate Buffered Saline D PBS without Ca or Mg Cat no 14190 e Dibutyryl cyclic AMP dBcAMP Sigma D0627 e Penicillin streptomycin Cat no 15070 063 Trypan Blue Stain Cat no 15250 included with the Countess Automated Cell Counter or LIVE DEAD Cell Vitality Assay Kit Cat no L34951 D
71. e used at a density of 200 000 cells mL Cryopreserving Neural Stem Cells 1 Neural Cell Culture and Differentiation Aspirate the medium and wash with D PBS without Ca and Mg Add 1 mL of TrypLE Express to the culture vessel Gently pipette to loosen monolayer into a single cell suspension Neutralize the treatment by adding 4 mL of medium Do not treat the cells for longer than 3 minutes after addition of TrypLE Express Spin down the cells by centrifugation at 1 200 rpm for 4 minutes Aspirate the supernatant Resuspend the cells in StemPro NSC SFM complete medium at a density of 2 x 10 cells mL Prepare freezing medium consisting of 20 DMSO and 80 medium Note Freezing medium 2X can be prepared on the day of use and stored at 4 C until use Add a volume of freezing medium equal to the amount of StemPro NSC SFM complete medium used to resuspend the cells in a drop wise manner Prepare 1 mL aliquots 1 x 10 cells in cryovials and place the vials in an isopropanol chamber Put the isopropanol chamber at 80 C and transfer the vials to liquid nitrogen storage the next day Characterizing NSCs by Immunocytochemistry and PCR Antibodies for NSC Characterization Use the antibodies listed in the following table to characterize NSCs by immunocytochemistry For details on the procedure refer to Chapter 17 Immunocytochemistry page 71
72. echnique involves labeling cells with a fluorescent marker and suspending cells in a stream of fluid which passes through and is measured by a fluorescence measuring station Cells Reagents and Equipment Titrating Antibodies Cells in suspension 0 1 BSA in PBS Staining Medium e Fluorescently labeled antibody e Flow cytometer 68 Determining the Optimal Concentration of Antibody for Flow Cytometry 1 Dilute labeled antibodies for the appropriate antigens to be detected in Staining Medium Make dilutions of all antibodies at x1 x2 x5 x10 x20 x40 x80 and x100 Prepare the cells that express the antigen to be analyzed Count the number of cells Use 1 x 10 cells for each dilution Smaller numbers of cells ranging from 50 000 to 100 000 may work as well Centrifuge cells at 300 x g for 5 minutes at 4 C and discard the supernatant Add 5 uL of antibody from each dilution into separate sample tubes containing cells Prepare negative controls of cells that have not been stained with antibody and cells stained with an isotype control Mix well and incubate cells on ice for 25 30 minutes If primary antibodies are not directly conjugated to fluorescent tags carry out the second step incubation with secondary antibody tagged to a fluorescent tag 10 11 Cell Analysis Wash with 10 mL of Staining Medium Discard the supernatant and resuspend the cells in 0 5 mL of Staining
73. ed with 0 5 ug of a plasmid encoding the Emerald Green Fluorescent Protein EGFP using the Neon Transfection system with the parameters listed in the following table 48 hours post transfection the cells were analyzed by light Panel A and fluorescence microscopy Panel B Cell densit Pulse Pulse Pulse Transfection Viabilit Neon y voltage V width ms number efficiency y tip 1400 20 2 8296 95 1 x 10 cells mL 1600 20 1 8496 95 10 uL 1700 20 1 87 96 Human Astrocytes GIBCO Human Astrocytes Cat no N7805 100 were transfected using the Neon Transfection Device and 0 5 ug of a plasmid encoding the Emerald Green Fluorescent Protein EGFP 24 hours post electroporation the cells were analyzed by light Panel A and fluorescence microscopy Panel B Cell densit Pulse Pulse Pulse Transfection Viabilit Neon y voltage V width ms number efficiency y tip 1100 30 1 92 97 7 i Tae lOmcells ml 1200 40 1 93 97 ide 88 Rat Fetal Neural Stem Cells Transfection GIBCO Rat Fetal Neural Stem Cells Cat no N7744 100 were transfected using the Neon Transfection Device and 0 5 ug of a plasmid encoding the Emerald Green Fluorescent Protein EGFP 24 hours post electroporation the cells were analyzed by light Panel A and fluorescence microscopy Panel B Cell densit Pulse Pulse Pulse Transfection Viabilit Neon y voltage V width ms
74. edium Note You may store the Geltrex treated dish at 4 C wrapped tightly with Parafilm for up to 1 month Do not remove Geltrex solution until just prior to use Dissolve poly L ornithine in cell culture grade distilled water to make 10 mg mL stock solution 500X Aliquot the solution and store it at 20 C until use Thaw the laminin slowly at 2 8 C and prepare 10 ug mL working solution in cell culture grade distilled water Aliquot the working solution into polypropylene tubes and store the tubes at 20 C until use Avoid repeated freeze thaw cycles Note Laminin may form a gel if thawed too rapidly Dilute the poly L ornithine stock solution 1 500 in cell culture grade distilled water to make 20 ng mL working solution Gibco Neurobiology Protocols Handbook 27 Differentiating Neural Stem Cells into Neurons and Glial Cells N Coat the surface of the culture vessel with or without cover slips with the poly L ornithine working solution 14 mL for T 75 7 mL for T 25 3 5 mL for 60 mm dish 2 mL for 35 mm dish Incubate the culture vessel overnight at 4 C or for 1 hour at 37 C Rinse the culture vessel twice with sterile water Coat the surface of the culture vessel with or without cover slips with the laminin working solution 14 mL for T 75 7 mL for T 25 3 5 mL for 60 mm dish 2 mL for 35 mm dish Incubate the culture vessel overnight at 4 C or for 2 hours at 37 C Rinse the
75. ells per well in poly D lysine coated 48 well plate or an 8 chambered slide Bring the cell suspension volume to 500 uL per well by adding complete Neurobasal medium Incubate the cells at 37 C in a humidified atmosphere of 5 CO in air Feed the cells every third day by aspirating half of the medium from each well and replacing it with fresh medium Characterizing Neural Cells Preparing Paraformaldehyde Fixing Solution 20 paraformaldehyde PFA stock solution Add PBS to 20 g of EM grade paraformaldehyde and bring the volume up to 100 mL Add 0 25 mL of 10 N NaOH and heat the solution at 60 C using a magnetic stirrer until the solution is completely dissolved Filter the solution through a 0 22 um filter and cool on ice Make sure the pH is 7 5 8 0 Aliquot 2 mL in 15 mL tubes freeze the tubes on dry ice and store them at 20 C 4 PFA for fixing Add 8 mL of PBS into each 15 mL tube containing 2 mL of 2076 PFA and thaw each tube in a 37 C water bath Once the solution has dissolved the tubes cool on ice Gibco Neurobiology Protocols Handbook 41 Isolation Culture and Characterization of Cortical and Hippocampal Neurons 42 Fixing Cells 1 Staining Cells 1 N Remove the culture medium and gently rinse the cells without dislodging them twice with D PBS containing Ca and Mg Fix the cells with 4 fresh Paraformaldehyde Fixing Solution PFA at room temperat
76. ent 296 2mL You may observe a white precipitate when thawing StemPro Neural Supplement this precipitate will disappear when the supplement is completely thawed or dissolved Neural differentiation medium requires supplementation of Neurobasal medium with B 27 Serum Free Supplement and GlutaMAX I Neural differentiation medium is stable for 2 weeks when stored in the dark at 2 8 C To prepare 100 mL of neural differentiation medium aseptically mix the following components For larger volumes increase the component amounts proportionally If desired add 1 mL of Antibiotic Antimycotic solution per 100 mL of medium Component Final concentration Amount Neurobasal Medium 1X 97 mL B 27 Serum Free Supplement 2 2mL GlutaMAX I Supplement 2mM 1 mL If faster differentiation is desired add dibutyryl cAMP Sigma Cat no 0627 to a final concentration of 0 5 mM at day 7 for a duration of 3 days as indicated in the differentitation protocols Gibco Neurobiology Protocols Handbook 25 Differentiating Neural Stem Cells into Neurons and Glial Cells 26 Astrocyte Differentiation Medium Oligodendrocyte Differentiation Medium Astrocyte differentiation medium requires supplementation of D MEM with N 2 GlutaMAX I and FBS Astrocyte differentiation medium is stable for 4 weeks when stored in the dark at 2 8 C To prepare 100 mL of astrocyte differentiation medium aseptically mix the following component
77. er the cells into a liquid nitrogen Gibco Neurobiology Protocols Handbook 61 Cryopreservation and Recovery of Mature Differentiated Neural Cells Cryopreservation and Recovery of Mature Differentiated Neural Cells Summary Required Materials Primary neuronal cultures are indispensable in the field of neurobiology and pharmacology Many researchers favor freshly isolated neuronal cells as they maintain their functional viability but for convenience an alternate route is to cryopreserve fresh cells for later use This chapter describes the generation of cryopreserved stocks from the freshly isolated neural cells and thawing procedures for recovering the stocks Rat Brain Cells Media and Reagents Equipment Cryopreservation Homogenous cell preparation from E18 rat brain tissue as described in Chapter 9 Isolation Culture and Characterization of Cortical and Hippocampal Neurons page 40 e Neurobasal Medium Cat no 21103 049 e B27 Serum Free Supplement Cat no 17504 044 e GlutaMAX I Cat no 35050 061 Trypan Blue Cat no 15250 061 e Synth a Freeze Cryopreservation Medium Cat no R 005 50 Cryogenic Vials Isopropanol Chamber e Freezer 80 C Liquid nitrogen freezer Water bath set to 37 C 62 Freezing Neural Cells 1 Isolate and prepare a suspension of rat brain cells in Neurobasal medium supplemented with 2 B 27 as described in Chapter 9 Isolation Culture
78. esiccator e lridectomy scissors e 70 um mesh cell strainer e Countess Automated Cell Counter Cat no C10227 or hemacytometer Gibco Neurobiology Protocols Handbook 35 Derivation and Culture of Cortical Astrocytes Preparing Reagents and Media Astrocyte Medium GIBCO Astrocyte Medium has been specifically formulated for the growth and maintenance of human and rat astrocytes while retaining their phenotype The medium has three components basal medium D MEM N 2 Supplement and One Shot Fetal Bovine Serum FBS Epidermal growth factor EGF may also be added to enhance astrocyte proliferation To prepare 100 mL of complete medium mix the following components under aseptic conditions For larger volumes increase the component amounts proportionally Component Amount D MEM 83mL N 2 15mL FBS 1mL Penicillin streptomycin 1mL Optional EGF prepared as 100 ug mL stock 20 uL Collagen Prepare a 50 ug mL working solution in distilled water with 0 02 M acetic acid and sterilize the solution with a 0 22 um filter Dibutyryl cyclic AMP dBcAMP Prepare a 0 25 M stock solution of dBcAMP in D PBS aliquot into sterilized tubes and store at 20 C HBSS Chill on ice prior to use Preparing Astrocyte Enriched Cultures 1 Coat the culture vessels with collagen and let stand for 45 minutes at room temperature Rinse with D PBS without calcium or magnesium two times 2 Anesthetize rat or mouse
79. fer to the manual supplied with the Neon unit Cell type Cell density Pulse voltage V Pulse width ms Pulse number Neon tip 1400 20 2 Human Neural Stem Cells 1 x 107 cells mL 1600 20 1 10 uL 1700 20 1 1100 30 1 7 10 Human Astrocytes 1 x 10 cells mL 1200 40 1 0 uL 1300 20 2 Rat Fetal Neural Stem Cells 1 x 107 cells mL 1500 10 3 10 uL 1600 10 3 1400 20 2 Rat Primary Cortical Astrocytes 0 5 x 10 cells mL 1400 30 1 10 uL 1700 20 1 1300 10 3 T 10 Rat Glial Precursor Cells 1 x 10 cells mL 1500 20 1 0 uL 10 11 12 13 14 15 16 17 Transfection Fill the Neon Tube with 3 mL of Buffer E Use Buffer E2 if you are using the 100 uL Neon Tip Insert the Neon Tube into the Neon Pipette Station until you hear a click indicating that the tube has locked in position Transfer 0 5 ug of plasmid DNA into a sterile 1 5 mL microcentrifuge tube Note The quality and concentration of DNA used for electroporation plays an important role for the transfection efficiency We strongly recommend using high quality plasmid purification kits such as PureLink HiPure Plasmid DNA Purification Kits to prepare DNA Add 1 mL of cells resuspended in step 3 to the tube containing the plasmid DNA and gently mix Insert a 10 uL Neon Tip into the Neon Pipette Press the push button on the Neon Pipette to the first stop and immerse the Neon Tip i
