Home

side

1. TTTTTTT VN GGGGGGGG G n C00 5 CP2 PCR n aa a CP2 5 P 5 CCCCCCCCCCCCCCO TTTTTTT TVN GGGGGGGG G CP2 5 A CCCCCCCCCCCCCCC 5 Figure 25B 8 1 Global amplification of mRNA from a few or single cells mRNA is captured by paramagnetic beads 1 and primed using random and oligo dT primers containing a poly C flanking region 2 cDNA synthesis starts from both primers 3 CFL5c8 is omitted in 3 and 4 After RNA removal a poly G tail is added by TdT Using the poly C containing CP2 primer all sequences can be amplified 5 25B 8 2 Supplement 61 Current Protocols in Molecular Biology paramagnetic oligo dT beads While the mRNA is bound to the beads reaction buffers can easily be changed without loss of mRNA or cDNA This allows using optimal e high concentrations of cDNA primers and nucleotides during cDNA synthesis without interference with the subsequent tailing reaction To avoid loss of transcripts do not contaminate the reaction with RNases because the mRNA holds the newly synthesized cDNA to the bead After cDNA synthesis and before starting the tailing reaction the unbound cDNA synthesis primers and unincorporated dNTPs have to be washed out Tailing is performed in a KH PO buffer that unlike the provided potassium cacodylate buffers does not inhibit the subsequent PCR reaction which is set up in the same reaction tube without discarding the tailing buffer Random primers wer
2. Transfer the RNeasy column to a new 2 ml collection tube Pipet 500 ul of Buffer RPE onto the RNeasy column Centrifuge 15 sec at 8000 x g and discard the flowthrough Add another 500 ul of Buffer RPE to the RNeasy column and centrifuge 2 min at 8000 x g to dry the RNeasy silica gel membrane Discard the flowthrough gt GQ mMm oO Qa 1 To elute transfer the RNeasy column to a new 1 5 ml collection tube and pipet 15 ul of H20 onto the RNeasy column Centrifuge 1 min at 8000 x g Qi o k Pipet another 15 ul of H20 onto the RNeasy column and centrifuge min at 8000 x g 21 Concentrate the amplified RNA aRNA sample to 11 ul in a concentrator evaporator at 50 C 22 Use a 1 ul aliquot for RNA quantification A low volume spectrophotometer such as a NanoDrop is utilized Second round RNA amplification 23 Assemble the first strand reaction by mixing 1 ul of random hexamer primer 1 ug ul with 10 ul of aRNA and incubate 10 min at 70 C Cool on ice for 5 min This results in annealing of the random primers to the aRNA 24 Collect the sample by quick spin centrifugation 30 sec at 600 x g and equilibrate the tube at room temperature for 10 min 25 Add 8 ul of the following mixture to each tube 10 mM dNTP mix 1 ul 5x first strand buffer 4 ul 0 1 M DTT 2 ul 40 U ul RNaseOut 0 5 ul 5 ug ul T4 gene 32 protein 0 5 ul NOTE When preparing a cocktail mixture to accommodate multiple samples excess reag
3. 20 C The concentration of MgCl will depend on specific primers utilized UNIT 15 1 but will commonly range between 1 5 to 4 5 mM Current Protocols in Molecular Biology PCR PK solution Prepare the following in triple 0 2 um filtered nanopure 3xF H O 20 mM Tris Cl pH 8 4 APPENDIX 2 50 mM KCI 1 4 to 4 5 mM MgC Aliquot and store up to 12 months at 20 C Just before use add 50 ug ml proteinase K The concentration of MgCl will depend on specific primers utilized UNIT 15 1 but will commonly range between 1 5 to 4 5 mM Ponceau S solution Prepare the following in triple 0 2 um filtered nanopure 3xF H O 0 5 w v Ponceau S 1 v v glacial acetic acid Store in aliquots up to 12 months at room temperature Proteinase K solution 25 mM Tris Cl pH 8 4 APPENDIX 2 37 mM KCl 1 5 mM MgCl 0 3 ug proteinase K Make fresh Reverse transcription reaction mix 93 mM Tris Cl pH 8 3 APPENDIX 2 140 mM KCl 5 5 mM MgC Store up to 12 months at 20 C Just before use add DTT to 25 mM and dNTPs UNIT 3 4 to 0 25 mM Xgal buffer Prepare the following in clean phosphate buffered saline pH 7 4 PBS APPENDIX 2 5 mM K 3Fe CN potassium ferrocyanide 5 mM K Fe CN 3H O potassium ferricyanide 2 mM MgCl Aliquot and store up to 3 months at room temperature COMMENTARY Background Information The concept of cellular pathology was put forth nearly 150 years ago by Virchow 1863 with
4. 20 cycles 1 min 95 C denaturation 3 min dG extension Final step 10min 72 C extension For the OBgl 24 primer a lower annealing temperature of 70 C is required Run 10 ul amplified product on a 2 agarose gel with DNA concentration standards UNIT 2 5A If necessary to improve the yield perform 1 to 3 more cycles after addition of 3 ul fresh Taq DNA polymerase Current Protocols in Molecular Biology Discovery of Differentially Expressed Genes 25B 7 7 Supplement 60 Representational Difference Analysis 25B 7 8 Supplement 60 The quantity of DNA should be between 0 1 to 0 3 ug In subsequent iterations of this step discrete products should be observed Alternatively the results of the agarose gel may suggest Strategies for interventional troubleshooting see Commentary For example a high background may indicate either primer hydrolysis or the need for increasing the stringency of the preceding hybridization step i e decreasing tester relative to driver Change adapter on the difference product 47 48 49 50 51 52 Combine the contents of the two PCR tubes in one microcentrifuge tube four tubes for the 96 well format Extract and isopropanol precipitate as described in step 13 Dissolve the pellet in 80 ul TE buffer Determine DNA concentration by 2 agarose gel electrophoresis UNIT 2 54 and adjust to 0 1 ug ul Digest 5 ug difference product 50 ul with 10 U ug chose
5. php num_co Mozilla Firefox File Edit View History Bookmarks Tools Help E ap r ce Gt http genome dfci harvard edujsager sig SAGEmap_sample txt 1371 txt mozilla org mozillaZine mozdev org l Genome Biology KJ BioMed Central My AAAAAAAAAA 10 23 53 ao 10 3 0976e 09 Hs 146741 IBRDC2 IBR domain cont AAAAABAAAA 10 23 53 ao 10 3 0976e 09 Hs 2590404 SLC25A3 Solute carries AAAAAAAAAC 7 ae 50 24 11 9 15985e 09 Hs 166436 MAPSKS Mitogen activat AAAASAAAAG zi 19 67 26 12 2 60412e 13 Hs 13159 CELF Chemokine like fz AAAAAAAAAG a 19 67 26 I 2 60412e 13 Hs 2309619 LINS3 LIN and senescei AAAAAAAAGA 9 24 22 24 T 1 774738 11 Hs 15159 CKLF Chemokine like f AAAAAAAAGA 9 24 55 24 7 i 77473 11 Hs 406467 SPATA6 Spermatogenesi AAAASAAATG 6 17 52 15 9 1 38426e 10 Hs 489722 ZNF277 Zinc finger pre AAAAALAATG 6 17 52 15 9 1 38426e 10 Hs 542465 Transcribed locus CCCCCCCCAA 3 17 3 9 46 1 72739e 05 Hs 187199 MALATI Metastasis assc ecceccccca 1s 2 10 5 49 0 00033017 Hs 190234 RAIL Smith Nagenis syi ccccccccTa 12 23 11 10 45 0 00191342 Hs T4422 PLP2Z Proteolipid prote cCCcccccGac 10 19 9 7 45 0 000314162 no match CCCCCCGGTG 11 23 10 3 45 0 0008224965 Hs 125867 EVL Enah Vasp like GGGGGGGAAA 9 10 lz 10 93 0 317675 Hs 212935 PREDICTED Homo sap GGGoGGGoccce a 9 1i 10 8 0 367276 Hs 346736 NRPL3O Mitochondrial 1 GGGGGGGCCG T amp 10 8 7 0 420583 Hs 350927 SLC25A6 Solute carries SGGGGGGCGC 93 92 109 96 93 5 4702 6e 06 Hs 496383 SOAT1 S
6. 25A 3 3 Supplement 87 Laser Microdissection and Amplification of Plant RNA 25A 3 4 Supplement 87 This step results in an 1 cm long segment of maize seedling shoot tissue that contains a short segment of stem topped by the SAM which is surrounded by basal portions of approximately 14 leaves or whole leaf primordia 2 Trim tissues while submersed in acetone fixative to a final size of 0 3 x 0 3 x 0 2 cm Place them in a scintillation vial with 15 ml of ice cold 100 acetone and keep on ice Prepare eight to ten seedlings in this manner and place into the same vial the volume ratio of fixative to sample should not be less than 20 1 Work rapidly The total preparation time for a single vial of eight to ten seedlings should not exceed 10 min Trimming of seedlings in the manner described above will ensure that the SAM is retained in sample blocks that are also small enough to permit two rows of samples to be mounted on a Single slide see below For larger tissue samples be sure to trim samples to a size small enough to be mounted on a 25 x 75 mm microscope Slide 3 Vacuum infiltrate the samples on ice by subjecting the vial to a vacuum of 400 mmHg for 10 to 15 min Slowly equilibrate to atmospheric pressure to avoid bumping or boiling the solution Decant acetone and replace with fresh ice cold 100 acetone Re cap the vial and allow samples to fix overnight at 4 C on a rotator Vacuum infiltration is required to
7. Critical Parameters and Troubleshooting MicroSAGE The two key determinants of a successful SAGE library are quantity and purity of ditags To ensure obtaining many ditags carefully op timize the starting reaction and scale up the number of PCR reactions as desired For cer tain low yield preparations the authors have gone as high as 700 PCR reactions of 50 ul to generate the starting material For purity ensure that the 102 bp and the 80 bp bands are well separated and be very careful not to extract any of the 80 bp band Run the gel as long as possible and do not overload the wells no more than 10 ul per well despite the large number of gels this will require Do the same for the 26 bp cut ditag band avoiding the 40 bp linker band One other problem that has been en countered occasionally is contamination of reagents following construction of libraries which will result in 102 bp bands in the no ligase control in the initial optimization PCR reactions To avoid this be very careful to avoid splashes and not reuse tips during the scale up or initial purification of the 102 bp band Make separate aliquots of LoTE buffer PC8 ammonium acetate and ethanol for each library during these steps to reduce the like lihood of contamination Use aerosol barrier tips wherever possible A final common cause of experimental fail ure is low quality reagents Wherever possible order supplies from the sources specified in the prot
8. In addition to finding genomic alterations RDA has been successfully used to identify exogenous sequences from DNA based infec tious agents Chang et al 1994 While RDA Current Protocols in Molecular Biology was original applied to genomic DNA the versatility of the technique allowed minor modifications in the protocol for the examina tion of differences in gene expression Hubank and Schatz 1994 Bakin and Curran 1999 Reick et al 2001 Shields et al 2001 as well as the identification of new RNA viruses Nishizawa et al 1997 Birkenmeyer et al 1998 RDA has advantages and limitations when compared to other techniques used to detect BASIC PROTOCOL 2 Discovery of Differentially Expressed Genes 25B 7 9 Supplement 60 Representational Difference Analysis 25B 7 10 Supplement 60 differences in genomic content The first gen eration technique of subtractive hybridization requires large amounts of starting DNA and is inefficient usually allowing only a 1 100 fold enrichment of target sequences This is due to the complexity of eukaryotic genomes in which hybridization of complementary sequences cannot go to completion Therefore only very long or abundant sequences can be isolated RDA circumvents this problem by the incorpo ration of a simplification step in which only a representation of the genome is used in the analysis The simplification process is based on restriction endonuclease dig
9. PCR including all pretreat ments 1 5 to 2 days this is not a continuous effort and gel electrophoresis prehybridiza tion and hybridization 1 to 1 5 days this also is not a continuous effort Literature Cited Coligan J E Kruisbeek A M Margulies D H Shevach E M and Strober W eds 2001 Cur rent Protocols in Immunology John Wiley amp Sons New York Gilbert S 1994 Developmental Biology 4th ed Sinauer Associates Inc Sunderland Mass Katz J P Bodin E T and Coen D M 1990 Quan titative polymerase chain reaction analysis of herpes simplex virus DNA in ganglia of mice infected with replication incompetent mutants J Virol 64 4288 4295 Current Protocols in Molecular Biology Mullis K B and Falona F A 1987 Specific synthe sis of DNA in vitro via a polymerase catalyzed chain reaction Meth Enzymol 155 335 350 Pretlow II T G and Pretlow T P eds 1982 Cell Separation Methods and Selected Applications Academic Press New York Sawtell N M 1997 Comprehensive quantification of herpes simplex virus latency at the single cell level J Virol 71 5423 5431 Sawtell N M and Thomson R L 1992 Herpes simplex virus type 1 latency associated tran scription unit promotes anatomical site depend ent establishment and reactivation from latency J Virol 66 2157 2169 Sawtell N M Poon D K Tansky C S and Thompson R L 1998 The latent HSV 1 genome copy number in ind
10. Store up to 6 months at 20 C Taq DNA polymerase buffer 10x 100 mM Tris Cl pH 9 0 APPENDIX 2 500 mM KCI APPENDIX 2 1 v v Triton X 1000 Store at 20 C COMMENTARY Background Information Early subtractive cloning involved one or two rounds of hybridization using cDNA as tracer and mRNA as driver cCDNA mRNA hy brids were removed by binding to hydroxyla patite columns maintained at 68 C This scheme has two major limitations that pre vented subtractive cloning from becoming a routine and frequently used technique The first was that hydroxylapatite columns are cumbersome making it difficult to separate single stranded sequences from the hybrids This problem has been largely overcome throughthe use of biotinylated driver sequences in combination with streptavidin treatment and phenol extractions Sive and St John 1988 Sive et al 1989 or streptavidin conjugated magnetic beads Uhlen 1989 Straus and Ausubel 1990 A second problem with the original tech nique was the rapid decrease in the amount of cDNA present making it very difficult to per Current Protocols in Molecular Biology form multiple rounds of subtraction or to clone the minute amounts of cDNA left after subtrac tion Several different approaches have been used to tackle this second problem One solu tion has been to construct directional phagemid libraries that can be converted into a single stranded library after the subtractions
11. Taq adapter top strand 5 CTCGTAGACTGCGTACA 3 TaqI adapter bottom strand 3 CATCTGACGCATGTGC 5 Msel adapter top strand 5 GACGATGAGTCCTGAG 3 Msel adapter bottom strand 3 GCTACTCAGGACTCAT S Nonselective primers AFLP 0 Taq 0 primer 5 CTCGTAGACTGCGTACACGA 3 Msel 0 primer 5 GACGATGAGTCCTGAGTAA 3 Selective primers AFLP 1 and 2 Taqi 1 primer 5 GTAGACTGCGTACACGAN 3 Taqi 2 primer 5 GTAGACTGCGTACACGANN 3 Msel 1 primer 5 GATGAGTCCTGAGTAAN 3 Msel 2 primer 5 GATGAGTCCTGAGTAANN 3 N is any nucleotide therefore there are a total of 1 0 4 1 and 16 2 primers for each restriction endonuclease Loading dye 98 formamide deionized and filtered Merck 10 mM EDTA pH 8 0 APPENDIX 2 5 mM spermidine 3HCI Sigma Trace amounts i e 0 5 mg ml of bromphenol blue and xylene cyanol Store in small 500 ul aliquots up to 6 months at 20 C Current Protocols in Molecular Biology PCR buffer 10x 100 mM Tris Cl pH 8 3 APPENDIX 2 15 mM MgCl 500 mM KCl Store up to 6 months at room temperature RL buffer 5x 50 mM Tris acetate pH 7 5 50 mM magnesium acetate 250 mM potassium acetate 25 mM DTT Store in small aliquots up to 500 ul and store up to 6 months at 20 C Second strand buffer 5x 100 mM Tris Cl pH 7 0 APPENDIX 2 20 mM MgCl 450 mM KCl 750 UM NAD 50 mM NH SO Store in small aliquots up to 6 months at 20