80. he cells with 4 fresh Paraformaldehyde Fixing Solution PFA at room temperature for 15 minutes Rinse 3X with D PBS containing Ca and Mg Check for the presence of cells after fixing Proceed to staining described below You may store slides for up to 3 4 weeks in D PBS at 4 C before staining Do not allow slides to dry Gibco Neurobiology Protocols Handbook 29 Differentiating Neural Stem Cells into Neurons and Glial Cells Staining Cells 1 Incubate cells for 30 60 minutes in blocking buffer 5 serum of the secondary antibody Expected Results host species 1 BSA 0 1 Triton X in D PBS with Ca and Mg Note If you are using a surface antigen such as GalC omit Triton X from the blocking buffer Remove the blocking buffer and incubate the cells overnight at 4 C with primary antibody diluted in 576 serum Ensure that the cell surfaces are covered uniformly with the antibody solution Wash the cells 3X for 5 minutes with D PBS containing Ca and Mg if using a slide use a staining dish with a magnetic stirrer Incubate the cells with fluorescence labeled secondary antibody 5 serum in D PBS with Ca and Mg in the dark at 37 C for 30 45 minutes Wash the cells 3X with D PBS containing Ca and Mg and in the last wash counter stain the cells with DAPI solution 3 ng mL for 5 10 minutes and rinse with D PBS If desired mount using 3 drops of ProLong Gold ant
81. hibitors Serum also contains unknown and variable levels of growth factors hormones vitamins and proteins This chapter details the isolation and culture of neural cells in serum free media and supplements Isolating Rat Brain Cells Culturing Embryonic Neurons 38 Hibernate E Medium Cat no A12476 01 B 27 Serum Free Supplement Cat no 17504 GlutaMAX I Cat no 35050 Hibernate E Medium without Ca BrainBits LLC Cat no HE Ca Papain Worthington Cat no LS003119 Neurobasal Medium Cat no 21103 049 Trypan Blue Stain Cat no 15250 061 Pasteur pipettes Hemacytometer cell counter and trypan blue or the Countess Automated Cell Counter Cat no C10227 Conical tubes 15 mL 50 mL Poly D lysine hydrobromide Sigma Cat no P 6407 48 well plate or 8 chambered slides Distilled water Cat no 15230 162 Dulbecco s Phosphate Buffered Saline D PBS Cat no 14040 141 Neurobasal Medium Cat no 21103 049 B 27 Serum Free Supplement Cat no 17504 GlutaMAX I Cat no 35050 Immunocytochemistry Preparing Media Neural Cell Culture and Differentiation Goat serum Cat no 16210 064 Mouse anti MAP2 antibody Cat no 13 1500 Rabbit anti GFAP antibody Cat no 08 0063 Alexa Fluor 488 goat anti mouse IgG H L Cat no A 11029 Alexa Fluor 594 goat anti rabbit IgG H L Cat no A 11037 e 4 6 diamidino 2 phenylindole dihydrochloride DAPI
82. ibco Neurobiology Protocols Handbook 97 Modeling Parkinson s Disease in Rats Using Neural Cells for Cell Therapy Modeling Parkinson s Disease in Rats Summary In animals with a unilateral dopaminergic DA lesion there is an imbalance of motor activity Complete DA lesion can be induced by unilateral intracerebral stereotactic injection of 6 hydroxydopamine in the medial forebrain bundle MFB This model is useful in the study of DA replacement therapy This chapter describes methods to induce a rat Parkinson s disease model with complete unilateral DA lesion Required Materials Rats Sprague Dawley rats 200 250 g Media and Reagents Sterile saline soflurane Betadine e 70 Ethanol 6 hydroxydopamine Sigma Aldrich Cat no H116 Apomorphine Sigma Aldrich Cat no A4393 Amphetamine Sigma Aldrich Cat no A1263 Special Tools Stereotactic frame Animal balance e Isoflurane inhalation chamber Electric razor e Scalpel Tissue forceps e Scissors e 10 uL Hamilton syringes and needles Dental drill Sutures or staples 98 Preparing Reagents Using Neural Cells for Cell Therapy Preparing 6 hydroxydopamine 6 OHDA Solution Make a 2 mg mL solution of 6 hydroxydopamine 6 OHDA in saline Store protected from light up to 12 months at 20 C Performing the DA Lesion Using a Rat Model Preparing the Animal 1 Weigh a rat and place it into an isoflurane chamber and apply o
83. ifade reagent per slide and seal with the cover slip You may store the slides in the dark at 4 C 30 Figure 1 Fluorescence images 20X of GIBCO hNSCs that have been cultured in StemPro NSC SFM for three passages and then allowed to differentiate into neurons oligodendrocytes or astrocytes Upon directed differentiation cells start to lose the undifferentiated NSC marker nestin but stain positive for the differentiated cell type markers Dcx GalC and GFAP Cells were stained for the undifferentiated NSC markers nestin red and SOX2 green prior to directed differentiation Panel A Cell were then differentiated into neurons and glial cells and respectively stained for the neuronal marker Dcx green Panel B for the oligodendrocyte marker GalC red Panel C or for the astrocyte marker GFAP green Panel D The nuclei were counterstained with DAPI blue in panels B D A B C D Neural Cell Culture and Differentiation Troubleshooting The table below lists some causes and solutions to help you troubleshoot your potential differentiation problems Possible cause Solution Culture medium contains bFGF Remove bFGF from culture medium Cell density too high and endogeneous bFGF Reduce cell density is preventing differentitation Concentration of GlutaMAX I Supplement is Use the GlutaMAX I Supplement at a final incorrect concentration of 2 mM Cells have been passaged too many times Obtain new GI
84. ifferentiation ability and self renewal capacity Specific regions of the brain may have relatively distinct stem cell populations such as the developing retina and the cerebellum Stem Cells in Subventricular Zone As development proceeds the ventricular zone is much reduced in size and additional zones of mitotically active precursors appear Mitotically active cells that accumulate adjacent to the ventricular zone are called the subventricular zone SVZ cells The SVZ later becomes the subependymal zone as the ventricular zone is reduced to a single layer of ependymal cells The SVZ is prominent in the forebrain and can be identified as far back as the fourth ventricle but it cannot be detected in more caudal regions of the brain if it exists in these regions it likely consists of a very small population of cells An additional germinal matrix derived from the rhombic lip of the fourth ventricle called the external granule layer generates the granule cells of the cerebellum Like the VZ the SVZ can be divided into subdomains that express different rostrocaudal markers and generate phenotypically distinct progeny Distinct SVZ domains include the cortical SVZ the medial ganglion eminence and the lateral ganglion eminence The proportion of SVZ stem cells declines with development and multipotent stem cells are likely to be present only in regions of ongoing neurogenesis e g anterior SVZ and the SVZ underlying the hippocampus in the adul
85. ik Ziegler L Pomp O et al 2008 Peripheral sensory neurons differentiate from neural precursors derived from human embryonic stem cells Differentiation 76 145 155 Izrael M Zhang P Kaufman R et al Human oligodendrocytes derived from embryonic stem cells Effect of noggin on phenotypic differentiation in vitro and on myelination in vivo Mol Cell Neurosci 34 310 323 Kang S M Cho M S Seo H et al 2007 Efficient induction of oligodendrocytes from human embryonic stem cells Stem Cells 25 419 424 Keirstead H S Nistor G Bernal G et al 2005 Human embryonic stem cell derived oligodendrocyte progenitor cell transplants remyelinate and restore locomotion after spinal cord injury J Neurosci 25 4694 4705 Lamba D A Karl M O Ware C B and Reh T A 2006 Efficient generation of retinal progenitor cells from human embryonic stem cells Proc Natl Acad Sci U S A 103 12769 12774 Lee H Shamy G A Elkabetz Y et al 2007 Directed differentiation and transplantation of human embryonic stem cell derived motoneurons Stem Cells 25 1931 1939 Lee D S Yu K Rho J Y et al 2006 Cyclopamine treatment of human embryonic stem cells followed by culture in human astrocyte medium promotes differentiation into nestin and GFAP expressing astrocytic lineage Life Sciences 80 154 159 Li X J Du Z W Zarnowska E D et al 2005 Specification of motoneurons from human embryonic stem cel
86. in a 37 C incubator with a humidified atmosphere of 5 CO and replace the spent medium with fresh neural differentiation medium every other day You can evaluate DA neuron differentiation 3 4 weeks after plating Gibco Neurobiology Protocols Handbook 53 Derivation of Dopaminergic Neurons from Midbrains of Rodents Derivation and Culture of Dopaminergic Neurons from Midbrains of Rodents Summary Required Materials Dopaminergic DA neurons are located in the ventral midbrain VM The ability to isolate precursor cells and neurons from the VM provides a powerful means to characterize their differentiation properties and to study their potential for restoring dopamine neurons degenerated in Parkinson s disease PD This chapter describes methods to differentiate precursor cells derived from embryonic ventral mesencephalon into DA neurons Embryos Media and Reagents Special Tools 54 Embryonic E14 rats or embryonic E13 mice Water distilled Cat no 15230 162 Hanks Balanced Salt Solution HBSS without Ca and Mg Cat no 14170 112 Dulbecco s Phosphate Buffered Saline D PBS without Ca and Mg Cat no 14190 D Glucose Sigma Cat no G8270 Penicillin Streptomycin Cat no 15070 063 Ascorbic Acid Sigma Cat no A4034 StemPro Accutase Cell Dissociation Reagent Cat no A11105 01 Trypan Blue Cat no 15250 061 Natural Mouse Laminin Cat no 23017 015 Poly L Ornithine Sigm
87. into a 50 mL conical tube using a 5 mL pipette Note Do not break the cells clumps into smaller pieces Add 1 mL of pre warmed hESC EB medium into each well of 6 well plate 2 mL into each 60 mm dish or 3 mL into each 100 mm dish to collect remaining cells and add them to the 50 mL conical tube containing the hESC Centrifuge the cells for 5 minutes at 200 x g Aspirate the supernatant from the hESC pellet Gently re suspend the pellet with an appropriate amount of EB medium 15 mL for all the cells from one 60 mm dish or 40 mL for all cells from one 100 mm dish Transfer the cell clumps to an uncoated T 75 flask for a couple of hours This allows the fibroblasts to differentially attach to the flask After a few hours set the T 75 flask down at a tilted angle to allow the EBs to settle in one corner of the flask Aspirate the EB medium and replace it with 40 mL of fresh EB medium Transfer the cell clumps to a fresh T 75 flask and incubate them in a 37 C incubator with a humidified atmosphere of 5 CO Feed the EBs with EB medium every day for 4 days When feeding set the flask down at a tilted angle so that the EBs settle in one corner of the flask Aspirate almost all spent EB medium replace it with pre warmed EB medium and return flask to the incubator Note Due to DNA release form dead cells cell clumps may stick together In this case gently pipet the EBs up and down 2 3 times using a 5 mL pipette This will