12. 1995 Representational difference analysis Finding the difference between genomes Trends Genet 11 303 307 Martin K J Kwan C P O Hare M J Pardee A B and Sager R 1998 Identification and veri fication of differential display cDNAs using gene specific primers and hybridization arrays BioTechniques 24 1018 1026 Miele G MacRae L McBride D Manson J and Clinton M 1998 Elimination of flase posi tives generated through PCR reamplification of differential display cDNA BioTechniques 25 138 144 Pesole G Liuni S Grillo G Belichared P Tren kle T Walse J and McClelland M 1998 GeneUp A program to select short PCR primer pairs that occur in multiple members of sequence lists BioTechniques 25 112 123 Prasher Y and Weissman S M 1996 Analysis of differential gene expression by display of 3 end restriction fragments of cDNAs Proc Natl Acad Sci U S A 93 659 663 Sager R 1997 Expression genetics Shifting the focus from DNA to RNA Proc Natl Acad Sci U S A 94 952 955 Steeg P S Bevilacqua G Kopper L Thorgeirson U P Talmadge J E Liotta L A and Sobel M E 1988 Evidence for a novel gene associated with low tumor metastatic potential J Natl Cancer Inst 80 200 204 Trentmann S M van der Dnapp E and Kende H 1995 Alternatives to S as a label for the differ ential display of eukaryotic messenger RNA Science 267 1186 1187 Wang W
13. 2 The 28 PEG 3 6 mM MgCl solution is rather viscous Pipet slowly and carefully again being sure to accurately transfer the required volume 3 Mix carefully by first repeatedly inverting the tube then vigorously vortexing Due to viscosity complete and homogeneous mixing takes a while During addition of PEG solution a white glycogen precipitate usually forms This becomes invisible again in the course of mixing When washing the pellet with ethanol detachment from the tube wall does no harm since the pellet is too large to be easily lost Perform restriction digest 7 Dissolve the pellet on ice in the following solution 96 ul total 15 0 ul 10x universal buffer 81 0 ul H O Instead of the Universal buffer supplied by Stratagene any buffer supplied with the restriction enzyme can be used In this case adhere to the manufacturer s recommendations concerning dilution of buffer stock 8 Add 4 0 ul of 4 U ul Mbol and incubate 1 hr at 37 C Inactivate the enzyme by heating 20 min at 65 C The choice of restriction enzyme is discussed elsewhere in this unit see Strategic Planning 9 Extract with 50 ul phenol buffered with TE buffer pH 8 0 then with 50 ul chloroform Add 1 ul glycogen and 10 ul 3 M sodium acetate pH 5 2 followed by 2 5 vol 100 ethanol Microcentrifuge 20 min at maximum speed and wash pellet with 70 ethanol Air dry pellet briefly 5 to 10 min Do not apply heat and or vacuum since overdrying DNA
14. 25B 2 6 Supplement 55 Current Protocols in Molecular Biology 6 Set up ligation reactions in 0 5 ml PCR tubes for each set of cDNAs using the appropriate adapter 130 ul per reaction 63 ul H O 13 ul 10x T4 DNA ligase buffer 30 ul 40 PEG 8000 1 ul 15 mM ATP 10 ul Alul digested cDNA 10 ul Alul Rsal digested cDNA 2 ul al a2 adapter or 2 ul b1 b2 adapter 1 ul 10 U ul T4 DNA ligase Mix and incubate 2 hr at 16 C 7 Incubate reactions gt 10 min on ice 8 Prepare Sephacryl S 300 spin columns according to manufacturer s instructions 9 Add 1 ul of 75 mM ATP and 1 ul T4 polynucleotide kinase to each ligation reaction Incubate 30 min at 37 C 10 Extract the ligation reaction with 1 vol of 25 24 phenol chloroform then with 1 vol chloroform 11 Centrifuge the reaction mixture through a prepared Sephacryl S 300 spin column 1 e 2 min at 400 x g in a Beckman Accuspin FR with a swinging bucket rotor room temperature to remove unligated adapters Approximately 130 ul ligated cDNA will come through the column Ligated cDNAs may also be separated from unligated adapters by agarose gel electropho resis UNIT 2 5A followed by electroelution UNIT 2 6 Amplify ligated cDNA Ligated cDNA is amplified by PCR to obtain large amounts of cDNA Ag Bo 12 Set up a PCR mixture for each of the two sets of cDNAs 50 ul per reaction 35 ul H O 5 ul 10x Taq DNA polymerase buffer 3 ul 25 mM MgCl 1 ul 10 mM 4dNTP mix 0 5 ul 2 5
15. A and B thatis genes preferentially expressed in A more than in B are isolated as are genes expressed tissues E tracer driver mRNA EAA EAA ee A Ls n n cDNA e mmm MRNA or cDNA g E E A DRR ag a s be a n m a n hybridize anaa E ears DAANA Fa e a n a a Y Conn M aa aa Pama SK a M H f remove hybrids and driver ANN E subtracted cDNA enriched with m mmm SEQUENCES differentially expressed in tracer Figure 25B 2 1 Generalized subtraction scheme Tracer cDNA from the cell population is hybridized to gt 10 fold excess driver mRNA or cDNA from the cell population The resulting hybrids and excess driver are removed to enrich for cell type specific sequences in the tracer The subtraction may be repeated for further enrichment Contributed by Mukesh Patel and Hazel Sive Current Protocols in Molecular Biology 2001 25B 2 1 25B 2 20 Copyright 2001 by John Wiley amp Sons Inc UNIT 25B 2 Discovery of Differentially Expressed Genes 25B 2 1 Supplement 55 PCR Based Subtractive cDNA Cloning 25B 2 2 Supplement 55 tissue A tissue B OI AAA mRNA NOU AAA es ds cDNA E digest with restriction endonucleases aa C ara ligate adaptor j dal a2 b1 b2 ar E E oe PCR Ao Bo PCRT p ra N J 32p_ 32p_ enn Bio Ay Bio Bo ja OE E E 82P A Bio Bo 32P Bo Bio Ap a n La ae oooO _ 7 mix
16. Analysis of gene expression in single live neu rons Proc Natl Acad Sci U S A 89 3010 3014 Kacharmina J E Crino P B and Eberwine J 1999 Preparation of cDNA from single cells and subcellular regions Methods Enzymol 303 3 18 Klein C A Seidl S Petat Dutter K Offner S Geigl J B Schmidt Kittler O Wendler N Passlick B Huber R M Schlimok G Baeuerle P A and Riethmuller G 2002 Com bined transcriptome and genome analysis of sin gle micrometastatic cells Nat Biotechnol 20 387 392 Luo L Salunga R C Guo H Bittner A Joy K C Galindo J E Xiao H Rogers K E Wan J S Jackson M R and Erlander M G 1999 Gene expression profiles of laser captured adja cent neuronal subtypes Nat Med 5 117 122 Zohlnhofer D Richter T Neumann F Nuhren berg T Wessely R Brandl R Murr A Klein C A and Baeuerle P A 2001a Transcriptome analysis reveals a role of interferon gamma in human neointima formation Mol Cell 7 1059 1069 Zohlnhofer D Klein C A Richter T Brandl R Murr A Nuhrenberg T Schomig A Baeuerle P A and Neumann F J 2001b Gene expression profiling of human stent induced neointima by cDNA array analysis of micro scopic specimens retrieved by helix cutter atherectomy Detection of FK506 binding pro tein 12 upregulation Circulation 103 1396 1402 Contributed by Christoph A Klein Dietlind Zohlnh fer Kar
17. C STEX 2x 1x 20 mM Tris Cl pH 8 0 APPENDIX 2 2000 mM NaCl APPENDIX 2 2 mM EDTA APPENDIX 2 0 2 v v Triton X 100 Store up to 6 months at room temperature Dilute to 1x with Milli Q purified or double distilled H O T4 polynucleotide kinase buffer 10x 250 mM Tris Cl pH 7 5 APPENDIX 2 100 mM MgCl 50 mM DTT Make small aliquots and store up to 6 months at 20 C TBE 1x Prepare a 10x stock 1 M Tris base 1 M boric acid 20 mM EDTA pH 8 3 Store up to 6 months at room temperature Dilute to 1x with water Wash buffer 10 mM Tris Cl pH 7 5 APPENDIX 2 150 mM LiCl 1 mM EDTA Store up to 6 months at room temperature Current Protocols in Molecular Biology Discovery of Differentially Expressed Genes 25B 5 11 Supplement 57 AFLP Based Transcript Profiling 25B 5 12 Supplement 57 COMMENTARY Background Information At present a variety of technologies are available for high throughput analysis of mRNA populations in cells tissues and organs These can be divided into three major classes 1 methods based on hybridization of labeled cDNA to transcript sequences on microarrays Schena et al 1995 De Risi et al 1997 2 methods based on high throughput sequencing of small identifier signature sequences cor responding to specific transcripts UNIT 25B 6 Velculescu et al 1995 Brenner et al 2000 and 3 methods based on display of cDNA fragment patterns on high resolution ge
18. Ex pressed sequence tags and the human genome project Science 252 1651 1655 Bachem C W B Van der Hoeven R S De Bruijn S M Vreugdenhil D Zabeau M and Visser R G F 1996 Visualization of differential gene expression using a novel method of RNA finger printing based on AFLP Analysis of gene ex pression during potato tuber development Plant J 9 745 753 Brenner S Johnson M Bridgham J Golda G Lloyd D H Johnson D Luo S McCurdy S Foy M Ewan M Roth R George D Eletr S Albrecht G Vermanas E Williams S R R Moon K Burcham T Pallas M DuBridge R B Kirchner J Fearson K Mao J and Corcoran K 2000 Gene expression analysis by massively parallel signature sequencing on mi crobead arrays Nat Biotechn 18 630 634 Current Protocols in Molecular Biology Breyne P and Zabeau M 2001 Genome wide expression analysis of plant cell cycle modulated genes Curr Opin Plant Biol 4 136 142 De Risi J L Iyer V R and Brown P O 1997 Exploring the metabolic and genetic control of gene expression on a genome scale Science 278 1359 1367 Din R F Nesert E W and Comai L 2001 Plant gene expression response to Agrobacterium tu mefaciens Proc Natl Acad Sci U S A 98 10954 10959 Durrant W E Rowland O Piedras P Hammond Kosack K E and Jones J D 2000 cDNA AFLP reveals a striking overlap in race specific resistance and wound res
19. H 1997 Microbeam MOMeNT Non contact laser microdissection of membrane mounted native tissue Am J Pathol 151 63 67 Bonner R F Emmert Buck M Cole K Pohida T Chuaqui R Goldstein S and Liotta L A 1997 Laser capture microdissection Molecular analysis of tissue Science 278 1481 1483 Bostwick D G al Annouf N and Choi C 1994 Establishment of the formalin free surgical pa thology laboratory Utility of an alcohol based fixative Arch Pathol Lab Med 118 298 302 Coombs N J Gough A C and Primrose J N 1999 Optimisation of DNA and RNA extraction from archival formalin fixed tissue Nucl Acids Res 27 e12 Dietmaier W Hartmann A Wallinger S Hein moller E Kerner T Endl E Jauch K W Hofstadter H and Ruschoff J 1999 Multiple mutation analyses in single tumor cells with improved whole genome amplification Am J Pathol 154 83 95 DiFrancesco L M Murthy S K Luider J and Demetrick D J 2000 Laser capture microdis section guided fluorescence in situ hybridization and flow cytometric cell cycle analysis of puri fied nuclei from paraffin sections Modern Pa thology 13 705 711 Ehrig T Abdulkadir S A Dintzis S M Mil brandt J and Watson M A 2001 Quantitive amplification of genomic DNA from histological tissue sections after staining with nuclear dyes and laser capture microdissection Journal of Molecular Diagnostics 3 22 25 Fend F Qu
20. H and Theissen G 1995 Restriction fragment length polymorphism cou pled domain directed differential display A highly efficient technique for expression analy sis of multigene families Proc Natl Acad Sci U S A 92 5331 5335 Karrer E E Lincoln J E Hogenhout S Bennett A B Bostock R M Martineau B Lucas W J Gilchrist D G and Alexander D 1995 In situ isolation of mRNA from individual plant cells Creation of cell specific cDNA libraries Proc Natl Acad Sci U S A 92 3814 3818 Current Protocols in Molecular Biology Ledakis P Tanimura H and Fojo T 1998 Limi tations of differential display Biochem Biophys Res Commun 251 653 656 Liang P and Pardee A B 1992 Differential display of eucaryotic messenger RNA by means of the polymerase chain reaction Science 257 967 971 Malhotra K Foltz L Mahoney W C and Schueler PA 1998 Interaction and effect of annealing temperature on primers used in differ ential display RT PCR Nucl Acids Res 26 854 856 McClelland M and Welsh J 1994 RNA finger printing by arbitrarily primed PCR PCR Meth ods Appl 4 S66 S81 Poirier G M Pyati J Wan J S and Erlander M G 1997 Screening differentially expressed cDNA clones obtained by differential display using amplified RNA Nucl Acids Res 25 913 914 Prashar Y and Weissman S M 1996 Analysis of differential gene expression by display of 3 end restrictio
21. PC8 see recipe SeeDNA Amersham Pharmacia Biotech 7 5 M ammonium acetate Sigma 70 and 100 ethanol LoTE buffer see recipe 100x BSA New England Biolabs 10 U ul Niall and 10x NEBuffer 4 New England Biolabs Streptavidin Dynabeads Dynal 1x BW buffer see recipe Annealed linkers see Support Protocol 1 5 U ul high concentration T4 DNA ligase Invitrogen 1x BW buffer 1 x BSA 1x NEBuffer 4 1 x BSA 100x BSA 10 U ul AscI New England Biolabs 10x SAGE PCR buffer see recipe DMSO PCR primers see recipe 350 ng ul M13 forward primer 350 ng ul primer 2 5 U ul Platinum Tag DNA polymerase Invitrogen 4 to 20 TBE acrylamide gel Novex 1 kb ladder 1x SYBR green I Roche Diagnostics in TBE buffer APPENDIX 2 5 M betaine prepare monohydrate salt Sigma in PCR grade ddH2O SAGE tag specific primer see recipe Qiaquick gel extraction kit Qiagen Qiaquick columns EB Buffer TOPO TA Cloning Kit with pCR2 1 vector Invitrogen or TOPO TA Cloning Kit for Sequencing with pCR4 TOPO vector Invitrogen 16 50 and 70 C water baths heat blocks or equivalent 1 5 ml No stick siliconized microcentrifuge tubes Ambion Magnetic rack for 1 5 ml microcentrifuge tubes Dynal 1 5 ml nonsiliconized nuclease free microcentrifuge tubes Additional reagents and equipment for preparing total RNA UNIT 4 2 agarose gel electrophoresis UNIT 2 54 and sequencing UNIT 7 4A Synthesize cDNA 1 Prepare total RNA in DEPC ddH20 using st
22. Place the filter dialysis membrane into the PCR tube of the collecting apparatus Microcentrifuge the collecting apparatus 5 min at 8 000 rpm room temperature Discard the PCR tube and filter dialysis tubing Bring up volume of collected liquid to 400 ul with water and extract with 1 vol phenol followed by 1 vol phenol chloro form isoamyl alcohol Ethanol precipitate DNA with 20 ug glycogen and dry the pellet as described step 2 Dissolve the DNA pellet in 30 ul TE buffer check DNA concentration by agarose gel electrophoresis against DNA standards UNIT 2 54 and adjust the concentration to 0 1 ug ul Ligate 1 ug purified tester amplicon DNA digest to primer set O as described in steps 4 to 6 above The R set of primers used to make the driver amplicons is never used in subsequent subtractive kinetic enrichment rounds to prevent driver amplification as a result of un cleaved primers Current Protocols in Molecular Biology Discovery of Differentially Expressed Genes 25B 7 5 Supplement 60 Representational Difference Analysis 25B 7 6 Supplement 60 27 Dilute the pellet to a concentration of 10 ng ul by adding 70 ul TE buffer Tf using HindIII dilute the pellet to 25 ng ul by adding 10 ul TE buffer Perform subtractive kinetic enrichment 28 Ina microcentrifuge tube combine driver and tester by mixing 80 ul driver amplicon DNA digest 0 5 ug ul and 40 ul diluted tester amplicon ligate 0 4 ug for repre se