88. ion Reagent Cat no A11105 01 Recombinant Human FGF Basic bFGF Cat no 13256 029 FGF 8b Recombinant Human Cat no PHG0271 B DNF Recombinant Human Cat no PHC7074 G DNF Recombinant Human Cat no PHC7045 Trypan Blue Stain Cat no 15250 061 Distilled water Cat no 15230 162 Poly L Ornithine Sigma Cat no P3655 Heparin Sigma Cat no H3149 Ascorbic Acid Sigma Cat no A4403 Dibutyryl cyclic AMP dcAMP Sigma Cat no D0627 Recombinant human sonic hedgehog SHH R amp D systems Cat no 1314 SH 025 Special Tools Preparing Media Neural Cell Culture and Differentiation e StemPro EZPassage Disposable Stem Cell Passaging Tool Cat no 23181 010 Cell scraper Fisher Cat no 087711A Stock Solutions Knockout Serum Replacement KSR Thaw a bottle of KSR prepare 50 mL aliquots and store at 20 C Use KSR within a week of thawing Recombinant human FGF basic Prepare a 10 ug mL stock solution in D PBS with 0 1 BSA aliquot into sterilized tubes and store at 20 C Heparin Prepare a 2 mg mL stock solution in D PBS aliquot 0 5 mL into sterilized tubes and store at 80 C Ascorbic acid Prepare a 200 mM stock solution in D PBS aliquot 0 5 mL into sterilized tubes and store at 20 C Recombinant human sonic hedgehog Prepare a 0 2 mg mL stock solution in D PBS with 0 1 BSA aliquot into sterilized tubes and store at 20 C Recombinant human FGF8b Prepare a 0
89. ith 1 mL of pre warmed complete Neurobasal B 27 medium and transfer the rinse to the 15 mL tube containing the cells at a rate of one drop per second Mix by gentle swirling after each drop 7 Slowly add 2 mL of complete Neurobasal B 27 medium to the tube for a total suspension volume of 4 mL 8 Mix the suspension very gently with P 1000 pipette Avoid creating any air bubbles 9 Add 10 uL of cell suspension to a microcentrifuge tube containing 10 uL of 0 4 Trypan blue using a pre rinsed tip Mix the cells by gently tapping the tube Determine the viable cell density using a hemocytometer 10 Plate 1 x 10 cells per well in poly D lysine coated 48 well plate or an 8 chambered slide Bring the cell suspension volume to 500 uL per well by adding complete Neurobasal B 27 medium 11 Incubate the cells at 37 C in a humidified atmosphere of 5 CO in air 12 Feed the cells every third day by aspirating half of the medium from each well and replacing it with fresh medium Gibco Neurobiology Protocols Handbook 63 Cell Viability Assays for Neural Stem Cells Cell Analysis Cell Viability Assays for Neural Stem Cells Summary Required Materials The LIVE DEAD Viability Cytotoxicity Assay Kit provides a two color fluorescence cell viability assay that is based on the simultaneous determination of live and dead neural stem cells NSCs with probes that measure two recognized parameters of cell viability int
90. ith the cells For troubleshooting tips regarding the Neon Transfection System see below Problem Possible cause Solution Connection failure No Neon Tip is inserted or the Neon Tip is inserted incorrectly Make sure that the Neon Tip is inserted into Neon Pipette correctly as described There should be no gap between the tip and the top head of the pipette Arcing sparks Air bubbles in the Neon Tip Avoid any air bubbles in the Neon Tip while aspirating the sample High voltage or pulse length settings Reduce the voltage or pulse length settings Low cell survival rate Poor DNA quality Use high quality plasmid DNA for transfection use high quality plasmid purification kits such as PureLink HiPure Plasmid DNA Purification Kits Cat no K2100 to prepare DNA Resuspend the purified DNA in deionized water or TE buffer 10 mM Tris HCl 1 mM EDTA pH 8 0 at a concentration between 0 5 5 ug uL Check the purity of the purified DNA preparation by measurement of the A260 280 ratio The ratio should be at least 1 8 for electroporation Do not precipitate DNA with ethanol to concentrate DNA Concentrated DNA by ethanol precipitation shows poor transfection efficiency and cell viability due to salt contamination Cells are stressed or damaged Avoid severe conditions during cell harvesting especially high speed centrifugation and pipette cells gently Avoid using over confluent cells
91. iumt 96 well 0 3 cm 100 pL 1 0 x 104 20 uL 100 ng 0 3 0 6 uL 0 1 uL 48 well 1 cm 200 uL 2 0 x 10 40 uL 200 ng 0 6 1 2 uL 0 2 uL 24 well 2 cm 500 uL 5 0 x 104 100 uL 500 ng 1 5 3 0 uL 0 5 uL 12 well 4 cm 1 mL 1 0 x 10 200 uL 1 ug 3 0 6 0 uL 1 0 uL 6 wel 10 cm 2mL 2 5 x 10 500 uL 2 5 ug 7 5 15 0 uL 2 5 pL Surface areas may vary depending on the manufacturer t If the volume of Lipofectamine LTX Reagent is too small to dispense accurately and you cannot pool dilutions predilute Lipofectamine LTX Reagent 10 fold in Opti MEM Reduced Serum Medium and dispense a 10 fold higher amount should be at least 1 0 ul per well Discard any unused diluted Lipofectamine LTX Reagent Gibco Neurobiology Protocols Handbook 95 Lipid Mediated Transfection of Human Astrocytes Transfecting siRNA into Human Astrocytes Using Lipofectamine RNAiMAX Reagent 96 Prepare siRNAs Prepare cells Transfect cells Resuspend the Silencer Select siRNAs with nuclease free water A convenient stock concentration is 100 uM which can be diluted to meet downstream experimental needs Validate the concentration of the siRNA by measuring absorption at 260 nM using a spectrophotometer and adjust with water if necessary Keep aliquots frozen at 20 C Dilute stock siRNAs of 100 uM to a working concentration of 10 uM From the working stock dilute siRNAs in 20 uL of Opti MEM I per well to a
92. ll Counter Determine the total number of cells and percent viability using trypan blue stain or the LIVE DEAD Cell Vitality Assay Kit Dilute the cell suspension to 5 x 10 viable cells mL with astrocyte medium and plate the cells into culture vessels at 2 5 x 10 cm Incubate the cells in a 37 C incubator with 5 CO and 90 humidity Change the astrocyte medium the next day and then every other day until cells are confluent When confluent feed the cells with astrocyte medium containing 0 25 mM dBcAMP to induce differentiation Dilute 0 25 M stock of dBcAMP 1 1 000 in astrocyte medium Feed the cultures with dBcAMP two times per week and check for differentiation Astrocytes are ready for experiments 2 3 weeks after culturing Gibco Neurobiology Protocols Handbook 37 Isolation Culture and Characterization of Cortical and Hippocampal Neurons Isolation Culture and Characterization of Cortical and Hippocampal Neurons Summary Required Materials The ability to culture primary neurons under serum free conditions facilitates tighter control of neuronal studies Some serum free media and supplements allow for the low density neuronal cultures which in turn enables the study of individual neurons and synapses This has not been possible using serum supplemented media without a feeder layer of glial cells In serum supplemented media glial cells continue to multiply necessitating the use of cytotoxic mitotic in
93. ls Nat Biotechnol 23 215 221 Gibco Neurobiology Protocols Handbook 7 Neural Cell Types in Neurological Diseases Molero A E Gokhan S Gonzalez S et al 2009 Impairment of developmental stem cell mediated striatal neurogenesis and pluripotency genes in a knock in model of Huntington s disease Proc Natl Acad Sci U S A 106 21900 21905 Park C H Minn Y K Lee J Y et al 2005 In vitro and in vivo analyses of human embryonic stem cell derived dopamine neurons J Neurochem 92 1265 1276 Perrier A L Tabar V Barberi T et al 2004 Derivation of midbrain dopamine neurons from human embryonic stem cells Proc Natl Acad Sci U S A 101 12543 12548 Roy N S Cleren C Singh S K et al 2006 Functional engraftment of human ES cell derived dopaminergic neurons enriched by coculture with telomerase immortalized midbrain astrocytes Nat Med 212 1259 1268 Yan Y Yang D Zarnowska E D et al 2005 Directed differentiation of dopaminergic neuronal subtypes from human embryonic stem cells Stem Cells 23 781 790 Neural Cell Culture and Differentiation Neural Cell Culture and Differentiation Culturing Human Neural Stem Cells Summary Required Materials Neural stem cells NSC are valuable resources because of their ability to differentiate into neurons and glial cells with applications in neuroscience and clinical use for treatment of neurodegenerative disease and neurological disorders NSC are
94. ls immediately prior to use Use RNase free pipette tips with aerosol barriers Prepare RNA Lysis Solution by adding 10 uL B mercaptoethanol per mL of RNA Lysis Solution Remove media from T 25 flasks rinse once with Dulbecco s phosphate buffered saline D PBS and treat cells with 1 mL of pre warmed TrypLE reagent for 10 minutes at 37 C Harvest the cells and place them into 15 mL centrifuge tubes Take 100 uL of the sample and obtain a viable cell count Centrifuge the cells in a tabletop centrifuge for 7 minutes at 100 x g Discard the supernatant Freeze the cells overnight in a 70 C freezer Allow the cell pellet to thaw Add 0 5 mL of RNA Lysis Solution for each T 25 flask harvested for the pellet 0 5 mL per 2 x 10 5 x 10 cells Pipet the cells 20 times until the pellet is disrupted Transfer 0 5 mL of cell lysis solution to 1 5 mL RNase free microcentrifuge tubes and centrifuge at room temperature for 2 minutes at 12 000 x g 12 000 rpm Add 0 5 mL of 7076 ethanol to each tube and vortex the suspension 5 10 times Apply a 600 uL aliquot of sample to the RNA Spin Cartridge Centrifuge at room temperature for 15 30 seconds at 12 000 x g then discard the flow through Continue applying 600 uL aliquots of the same RNA sample to the spin cartridge until the entire sample has been processed Add 700 uL Wash Buffer I to the spin cartridge and centrifuge at room temperature for 15 30 seco
95. m 1X 97 mL GlutaMAX I Supplement 2mM 1mL N 2 Supplement 196 1mL FBS 196 1mL Matrix for Oligodendrocyte Differentiation 1 Prepare a 1 500 dilution of poly L ornithine in distilled water for a final concentration of 20 ug mL Add 2 mL of 20 ug mL poly L ornithine solution to a 35 mm dish 0 5 mL for 4 well plate or slide 0 25 mL for 8 well slide Incubate the culture vessel at 37 C in a humidified atmosphere of 5 CO for at least 1 hour Rinse the culture vessel once with distilled water Prepare a 1 1 000 dilution of laminin in distilled water for a final concentration of 1 pg mL Gibco Neurobiology Protocols Handbook 33 Differentiating Glial Precursor Cells into Astrocytes and Oligodendrocytes Differentiation of GRPs Matrix for Astrocyte Differentiation N 1 Add 2 mL of 1 ug mL laminin solution to a 35 mm dish 0 5 mL for 4 well plate or slide 0 25 mL for 8 well slide Incubate the culture vessel at 37 C in a humidified atmosphere of 5 CO for at least 1 hour Store it at 4 C until use Note You may coat the plates in advance and store them at 2 8 C wrapped tightly with Parafilm for up to 4 weeks TM Thaw the Geltrex bottle at 4 C overnight to prevent polymerization The next day prepare a 50X stock solution of Geltrex by diluting to a final concentration of 10 mg mL with D MEM F 12 Use an ice bucket to keep the bottle at 4 C Quickly prepare 1 mL ali
96. nd adjust the ratio according to the appearance of the hESC colonies If the cells look healthy and colonies have enough space split them using the same ratio as the previous passage If the cells are overly dense and crowded increase the split ratio if the cells are sparse decrease the ratio Generally hESCs need to be split every 4 10 days based upon their appearance Two days prior to passaging your hESC culture prepare fresh MEF culture vessels Remove the culture vessel containing hESCs from the incubator Mark differentiated colonies under a microscope using a microscopy marker and remove them by aspirating with a Pasteur pipette in the culture hood Add an appropriate amount of pre warmed hESC medium into each culture vessel 2 mL for each 60 mm dish or 4 mL for each 100 mm dish Roll the StemPro EZPassage Disposable Stem Cell Passaging Tool across the entire vessel in one direction left to right Rotate the culture vessel 90 degrees and roll the tool across the entire dish again Using a cell scraper gently detach the cells off the surface of the culture vessel Gently transfer the cell clumps into a 15 or 50 mL conical tube using a 5 mL pipette Rinse the culture vessel with an appropriate amount of pre warmed hESC medium 1 mL for each 60 mm dish or 2 mL for each 100 mm dish to collect remaining cells If some cell clumps are too big pipet the cell solution up and down several times using