23. Process and embed tissue 4 Sa Sb After the tissue sections in the cassettes are fixed place the cassettes in the first station of an automated tissue processor Program and load the processor For routine overnight processing Perform the steps in Table 25A 1 1 After processing the tissue will be infiltrated with paraffin For accelerated processing Follow the steps in Table 25A 1 2 No difference has been found in the LCM transfer efficiency of tissues processed either way Remove the tissue from the original cassette and embed the paraffin infiltrated tissue in additional melted paraffin in an embedding mold Allow to cool and harden Adhere the paraffin block to a cutting platform chuck and remove the paraffin block from the embedding mold The paraffin block is now ready for sectioning see Basic Protocol 2 Also see Sheehan and Hrapchak 1987b Current Protocols in Molecular Biology Table 25A 1 1 Routine Overnight Tissue Processing Station Solution 1 NBF 2 Ethanol 3 Ethanol 4 Ethanol 5 Ethanol 6 Ethanol T Ethanol 8 Ethanol 9 Xylene 10 Xylene 1 Embedding paraffin 12 Embedding paraffin 13 Embedding paraffin 14 Embedding paraffin If neutral buffered formalin NBF is not the initial fixative skip station 1 Table 25A 1 2 Accelerated Tissue Processing Station Solution l Ethanol 2 Ethanol 3 Ethanol 4 Ethanol 5 Ethanol 6 Xylene 7 Xylene 8 Xylene 1 Embedding paraff
24. RNA preservation and introduce undesirable histologic artifacts Section tissue 6 Remove the tissue block from the cryomold and attach it to the tissue platform chuck in the cryostat with additional embedding media serving as the glue at the interface Apply just enough embedding media to cover the surface of the chuck and quickly attach the frozen tissue block before the glue hardens completely The cutting surface should be as parallel as possible to the chuck surface 7 Allow the block to equilibrate to the cryostat temperature 1 e 20 C 215 min 8 Cut 5 to 10 um sections onto glass slides that have been sitting at room temperature and previously labeled with identifying numbers and or letters using a no 2 pencil or a permanent marker designed for labeling slides Current Protocols in Molecular Biology Glass slides can be plain uncoated charged or silanized The properties of glass slides that allow tissue adherence are variable among different brands even with plain uncoated slides It is important to use Slides that allow tissue sections to adhere well enough that they do not fall off during staining but not so tightly that the tissue cannot be captured It is likely that different brands and types of slides will have to be tried and that slides used successfully for formalin fixed paraffin embedded sections may not be optimal for frozen ones The authors have found the Becton Dickinson Gold Seal plain unc
25. W Bohle R M and Fink L 2006 Systematic comparison of the T7 IVT and SMART based RNA preamplification techniques for DNA microarray experiments Clin Chem 2 1161 1167 Wilson C L Pepper S D Hey Y and Miller C J 2004 Amplification protocols introduce sys tematic but reproducible errors into gene expres sion studies Biotechniques 36 498 506 Woll K Borsuk L A Stransky H Nettleton D Schnable P S and Hochholdinger F 2005 Iso lation characterization and pericycle specific transcriptome analyses of the novel maize lat eral and seminal root initiation mutant rum Plant Physiol 139 1255 1267 Wu Y Llewellyn D J White R Ruggiero K Al Ghazi Y and Dennis E S 2007 Laser capture microdissection and cDNA microarrays used to generate gene expression profiles of the Current Protocols in Molecular Biology rapidly expanding fibre initial cells on the sur face of cotton ovules Planta 22 1475 1490 Yu Y Lashbrook C C and Hannapel D J 2007 Tissue integrity and RNA quality of laser mi crodissected phloem of potato Planta 226 797 803 Zhang X Madi S Borsuk L Nettleton D Elshire R J Buckner B Janick Buckner D Beck J Timmermans M Schnable P S and Scanlon M J 2007 Laser microdissection of narrow sheath mutant maize uncovers novel gene expression in the shoot apical meristem PLoS Genet 3 e101 Zimmerman J L and Goldberg R B 1977 D
26. bake or at least decrease the baking time 6 Try a different brand or type of glass slide Current Protocols in Molecular Biology 7 If still not successful call the technical support at Acturus Engineering 650 962 3020 The authors also find that talking with other researchers working with LCM to be very useful If LCM is successful but the cap contains contaminating debris the following measures are recommended 1 Make sure the slide is free of debris It may be necessary to wash the slide in fresh changes of xylene 2 Use a CapSure Pad or Post It Note to remove any debris from the cap 3 Use HS caps which minimize contami nation If the LCM was successful but no RNA DNA or protein was identified at analysis try the following 1 Make sure optimum laboratory practices and conditions that are free of nucleases or proteinases have been observed 2 Check the cap to see if the microdissected tissue has dissolved in the lysis buffer in the microcentrifuge tube 3 Increase the number of microdissected cells 4 An overnight incubation at 37 C can be used to lyse the cells from the cap when using DNA lysis solutions if required For RNA and proteins inverting and gentle agitation should be used to dislodge the cells from the cap Anticipated Results Many molecular analyses have been suc cessfully performed on cells procured by LCM These include genomic analyses such as loss of heterozygosity analysis
27. ditional drawback of SAGE is the requirement that a large body of cDNA EST sequence must be available from the organism being stud ied in order to match SAGE tags to the spe cific mRNAs This effectively limits the use of SAGE to model organisms Another draw back of the method is the occasional failure of a SAGE tag to match a predicted gene or to be long enough to easily isolate a full length cDNA clone While this happens at relatively low frequency for high abundance transcripts in model organisms it can limit the interpre tation of the data in some cases As a result several approaches most of which are variations of conventional RT PCR have been developed to identify these un known or anonymous SAGE tags There has been marked improvements in strategies used to identify unknown SAGE tags by reverse cloning cDNA fragments collectively called reverse SAGE rSAGE see Basic Protocol 2 First the cloning process is similar to the orig inal SAGE protocol therefore only cDNA pieces which are 3 to the most 3 anchoring enzyme site are used as templates for sub sequent PCR amplification and subcloning Discovery of Differentially Expressed Genes 25B 6 33 Supplement 80 Serial Analysis of Gene Expression SAGE 25B 6 34 Supplement 80 Polyak et al 1997 also see Internet Re sources SAGEnet Second the use of betaine allows for a prolonged PCR touchdown that results in more specific priming
28. in this example to view or download results with calculated P values The result is shown in Figure 25B 6 7 The last column contains the calculated P values The result file is a tab delimited text file Users can open the result file in Microsoft Excel or Access Result data can be sorted by P value to allow the selection of tags that are most significantly differentially expressed The smaller the P value the more significantly differentially expressed the tag 6 To annotate the data select an organism for SAGE tag gene mapping Fig 25B 6 6 Click Submit The annotated results appears on screen Fig 25B 6 8 Performing cluster analysis Cluster analysis is more appropriate for multiple SAGE library data sets rather than simple pair wise comparisons between libraries Cluster analysis allows users to select several different algorithms distances including Poisson based PoissonC Pearson correlation PearsonC and Euclidean etc to group SAGE data into a user defined Current Protocols in Molecular Biology Discovery of Differentially Expressed Genes 25B 6 27 Supplement 80 Serial Analysis of Gene Expression SAGE 25B 6 28 Supplement 80 Mozilla Firefox File Edit View History Bookmarks Tools Help ip mozilla org mozillaZine S mozdev org Genome Biology BioMed Central My Gt http s genome dfci harvard edu sager step3 1 You have chosen columns i 3 aj for significance an
29. just before the plateau is reached This can be done by setting up and running the PCR with half of the cDNA and then running a gel of 3 ul aliquots that are taken during the PCR at various cycle numbers be tween 20 and 40 cycles e g cycle 20 24 28 etc Then the PCR may be set up with the other half of the cDNA programming the thermal cycler for the ideal number of cycles Critical Parameters For best results adhere to the following rules High quality enzymes are critical for ampli fication success In particular terminal de oxynucleotide transferase TdT and RNaseH deficient reverse transcriptase RT need to be selected carefully TdT is delivered either in cacodylate containing or KH PO containing storage buffers Avoid cacodylate containing buffers unless they can be highly diluted Re verse transcriptase is sometimes contaminated with bacterial DNA Therefore check different batches of a manufacturer Always work under sterile conditions with filter tips and avoid RNase contamination It is also of great importance to protect the reactions from any nucleic acid contamination because DNA RNA molecules present in the tube will be amplified as well reverse transcriptase also uses DNA as a template Always work on ice During all wash steps using the magnet check that no beads are aspirated with the Supernatant Do not allow the beads to dry out This preserves the binding of the mRNA to the beads Wor
30. rounds each entailing sequential reverse transcription conversion to double stranded DNA using E coli DNA polymerase I and transcription using T7 RNA polymerase Use RNase free DEPC treated water in all recipes and protocol steps NOTE All centrifugation steps are performed in a benchtop microcentrifuge at room temperature Materials T7 oligo dT primer 0 5 g l 5 TCTAGTCGACGGCCAGTGAATTGTAATACGACTCACTATAGGGCG TTTTTTTTTTTTTTTTTTTTT 3 RNA extracted from laser microdissection LM sample see Basic Protocol 1 Diethylpyrocarbonate DEPC Sigma dNTP mix 10 mM Intermountain Scientific SuperScript I Reverse Transcriptase 200 U ul Invitrogen containing 5x first strand buffer 0 1 M DTT RNaseOUT Recombinant Ribonuclease Inhibitor 40 U ul Invitrogen T4 gene 32 protein 5 ug ul USB E coli DNA polymerase I 10 U ul New England Biolabs containing 10x DNA polymerase I buffer B Nicotinamide adenine dinucleotide hydrate B NAD 260 uM min 98 from yeast Sigma Ribonuclease H RNase H 2 U wul Invitrogen E coli DNA ligase 10 U ul New England Biolabs T4 DNA polymerase 3 U ul New England Biolabs Phenol Saturated Fisher Scientific pH 6 6 BP1750I 400 for step 10 pH 4 3 BP175 11 400 for step 18 Chloroform 0 75 ethanol as preservative Technical grade Fisher Scientific QIAquick PCR Purification Kit including Qiagen 250 columns Buffer PB Buffer PE Bufffer EB Sodium acetate 100 mM pH 5 2 certified AC
31. see recipe DMSO Sigma PCR primers see recipe 350 ng ul primers 1 and 2 350 ng ul M13 forward and reverse primers 5 U l Platinum Tag DNA polymerase Invitrogen 20 mg ml glycogen Roche Diagnostics 7 5 M ammonium acetate Sigma Dry ice methanol bath 5x loading buffer 50 mM EDTA 50 mM Tris Cl pH 8 0 APPENDIX 2 50 v v glycerol 20 w v polyacrylamide TBE minigels Novex 20 bp DNA ladder GenSura Discovery of 10 000x SYBR Green I Roche Diagnostics queer 25B 6 3 Current Protocols in Molecular Biology Supplement 80 Serial Analysis of Gene Expression SAGE 25B 6 4 Supplement 80 1x TBE 4PPENDIX 2 1 kb DNA ladder pZErO 1 plasmid Invitrogen Sphi and NEBuffer 2 New England Biolabs TE buffer pH 8 0 APPENDIX 2 SOC medium UNIT 1 8 0 01 ng ul pUC19 control DNA DH10B Electromax competent cells 70 C Invitrogen LB medium UNIT 1 1 optional LB plates with 100 ug ml ampicillin UNIT 1 1 10 cm zeocin containing low salt LB plate see recipe 10 1 U ul Tag Pfu polymerase Stratagene Exonuclease I USB Shrimp alkaline phosphatase USB 50 mM Tris Cl pH 8 0 APPENDIX 2 0 5 1 5 2 0 ml RNase free No stick siliconized microcentrifuge tubes Ambion Magnetic rack for 1 5 ml microcentrifuge tubes Dynal Biotech Tissue homogenizer e g Polytron PT1200 Brinkmann Instruments 23 G needles and 1 ml syringes 200 ul aerosol barrier pipet tips 16 and 65 C water baths heat bl
32. template preparation and cDNA AFLP reactions notice the reproducibility The same is true of samples B1 to B3 however these samples were induced differently than the A sample sets and therefore a number of differentially expressed cDNAs are detected between the two samples Fingerprints on the right represent 2 2 fingerprints and on the left corresponding 1 2 fingerprints The figure clearly shows that the cDNA fragments in the 2 2 fingerprints are a subset of the cDNA fragments in the 1 2 fingerprint tion e g secondary structure In the authors experience the major cause for this is deviation from the protocol as outlined above Annota tions to the steps highlight important consid erations The quality of the sequence gels can simply be verified by adding a sequence ladder to the gel Gels that work well for sequencing will be good for AFLP profiling as well results Typical transcript profiles show 50 to 100cDNA AFLP fragments per lane 1 e sam ple The profiles should change completely when a different primer combination is used with virtually none of the fragments being the same Transcript profiles from the same indi vidual will vary according to the tissue that is inspected and the conditions that are used e g developmental stages environmental factors pathogenic infections Figure 25B 5 4 dis AFLP Based Anticipated Results plays an example of a typical experiment with Transcript
33. that also encodes an M13 forward priming site and an Ascl restriction site The anchoring enzyme N alll is used to cleave the cDNA and produce 3 cDNA fragments with Niall cohesive overhangs These 3 cDNA fragments are captured onto magnetic streptavidin Dynabeads and subsequently purified The NlallI overhangs are then ligated with an nealed linkers 2A 2B that encode a priming site for PCR primer 2 which is used for subsequent amplification The cDNA is then released from the Dynabeads by digestion with AsclI restriction endonuclease The resulting cDNA library is then amplified using PCR primer 2 and M13 forward primer M13F A specific rSAGE PCR product is then generated using a SAGE tag specific primer with M13F The SAGE tag specific PCR product is then agarose gel purified and subsequently TA cloned into a sequencing vector Materials SuperScript Choice System cDNA synthesis kit Invitrogen DEPC ddH2O 5x first strand buffer 0 1 M DTT 10 mM dNTP 200 U ul SuperScript I reverse transcriptase 5x second strand buffer 10 U ul E coli DNA ligase 10 U pl E coli DNA polymerase I 2 U ul E coli RNase H Current Protocols in Molecular Biology Discovery of Differentially Expressed Genes 25B 6 17 Supplement 80 Serial Analysis of Gene Expression SAGE 25B 6 18 Supplement 80 5 U ul T4 DNA polymerase 1x and 5x T4 DNA ligase buffer 1 ug ul gel purified BRS1 primer see recipe 0 5 M EDTA pH 7 5 APPENDIX 2
34. the primers to ensure they are full length and free of any salts or other inhibitors The synthe sized primers can be gel purified although the authors prefer to use Nensorb Prep columns Du Pont NEN To use these columns the 5 trityl group on the primer must not be re moved see UN T2 11 for more information about the synthesis of oligonucleotides Primer design The two different adapters used during this protocol are created by annealing a 21 mer and a 25 mer oligonucleotide The sequences of four primers that these authors have used suc cessfully are listed in the Basic Protocol These primers contain sites for EcoRI or EcoRV how ever different restriction endonuclease sites or other special features for particular vectors may be desirable so this section outlines some con siderations in primer design First restriction endonucleases generally require at least four bases next to their recog nition sequences to work efficiently Second primers should contain minimal secondary structure to maximize annealing to the target sequence Third there should be no similarity between the primers that make up one set of adapters and those that make up the second set This is extremely important for the success of the subtractions and it is essential to check for any cross annealing by testing whether a primer from one set of adapters can amplify cDNA or a test DNA fragment ligated to the other adapter Fourth in order to per
35. which can then be utilized in a variety of transcriptomic anal yses including quantitative RT PCR qRT PCR microarrays hybridization or massively parallel sequencing RNA Seq The power and allure of LM technology for plant biolog ical research lies in the ability to sample discrete microdomains or cell types within plant tissues thereby eliminating the transcriptional background noise contributed by adjacent or contaminating unrelated tissues In this way profiles of localized gene expression are generated that are resolutely focused on the cells and tissues of interest Fig 25A 3 1 The protocols described in this unit are adapted specifically for microdissection of plant cells and tissues whose properties including cellulosic cell walls and large hydrolytic vacuoles present unique challenges to the implementation of LM technology Accord ingly the LM protocol described here differs from those in UNITS 25A 1 amp 25B 8 which are optimized for animal cells and tissues For additional reviews on the use of LM for tran scriptional profiling in plants see Kehr et al 2003 Day et al 2005 and Nelson et al 2006 A variety of laser assisted microdissection platforms are commercially available users are advised to evaluate several systems before deciding which platform is best suited for their samples The authors laboratories currently use the PALM P A L M Micro laser Technologies Carl Zeiss laser microdissection and pressu
36. www umich edu ehm eSAGE eSAGE at University of Michigan Helpful software for SAGE data analysis http www invitrogen com iSAGE at Invitrogen Integrated kit and software package for conducting microSAGE The protocol used is very similar to the one described here http arep med harvard edu labgc adnan projects Utilities mergesagetags html Merge SAGE tags at Harvard Medical School ber of downloadable human SAGE libraries con taining gt 3 5 million total tags as well as tools for submitting SAGE data for public access and tools Helpful tool for merging SAGE data files and down loaded predicted tag identify files from NCBI APPENDIX ALGORITHM FOR POISSON BASED SIGNIFICANCE ANALYSIS In a SAGE experiment a set of transcripts from a cell or tissue is sampled for tag extraction Considering the numerous types of transcripts present in a cell or tissue and the small probability of sampling a particular type of transcript the authors assume that the number of sampled transcripts of each type is approximately Poisson distributed Statistically when this actual sampling process is random enough Poisson would be the most practical and reasonable assumption compared to other probability models This assumption leads to the following probability models used for significance analysis and clustering analysis of SAGE data Based on Poisson assumption the authors developed a significance analysis algorithm SA algorithm to
37. 0 5 ul NOTE When preparing a cocktail master mixture to accommodate multiple samples excess reagents should be prepared to compensate for reagent loss during pipetting RNaseOUT is an inhibitor of RNaseA RNaseB and RNaseC type ribonucleases and is added to help prevent degradation of RNA samples during the ensuing reverse transcrip tase reaction 5 Mix gently and add 1 ul of Superscript I 200 U ul to each tube 6 Incubate 1 hr at 42 C If necessary at this point the samples can be stored indefinitely at 20 C Reverse transcription of the RNA occurs during this step to form single stranded DNA that contains the T7 RNA polymerase promoter at 5 end 7 Add 130 ul of the following mixture to each 20 ul reaction 10x E coli DNA polymerase I buffer 15 ul 10 mM dNTP mix 3 ul 260 uM B NADT 15 ul 10 U ul E coli DNA polymerase I 4 ul 2 U ul RNase H 1 ul 10 U ul E coli DNA ligase 1 ul H20 91 ul NOTE Prepare excess reagent mixture to compensate for reagent loss during pipetting L Microdiasecton 8 Mix gently and incubate 2 hr at 16 C and Amplification of Plant RNA During this step DNA polymerase I synthesizes second strand DNA molecules while DNA 25A 3 8 ligase will ligate the new molecules into a single uninterrupted DNA strand Supplement 87 Current Protocols in Molecular Biology 10 11 12 13 14 15 16 17 18 19 20 Add 2 ul of T4 DNA polymerase 3 U ul and incubate
38. 2 panels A 2 to C 2 A 3 and B 3 Many factors will influence the separation of the cell suspension on the Percoll gradient Thus adjusting the gradient to give the separation desired may be required Monitoring the distribution of cells throughout the gradient is helpful when beginning to determine optimum separation conditions Analyze DNA or RNA from single cell populations see Basic Protocols 2 and 3 DETERMINING NUMBER OF NEURONS RECOVERED In the preceding method see Basic Protocol 1 there are two steps 1 e steps 10 and 17 at which evaluating the yields of the cell type of interest should be performed The following procedure is presented for the evaluation of neurons but can be easily adapted for any cell type that can be distinguished on the basis of morphology or specific marker protein Materials Cell pellet see Basic Protocol 1 Cresyl violet solution see recipe 95 and 100 ethanol Xylene Permount Supertfrost Plus glass slides Fisher or equivalent with coverslips Additional reagents and equipment for analyzing neuron specific proteins e g neurofilament 200 kDa peptide by immunohistochemistry Sawtell 1997 Resuspend cell pellet in a known volume of 3xF H 0 Mix tube well by flicking and inverting several times to ensure uniform distribution of cells Dot five 1 ul aliquots of the cell suspension onto a Superfrost Plus glass slide or equivalent Keep cell suspension thoroughly mixed during aliqu
39. 2 ng ul with LoTE prior to use in SAGE library construction Current Protocols in Molecular Biology SUPPORT PROTOCOL 3 Discovery of Differentially Expressed Genes 25B 6 23 Supplement 80 BASIC PROTOCOL 3 Serial Analysis of Gene Expression SAGE 25B 6 24 Supplement 80 Perform and check ligation 6 Prepare the following ligation reaction 0 5 ul annealed undiluted 350 ng ml linker 1A phosphorylated linker 1B step 4 0 5 ul annealed undiluted 350 ng ml linker 2A phosphorylated linker 2B step 4 1 ul 10x T4 DNA ligase buffer 1 ul 5 U ul high concentration T4 DNA ligase buffer Incubate 4 hr at 16 C All linkers whether ordered prephosphorylated or phosphorylated in house should be checked for self ligation 7 Analyze product on a prepoured 20 polyacrylamide TBE gel Visualize as de scribed see Basic Protocol 1 step 37 Phosphorylated linkers should allow linker linker dimers 80 to 100 bp to form after ligation while nonphosphorylated linkers will prevent self ligation Only linker pairs that self ligate gt 70 should be used in further steps USING THE SAGE DATA ANALYSIS APPLICATION The SAGE Data Analysis Application is a statistical computational program imple menting a Poisson based algorithm for analysis of SAGE data Cai et al 2004 The application allows users to compare two or multiple SAGE libraries and to perform clus ter analysis The purpose of cluster analysis is
40. 5326 5328 Sawyer E J Hanby A M Ellis P Lakhani S R Ellis I O Boyle S and Tomlinson I P 2000 Molecular analysis of phyllodes tumors reveals distinct changes in the epithelial and stromal components Am J Pathol 156 1093 1098 Sgroi D C Teng S Robinson G LeVangie R Hudson Jr J R and Elkahloun A G 1999 In vivo gene expression profile analysis of human breast cancer progression Cancer Res 59 5656 5661 Sheehan D C and Hrapchak B B eds 1987a Specimen preparation for enzyme histochemis try In The Theory and Practice of Histotechnol ogy 2nd Edition pp 293 295 The C V Mosby Company St Louis MO Sheehan D C and Hrapchak B B eds 1987b Processing of tissue dehydrants clearing agents and embedding media n The Theory and Prac tice of Histotechnology 2nd Edition pp 59 78 The C V Mosby Company St Louis MO Shen C Y Yu J C Lo Y L Kuo C H Yue C T Jou Y S Huang C S Lung J C and Wu C W 2000 Genome wide search for loss of heterozy gosity using laser capture microdissected tissue of breast carcinoma An implication for mutator phenotype and breast cancer pathogenesis Can cer Res 60 3884 3892 Shibutani M Uneyama C Miyazaki K Toyoda K and Hirose M 2000 Methacarn fixation A novel tool for analysis of gene expressions in Discovery of Differentially Expressed Genes 25A 1 23 Supplement 55 Laser Capture Microdiss
41. 6 4 labeling oligonucleotides UNITS 4 6 4 8 amp 15 7 and phosphorimaging APPENDIX 3A Select single neurons 1 Dilute a portion of the enriched neuron sample with 3XF H O so that 1 ul contains neuron Add Ponceau S solution to a final volume of 1 200 and aliquot 1 ul neuronal suspension into the bottom of a 200 ul PCR tubes This dye allows easy visualization of neurons in the bottom of the PCR tube when viewed under a dissecting microscope but does not interfere with subsequent analyses 2 Examine each tube under a dissecting microscope and identify those containing a single neuron for use in step 3 The number of tubes will depend upon the anticipated frequency of the DNA sequence being analyzed In the authors studies a typical analysis will include 200 single neuron samples Immobilized DNase treatment and PCR reaction 3 Resuspend immobilized DNase on PVP beads in DNase reaction buffer so that 5 ul contains 100 beads Add a 5 ul aliquot to each PCR tube containing a single neuron Mix gently Incubate samples several hours or overnight at 37 C The purpose of the DNase treatment is to make sure that the DNA being measured is the DNA within the cell or cells in the PCR tube While DNase treatment could be performed on cells enmasse one could not be sure that some cells were not broken during purification and aliquoting of cells Prior to use of the immobilized DNase it is important to confirm that the DNase activity i
42. Add the bead suspension to the cDNA mixture and incubate 30 min at room temperature with gentle agitation Purification of a large number of samples using beads can be performed in 96 well format Incubation at room temperature is done in 96 well plates with caps Subsequently samples are transferred to fresh microtiter plates Collect beads with the MPC step 4 wash once with 100 ul of 1x STEX and transfer to a fresh microcentrifuge tube Wash twice more with 1x STEX and resuspend final bead pellet in 50 ul H O or 10 mM Tris Cl pH 8 0 0 1 mM EDTA Generally 250 to 500 ng ds cDNA will be obtained from the 500 ng of input single stranded poly A RNA 10 mM Tris Cl pH 8 0 0 1 mM EDTA is also known as T Eg buffer and has a lower EDTA concentration than the TE buffer described in APPENDIX 2 of this manual The ds cDNA is attached to the beads and is taken into subsequent steps while attached to the beads Current Protocols in Molecular Biology Discovery of Differentially Expressed Genes 25B 5 5 Supplement 57 Prepare the AFLP cDNA template fragments using TaqI and Msel 12 Mix the following 20 ul cDNA preparation generally 100 to 200 ng cDNA 10 U TadI restriction endonuclease 8 ul 5x RL buffer Adjust volume to 40 ul with H O Incubate 1 hr at 65 C 13 Add the following 10 U Msel restriction endonuclease enzyme 2 ul 5x RL buffer Adjust the volume to 50 ul with H O Incubate 1 hr at 37 C 14 P
43. Biology BASIC PROTOCOL 3 Discovery of Differentially Expressed Genes 25A 1 5 Supplement 55 BASIC PROTOCOL 4 Laser Capture Microdissection 25A 1 6 Supplement 55 la For cellular fluid Place a drop of cellular fluid e fine needle aspiration samples or cultured cells suspended in medium no larger than 5 mm in diameter towards the label end of a clean glass slide Quickly utilize the edge of another glass slide or preferably a hemacytometer cover to thinly spread the drop 1 e as if making a blood smear preparation on the slide in a single motion relying on capillary action between the liquid and the two slides to spread the liquid in a uniform thin layer across the length and width of the slide Do not apply excessive force which might result in crushing or shearing of cells Plain uncoated charged or silanized glass slides can be used We prefer to prepare cytologic smears with a hemocytometer cover because its width is slightly less than that of the standard glass microscopic slide and the resulting smear i e cells is not spread to or off the edge of the slide lb For fresh tissue Quickly sample by scraping tissue with a scalpel blade and then rapidly spread the scraped sample on a glass slide with the blade This is a quick and useful method of specimen preparation for tissues in which the desired cells can be readily identified cytologically such as highly malignant cells 2 Immediate