97. nd measuring green fluorescence emission for calcein i e 530 30 bandpass and red fluorescence emission for EthD 1 i e 610 20 bandpass Gate on cells to exclude debris Using single color stained cells perform standard compensation The population should separate into two groups live cells will show green fluorescence and dead cells will show red fluorescence Figure 1 Figure 1 Flow cytometry viability assay using the LIVE DEAD Viability Cytotoxicity Kit A 1 1 mixture of live and ethanol fixed human B cells was stained with calcein AM and EthD 1 following the protocol provided Flow cytometry analysis was performed with excitation at 488 nm The resulting bivariate frequency distribution shows the clear separation of the green fluorescent 530 nm live cell population from the red fluorescent 585 nm dead cell population 10 4 Dead cells 10 4 Red fluorescence 10 3 h Live cells 10 oo ESO 10 10 10 10 10 Green fluorescence Markers for Characterizing Neural Subtypes Summary Neural Stem Cell Culture and Differentiation After cells are isolated from tissue or differentiated from pluripotent precursors the resulting population needs to be characterized to confirm whether the target population has been obtained This chapter lists cell type specific antibody markers commonly used for immunocytochemical ICC and flow cytometric analysis of neural subtypes Cell type Specific A
98. ndbook 79 RNA Isolation and cDNA Preparation from Neural Stem Cells 4 While the tube is on ice add the following components to the tube Component Amount 2X First Strand Reaction Mix 10 uL SuperScript III RNaseOUT Enzyme mix 2 uL 5 Vortex the sample briefly and collect the contents by brief centrifugation 6 Incubate the tube at 25 C for 10 minutes 7 Incubate the tube at 42 C for 50 minutes 8 Terminate reaction by incubating at 85 C for 5 minutes then chill the tube on ice 9 Add 1 uL of RNAse H to the sample and incubate at 37 C for 20 minutes 10 Store the cDNA samples at 20 C 80 Molecular Characterization Characterizing Neural Cells by qPCR Summary Required Materials Quantitative polymerase chain reaction qPCR is one of the most accurate and sensitive methods for studying gene regulation and can be used to measure the expression levels of specific genes in neural stem cells NSCs These genes can be used to characterize the NSCs and their respective sublineages Here we provide guidelines and a general protocol for performing qPCR using the Applied Biosystems 7300 Real Time PCR System and Platinum SYBR Green qPCR SuperMix UDG with ROX Reference Dye Starting Material Media and Reagents Special Tools Methods cDNA generated from total RNA isolated from neural stem cells NSCs see Chapter 20 RNA Isolation and cDNA Preparation from Neural Stem Cells
99. nds at 12 000 x g Discard the flow through and the tube Place the spin cartridge into a clean 2 mL RNA Wash Tube Add 500 uL Wash Buffer II containing ethanol to the spin cartridge and centrifuge at room temperature for 15 30 seconds at 12 000 x g Discard the flow through Centrifuge for 1 minute to dry the cartridge Place the cartridge into an RNA Recovery Tube Add 40 uL of RNase free water to the cartridge and let it stand for 1 minute Centrifuge the cartridge at room temperature for 2 minutes at 12 000 x g Add an additional 40 uL of RNase free water to the cartridge and repeat the step Yield should be about 60 300 ug total RNA Note Always allow time for the RNase free water to percolate into the cartridge bed Do not spin the cartridge immediately because it may result in partial recovery and alter the yield of RNA To recover more RNA add an additional 40 uL of RNase free water to the cartridge and repeat the last step for a third time Molecular Characterization Determining RNA Quality 1 Measure ratio of absorbance at 260 nm and 280 nm by analyzing 1 uL of the RNA RNA Storage cDNA Preparation sample using a NanoDrop spectrophotometer Conduct readings three times and use the average as the final value Wipe down the analysis stage with a lab tissue wetted with DEPC water before and after measuring each RNA sample The A360 280 of pure RNA is 2 Note The yield and quality of the isolated RNA depends on the type and
100. neuralculture Headquarters a 5791 Van Allen Way Carlsbad CA 92008 USA Phone 1 760 603 7200 Toll Free in USA 800 955 6288 m For support visit www invitrogen com support or email techsupport dinvitrogen com technologies www lifetechnologies com C017508 MAN0O003589 Rev 02 2011
101. neuron cultures Neurobasal complete medium requires additional supplementation with 25 uM L Glutamate up to the fourth day of culture Gibco Neurobiology Protocols Handbook 39 Isolation Culture and Characterization of Cortical and Hippocampal Neurons Preparing Matrix Coating Culture Vessels with Poly D Lysine 1 2 Isolating Neurons Prepare a 2 mg mL poly D lysine stock solution in distilled water Dilute the poly D lysine stock solution 1 40 in D PBS to prepare a 50 ug mL working solution i e 125 uL of poly D lysine stock solution into 5 mL of D PBS Coat the surface of the culture vessel with the working solution of poly D lysine 150 uL cm i e 100 uL per well for a 48 well plate Incubate the culture vessel at room temperature for 1 hour Remove the poly D lysine solution and rinse 3 times with distilled water Make sure to rinse the culture vessel thoroughly because excess poly D lysine can be toxic to the cells Leave the coated vessels uncovered in the laminar hood until the wells have completely dried You may use the dry plates immediately or store them at 4 C wrapped tightly with Parafilm for up to one week N 10 40 Dissect cortex or hippocampus pairs from ten E 18 rat embryo brains Remove all the meninges thoroughly Collect all the tissue in a conical tube containing Hibernate E supplemented with 2 B 27 Serum Free Supplement and 0 5 mM Gluta
102. ng components The medium can be stored at 4 C for 1 week and add ascorbic acid solution before use Component Amount Neurobasal Medium 98 mL L Glutamine 1mL B 27 Supplement 2mL FBS 1mL Ascorbic Acid Solution 0 1 mL Gibco Neurobiology Protocols Handbook 55 Derivation of Dopaminergic Neurons from Midbrains of Rodents Preparing Matrix Matrix for Midbrain Neural Cell Culture 1 N Prepare a 1 500 dilution of poly L ornithine in distilled water for a final concentration of 20 ug mL Add 2 mL of 20 ug mL poly L ornithine solution to a 35 mm dish 0 5 mL for a 4 well plate or slide 0 25 mL for a 8 well slide Incubate the culture vessel at 37 C in a humidified atmosphere of 5 CO for at least 2 hours Rinse the culture vessel once with distilled water Prepare a 1 100 dilution of laminin in distilled water for a final concentration of 10 pg mL Add 2 mL of 10 ug mL laminin solution to a 35 mm dish 0 5 mL for a 4 well plate or slide 0 25 mL for a 8 well slide Incubate the culture vessel at 37 C in a humidified atmosphere of 5 CO for at least 2 hours Store at 4 C until use Note You may coat the plates in advance and store them at 2 8 C wrapped tightly with Parafilm for up to 4 weeks Isolating and Culturing Precursor Cells from the Ventral Midbrain 56 Collecting Embryos 1 Except for the initial steps of
103. no PHG0314 e CELLstart CTS Cat no A10142 01 Geltrex Reduced Growth Factor Basement Membrane Matrix Cat no 12760 Poly L Ornithine Sigma Cat no P3655 Laminin Cat no 23017 Dibutyryl cAMP Sigma Cat no D0627 T3 Sigma Cat no D6397 EM grade paraformaldehyde Electron Microscopy Services Cat no 19208 ProLong Gold antifade reagent Cat no P36930 Gibco Neurobiology Protocols Handbook 23 Differentiating Neural Stem Cells into Neurons and Glial Cells 24 Primary Antibodies Secondary Antibodies Lineage marker Antigen Concentration Subtypes Reactivity NSC Nestin 1 1 000 Rabbit Hu Rt Ms Sox2 1 200 Mouse Ig6 Hu Neuron Dcx 1 400 Rabbit Hu Rt Ms MAP2 1 200 Mouse IgG Hu Rt Ms Glial A2B5 1 100 Mouse IgM Hu Rt Ms CD44 1 50 Mouse IgG Hu Oligodendrocyte GalC 1 200 Mouse IgG Hu Rt Ms Astrocyte GFAP 1 200 Rabbit Hu Rt Ms Hu human Rt rat Ms mouse Ex Em color Alexa no 2nd host 2nd against Cat no Concentration Goat Mouse IgM A31552 1 1 000 Goat Mouse IgG A21049 1 000 346 442 Blue 350 Goat Rat IgG A21093 1 000 Goat Rabbit IgG A21068 1 1 000 Donkey Goat IgG A21081 1 000 Goat Mouse IgM A21042 1 1 000 Goat Mouse IgG A11029 1 000 Anica ered m Goat Rat IgM A21212 1 000 Goat Rat IgG A11006 1 1 000 Goat Goat IgG A11034 1 000 Donkey Mou
104. nter of each marked colony blow off the cells in rosettes Use a 10 mL pipette to transfer the detached cell clumps into a 50 mL centrifuge tube Note You can combine the cell clumps from five 100 mm dishes into one 50 mL tube Centrifuge the cells for 3 minutes at 200 x g N DA Neuron Differentiation 1 10 11 Neural Cell Culture and Differentiation Aspirate the supernatant and resuspend the cell clumps in 40 mL of neural expansion medium containing 100 ng mL FGF 8b and 200 ng mL SHH Transfer the cell clumps to a T 75 flask and place the flask in a 37 C incubator with a humidified atmosphere of 5 CO The rosettes will roll up to form neurospheres after about 1 day in the incubator Replace half of the neural expansion medium containing 100 ng mL FGF 8b and 200 ng mL SHH with fresh medium every other day Note Contaminating non neural cells tend to attach to the flask When changing the medium set the flask down at a tilted angle to allow the neurospheres to settle in one corner of the flask Aspirate half of the neural expansion medium and use a 10 mL pipette to transfer the neurospheres with the rest of the spent neural expansion medium to a fresh T 75 flask Add 20 mL of pre warmed fresh neural expansion medium to the flask and incubate in a 37 C incubator with a humidified atmosphere of 5 CO You can perform this procedure several times to purify the neural cells Coat the surface of the cul
105. ntibodies for Characterizing Neural Subtypes Cell type Antigen Type ICC dilution Neural stem cells Sox1 Goat IgG 10 pg mL Sox2 Mouse IgG 2 ug mL Nestin Mouse IgG 1 500 CD133 Rabbit IgG 1 100 Neuronal progenitors MAP2 Mouse IgG 1 200 al HuC D Mouse IgG 10 pg mL NF Mouse IgG 1 100 NCAM Mouse IgG 1 50 BIII tubulin Mouse IgG 1 2 000 Dcx Rabbit IgG 1 200 Dopaminergic neurons TH Rabbit IgG 1 1 000 Motoneurons Isl Mouse IgG 1 50 HB9 Mouse IgG 1 50 GABAergic Glutaminergic neurons GABA Rabbit IgG 2 000 Cholinergic neurons ChAT Goat IgG 1 100 Astrocyte progenitors CD44 Mouse IgG 1 50 Hine GFAP Rat IgG 1 100 GFAP Rabbit IgG 1 200 Oligodendrocyte progenitors GalC Mouse IgG 1 200 Oligodendrocytes NG Mouse IgG 150 A2B5 Mouse IgM 1 2 000 04 Mouse IgM 1 50 Proliferation Ki67 Rabbit IgG 1 50 EdU Chemicals 1 1 000 Isotype control Mouse IgM and IgG Use as is Rabbit IgG Use as is These are recommended starting concentrations for ICC applications optimal working concentrations must be determined empirically Gibco Neurobiology Protocols Handbook 67 Surface Marker Analysis by Flow Cytometry Surface Marker Analysis by Flow Cytometry Summary Required Materials Flow cytometry is a technique for counting particles using electronic detection apparatus and is often used to collect quantitative information about cell populations The t