44. Expressed Genes 25A 3 11 Current Protocols in Molecular Biology Supplement 87 Laser Microdissection and Amplification of Plant RNA 25A 3 12 Supplement 87 preserving the cellular macromolecules lipids proteins nucleic acids carbohydrates in a state that best approximates that found in living tissues and enabling their efficient extraction Surveys of several chemical fix atives have concluded that reagents that co agulate or precipitate cellular molecules are superior to non coagulative or cross linking fixatives for use in LM mediated RNA analy ses Nakazono et al 2003 reviewed in Kehr et al 2003 Day et al 2005 Nelson et al 2006 Thus although non coagulative fixa tives such as formaldehyde and glutaraldehyde yield superior tissue histology these are gen erally avoided for LM studies owing to the greatly reduced yields of RNA extracted from cross linked tissues In addition to the ace tone fixative described in this unit a num ber of different coagulating fixatives have been used for LM analyses of plants includ ing ethanol ethanol acetic acid and chloro form acetic acid It is of critical importance that dissection times be minimized to 5 min or less per sam ple to avoid eliciting transcriptional responses to plant wounding If longer dissection times are mandated dissections should be performed while the plant tissues are immersed in fixa tive In addition fixation should be performed at c
45. Gillespie J W Paweletz C O Linehan W M Emmert Buck M R and Petricoin E F II 2000a Charac terization of intracellular prostate specific anti gen from laser capture microdissected benign and malignant prostatic epithelium Clin Cancer Res 6 353 356 Ornstein D K Gillespie J W Paweletz C P Duray P H Herring J Vocke C D Topalian S L Bostwick D G Linehan W M Petricoin E F II and Emmert Buck M R 2000b Pro teomic analysis of laser capture microdissected human prostate cancer and in vitro prostate cell lines Electrophoresis 21 2235 2242 Palmer Toy D E Sarracino D A Sgroi D Le Vangie R and Leopold P E 2000 Direct ac quisition of matrix assisted laser desorp tion ionization time of flight mass spectra from laser capture microdissected tissues Clin Chem 46 1513 1516 Paweletz C P Ornstein D K Roth M J Bichsel V E Gillespie J W Calvert V S Vocke C D Hewitt S M Duray P H Herring J Wang Q H Hu N Linehan W M Taylor P R Liotta L A Emmert Buck M R and Petricoin E F II 2000 Loss of annexin 1 correlates with early onset of tumorigenesis in esophageal and prostate carcinoma Cancer Res 60 6293 6297 Peterson L A Brown M R Carlisle A J Kohn E C Liotta L A Emmert Buck M R and Krizman D B 1998 An improved method for construction of directionally cloned cDNA li braries from microdissected cells Cancer Res 58
46. If desired freeze the sample after this step at 8O C The authors have stored samples for up to 12 months without any negative effect On continuation resuspend the beads after thawing and rotate for 5 min Table 25B 8 1 Volumes of Beads and Lysis Buffer for Given Numbers of Cells No of cells Oligo dT beads Lysis buffer 1 10 10 ul 10 ul 11 50 30 ul 30 ul 51 300 50 ul 50 ul gt 300 3000 50 ul 50 200 ul Current Protocols in Molecular Biology Table 25B 8 2 cDNA Synthesis Mixes No of samples 1 2 3 4 5 6 7 8 9 10 CDNA synthesis mix I 5x first strand buffer 2 4 6 8 10 12 14 16 18 20 0 1 M DTT 1 2 3 4 5 6 7 8 9 10 10 Igepal 0 5 1 1 5 2 2 3 3 5 4 4 5 5 H O 0 5 1 1 5 2 23 3 aD 4 4 5 5 cDNA synthesis primers 6 12 18 24 30 36 42 48 54 60 cDNA synthesis mix II 5x first strand buffer 2 4 6 8 10 12 14 16 18 20 0 1 M DTT 1 2 3 4 5 6 1 8 9 10 10 mM dNTP 1 2 3 4 5 6 7 8 9 10 H O 5 10 15 20 25 30 35 40 45 50 Reverse transcriptase 1 2 3 4 5 6 y 8 9 10 All solution volumes are indicated in microliters Synthesize cDNA 5 Prepare cDNA synthesis mix I and II see Table 25B 8 2 on ice while the beads are rotating Add the reverse transcriptase to mix II just before use Never use a reverse transcriptase with RNase H activity 6 Add an equal volume of Igepal wash buffer to the cell lysate containing the mRNA bound to the beads and place tube in the magnet Remove supernatant after the beads have completely adhered to the tube at t
47. Other buffer recipes can be found in many of the references provided and at the BioProtocol web site http www bioprotocol com however it is best to customize the buffer to the methodology of the specific laboratory The authors prefer to use Trizol Life Technologies or Stat 60 Tel Test for cell lysis and RNA stabilization prior to RNA extraction and have not provided a recipe for an RNA lysis buffer however other buffers containing guanidine thiocyanate and 2 mercaptoethanol can also be used The caps fit well in standard 0 5 ml microcentrifuge tubes When properly seated the cap does not sit down fully in the tube but should be seated evenly Capped tubes will leak if the cap is pushed all the way down into the tube so that the top portion of the cap touches the lip of the microcentrifuge tube 17 Invert the tube so that the lysis buffer contacts the cap surface Flick the tube to move the lysis buffer to the cap surface if necessary Place on ice or refrigerate until the microdissection session is over if this will help to preserve the analyte in the chosen lysis buffer This sample is now ready to be processed by appropriate methods for the analyte of interest LASER CAPTURE MICRODISSECTION OF SINGLE OR A SMALL NUMBER OF CELLS Arcturus Engineering has developed a line of related consumables that are specially designed for high sensitivity capture and extraction of a single cell or a minimal number of cells There are three k
48. Petsch Cornell University agarose gel image of IVT amplified RNA is kindly provided by X Zhang University of Georgia mounted above the samples Thus the PALM system enables the destruction of closely surrounding non targeted tissues by laser ablation before isolation of the cells tissues of interest thereby eliminating undesired contaminant transcripts from the sample pool Current Protocols in Molecular Biology LASER MICRODISSECTION OF PLANT RNA The following protocol details procedures for LM and subsequent RNA isola tion amplification from acteone fixed and paraffin embedded shoot apical meristem SAM tissue obtained from 14 day old maize seedlings Although procedures are fo cused on SAM tissue this method has been utilized in LM analyses of a variety of plant cell and tissue types with minor modifications in infiltration and embedding times as described below Materials Maize seedlings 14 days post germination Acetone 100 Fisher Scientific ice cold and room temperature Ice Xylene Fisher Scientific Diethylpyrocarbonate DEPC Sigma 100 ethanol Mineral oil optional PicoPure RNA Isolation Kit Arcturus Razor blade single edged Petri dishes glass Scintillation vials 20 ml Fisher Scientific Vacuum apparatus Rotator e g Ted Pella Paraplast chips Paraplast 56 C Oxford Labware Oven preset to 60 C Gradient metal warming plate a paraffin embedding center can be used if one is av
49. Protocol 1 Global Amplification and Basic Protocol 2 Non Radioactive Gene Expression Analysis on Nylon Arrays enables quick analysis of global gene expression from 30 to 200 cells from 5 um sections Materials also see Basic Protocol 1 Resectioned tissue snap frozen in liquid nitrogen and stored at 80 C see Alternate Protocol 1 OCT embedding compound Tissue Tek Miles also see UNIT 254 1 Mayer s hematoxylin solution Sigma 70 95 and 100 ethanol Lysis buffer from Oligo dT kit see Basic Protocol 1 Cryostat Slides for the PALM Laser MicroBeam System PALM PALM Laser MicroBeam System PALM Current Protocols in Molecular Biology DNA and RNA lysis buffer _ gt ss lt gt l lid of PCR tube N isolation microdissected gt area laser cryosection membrane slide Figure 25B 8 2 Isolation of small tissue samples by laser microdissection and catapulting using the PALM system 1 Embed the tumor sample in OCT embedding medium UNIT 25A 1 and cut the sample to 5 um thick slices on slides for the PALM Laser MicroBeam System using a cryostat 2 Place the slides in Mayer s hematoxylin solution for 45 sec in water for 5 min and in distilled water for 1 min 3 Dehydrate sections in 70 95 and 100 ethanol for 60 sec in each concentration 4 Dry stained tissue sections overnight at room temperature The slides are ready for the Laser MicroBeam System For the PALM Laser MicroBeam
50. R A and Liotta L A 1996 Laser capture microdissection Science 274 998 1001 Espina V Heiby M Pierobon M and Liotta L A 2007 Laser capture microdissection tech nology Expert Rev Mol Diagn 7 647 657 Gillespie J W Best C J Bichsel V E Cole K A Greenhut S F Hewitt S M Ahram M Gathright Y B Merino M J Strausberg R L Epstein J I Hamilton S R Gannot G Baibakova G V Calvert V S Flaig M J Chuaqui R F Herring J C Pfeifer J Petricoin E F Linehan W M Duray P H Bova G S and Emmert Buck M R 2002 Evaluation of non formalin tissue fixation for molecular profiling studies Am J Pathol 160 449 457 Goldsworthy S M Stockton P S Trempus C S Foley J F and Maronpot R R 1999 Effects of fixation on RNA extraction and amplification from laser capture microdissected tissue Mol Carcinog 25 86 91 Jiang K Zhang S Lee S Tsai G Kim K Huang H Chilcott C Zhu T and Feldman L J 2006 Transcription profile analyses identify genes and pathways central to root cap functions in maize Plant Mol Biol 60 343 363 Kamme F Zhu J Luo L Yu J Tran D T Meurers B Bittner A Westlund K Carlton S and Wan J 2004 Single cell laser capture microdissection and RNA amplification Meth ods Mol Med 99 215 223 Kehr J 2003 Single cell technology Curr Opin Plant Biol 6 617 621 Kerk N M Ceserani T
51. Support Protocol 3 Prehybridize nylon array by placing the nylon membrane containing the cDNA array in a small hybridization tube add 6 ml DIG Easy Hyb solution supplemented with 100 ug ml E coli DNA that has been digested with DNase I to a size of 100 to 1000 bp and prehybridize for at least 6 hr at 45 C Current Protocols in Molecular Biology Table 25B 8 5 PCR Master Mix for Non Radioactive Gene Expression Analysis No of samples 1 2 3 4 5 6 7 8 10x ELT buffer 1 5 10 15 20 25 30 35 40 dNTP mix 1 75 3 5 5 25 7 8 75 10 5 12 25 14 20 formamide 7 5 15 2295 30 37 5 45 J29 60 24 uM CP2 primer 5 10 15 20 25 30 35 40 Dig UTP 2 5 L3 10 123 15 17 5 20 H O 28 56 84 112 140 168 196 224 3 5 U ul DNA polymerase mix 0 5 1 1 5 2 2i 3 3 5 4 All solution volumes are indicated in microliters Be aware that several commercial membranes are heavily contaminated with bacterial and or plasmid DNA The additional DNA in the hybridization solution serves not only to block all non specific binding of labeled probe but also any amplified bacterial plasmid DNA contaminating the enzyme preparations used to generate probes All enzyme prepa rations contain traces of bacterial RNA DNA that will be amplified by the highly sensitive amplification protocol and sometimes hybridize to bacterial plasmid DNA on the filters Therefore even with the additional DNA some poor arrays might not be usable Always test the quality of the arrays by labeling and hyb
52. TE buffer and transfer the mixture to a 1 5 ml microcentrifuge tube Wash the hybridization tube with 250 ul TE buffer and add it to the hybridization mix the volume is now 500 ul Add 500 ul phenol chloroform isoamyl alcohol vortex and microcentrifuge min to separate the phases Current Protocols in Molecular Biology 18 Transfer the upper aqueous phase to a new tube Reextract this phase with 500 ul chloroform isoamyl alcohol as in step 17 Recover the aqueous phase and add 50 ul of 3 M sodium acetate pH 5 2 and 1 ml ethanol Precipitate as in steps 7 and 8 Resuspend the washed and dried pellet in 12 ul TE buffer Chloroform isoamyl alcohol extraction ensures removal of SDS and formamide Ligate the DNA 19 Ligate the insert DNA to Agt10 not Agt11 phage arms by adding in the following order final volume 25 ul 12 ul insert DNA 10 ul Agt10 phosphatased phage arms 10 ug 2 5 ul 10x ligase buffer 0 5 ul T4 DNA ligase 200 U Mix by gently pipetting up and down and incubate overnight at 12 to 15 C Package and plate the library 20 Start a fresh overnight culture of E coli C600hflA and the next morning package the ligation from step 19 with 8 to 10 commercial A phage packaging extracts according to manufacturer s instructions The vector gt10 is used here because it permits selection of recombinants when grown on the appropriate host Ten micrograms of bacteriophage vector is roughly an equimolar amount of
53. Tausta S L Sussex I M and Nelson T M 2003 Laser capture microdis section of cells from plant tissues Plant Physiol 132 27 35 Klink V P Alkharouf N MacDonald M and Matthews B 2005 Laser capture microdissec tion LCM and expression analyses of Glycine max soybean syncytium containing root re gions formed by the plant pathogen Heterodera glycines soybean cyst nematode Plant Mol Biol 59 965 979 Luo L Salunga R C Guo H Bittner A Joy K C Galindo J E Xiao H Rogers K E Wan J S Jackson M R and Erlander M G 1999 Gene expression profiles of laser captured adjacent neuronal subtypes Nat Med 5 117 122 Luzzi V Mahadevappa M Raja R Warring ton J A and Watson M A 2003 Accurate and reproducible gene expression profiles from laser capture microdissection transcript ampli fication and high density oligonucleotide mi croarray analysis J Mol Diagn 5 9 14 Mustafa D Kros J M and Luider T 2008 Combining laser capture microdissection and proteomics techniques Methods Mol Biol 428 159 178 Nakazono M Qiu FE Borsuk L A and Schnable P S 2003 Laser capture microdis section a tool for the global analysis of gene expression in specific plant cell types Identifi cation of genes expressed differentially in epi dermal cells or vascular tissues of maize Plant Cell 15 583 596 Nelson T Tausta S L Gandotra N and Liu T 2006 Las