106. nto the cell DNA mixture Slowly release the push button on the pipette to aspirate the cell DNA mixture into the Neon Tip Insert the Neon Pipette with the sample vertically into the Neon Tube placed in the Neon Pipette Station until you hear a click indicating that the pipette has locked in position Ensure that you have entered the appropriate electroporation parameters and press Start on the Neon touchscreen The Neon device delivers the electric pulse according to the parameters entered in step 5 and the touchscreen displays Complete to indicate that electroporation is complete Remove the Neon Pipette from the Neon Pipette Station and immediately transfer the samples from the Neon Tip into the prepared culture plate containing the appropriate pre warmed complete growth medium without antibiotics Discard the Neon Tip into an appropriate biological hazardous waste container Repeat Steps 10 14 for the remaining samples Gently rock the plate to assure even distribution of the cells Incubate the plate at 37 C in a humidified 5 CO incubator Assay the samples to determine the transfection efficiency e g fluorescence microscopy or functional assay Gibco Neurobiology Protocols Handbook 87 Transfecting Neural Cells Using the Neon Transfection System Expected Results Human Neural Stem Cells GIBCO Human Neural Stem Cells Cat no N7800 100 cultured in StemPro NSC SFM complete medium were transfect
107. obtained by isolation from tissue or differentiated from pluripotent cells This chapter describes methods for expanding human NSC in cell culture and their subsequent characterization Cells Reagents Human neural stem cells e g Cat no N7800 100 StemPro NSC SFM Cat no A10509 01 B Mercaptoethanol Cat no 21985 GlutaMAX I Cat no 35050 CELLstart CTS Cat no A10142 01 Fibronectin Cat No 33016 015 Water distilled Cat no 15230 Dulbecco s Phosphate Buffered Saline D PBS without Ca and Mg Cat no 14190 Dulbecco s Phosphate Buffered Saline D PBS Cat no 14040 StemPro Accutase Cell Dissociation Reagent Cat no A11105 TrypLE Express Stable Trypsin Replacement Enzyme Cat no 12604 013 Gibco Neurobiology Protocols Handbook 9 Culturing Human Neural Stem Cells Preparing Media StemPro NSC SFM Complete Medium StemPro NSC SFM complete medium consists of KnockOut D MEM F 12 with StemPro Neural Supplement bFGF EGF and GlutaMAX I Complete medium is stable for 4 weeks when stored in the dark at 2 8 C To prepare 100 mL of complete medium 1 Reconstitute bFGF and EGE with 0 1 BSA solution in KnockOut D MEM F 12 at a concentration of 100 ug mL You will need 20 uL of each per 100 mL of complete medium Freeze unused portions in aliquots 2 Mix the following components under aseptic conditions For larger volumes increase the component amounts proportion
108. oduct that does not meet those specifications This warranty limits the Company s liability to only the price of the product No warranty is granted for products beyond their listed expiration date No warranty is applicable unless all product components are stored in accordance with instructions The Company reserves the right to select the method s used to analyze a product unless the Company agrees to a specified method in writing prior to acceptance of the order Invitrogen makes every effort to ensure the accuracy of its publications but realizes that the occasional typographical or other error is inevitable Therefore the Company makes no warranty of any kind regarding the contents of any publications or documentation If you discover an error in any of our publications please report it to our Technical Support Representatives Life Technologies Corporation shall have no responsibility or liability for any special incidental indirect or consequential loss or damage whatsoever The above limited warranty is sole and exclusive No other warranty is made whether expressed or implied including any warranty of merchantability or fitness for a particular purpose The trademarks mentioned herein are the property of Life Technologies Corporation or their respective owners 2011 Life Technologies Corporation All rights reserved For research use only Not intended for any animal or human therapeutic or diagnostic use www invitrogen com
109. of interest Carefully dissect and remove the overlying scalp tissue to isolate the brain Place the isolated brain in a clean 60 mm petri dish containing dissection buffer on ice Stabilize the brain with forceps near the forebrain or hindbrain regions carefully remove and discard the fore and hindbrain regions using a scalpel or microscissors Make the rostral cut close to the forebrain vesicles and thalamic region and the caudal cut at the isthmus region Steady the obtained midbrain tube with forceps exclusively at the posterior midbrain region marked by the convex curvature at the dorsal midline Use small microscissors or the very tip of a curved scalpel blade to gradually dissect open the midbrain tube along the dorsal midline Carefully open the now characteristically butterfly shaped tissue flap Use forceps to thoroughly remove any remaining overlying meningeal tissue Trim the outermost most dorsal areas of the midbrain tube by dissecting away two thirds of the tissue on each side approximately lateral posterior to the sulcus limitans as an anatomical landmark Transfer the resulting tissue piece 0 3 mm x 1 0 mm in dimension into a conical tube containing cold dissection buffer kept on ice Use 0 2 to 0 5 mL of buffer volume for each piece of VM tissue Wash the pieces of VM tissue in cold dissection buffer e g 15 mL of buffer in a 15 mL conical tube by letting the tissue pieces sink to the
110. ology of rat fetal NSCs in adherent or neurosphere suspension cultures Cells Media and Reagents Special Tools e GIBCO Rat Fetal Neural Stem Cells Cat no N7744 100 or homogenous cell preparation from 14 18 days post coitum rat brain tissue Dulbecco s Phosphate Buffered Saline D PBS Cat no 14040 Dulbecco s Phosphate Buffered Saline D PBS without calcium or magnesium Cat no 14190 e StemPro NSC SFM Cat no A10509 01 e StemPro Accutase Cell Dissociation Reagent Cat no A11105 01 e CELLstart CTS Cat no A10142 01 Trypan blue Cat no 15250 included with the Countess or the LIVE DEAD Cell Vitality Assay Kit Cat no L34951 e Countess Automated Cell Counter Cat no C10227 or hemacytometer Gibco Neurobiology Protocols Handbook 15 Culturing Rat Fetal Neural Stem Cells Preparing Media Medium for Expanding Neural Stem Cells StemPro NSC SFM complete medium consists of KnockOut D MEM F 12 with StemPro Neural Supplement bFGF EGF and GlutaMAX I Complete medium is stable for 4 weeks when stored in the dark at 2 8 C To prepare 100 mL of complete medium 1 Reconstitute bFGF and EGE with 0 1 BSA solution in KnockOut D MEM F 12 at a concentration of 100 pg mL You will need 20 uL of each per 100 mL of complete medium Freeze unused portions in aliquots 2 Mix the following components under aseptic conditions For larger volumes increase the component amounts
111. om each other in their differentiation abilities their cytokine responses and their surface antigen characteristics Gibco Neurobiology Protocols Handbook 3 Neural Stem Cells and Neural Development Rationale for Studying Neural Stem Cells Stem Cells and Cancer Neural Development Neurological disorders especially neurodegenerative disorders are at the top of the list of diseases that have been suggested as targets for stem cell therapy Despite the enthusiasm for the use of stem cells in neurological disorders a thorough characterization of NSCs and a better understanding of neural patterning and the generation of all three major cell types that constitute the central nervous system i e neurons astrocytes and oligodendrocytes as well as the microenvironments that can support them is crucial to increase the likelihood of clinical success An exciting finding has been the discovery that many cancers may be propagated by a small number of stem cells present in the tumor mass This was first described in breast cancers and subsequently in a variety of solid tumors Several reports have suggested that cancer stem cells can be identified in the nervous system as well and that these cells bear a remarkable similarity to neural stem cells present in early development Likewise cells resembling glial progenitors have been isolated from some glial tumors suggesting an intriguing link between developmental and cancer biology St
112. ombination J Neurosci Res 35 567 576 Gibco Neurobiology Protocols Handbook 43 Derivation of Dopaminergic Neurons from Human Embryonic Stem Cells Derivation of Dopaminergic Neurons from Human Embryonic Stem Cells Summary Directed differentiation of specific lineages has been a focal point in the field of human embryonic stem cell hESC research Cell replacement therapy using hESCs have the potential for treating Parkinson s disease and other neurodegenerative disorders This chapter describes the procedure for the derivation of dopaminergic DA neurons from hESCs Required Materials Cells Media and Reagents 44 GIBCO Mouse Embryonic Fibroblasts MEF irradiated Cat no 81520 100 Human embryonic stem cells hESC Dulbecco s Phosphate Buffered Saline D PBS without Ca and Mg Cat no 14190 D MEM F 12 with GlutaMAX I Cat no 10565 018 Neurobasal Medium Cat no 21103 049 Knockout Serum Replacement Cat no 10828 028 1096 Bovine Serum Albumin BSA Cat no P2489 Fetal Bovine Serum FBS Cat no 16000 044 Dulbecco s Modified Eagle Medium D MEM Cat no 10569 010 Non essential Amino Acids Solution NEAA Cat no 11140 B 27 Supplement without Vitamin A Cat no 12587 010 N 2 supplement Cat no 17502 048 B Mercaptoethanol Cat no 21985 023 Attachment Factor Cat no S 006 100 Natural Mouse Laminin Cat no 23017 015 StemPro Accutase Cell Dissociat
113. on of CELLStart CTS 14 mL for T 75 7 mL for T 25 3 5 mL for 60 mm dish 2 mL for 35 mm dish Incubate the culture vessel at 37 C in a humidified atmosphere of 5 CO in air for 1 hour Remove the vessel from the incubator and store it until use Immediately before use remove all CELLStart CTS solution and replace it with complete StemPro NSC SFM Note You may coat the plates in advance and store them at 4 C wrapped tightly with Parafilm for up to 2 weeks Do not remove CELLStart CTS solution until just prior to use Make sure the plates do not dry out Thaw the Geltrex bottle at 4 C overnight to prevent polymerization The next day dilute Geltrex 1 2 with D MEM F 12 at 4 C to make 100X stock solution using an ice bucket to keep the bottles cold Quickly prepare 0 5 mL aliquots in 50 mL conical tubes pre chilled on ice and store the tubes at 20 C TM Thaw 1 tube of Geltrex 0 5 mL aliquoted as above slowly at 4 C and add 49 5 mL of cold D MEM F 12 1 100 dilution Mix gently Cover the whole surface of each culture plate with the Geltrex solution 1 5 mL for a 35 mm dish 3 mL for 60 mm dish 5 mL for a T 25 culture flask Seal each dish with Parafilm to prevent drying and incubate 1 hour at room temperature in a laminar flow hood Immediately before use remove all Geltrex solution wash once with D PBS with calcium and magnesium and replace pre warmed complete m
114. or cells at high densities as this may affect the cell survival after electroporation After electroporation immediately plate the cells into prewarm culture medium without antibiotics Multiple use of the same Neon Tip Do not use the same Neon Tip for electroporation for more than 2 times because the repeated application of electric pulses reduce the tip quality and impair their physical integrity Low transfection efficiency Poor plasmid DNA quality or the plasmid DNA is low Use high quality plasmid DNA for transfection e Start with 0 5 ug plasmid DNA per sample Incorrect cell density Use the recommended cell densities of 1 x 10 cells per 10 uL per sample i e 1 x 107 cells mL Incorrect electroporation parameters Use the recommended voltage pulse width and pulse number We recommend optimizing the electroporation parameters using the preprogrammed 24 well optimization protocol available on the Neon unit Mycoplasma contaminated cells Test cells for Mycoplasma contamination Start a new culture from a fresh stock Nonreproducible transfection efficiency Inconsistent cell confluency or passage number Always use cells with low passage number and harvest cells with comparable confluency levels Multiple use of the same Neon Tip or the same Neon Tube e Do not use the same Neon Tip for more than 2 times because the repeated application of electric pulses reduce
115. ors appropriate for your neural cell line Plasmid DNA of interest 1 5 ug mL in deionized water or TE e Dulbecco s Phosphate Buffered Saline D PBS 1X liquid without Ca and Mg Cat no 14190 144 Neon Transfection system Cat no MPK5000 e Neon Kit 10 uL Cat no MPK1096 or Neon Kit 100 uL Cat no MPK10096 Appropriate tissue culture plates and supplies Culture Conditions Transfection The following table summarizes the culture conditions for various neural cell lines including neural stem cells For detailed instructions on culturing and passaging these cells refer to the to the instructions supplied with the specific cell line you are using Cell type Media Culture conditions Human Neural Stem Cells Complete StemPro NSC SFM e Adherent culture on CELLStart fibronectin or poly L ornithine coated culture vessels 37 C humidified atmosphere of 5 CO in air Exchange spent medium every other day Human Astrocytes Complete GIBCO Astrocyte Medium e Adherent culture on Geltrex coated tissue culture vessels 37 C humidified atmosphere of 596 CO in air Exchange spent medium every 3 4 days Rat Fetal Neural Stem Cells Complete StemPro NSC SFM e Adherent culture on CELLStart fibronectin or poly L ornithine coated culture vessels 37 C humidified atmosphere of 5 CO in air Exchange spent medium every 3 4 days Rat Primary Cortical Astroc
116. ot be maintained for more than 3 passages Important If you are re feeding rat fetal NSC in a growth medium other than complete StemPro NSC SFM ensure that the medium is supplemented with 10 ng mL bFGF to maintain the undifferentiated state of the rat fetal NSCs Resuspend the rat fetal NSCs as follows For freshly prepared rat fetal NSCs after rinsing with D PBS resuspend in warmed complete StemPro NSC SFM at a cell density of 1 x 10 viable cells mL For thawed rat fetal NSCs after determining the viable cell count resuspend in warmed complete StemPro NSC SFM at a cell density of 1 x 10 viable cells mL Plate the rat fetal NSCs onto uncoated or low attachment culture vessels at a density of 2 x 10 viable cells cm See the table below for recommended seeding densities Vessel size Growth area Volume of media No of cells 96 well plate 0 32 cm well 0 1 mL 6 4 x 104 24 well plate 1 9 cm wel 0 5 mL 3 8 x 10 12 well plate 3 8 cm wel 1mL 7 6 x 10 35 mm dish 8 cm well 2mL 1 6 x 10 6 well plate 9 6 cm wel 2mL 1 9 x 10 60 mm dish 19 5 cm 5mL 3 9 x 10 T 25 flask 25 cm 5mL 5 0 x 105 100 mm dish 55 cm 10 mL 1 1 x 107 Neural Cell Culture and Differentiation 3 Add the appropriate volume of cells to each culture vessel and incubate at 37 C 5 CO and 90 humidity 4 Carefully re feed the neurosphere suspension of rat fetal NSCs every 2 3 days with 1
117. page 77 Platinum SYBR Green qPCR SuperMix UDG Cat nos 11733 038 11733 046 e SuperScript VILO cDNA Synthesis Kit Cat nos 11754 050 11754 250 e TRIzol Reagent Cat nos 15596 018 15596 026 Custom primers www invitrogen com oligos Applied Biosystems 7300 Real Time PCR System or similar instrument e 0 2 mL microcentrifuge tubes or 96 well or 384 well PCR plates Vortex mixer Microcentrifuge Template Preparation Real Time PCR Instruments For qPCR prepare a 1 10 dilution series of cDNA generated from 10 pg 1 ug of total RNA using the protocol described in Chapter 20 RNA Isolation and cDNA Preparation from Neural Stem Cells page 77 Platinum SYBR Green qPCR SuperMix UDG can be used with a variety of real time instruments including but not limited to the following Applied Biosystems instruments 7300 and 7500 Real Time PCR Systems PRISM 7000 7700 and 7900HT and GeneAmp 5700 Optimal cycling conditions will vary with different instruments Gibco Neurobiology Protocols Handbook 81 Characterizing Neural Cells by qPCR 82 Primer Design ROX Reference Dye Protocol for qPCR Primer design is one of the most important parameters when using a SYBR Green qPCR detection system We strongly recommend using a primer design program such as OligoPerfect available at www invitrogen com oligos or Vector NTI Advance software When designing primers the amplicon length should be approxim
118. pean Headquarters 5791 Van Allen Way LOOP X Bldg 6F Inchinnan Business Park Carlsbad CA 92008 3 9 15 Kaigan 3 Fountain Drive USA Minato ku Tokyo 108 0022 Paisley PA4 9RF Phone 1 760 603 7200 Japan UK Fax 1 760 602 6500 Phone 81 3 5730 6509 Phone 44 141 814 6100 Email Fax 81 3 5730 6519 techsupport alifetech com Email jpinfo invitrogen com Fax 44 141 8146260 PP i HR a Email Tech eurotech dinvitrogen com SDS Certificate of Analysis Safety Data Sheets SDSs are available at www invitrogen com sds The Certificate of Analysis provides detailed quality control and product qualification information for each product Certificates of Analysis are available on our website Go to www invitrogen com support and search for the Certificate of Analysis by product lot number which is printed on the product packaging tube pouch or box Gibco Neurobiology Protocols Handbook 107 Limited Warranty 108 Invitrogen a part of Life Technologies Corporation is committed to providing our customers with high quality goods and services Our goal is to ensure that every customer is 10076 satisfied with our products and our service If you should have any questions or concerns about an Invitrogen product or service contact our Technical Support Representatives All Invitrogen products are warranted to perform according to specifications stated on the certificate of analysis The Company will replace free of charge any pr
119. pups with ether in a desiccator in a chemical fume hood 3 Remove pups from the hood and spray 70 ethanol over the animal Decapitate the animals with scissors Open the skull with iridectomy scissors Remove the meninges and dissect the brain tissue from the cortices 4 Put the cortices in a petri dish containing 5 10 mL of ice cold HBSS Pool the cortices from two pups in a new petri dish and wash with 5 mL of HBSS 36 N 10 11 12 13 14 15 16 17 Neural Cell Culture and Differentiation Take the petri dish to a laminar flow hood Mince the cortices into small pieces with a scissors in a petri dish containing about 5 mL of ice cold HBSS Transfer the tissue to a 15 mL sterile tube Centrifuge the tube at 200 x g for 3 minutes at 4 C and aspirate the supernatant Resuspend the tissue in 5 mL of 0 05 trypsin and incubate at 37 C for 25 minutes in a shaker bath Centrifuge the tissue suspension at 200 x g for 3 minutes aspirate the trypsin solution with a pipette and rinse the cells 3 times with 3 mL of HBSS Add 6 mL of astrocyte medium and pipet the cell suspension up and down with a 10 mL pipette to dissociate cells Filter the cell suspension through a 70 um mesh cell strainer into a 50 mL sterile tube Rinse the mesh with another 4 mL of astrocyte medium total of 10 mL suspension Remove 10 uL of the filtrate for counting on a hemacytometer or the Countess Automated Ce
120. quots in 50 mL conical tubes pre chilled on ice and store the tubes at 20 C TM Thaw one tube of Geltrex 1 mL aliquot described above slowly at 4 C and add 49 mL of cold D MEM F 12 Mix gently Cover the whole surface of each culture plate with the Geltrex solution 1 5 mL for a 35 mm dish 3 mL for 60 mm dish 5 mL for a T 25 culture flask Seal each dish with Parafilm to prevent drying and incubate 1 hour at room temperature in a laminar flow hood Store at 4 C until use Immediately before use remove all Geltrex solution wash once with D PBS with calcium and magnesium and replace it with pre warmed complete medium Note You may store the Geltrex treated dish at 2 8 C wrapped tightly with Parafilm for up to 1 month Ensure that plates do not dry out Do not remove the Geltrex solution until just prior to use 34 Differentiation to Oligodendrocytes Differentiation to Astrocytes 1 1 Plate glial precursor cells on poly L ornithine and laminin coated plate in StemPro NSC SFM at a density of 2 5 x 10 5 x 10 cells cm Culture the cells for 2 days then change the medium to Oligodendrocyte Differentiation Medium Change the medium every 3 4 days Plate glial precursor cells on Geltrex coated plate in StemPro NSC SFM at a density of 2 5 x 10 cells cm Culture the cells for 2 days then change th emedium to Astrocyte Differentiation Medium Chang
121. racellular esterase activity and plasma membrane integrity The polyanionic dye calcein AM is well retained within live cells producing an intense uniform green fluorescence in live cells excitation emission 495 nm 515 nm while ethidium homodimer 1 EthD 1 enters cells with damaged membranes to produce a bright red fluorescence in dead cells excitation emission 4495 nm 635 nm Protocols are provided for fluorescence microscopy or microplate analysis of adherent cells or flow cytometry analysis of cells in suspension Cells Media and Reagents Special Tools Preparing Reagents Adherent or suspended NSCs e LIVE DEAD Viability Cytotoxicity Assay Kit Cat no L 3224 Calcein AM Ethidium homodimer 1 EthD 1 Dulbecco s Phosphate Buffered Saline D PBS Cat no 14040 Fluorescence microscope Note Calcein and EthD 1 can be viewed simultaneously with a conventional fluorescein longpass filter The fluorescence from these dyes may also be observed separately calcein can be viewed with a standard fluorescein bandpass filter and EthD 1 can be viewed with filters for propidium iodide or Texas Red dye 64 Prepare the reagents in the LIVE DEAD Viability Cytotoxicity Assay Kit as follows Remove the stock solutions provided in the kit from the freezer and allow them to warm to room temperature Methods Cell Analysis 2 Add 20 uL of the supplied 2 mM EthD 1 stock solution Component B
122. ree Supplement Cat no 17504 044 N 2 Supplement Cat no 17502 048 T3 Liothyronine Sigma Cat no T6397 FBS Cat no 16000 Geltrex Reduced Growth Factor Basement Membrane Matrix Cat no 12760 Laminin Cat no 23017 Poly L Ornithine Sigma Cat no P4957 Water distilled Cat no 15230 KnockOut D MEM F 12 Cat no 12660 Dulbecco s Phosphate Buffered Saline D PBS without Ca and Mg Cat no 14190 Dulbecco s Phosphate Buffered Saline D PBS Cat no 14040 StemPro NSC SFM Cat no A10509 01 Preparing Media Neural Cell Culture and Differentiation Preparing Oligodendrocyte Differentiation Medium Preparing Astrocyte Differentiation Medium Preparing Matrix Oligodendrocyte differentiation medium uses Neurobasal medium supplemented with B 27 GlutaMAX I and T3 Complete medium is stable for 2 weeks when stored in the dark at 2 8 C To prepare 100 mL of complete medium mix the following components under aseptic conditions For larger volumes increase the component amounts proportionally Component Final concentration Amount Neurobasal Medium 1X 97 mL GlutaMAX I Supplement 2 mM 1mL B 279 Supplement 296 2mL T3 30 ng mL 0 1 mL Astrocyte differentiation medium uses D MEM medium supplemented with N 2 GlutaMAX I and FBS Complete medium is stable for 2 weeks when stored in the dark at 2 8 C Component Final concentration Amount D MEM Mediu
123. ry At 10 14 days after injection of 6 OHDA the rats that exhibit at least 210 contralateral rotations over 30 minutes when challenged with the dopamine receptor agonist apomorphine 0 2 mg kg i p or 630 ipsilateral rotations over 90 minutes when challenged with the DA releasing substance amphetamine 5 mg kg i p are suitable for future study Gibco Neurobiology Protocols Handbook 99 Life Technologies Products Appendix Life Technologies Products Overview Life Technologies provides you with all of your neural cell culture needs through its GIBCO Cell Culture Media and offers products including reagents media sera and growth factors to support the growth of a range of neural cell lines AII cell culture media products available from Life Technologies are tested for contamination and guaranteed for their quality safety consistency and regulatory compliance For more information on Invitrogen and GIBCO products refer to www invitrogen com Cells Product Quantity Cat no Rat GIBCO Rat Fetal Neural Stem Cells 1mL N7744 100 GIBCO Rat Fetal Neural Stem Cell Kit includes StemPro 1 kit N7744 200 NSC SFM GIBCO Rat Primary Cortical Astrocytes 1mL N7745 100 GIBCO Rat Glial Precursor Cells 1mL N7746 100 Primary Rat Cortex Neurons 1 x 105 cells mL 1mL A10840 01 Primary Rat Cortex Neurons 4 x 10 cells mL 1mL A10840 02 Primary Rat Hippocampus Neurons 1 mL A10841