54. The hybridization mix can be stored at 20 C and re used for additional filters Before re using the hybridization mix denature the solution for 10 min at 80 C 6 Wash the membrane in development buffer for a few seconds at room temperature then block in 25 ml development buffer 2 for 30 min with gentle agitation Current Protocols in Molecular Biology 9 10 45 50 15373 LTS 67 5 75 45 50 229 25 252 280 4 5 50 Discovery of Differentially Expressed Genes 25B 8 11 Supplement 61 BASIC PROTOCOL 3 Gene Expression Analysis of A Single or Few Cells 25B 8 12 Supplement 61 7 Dilute 2 5 ul anti digoxigenin AP Fab fragment antibody directly into the 25 ml development buffer 2 and incubate for an additional 30 min at room temperature 8 Pour off development buffer 2 and wash two times 15 min each in development buffer 1 containing 0 3 Tween 20 at room temperature This step will remove the unbound antibody Detect binding with chemiluminescent substrate 9 Prepare 50 ml of development buffer 3 and prepare 1 ml of chemiluminescent substrate by mixing 10 ul CSPD with 990 ul development buffer 3 Equilibrate the membrane for a few seconds in the remaining development buffer 3 10 Place the membrane between two acetate sheets Lift the top sheet of plastic and add 1 ml of the chemiluminescent substrate from step 9 scattering the drops over the surface of the membrane Carefully lower the top sheet o
55. a total number of 12 x 16 192 reactions to be performed for complete coverage of all generated 3 end fragments Two rounds are chosen since the discrimination of a polymerase against extension of primers distinguished by a mismatch at the second last position is much less pronounced than the discrimination against extension of terminal mismatches prohibiting use of primers carrying two selective bases at their 3 end in a single round of PCR However in practice a certain extent of bleedthrough can still be observed 1 e amplification of fragments with a given selective primer which theoretically should not take place due to a 3 terminal mismatch of the annealed primer IfmRNA complexity is not too high e g material obtained from cell cultures or simple tissues of low complexity this bleedthrough usually does not cause any problems nevertheless when working with highly complex samples e g RNA isolated from mammalian brain bleedthrough may render band patterns too crowded for reliable isolation of particular bands of interest To reduce bleedthrough both first and second amplification reactions can be performed in a two phase manner see the Alternate Protocol The first phase performed at extremely low concentrations of dNTPs e 2 uM each involves 10 first amplification or 15 second amplification cycles and defines which products will be amplified to a detectable level This phase exploits t
56. absence of dNTP which consequently has to be included in mix II The reason for the hot start is to avoid unspecific priming and extension of the CP2 primers that bound to the single stranded cDNA at low temperatures until 94 C is reached The longer extension time in cycles 20 to 39 is due to the increased amount of product 16 Store sample at 20 C Evaluate global amplification and validate genes 17 Check 3 to 5 ul of the primary PCR on a 1 5 agarose gel for the presence of a smear in the range of 300 to 2000 bp 18 Test amplification success by performing gene specific PCR on at least two house keeping genes For human cells use the primers for B actin and EF 10 see Materials in the conditions outlined below see step 19 For other species choose design primers specific to house keeping genes of those species To test amplification success perform gene specific PCRs for selected genes Each gene specific PCR should be individually optimized For most transcripts best results will be obtained after dilution of the primary amplifications in water 1 10 As the length of the amplified cDNA is usually lt 1000 bp choosing primers that amplify sequences of 150 to 200 bp is recommended as this size range produces the best results 19 Make up a PCR reaction containing 2 5 ng of each cDNA in a 25 ul reaction containing 1x PCR buffer Sigma 200 uM dNTPs 0 4 uM of each primer B actin or EF 1q and 0 75 U Taq polymera
57. apple com safarl Current Protocols in Molecular Biology Files Raw SAGE data should be in tab delimited text format with tags in rows and SAGE libraries in columns For security purposes the header line identifying the data in each column has been removed see Fig 25B 6 3 The SAGE Data Analysis Application requires that the data file be sorted by the tag sequence column see the first column in Fig 25B 6 3 In a Unix system this can be done with the sort command and in Microsoft Windows system this can be done by choosing from the menu Records gt Sort in Microsoft Access or Data gt Sort in Excel After sorting export or save data as a tab delimited text file If the Cluster Analysis module is used the columns that contain tag counts for all libraries in the data file must be next to each other 1 e if the libraries start from the second column and there are 5 libraries the 2nd through 6th columns should be the columns for tag counts from each individual SAGE library see Fig 25B 6 3 NOTE The data file can have as many extra columns as desired As long as the correct column numbers are specified for the tag counts and first library the program should work Mozilla Firefox File Edit View History Bookmarks Tools Help gt mozilla org mozillaZine W mozdev org Genome Biology K BioMed Centra AAAAAARAAR 23 53 23 10 AAAAAARAAC 22 30 24 11 AAAAAAAALAG 19 67 26 12 AAALAAAAAG
58. be as great as that from tissue culture cells or fresh tissue but it can be more than adequate to permit qualitative analysis by RT PCR Figure 25A 2 2A 1 to D I shows several tissues including cerebral cortex trigeminal ganglia liver and diaphragm after fixation and dissociation 10 Determine the number of neurons recovered see Support Protocol Current Protocols in Molecular Biology f E igl TA TE A u S a E Ja an OERAL fs gt 5 Ti Figure 25A 2 2 Photomicrograph showing tissues after dissociation and density gradient centrifu gation Following perfusion fixation several tissue types were removed finely minced and disso ciated as described in this protocol The total dissociated cell suspensions obtained from cerebral cortex A 1 trigeminal ganglia B 1 liver C 1 and diaphragm D 1 are shown Following density gradient centrifugation enriched populations of neurons were obtained from cerebral cortex A 2 A 3 and trigeminal ganglia B 2 Enriched populations of satellite and support cells isolated from trigeminal ganglia are shown in B 3 An example of marker based separation is shown in panels E 1 to E 3 A mouse infected with a virus containing a B galactosidase expression cassette was perfusion fixed and the trigeminal ganglia removed and stained histochemically for B galactosidase activity using Xgal The dark spots in panel E 1 are blue neurons a result of the action of B gala
59. bromphenol blue 0 09 w v xylene cyanol FF Store at 4 C COMMENTARY Background Information Current methods to distinguish mRNAs in comparative studies rely largely on differential or subtractive hybridization techniques He drick et al 1984 Lee et al 1991 Several important genes implicated in tumorigenesis have been isolated using these methods Steeg et al 1988 Although subtraction is quite sen sitive and can detect fairly rare mRNAs see UNIT 25B 1 the method recovers genes incom pletely and selects for genes in only one direc tion at a time during a two way comparison between a pair of cells The process is also laborious and time consuming The differential display technique was de veloped with the goal of identifying differen tially expressed genes detecting individual mRNA species that are changed in different sets of mammalian cells then recovering and clon ing the cDNA Liang and Pardee 1993 Liang et al 1993 This method utilizes polymerase chain reaction PCR amplification and dena turing polyacrylamide gel electrophoresis two of the most commonly used molecular biologi cal methods and provides a sensitive straight forward and flexible approach to detect genes that are differentially expressed at the mRNA level In differential display each RNA sample is first reverse transcribed with a degenerate an chored oligo dT primer set that anneals at the start of the poly A tails of mRNAs Ea
60. by T7 RNA po lymerase or PCR amplification Both proce dures have advantages and disadvantages and the one used depends on the experimental situ ation As a general rule PCR based methods are easier to handle and less time consuming al though there are concerns about the quantita tive reliability of measurements obtained after exponential amplification Brail et al 1999 The linear amplification achieved by T7 RNA polymerase also referred to as the Eberwine protocol Eberwine et al 1992 Kacharmina et al 1999 has the advantage that a failure to amplify a given transcript will not be exponen tially transmitted On the other hand there are several publications using PCR based proto cols showing that the relative abundance of transcripts is preserved even after 50 cycles T7 RNA polymerase based methods have been applied to cDNA and oligonucleotide arrays but so far the least number of cells that could be used successfully was 1000 Luo et al 1999 The methods provided in this unit are PCR approaches and therefore are inherently prone to exponentially propagate initial amplification errors The authors primary intention was to obtain a qualitative representation of a single cell transcriptome rather than preserving the numerical ratios of transcript abundance Klein et al 2002 Having established the method for single cells the authors saw that quantitative differential analysis of gene expression with
61. celltype A cell type B extract band of interest steps 17 24 reamplify step 25 purify by agarose gel electrophoresis and extraction UNITS 2 5 amp 2 6 probe for northern probe for cDNA sample for subcloning blot hybridization library screening and sequencing UNIT 4 9 UNIT 6 3 UNITS 15 4 amp 7 4 Figure 25B 3 1 Schematic representation of differential display Diagram of gel represents results with a single primer set for two cell types A and B Dashed line RNA solid line DNA T MN degenerate oligo dT primer M indicates A C or G degenerate N can be A C G or T 65 95 80 and 100 C water baths Thermal cycler Whatman 3MM filter paper Additional reagents and equipment for preparing total UNIT 4 2 or poly A UNIT 4 5 RNA quantitating RNA APPENDIX 3D PCR UNIT 15 1 agarose formaldehyde gel electrophoresis UNIT 4 9 denaturing PAGE UNIT 7 6 autoradiography APPENDIX 3A agarose gel electrophoresis UNIT 2 54 purifying DNA from agarose gels UNIT 2 6 analysis of RNA by northern blot analysis Differential UNIT 4 9 Screening libraries using oligonucleotide probes UNIT 6 3 cloning RN eck PCR products UNIT 15 4 and dideoxy DNA sequencing UNIT 7 4 25B 3 2 Supplement 56 Current Protocols in Molecular Biology CAUTION This procedure should be performed only by personnel trained in the proper use of P isotope and in NRC licensed sites Standard precautions to prevent exc
62. chemical fixation prior to dissociation Yields of even fragile adult cell types such as neurons are high Distinct mor phological features such as brush borders of the intestinal epithelial cells as well as nuclear and cytoplasmic nucleic acid staining patterns are comparable to those in sectioned tissues Sawtell 1997 DNA and RNA isolated from dissociated tissues are reasonably intact By immunohistochemical staining the distribu tion of cytoskeletal proteins including actin and neurofilament 200 kDa peptide are similar in dissociated cells when compared to sectioned tissue Sawtell 1997 The impetus for development of this proto col arose out of the need in the author s labora tory to identify the cell types and to quantify the number of cells in a specific solid tissue that harbored the latent HSV genome It was also important to determine the number of viral genomes in each of those cells The approach has proven extremely useful for this purpose Sawtell 1997 Thompson and Sawtell 1997 2000 2001 Sawtell et al 1998 Sawtell et al 2001 however this method should be widely useful for facilitating the analysis of rare cells or cellular events occurring in a complex multi cellular environment Critical Parameters and Troubleshooting In developing this procedure several com mon fixation formulations were tested in com bination with alternative digestive enzymes For the most part tissues either remained a sol
63. clean 50 ml centrifuge tube Carefully pipet the cell suspension onto the Ficoll Paque It is best not to mix the Ficoll Paque with the specimen at this point 5 Centrifuge 10 min at 350 x g room temperature After centrifugation the top and clearest layer contains any epithelial cells and some white blood cells The middle layer is the Ficoll Paque and the lowest layer is predominantly red blood cells and white blood cells 6 Prepare the superficial cell layer as direct smears or cytospins see Basic Protocols 3 and 4 HEMATOXYLIN AND EOSIN STAINING Histologic section and cytologic preparations must be stained so that the component cells can be adequately visualized for accurate identification hematoxylin and eosin stain is commonly used for this purpose With this stain nuclei are black blue and cell cytoplasm and most extracellular material are varying shades of pink Although both hematoxylin and eosin staining solutions can be prepared from their basic components the authors recommend purchasing prepared ready to use stains Materials Sample on a glass slide see Basic Protocols 1 to 4 70 95 and 100 ethanol Sterile distilled or RNase free water Mayer s hematoxylin Richard Allan Scientific Bluing reagent Richard Allan Scientific Eosin Y Xylene For frozen sections optional Rapidly remove the sample on a glass slide from 80 C storage see Basic Protocol 1 and immerse in or flood with
64. cutting enzyme Performing RMDD with a second enzyme assuming both enzymes recognize 80 of cDNAs each would provide a total coverage of 96 of all transcripts RMDD LIBRARY PREPARATION AND TWO ROUND AMPLIFICATION This protocol describes conversion of total RNA to labeled PCR products which are ready to be displayed by gel electrophoresis Materials 50 ug total RNA UNITS 4 1 amp 4 2 RNase free water 10 uM cDNA primer CP29V 5 ACC TAC GTG CAG ATT TTT TTT TTT TTT TX 3 X A C or G equimolar amounts of all three species see UNIT 2 11 for oligonucleotide synthesis 100 mM RNase free DTT Life Technologies 5x SuperScript buffer Life Technologies 10 mM RNase free and standard dNTPs 40 U ul RNase inhibitor e g RNasin 200 U ul SuperScript I reverse transcriptase Life Technologies 5x second strand buffer II UNIT 5 5 1 5 U ul RNase H 10 U ul E coli DNA polymerase I Phenol equilibrated with TE buffer pH 8 0 UNIT 2 1A Chloroform 20 mg ml glycogen 28 PEG 8000 3 6 mM MgC see recipe 70 and 100 ethanol 10x universal buffer Stratagene 4 U ul Mbol restriction endonuclease Stratagene 3 M sodium acetate pH 5 2 APPENDIX 2 10 mM ATP 0 5 ug ul Mbol linker ML2025 see recipe T4 DNA ligase and 10x buffer Roche 1x and 0 25x TE buffer pH 8 0 APPENDIX 2 4 uM primer CP28X 5 ACC TAC GTG CAG ATT TTT TTT TTT TTT TX 3 X A C or G see UNIT 2 11 for oligonucleotide synthesis 4
65. equipment by placing tubing from a peristaltic pump in the bottom of a 50 ml conical tube containing 30 to 40 ml Streck tissue fixative STF Attach a 27 G needle to the other end this will be inserted into the left ventricle Run fixative through the line Place a50 ml conical tube containing 50 ml STF in an 80 C water bath and equilibrate to temperature Heat facilitates the inactivation of nucleases While the fixative is heating anesthetize the animal by intraperitoneal injection of 80 to 100 mg kg sodium pentobarbital As soon as deep reflexes are fully deadened 1 e in mice lack of corneal reflexes 1 e no blinking response when touched with the tip of a gloved finger and response to pinching rear paw very firmly place the animal ventral surface up on absorbent paper and wet the chest and abdomen with 95 ethanol Isoflurane can be used as an alternative anesthetic Use forceps to lift the skin and using a scalpel make a T shaped incision starting over the abdomen with the vertical and horizontal cut centers at the base of the sternum just below the diaphragm Cut the diaphragm along the rib line and keep the chest cavity open by clamping the base of sternum with a small hemostat rotating it upward toward the chest For additional information on animal handling see Coligan et al 2001 Chapter 1 Insert the needle at the end of the pump tubing into the left ventricle and start the pump adjustin
66. for labeling which is due to the fact that sensitivity is not limited by the amount of amplification product used for dis play but by a slight background smear which cannot be avoided when separating complex mixtures of PCR products by gel electrophore sis It is important to note that due to the use of nonphosphorylated linkers only one of the two linker strands is covalently attached to the cDNA restriction fragments upon ligation The opposite linker strand is melted off during the initial denaturation step and can no longer serve as a primer binding site Thus amplification can take place only when extension of a non linker primer i e the downstream primer which is essentially identical to the cDNA primer has taken place incorporating the re verse complement of the covalently attached linker strand As a consequence only cDNA 3 ends are amplified to a detectable level whereas internal cDNA fragments flanked by linkers at both ends remain unamplified Another problem that had to be solved was band identification Classic protocols rely on cutting out invisible radioactive bands from dried gels after superimposing the gel and its corresponding autoradiogram Liang and Pardee 1992 In addition to the uncertainty of cutting invisible bands which may easily lead to missing the desired band tiny splinters of the radioactive gel which becomes quite brittle after drying might be inhaled On the other h
67. for reagent loss during pipetting Incubate the reaction mix 5 hr at 37 C During this step T7 RNA polymerase will transcribe antisense RNA from the T7 RNA polymerase promoter sequence that was incorporated into the cDNA prepared above This results in one round of RNA amplification Add 1 ul of RNase free DNase I 2 U ul and incubate 15 min at 37 C This step removes the cDNA template from the reaction mixture leaving amplified RNA aRNA that is antisense in orientation Add 30 ul of nuclease free H20 to the sample and extract with an equal volume 50 ul of 1 1 phenol pH 4 3 chloroform Extract with an equal volume of chloroform and transfer the aqueous layer to a new microcentrifuge tube During steps 18 and 19 the newly synthesized aRNA is purified by extraction with organic solvents to denature and remove enzymes and other proteins Concentrate sample in RNeasy mini column a Add 350 ul of Buffer RLT with 3 5 ul of 2 mercaptoethanol and mix thoroughly by inverting Current Protocols in Molecular Biology Discovery of Differentially Expressed Genes 25A 3 9 Supplement 87 Laser Microdissection and Amplification of Plant RNA 25A 3 10 Supplement 87 b Add 250 ul of absolute ethanol and mix thoroughly by pipetting Do not centrifuge O Apply the entire sample 700 ul to an RNeasy minicolumn placed in a 2 ml collection tube Centrifuge 15 sec at 8000 x g and discard the flowthrough
68. important because they reveal the degree to which A and B cDNAs still cross hybridize with B and A cDNAs respectively In general further subtractions are desired if the differential is lt 20 fold that is A hybridizes lt 20 fold better to itself than to B and vice versa Probing the subtracted cDNAs with a highly expressed gene or with a differentially expressed gene gives another indication of how well the subtractions are advancing Common abundant genes should become less abundant with increasing rounds of subtraction and the known differentially expressed gene should become enriched in one series of cDNAs and depleted in the other The A and B probes usually represent the common abundant genes and therefore behave accordingly that is they hybridize more strongly to cDNA from earlier rounds of subtraction and less so to later rounds When the evaluation suggests that no more subtractions are required then the A and B cDNAs should be cloned into an appropriate vector REAGENTS AND SOLUTIONS Use deionized distilled water in all recipes and protocol steps For common stock solutions see APPENDIX 2 for suppliers see APPENDIX 4 Alul buffer 10x 100 mM Bis Tris propane 1 3 bis tris hydroxymethyl methylamino pro pane Cl pH 7 0 100 mM MgCl 10 mM dithiothreitol DTT APPENDIX 2 Store up to 6 months at 20 C Driver dNTP mix 1 5 mM each dATP dCTP and dGTP 1 0 mM dTTP 0 5 mM bio 11 dUTP Enzo Diagnostics Store
69. long hydro carbon linker arm photobiotinylated driver sometimes precipitates out of the hybridization mix Nucleic acids with biotinylated nucleo tides incorporated during PCR seem as soluble as unmodified nucleic acids and precipitation in the hybridization mix does not occur at least in in the authors hands Another method for incorporating biotinylated nucleotides is to use biotinylated primers for PCR Rosenberg et al 1994 Second this protocol uses different adapters on the driver and tracer cDNAs The original protocol Wang and Brown 1991 used the same adapters for both tracer and driver to ensure that all sequences in tracer and driver amplified to the same extent however this also Table 25B 2 1 Method Advantages Subtractive cloning Targets rare mRNAs lt 0 001 Targets complete set of differentially expressed RNAs meant an increased risk of driver carry over into the next round of subtraction such carried over driver would be amplified along with the sub tracted cDNA and would decrease subtraction efficiency Using the different primers given here the authors have observed essentially equivalent PCR efficiency for the two cDNA pools Several other methods have been used to isolate genes that are differentially expressed between two or more cell populations see Table 25B 2 1 random sampling in which clones are randomly selected from a cDNA library differential hybridization in which probes made
70. may be omitted if blunt ended ligations are to be performed PCR amplification often results in the addition of an extra adenosine at the 3 end this should be removed by Klenow treatment UNIT 3 16 if blunt ended ligations are to be performed Alternatively the subtracted cDNAs may be cloned into a T vector UNIT 15 4 33 Purify digested cDNAs by phenol chloroform extraction and ethanol precipitation 34 Ligate the DNA into an appropriate vector UNIT 3 16 e g pBluescript digested with EcoRI or EcoRV Any convenient vector may be used see Critical Parameters and Troubleshooting Using noted the a vector with blue white selection is useful b it allows immediat t of th Siihteactive ue white selection is useful because it allows immediate assessment of the cDNA Cloning proportion of the library that contains inserts 25B 2 10 Supplement 55 Current Protocols in Molecular Biology 35 Transform the vector into a transformation competent bacterial strain UNIT 1 8 If the subtractions were done to or nearly to completion and most of the colonies contain inserts then it should be possible to pick colonies at random and check for differential expression Alternatively use the following steps to assess the quality of the library Assess subtracted libraries Replica filters of the library are probed to assess for percent differentially expressed clones and to provide an indication of the success of the subtractions 36 Pla
71. more robust clusters Some sources of this data include the SAGEmap http www ncbi nim nih gov SAGE and SAGE Genie http cgap nci nih gov SAGE sites found at NCBI and at http www mouseatlas org Suggestions for improved results Given the fact that observed SAGE tag levels are actually found in a Poisson distribution about their actual abundance level Audic and Claverie 1997 an abundance threshold can be usefully applied to the data prior to submission for cluster analysis The exact value to use should be determined empirically and largely depends on how many false positives one is willing to tolerate in each cluster Tag counts gt 5 in at least one of the SAGE libraries is a good value to start with Significance analysis indicates that when comparing 2 or more libraries with tag count 5 in one library versus tag count O or 1 in the other library p lt 0 05 This means SAGE tags that are included in clustering analysis are significantly differentially expressed tags Current Protocols in Molecular Biology Using the stand alone version of the software To perform the analysis of SAGE data on a desktop computer obtain a copy of the application from the SAGE Data Analysis Application Web site http genome dfci harvard edu sager and store it onto the desktop computer and double click the downloaded file to start installation Follow instructions to finish the installation process There will be an application icon called S
72. no knowledge of sequences but rather PCR amplification using arbitrary oligonucleotides and high resolution polyacrylamide gel electrophoresis UNITS 25B 4 amp 25B 5 describe variations on differential display restriction mediated differ ential display RMDD and amplified fragment length polymorphism AFLP based transcript profiling which make use offrequently cutting restriction enzyme sites in cDNAs and may offer advantages to the practitioner Current Protocols in Molecular Biology 25 0 1 25 0 2 July 2009 Published online July 2009 in Wiley Interscience www interscience wiley com DOI 10 1002 0471142727 mb2500s87 Copyright 2009 John Wiley amp Sons Inc Discovery of Differentially Expressed Genes 25 0 1 Supplement 87 Introduction 25 0 2 Supplement 87 UNITS 25B 6 amp 25B 7 contain different PCR based approaches for determining what genes are expressed in a given cell or tissue type UNIT 25B 6 describes serial analysis of gene expression SAGE This technique generates concatemers of short cDNA sequence tags that have been ligated together These concatemers can be cloned sequenced and analyzed with the aid of specialized software to identify differentially expressed genes and to compare their expression with those present in other SAGE libraries The unit also contains a protocol for cloning cDNA starting with a given sequence tag UNIT 25B 7 describes representational difference analysis RDA RDA c
73. of 5 mM dNTPs 32 ul of 10x PCR buffer 6 4 U AmpliTag Gold polymerase and adjusting the volume to 270 4 ul Dispense 16 9 ul dNTP polymerase mixture in the first two columns of the microtiter plate Current Protocols in Molecular Biology An individual reaction can be prepared by combining 2 ul of 1 500 selective preamplifica tion reaction product 0 5 ul of 1 6 pmol ul 5 ng labeled selective TaqI 2 primer 0 6 ul of 8 pmol ul 30 ng unlabeled selective MseI 2 primer 0 8 ul of 5 mM dNTPs 2 0 ul of 10x PCR buffer and 0 4 U AmpliTaq Gold polymerase The volume is adjusted to 20 ul with water 26 Amplify the material using the touch down PCR program specified in step 22 Generally a number of AFLP reactions will be performed in parallel and the indicated quantities of the reaction mixes should be adjusted accordingly Analyze amplification products by standard PAGE 21 28 29 30 31 I2 Mix the AFLP reactions with an equal volume 20 ul of loading dye Denature the AFLP reaction products by heating at 90 C for 3 min and then quickly cooling on ice CAUTION Formamide is harmful perform this step under a fume hood Treat the back plate of the sequencing gel system with 2 ml repel silane and the front plate with 10 ml bind silane solution Prepare 4 5 denaturing polyacrylamide gels 100 ml The authors use the BioRad SequiGen sequencing gel system 38 X 50 x 0 04 cm for which the para
74. of direct blotting electrophoresis See Support Protocol below ALTERNATE AMPLIFICATION BY TWO PHASE PCR Rae ere Alternatively the amplification steps see Basic Protocol steps 12 to 17 can be replaced by a two phase PCR see Strategic Planning This procedure decreases the bleedthrough sometimes observed between different PCRs obtained from the same sample by illegitimate priming i e priming with a mismatch at the primer s 3 ultimate base The approach is to perform the first 10 to 15 cycles of each PCR at an extremely low nucleotide concentration 2 UM each which increases the bias of Tag polymerase against mismatch extension After these initial cycles are finished and the product composition in each reaction has been defined reactions are supplemented with nucleo tides to a final concentration of 200 uM each thus allowing sufficient amounts of amplification products to be generated The drawback is the increase in hands on time required for pipetting Additional Materials also see Basic Protocol 0 1 mM dNTPs freshly diluted from 10 mM dNTPs Perform first round low concentration amplification 1 Synthesize ds cDNA see Basic Protocol steps 1 to 11 2 Set up first round 2 uM amplification reactions 12 different reactions per sample 20 ul each 2 0 ul template PEG precipitated ligation products see Basic Protocol step 11 2 0 ul 10x PCR buffer 1 5 ul 20 mM MgCl 0 4 ul 0 1 mM dNTPs freshly diluted