124. s For larger volumes increase the component amounts proportionally If desired add 1 mL of Antibiotic Antimycotic solution per 100 mL of medium Component Final concentration Amount D MEM 1X 97 mL N 2 Supplement 196 1mL GlutaMAX I Supplement 2 mM 1mL FBS 196 1mL Oligodendrocyte differentiation medium requires supplementation of Neurobasal medium with B 27 GlutaMAX I and T3 Oligodendrocyte differentiation medium is stable for 2 weeks when stored in the dark at 2 8 C To prepare 100 mL of oligodendrocyte differentiation medium aseptically mix the following components For larger volumes increase the component amounts proportionally If desired add 1 mL of Antibiotic Antimycotic solution per 100 mL of medium Component Final concentration Amount Neurobasal Medium 1X 97 mL B 27 Serum Free Supplement 296 2mL GlutaMAX I Supplement 2 mM 1 mL T3 30 ng mL 0 1 mL You can prepare a 30 pg mL T3 stock solution 1 000X in distilled water Filter sterilize the T3 stock solution Preparing Matrix Neural Cell Culture and Differentiation Coating Culture Vessels with CELLstart 1 Coating Culture Vessels with Geltrex 1 Coating Culture Vessels with Poly L Ornithine and Laminin 1 Dilute CELLStart CTS 1 100 in D PBS with calcium and magnesium i e 50 uL of CELLStart CTS into 5 mL of D PBS Coat the surface of the culture vessel with the working soluti
125. s for FITC Cy5 and DAPI Expected Results Neural Cell Culture and Differentiation The thawed cortical neurons cultured in Neurobasal medium supplemented with 2 B 27 Serum Free Supplement and 0 5 mM GlutaMAX I show gt 90 neuronal population stained with MAP2 antibody and a minimum number of astrocytes Within 3 4 days in culture the neurons display extensive neurite outgrowth that keeps on increasing as long as the neurons are kept healthy in culture Note that results vary if the neurons are cultured in the presence of serum Figure 1 Primary Rat Cortical neurons Immunofluorescence detection of primary neuronal cells stained with mouse anti MAP2 antibody Green and presence of astrocytes as detected by rabbit anti GFAP marker Red Nuclei are stained with DAPI blue Troubleshooting The procedures are designed for neuronal cells grown in Neurobasal medium supplemented with 2 B 27 Serum Free Supplement and 0 5 mM GlutaMAX I Results may differ with culture systems grown in other complete media formulations which can result in higher numbers of cells other than neurons i e astrocytes References Brewer G J and Price P J 1996 Viable cultured neurons in ambient carbon dioxide and hibernation storage for a month Neuroreport 7 1509 1512 Brewer G J Torricelli J R Evege E K and Price P J 1993 Optimized survival of hippocampal neurons in B27 supplemented Neurobasal a new serum free medium c
126. same 15 mL tube containing the cells Add 4 mL of pre warmed MEF medium dropwise to the cells Gently mix by pipetting up and down Note Adding the medium slowly helps cells to avoid osmotic shock Centrifuge the cells at 200 x g for 5 minutes Aspirate the supernatant and resuspend the cell pellet in 5 mL of pre warmed MEF medium Remove 10 uL of cell suspension and determine the viable cell count using your method of choice Note We recommend using the Countess Automated Cell Counter for easy and accurate cell counting and viability measurements Centrifuge the MEFs at 200 x g for 5 minutes and aspirate the supernatant Resuspend the cell pellet in MEF medium to a concentration of 2 5 x 10 cells mL Aspirate the Attachment Factor solution from the coated culture vessels and wash the plates once with D PBS Add the appropriate amount of MEF medium into each culture vessel 2 5 mL into each well of 6 well plate 5 mL into each 60 mm dish or 10 mL into each 100 mm dish Into each of these culture vessels add the appropriate amount of MEF suspension 0 1 mL into each well of 6 well plate 0 2 mL into each 60 mm dish or 0 6 mL into each 100 mm dish The recommended plating density for GIBCO Mouse Embryonic Fibroblasts Irradiated is 2 5 x 10 cells cm Move the culture vessels in several quick back and forth and side to side motions to disperse cells across the surface of the wells and
127. se IgM A11055 1 1 000 Goat Mouse IgM A21044 1 000 Goat Mouse IgG A11029 1 000 Goat Rat IgM A21213 1 1 000 590 617 Red 594 Goat Rat IgG A11007 1 000 Goat Rabbit IgG A11037 1 1 000 Donkey Goat IgG A11058 1 000 Goat Mouse IgM M31504 500 ma 565 576 NA Goat Mouse IgG P852 1 1 000 Goat Rabbit IgG P2771MP 1 000 Approximate excitation and emission maxima in nm NA not applicable Preparing Media Neural Cell Culture and Differentiation StemPro NSC SFM Complete Medium Neural Differentiation Medium StemPro NSC SFM complete medium consists of KnockOut D MEM F 12 with StemPro Neural Supplement EGF bFGF and GlutaMAX I Complete medium is stable for 4 weeks when stored in the dark at 2 8 C To prepare 100 mL of complete medium Reconstitute bFGF and EGF with 0 1 BSA solution in KnockOut D MEM F 12 at a concentration of 100 g mL You will need 20 uL of each per 100 mL of complete medium Freeze unused portions in aliquots Mix the following components under aseptic conditions For larger volumes increase the component amounts proportionally If desired add 1 mL of Antibiotic Antimycotic solution per 100 mL of complete medium Component Final concentration Amount KnockOut D MEM F 12 1X 97 mL GlutaMAX I Supplement 2mM 1 mL bFGF prepared as 100 pg mL stock 20 ng mL 20 uL EGF prepared as 100 pg mL stock 20 ng mL 20 uL StemPro Neural Supplem
128. t 296 1mL You may observe a white precipitate when thawing StemPro Neural Supplement this precipitate will disappear when the supplement is completely thawed or dissolved Freezing Medium To prepare 10 mL of freezing medium aseptically mix the following components For larger volumes increase the component amounts proportionally Filter sterilize the freezing medium and store at 2 8 C until use Component Final concentration Amount StemPro NSC SFM Complete Medium 0 without bFGF and EGF see above 90 9 mL DMSO 10 1 mL Cryopreserving Neural Stem Cells Guidelines for Cryopreserving Neural Stem Cells Cryopreserve NSCs when they are 80 90 confluent 2 4 days after seeding e Freeze NSCs at a concentration of 2 x 106 2 4 x 10 viable cells mL and a volume of 1 mL vial Use a freezing medium composed of 90 complete StemPro NSC SFM without the growth factors i e bFGF and EGF and 10 DMSO e Do not incubate the NSCs in TrypLE Select for more than 2 minutes to avoid cell death e Pre label all cryovials with the following information cell line passage number concentration date of freezing and your initials 60 Freezing Neural Stem Cells 1 10 11 12 13 Neural Cell Culture and Differentiation When NSCs are 80 90 confluent 2 4 days after seeding aspirate the complete StemPro NSC SFM from the culture vessel Wash the cells twice with D P
129. t CNS At this stage marker expression is relatively heterogeneous Other relatively less characterized stem cells have also been described Neural stem cells do not generate differentiated progeny directly but rather generate dividing populations of more restricted precursors analogous to the blast cells or restricted progenitors described in the hematopoietic lineages These precursors can divide and self renew but they are located in regions distinct from the stem cell population and can be distinguished from them by the expression of cell surface and cytoplasmic markers and their ability to differentiate Several such classes of precursors have been identified including neuronal precursors bi and tri potential glial precursors that generate astrocytes and oligodendrocytes as well as unipotent astrocyte or oligodendrocyte precursors Other precursors such as a neuron astrocyte precursor may also exist and the same precursor may have multiple names Such precursors can be distinguished from stem cells by their marker expression ability to differentiate and time of development Gibco Neurobiology Protocols Handbook 5 Neural Cell Types in Neurological Diseases Neural Cell Types in Neurological Diseases Summary The table below lists some of the neurological disorders that have been studied and modeled in the laboratory and the cell types involved Neural Experimental Cell type Growth Progenitor Marker
130. t does not alter the viability and sublineage differentiation capacity of the preserved cells Cells Media and Reagents Tools and Equipment e Neural Stem Cells NSCs e KnockOut D MEM F 12 Cat no 12660 e StemPro NSC SFM Cat no A10509 01 e FGF basic AA 10 155 Recombinant Human bFGF Cat no PHG0024 e EGF Recombinant Human Cat no PHG0314 e TrypLE Select 1X Cat no 12563 029 Dulbecco s Phosphate Buffered Saline D PBS Cat no 14190 144 DMSO Dimethylsulphoxide Sigma Cat no D2650 Sterile 15 mL conical tubes Tabletop centrifuge e Syringe filter Cryovials Cryo 1 C Freezing Container Nalgene Cat no 5100 0001 Gibco Neurobiology Protocols Handbook 59 Cryopreserving Neural Stem Cells Preparing Media StemPro NSC SFM Complete Medium StemPro NSC SFM complete medium consists of KnockOut D MEM F 12 with StemPro Neural Supplement EGF bFGF and GlutaMAX I Complete medium is stable for 4 weeks when stored in the dark at 2 8 C To prepare 50 mL of StemPro NSC SFM complete medium aseptically mix the following components For larger volumes increase the component amounts proportionally If desired add 0 5 mL of Antibiotic Antimycotic solution per 50 mL of complete medium Component Final concentration Amount KnockOut D MEM F 12 1X 48 5 mL GlutaMAX I Supplement 2mM 0 5 mL bFGF 20 ng mL 1 ug EGF 20 ng mL 1 ug StemPro Neural Supplemen
131. the fluo 4 loaded NSCs with 100 uL of HBSS and maintain at room temperature in the dark until data acquisition Data Analysis N Place the 96 well plate containing the fluo 4 loaded NSCs in an inverted microscope e g Nikon T2000 for visual inspection and fluorescent imaging To acquire and analyze data define regions of interest around a random series of cells using your software of choice e g MetaFluor MDS Analytical Technologies Note The NSCs should display a typical neuronal morphology with dendritic and axonal processes clearly recognizable by cellular polarity and proportionate size Identify 50 100 neurons for data acquisition and analysis in each well examined Excite the NSCs with 488 nm light e g Lambda DG 4 light source and collect images from 520 nm emitted light with a CCD or digital camera e g ORCA ER Challenge the cells in one well with a neurotransmitter or other ligand For example add 20 uL of 3 mM acetylcholine to achieve a final concentration of 500 uM acetylcholine in the well Collect the data using the appropriate software e g MetaFluor MDS Analytical Technologies Repeat the procedure for each neurotransmitter or ligand of interest in separate wells Use the following final concentrations for each well 500 uM glutamate 500 uM dopamine add 500 uM ascorbic acid with dopamine to prevent dopamine oxidation 500 uM y aminobutyric acid and 500 uM ATP
132. the tip quality and impair their physical integrity e Do not use the same Neon Tube for more than 10 times Always use a new Neon Tip and Neon Tube for different plasmid DNA samples to avoid any cross contamination Gibco Neurobiology Protocols Handbook 91 Lipid Mediated Transfection of Human Astrocytes Lipid Mediated Transfection of Human Astrocytes Summary Required Materials Astrocytes are by far the most numerous cell type in the central nervous system CNS and have critical roles in adult CNS homeostasis They provide biochemical and nutritional support of neurons and endothelial cells which form the blood brain barrier perform the vast majority of synaptic glutamate uptake and maintain extracellular potassium levels Rothstein et al 1996 Rothstein et al 1994 Although there are few known differences between cortical and hippocampal astrocytes it has been reported that astrocytes from different regions of the brain show a differential sensitivity to ischemic injury Xu et al 2001 Zhao amp Flavin 2000 The following protocols provide instructions for lipid mediated transfection of plasmid DNA or siRNA into GIBCO Human Astrocytes using the Lipofectamine LTX Reagent or the Lipofectamine RNAiMax Reagent Lipofectamine LTX Reagent is a proprietary animal origin free formulation for the transfection of DNA into eukaryotic cells with low cytotoxicity Lipofectamine RNAiMAX is a proprietary formulation spe
133. ture vessel with or without cover slips with poly L ornithine working solution at 20 ng mL in distilled water 14 mL for T 75 7 mL for T 25 3 5 mL for 60 mm dish 2 mL for 35 mm dish and incubate the vessel overnight at room temperature Wash the poly L ornithine coated vessel 4 times with distilled water and then coat it with laminin working solution at 10 ug mL in D PBS without calcium or magnesium 14 mL for T 75 7 mL for T 25 3 5 mL for 60 mm dish 2 mL for 35 mm dish Incubate the culture vessel for 3 hours at 37 C Note You may coat the culture vessels in advance replace the laminin solution with D PBS without calcium or magnesium and store them wrapped tightly in Parafilm for up to 1 week Make sure that the culture vessels do not dry out After the neurospheres float in neural expansion medium for 6 8 days transfer them into a 15 mL tube and centrifuge for 5 minutes at 200 x g Aspirate the supernatant and incubate the neurospheres in pre warmed StemPro Accutase Cell Dissociation Reagent for 10 minutes at 37 C Gently pipet the cell clumps up and down to break the larger clumps into a single cell suspension Centrifuge the cells for 5 minutes at 200 x g and aspirate the supernatant Resuspend the cells in 10 mL of pre warmed neural differentiation medium Repeat steps 6 and 7 Aspirate the laminin from the coated culture vessels and plate the dissociated DA progenitors Incubate the cells
134. until just prior to use Make sure the plates do not dry out 10 Coating Culture Vessels with Fibronectin 1 Neural Cell Culture and Differentiation Dilute Fibronectin in distilled water to make a 1 mg mL stock solution Store working solution at 20 C until use Add stock solution to D PBS to make a working solution of 20 ug mL Add enough working solution to cover the surface of the culture vessel 10 mL for T 75 2 5 mL for 60 mm dish 1 5 mL for 35 mm dish Incubate the culture vessel at 37 C in a humidified atmosphere of 5 CO for 1 hour Remove the vessel from the incubator and store it until use Remove Fibronectin solution immediately before use and fill the vessel with complete StemPro NSC SFM Note You may store the Fibronectin treated plates at 4 C wrapped tightly with Parafilm for up to 2 weeks Ensure that plates do not dry out There is no washing step needed and use the dish directly after aspiration Culturing Neural Stem Cells Thawing Frozen Neural Stem Cells 1 2 Neural stem cell NSCs populations can be expanded from frozen stocks and grown in StemPro NSC SFM complete medium as adherent cultures or as suspension cultures In either environment change the spent culture medium every other day When the cells in adherent culture reach gt 90 confluency they are ready to be passaged When the neurospheres in suspension culture become gt 3 5 mm in diameter they are ready to
135. ure for 15 minutes Rinse the cells three times with D PBS containing Ca and Mg Permeabilize the cells with 0 3 Triton X diluted in D PBS with Ca and Mg for 5 minutes at room temperature Rinse the cells three times with D PBS containing Ca and Mg Incubate cells in 576 goat serum diluted in D PBS with Ca and Mg for 60 minutes at room temperature Remove the 5 goat serum solution and incubate the cells overnight with the primary antibody Mouse anti MAP2 at 10 ug mL and or Rabbit anti GFAP at 4 ug mL diluted in 5 goat serum at 4 C Ensure that the cell surfaces are covered uniformly with the antibody solution Wash the cells three times for 5 minutes with D PBS containing Ca and Mg if using a slide use a staining dish with a magnetic stirrer Incubate the cells with fluorescence labeled secondary antibody Alexa Fluor 488 goat anti mouse H L at 10 ng mL and or Alexa Fluor 594 goat anti rabbit H L at 10 ug mL diluted in 5 goat serum solution for 60 minutes at room temperature Wash the cells three times with D PBS containing Ca and Mg In the last wash counter stain the cells with DAPI solution 3 ng mL for 10 minutes Rinse the cells with D PBS and if desired mount using 3 drops of ProLong Gold antifade reagent per slide and seal it with the cover slip You may store the slides in the dark at 4 C Observe the cells under the microscope using filter
136. urons Cat no A10841 01 e Neurobasal Medium 1X liquid Cat no 21103 049 e B 27 Serum Free Supplement 50X liquid Cat no 17504 044 e GlutaMAX I Supplement Cat no 35050 061 Trypan Blue Stain Cat no 15250 061 Dulbecco s Phosphate Buffered Saline D PBS 1X liquid with calcium and magnesium Cat no 14040 Goatserum Cat no 16210 064 MAP2 Mouse Monoclonal Antibody Cat no 13 1500 Rabbit anti GFAP Glial Fibrillary Acid Protein Cat no 08 0063 Alexa Fluor 488 goat anti mouse IgG Cat no A11029 Alexa Fluor 594 goat anti rabbit IgG Cat no A11037 e 4 6 diamidino 2 phenylindole dihydrochloride DAPI Cat no D1306 ProLong Gold antifade reagent Cat no P36930 e Paraformaldehyde 4 e Triton X Multi chambered slides Fluorescence microscope Gibco Neurobiology Protocols Handbook 71 Immunocytochemistry Methods 72 Treating Surfaces with Poly D Lysine Maintaining Neuronal Cultures Immunocytochemistry Analysis 1 1 Treat the multi chambered slides used in immunocytochemistry analysis with poly D lysine prior to analysis as follows Prepare a 2 mg mL stock of poly D lysine in nuclease free water Prepare aliquots and store at 20 C Prepare a working solution of the poly D lysine stock from step 1 in D PBS with calcium and magnesium at a concentration of 50 ug mL Add 150 uL per cm of poly D lysine in
137. xygen and isoflurane Administering 6 OHDA Evaluating the Behavior N 1 until the animal is deeply anesthetized Position the rat in a stereotactic frame and fix the plastic tube connected to the anesthesia machine to the nose of the rat using surgical tape Maintain isoflurane at 1 5 with an oxygen flow of 2 3 liters minute Shave the top of the rat s head with an electric razor Clean the skin with betadine and 70 ethanol Perform a midline incision with a scalpel and identify the bregma at the intersection of the coronal and the sagittal sutures Adjust the incisor bar in the rat until the heights of lambda and bregma skull points are equal Calculate the stereotactic coordinates for injection For a MFB lesion coordinates are in reference to the bregma Anteroposterior A P 22 2 mm mediolateral M L 1 5 mm Drill a burr hole at the target site using a dental drill Fill a 10 uL Hamilton syringe with 5 uL 6 OHDA solution Attach the syringe to the holder on the stereotactic frame Lower the needle of the Hamilton syringe so that it is 8 mm from the dura Inject the 6 OHDA solution at a rate of 1 uL minute Leave the needle in place for 5 minutes and withdraw the tip slowly Close scalp margins with sutures or staples Remove the rat from the stereotactic frame and place it in its home cage Put food on the floor of the cage and monitor the animal s weight for 3 days after surge
138. y 10 pieces of midbrain originally isolated Using aliquot of the cell suspension determine the cell concentration and viability by dye exclusion method Trypan Blue Use the quantity of live cells counted for calculating the cell concentration Cell viability needs to be gt 80 and should ideally range from 95 100 DA neurons are among the most fragile cells in the solution While the cultures will contain neuronal cell types after relatively harsh treatment the number of DA neurons will be low Keep the cell suspension on ice or at 4 C until use Aspirate the laminin from the poly L ornithine and laminin coated culture plate and plate midbrain neural cells in differentiation medium at a density of 2 x 10 5 x 10 cells cm Culture the cells in an incubator changing medium every other day Culture the cells for 3 10 days then check for DA neurons by immunocytochemical staining using antibodies against the neuronal maker III tubulin and the dopaminergic markers tyrosine hydroxylase TH Neural Cell Culture and Differentiation Cryopreserving Neural Stem Cells Summary Required Materials There are numerous protocols available for cryopreserving neural stem cells NSCs derived from human embryonic stem cells the primary objective of these methods are the recovery of the cells post thaw and the retention of their multipotent properties This chapter describes a standardized cryopreservation protocol tha
139. ylated primary antibody Flick the tube to resuspend the cell pellet Mix well and incubate on ice for 25 30 minutes Wash the cells with 10 mL of cold Staining Medium Centrifuge the cells at 300 x g 4 C for 5 minutes Discard the supernatant Add diluted streptavidin secondary antibody conjugated to a fluorescent tag Gibco Neurobiology Protocols Handbook 69 Surface Marker Analysis by Flow Cytometry 70 N Mix well and incubate the cells on ice for 25 30 minutes Wash the cells with 10 mL of cold Staining Medium Centrifuge the cells at 300 x g 4 C for 5 minutes Discard the supernatant and resuspend cells with 0 5 mL of Staining Medium Filter the cell suspension through FACS filter tubes before analysis or sorting the cells by flow cytometry Note For negative controls prepare cells that have not been stained with antibody and cells stained with an isotype control Cell Analysis Immunocytochemistry Summary Required Materials Immunocytochemistry is a technique used to assess the presence of a specific protein or antigen in cells by use of a specific antibody that binds to it The antibody allows visualization of the protein under a microscope Immunocytochemistry is a valuable tool to study the presence and sub cellular localization of proteins Cells Media and Reagents Special Tools Primary Rat Cortex Neurons Cat no A10840 01 or Primary Rat Hippocampus Ne
140. ytes Complete GIBCO Astrocyte Medium Adherent culture on standard culture vessels 37 C humidified atmosphere of 596 CO in air Exchange spent medium every 2 3 days Rat Glial Precursor Cells Complete StemPro NSC SFM supplemented with 10 ng mL PDGF AA e Adherent culture on CELLStart or poly L ornithine coated culture vessels 37 C humidified atmosphere of 5 CO in air Exchange spent medium every other day For increased proliferation of rat astrocytes you can supplement complete GIBCO Astrocyte Medium D MEM with 1X N 2 Supplement and 1096 OneShot FBS with 20 ng mL EGF Adding EGF to human astrocyte cultures can increase proliferation but may result in morphological or phenotypic changes Preparing Media Complete StemPro NSC SFM To prepare 100 mL of complete StemPro NSC SFM aseptically mix the components listed in the table below Complete medium is stable for up to 4 weeks when stored in the dark at 4 C Component Concentration Amount KnockOut D MEM F 12 1X 97 mL GlutaMAX I Supplement 2mM 1mL bFGF 20 ng mL 2 ug EGF 20 ng mL 2 ug StemPro NSC SFM Supplement 2 2mL Gibco Neurobiology Protocols Handbook 85 Transfecting Neural Cells Using the Neon Transfection System Complete GIBCO Astrocyte Medium Transfection Protocol To prepare 100 mL of complete GIBCO NSC SEM aseptically mix the components listed in the table below Complete

Cryopreserving Neural Stem Cells

Contents

Download Pdf Manuals

Related Search

Related Contents