75. oligonucleotides and double stranded adapters 50 pmol ul Msel adapter top and bottom strands see recipe for oligonucleotides and double stranded adapters 10 mM ATP Pharmacia T4 DNA ligase Pharmacia 8 pmol ul AFLP 0 nonselective primers see recipe for oligonucleotides and double stranded adapters JagI 0 and MseI O primers 10x PCR buffer see recipe AmpliTaq DNA polymerase Perkin Elmer UNIT 3 5 10 uCi ul 2000 Ci mmol P y ATP Amersham 10x T4 polynucleotide kinase buffer see recipe T4 polynucleotide kinase Pharmacia UNIT 3 4 8 pmol ul AFLP 1 and 2 selective primers see recipe for oligonucleotides and double stranded adapters JagI 1 and 2 and MselI 1 and 2 primers AmpliTaqg Gold polymerase Perkin Elmer Loading dye see recipe Repel silane Pharmacia Bind silane solution fresh Combine 30 ul bind silane Pharmacia Biotech and 30 ul glacial acetic acid in 10 ml ethanol 4 5 denaturing polyacrylamide gels see recipe 1x TBE see recipe Molecular weight standard e g SequaMark 10 base ladder Research Genetics optional 10 acetic acid Microcentrifuge tubes RNase free Magnetic plate chamber MPC Dynal PE 9600 thermal cycler Perkin Elmer and PCR microtiter plate Discovery of Differentially Expressed Genes 25B 5 3 Current Protocols in Molecular Biology Supplement 57 AFLP Based Transcript Profiling 25B 5 4 Supplement 57 Sequencing gel system
76. paintbrush carefully place tissue sections Current Protocols in Molecular Biology Discovery of Differentially Expressed Genes 25A 3 5 Supplement 87 Laser Microdissection and Amplification of Plant RNA 25A 3 6 Supplement 87 17 onto slides floated with DEPC treated water Place slides with sections onto a slide warming tray at 40 C for 5 min or until the sections relax and decompress not to exceed 20 min Probe on Plus slides are coated with a charged tissue adhesive and are RNase free and thus are convenient and suitable for most LM applications However the use of PEN membrane coated slides permits sample microdissection with a minimal amount of tissue fragmentation Carefully remove water from underneath the relaxed section ribbons by tipping the slide onto absorptive paper towels Wick off residual water with tissue paper being careful not to disturb the ribbons Quickly place the slide back onto the slide warming tray and incubate overnight at 40 C to adhere tissue to slides Be sure to elevate one end of the slide during incubation to allow for air circulation and prevent the formation of air bubbles beneath the tissue Dried slides can be used right away or stored in a vacuum desiccator at 4 C for at least 14 days until utilized for laser microdissection Perform laser microdissection microcatapulting of plant cells 18 19 20 21 22 Bring sample slides to room temperature
77. plates to the preheated wells of a thermal cycler and cycle as described above see Basic Protocol step 13 except for only 10 rather than 25 cycles Perform second round normal concentration amplification 10 Cool reaction tubes on ice and add 20 ul of 200 uM amplification mix step 4 to each tube 11 Repeat the program see Basic Protocol step 13 this time using 20 cycles 1 e add 10 more cycles 12 Check products by agarose gel electrophoresis see Basic Protocol step 14 and UNIT 2 5A Agarose gel electrophoresis can be skipped if radioactive label is used In the latter case adhere to the usual precautions for working with radioisotopes APPENDIX 1F and handle samples at a dedicated workspace only DIRECT BLOTTING ELECTROPHORESIS The authors have found direct blotting electrophoresis DBE to be an extremely helpful technique to get high quality display results from amplified RMDD products and to simplify physical access to bands of interest In contrast with standard fragment analysis see Chapter 2 based on radioactive labeling it is not necessary for the sake of optimal resolution of different size ranges to perform short and long runs of each sample In DBE all fragments including the largest ones pass the whole length of the gel before being transferred to the blotting membrane providing unsurpassed resolution of bands in the size range relevant for RMDD Working with nonradioactive materials provide
78. precipitation steps Enzymatic activity of the reverse transcriptase or Taq polymerase should not be compromised by using less than an optimal supply of substrates or by inadequate buffers The basic goal of this protocol is to introduce two binding sites for PCR primers into cDNAs representing transcripts allowing amplification of each transcript uniformly Fig 25B 8 1 The first primer binding site 1s contained within a flanking region that lies at the 5 end of a random cDNA synthesis primer or an oligo dT primer The second is introduced through a tailing step using terminal deoxynucleotide transferase TdT Therefore three enzymatic steps are required cDNA synthesis tailing and PCR The use of a random primer has two advantages First it enables amplification of 5 regions that might be of interest e g when mutations are studied and second it leads to production of cDNAs of lengths that are optimal for PCR amplification However for cDNA synthesis with a random primer it is important to remove most of the rRNA and tRNA which comprise gt 95 of total cellular RNA Therefore mRNA is purified using 1 MRNA isolation AAAAAAAAAAAAAAAAAAAAA TITITIITITITITTITTTITTTTTTTT 2 primer hybridization AAAAAAAAAAAAAAAAAAAAAAAAAAAAA n A 5 Crn A TTTTTTT TVN NNNNNNNN 5 CCC CFI5cT CCC 5 CFI508 3 cDNA synthesis AAAAAAAAAAAAAAAAAAAAAAAAAAAAA N a TTTTTTT TVN SN m Ha 6 616 4 RNA removal G tailing
79. receptacle being careful not to dispose of any tissue samples Replace the volume with 60 C molten 100 Paraplast and incubate at 60 C Renew with fresh molten Paraplast twice per day at the beginning and end of each workday Repeat Paraplast infiltration at 60 C as in step 11 for 4 additional days Incubate overnight at 60 C after the last Paraplast change Prepare a gradient metal warming plate that is hot enough to melt Paraplast at one end but no greater than 60 C and room temperature on the opposite end a commercially available paraffin embedding station can be utilized for greater convenience Pour tissue and Paraplast from the vial into a metal weighing dish that has been placed on the hot side of the warming plate Using tweezers or a small paintbrush that 1s dedicated for use with molten Paraplast carefully transfer a single shoot tissue along with some molten Paraplast into the base mold Orient the tissue in the proper position for microtome sectioning and place the paraffin embedding ring over the base mold Fill the embedding ring base mold assembly block with molten paraffin Cool the block to room temperature slowly over at least 20 min by sliding gradually further and further down the warming plate toward the cool end Store solidified blocks in plastic bags at 4 C Overheated Paraplast will shrink and can cause tissue damage do not exceed 60 C Denser materials will require longer Paraplast infiltration
80. remove air spaces trapped within samples that may prevent penetration of fixative If the samples sink readily this step may not be necessary Be careful not to boil the solution during vacuum infiltration as this may cause tissue damage As air is removed the samples will rise to the surface infiltrated samples will rapidly sink to the bottom of the vial once the vacuum is released Xylene infiltrate samples 4 The next day bring the samples to room temperature and replace the fixative with fresh room temperature 100 acetone Rotate hr at room temperature 5 Replace the fixative with a mixture of acetone xylene 1 1 and rotate 1 5 hr at room temperature 6 Perform three solution changes of pure xylene incubating hr at room temperature after each change IMPORTANT NOTE Xylene is irritating to the skin eyes and respiratory tract ingestion or inhalation can cause systemic toxicity Always work in a fume hood Acetone is a polar yet versatile solvent that is miscible with H20 as well as most nonpolar organic solvents During the fixation step all aqueous components of the tissue are gradually replaced with the polar solvent acetone During xylene infiltration the acetone is gradually replaced with the nonpolar solvent xylene in preparation for embedding with the nonpolar Paraplast medium If the sample is very dense or contains multiple tissue layers more gradual infiltration should be performed using 3 1 I 1 and 1 3 mixtur
81. restriction fragment length polymorphism RFLP analysis DNA methylation analysis fluorescence in situ hy bridization and comparative genomic hybridi zation Finkelstein et al 1999 Guan et al 1999 DiFrancesco et al 2000 Jones et al 2000 Shen et al 2000 Slebos et al 2000 Gene expression analysis has been accom plished from LCM samples utilizing reverse transcription PCR construction of cDNA li braries and differential hybridization on high density spotted nylon filters or glass microar rays Peterson et al 1998 Fend et al 1999b Kuecker et al 1999 Luo et al 1999 Sgroi et al 1999 Garrett et al 2000 Leethanakul et al 2000 Ohyama et al 2000 Successful proteomic analysis has been accomplished by coupling LCM with immunoblotting UNIT 10 8 solid phase sequential chemiluminescent im munometric assay one dimensional and two dimensional polyacrylamide gel electrophore Current Protocols in Molecular Biology sis PAGE UNITS 10 2 10 4 protein chip surface enhanced laser desorption ionization SELDI mass spectrometry as well as matrix assisted laser desorption ionization time of flight MALDI TOF mass spectrometry Wright et al 1999 Natkunam et al 2000 Ohyama et al 2000 Ornstein et al 2000a b Palmer Toy et al 2000 Simone et al 2000 also see UNIT 10 21 For all these assays the expected results will depend on the quality of preservation of the analyte of interest withi
82. sodium acetate pH 5 2 APPENDIX 2 100 70 and 85 ethanol Diethylpyrocarbonate DEPC treated H O UNIT 4 1 10 uM each degenerate anchored oligo dT primer set 5 T MN 3 e g GenHunter TMG T MA TMT and T MC M represents G A or C 5x MoMuLV reverse transcriptase buffer UNIT 15 6 0 1 M dithiothreitol DTT APPENDIX 2 250 UM and 25 uM 4dNTP mixes UNIT 3 4 200 U ul Moloney murine leukemia virus MoMuLYV reverse transcriptase 10x PCR amplification buffer make as in uxt 15 1 with 15 mM MgCl but use only 0 1 mg ml gelatin store at 20 C 10 uCi ul a P dATP gt 2000 Ci mmol 2 UM arbitrary decamer see Critical Parameters e g GenHunter or Operon Technologies 5 U ul Tag DNA polymerase Mineral oil Formamide loading buffer see recipe 10 mg ml glycogen DNA free Contributed by Peng Liang and Arthur B Pardee Current Protocols in Molecular Biology 2001 25B 3 1 25B 3 10 Copyright 2001 by John Wiley amp Sons Inc UNIT 25B 3 BASIC PROTOCOL Discovery of Differentially Expressed Genes 25B 3 1 Supplement 56 N M AAAAAAAAAAAAAAA DNA free total cellular RNA or poly A RNA reverse transcribe steps 7 12 N M AAAAAAAAAAAAAAA NMTTTTTTTTTTTT degenerate anchored oligo dT primer perform PCR steps 13 15 arbitrary decamer FIRST ROUND NNNNNNNNNN NMTTTTTTITITTT REMAINING ROUNDS NNNNNNNNNN NMTTTTTTITITTITT perform denaturing PAGE step 16
83. superior in terms of resolution power yielding nearly equally spaced bands in the range be tween 100 and 1000 base pairs After generating a library of cDNA derived restriction fragments ligated to linkers suffi cient resolution and sensitivity of detection for the thousands of 3 cDNA fragments generated has to be achieved Towards this end RMDD primers elongated at their 3 ends are used for amplification each only allowing the amplifi cation of a defined subset of fragments Using extensions of two nucleotides on each side 16 linker primers and 12 reverse primers the first extension nucleotide by definition cannot be a T are synthesized Thus during the subsequent PCR step the original set of fragments is di vided into 16 x 12 192 subsets which fits exactly in two 96 well PCR plates and renders the method suitable for automation Each of these subsets then contains an estimated 50 to 100 fragments which can be easily resolved by denaturing polyacrylamide electrophoresis Critical Parameters During efforts to identify critical steps con tributing to the robustness of the RMDD pro tocol the amount of amplifiable material left after enzymatic processing of input RNA was identified as a major factor causing instability of band patterns probably due to random fluc tuations during early PCR cycles Karrer et al 1995 The authors RMDD protocol was there fore optimized to minimize losses during sam ple preparat
84. tester amplicon 18 19 20 21 22 2 24 25 26 Load 5 ug 100 ul tester amplicon DNA digest on a 1 agarose gel UNIT 2 5A Electrophorese at appropriate voltage until DNA in the range from 150 to 1500 bp can be resolved With a clean razor blade cut two full thickness slits in the running lanes one at 150 and another at 1500 bp Soak small pieces of 24 mm GF C glass microfibre filter and 6 000 to 8 000 MWCO dialysis tubing in water Make a two layer barrier of filter and dialysis tubing and cut into rectangles slightly higher and wider than the agarose lane Using a blunt flat forceps insert the filter dialysis tubing barrier into each of the slits with the filters facing the loading wells Be sure that the entire running lane is blocked by both the filter as well as the dialysis tubing Resume electrophoresis until DNA between 150 and 1500 bp has migrated onto the filter dialysis tubing Stop the electrophoresis and carefully remove the DNA embed ded filter dialysis tubing from the 150 bp slit DNA larger than 1500 bp should be blocked from migrating past the filter dialysis membrane in the 1500 bp slit In the author s hands this method gives better recovery than gel isolation and elution Cut the lid off a 0 5 ml PCR tube and puncture a hole in the bottom with an 18 G needle so that DNA can elute Make a collecting apparatus comprised of the PCR tube placed inside a 1 5 ml microcentrifuge tube
85. thermal cycler double the number of tubes and halve the PCR recipe in each tube In this case addition of mineral oil is not necessary Perform the following two step PCR program 10 cycles 1 min 95 C denaturation 3 min 72 C extension Final step 10min 72 C extension For the OBgl 24 primer a lower annealing temperature of 70 C is required Remove as much mineral oil as possible and combine the contents of the PCR tubes in a microcentrifuge tube Extract and isopropanol precipitate as described step 13 but dissolve the pellet in 40 ul water and do not pool DNA Digest single stranded templates with mung bean nuclease MBN by mixing 14 ul water 4 ul 10x mung bean nuclease buffer 20 ul amplified difference product 2 ul 10 U ul mung bean nuclease MBN 40 ul total volume Incubate at 30 C for 30 min Add 160 ul of 50 mM Tris Cl pH 8 9 Inactivate MBN by incubating 5 min at 98 C Prepare two tubes of PCR mix 360 ul containing the O 24 mer primer as in step 8 Add 40 ul MBN treated difference product in each tube and place in a thermal cycler set at 72 C For OBgl 24 mer use an annealing temperature of 70 C Add 3 ul of 5 U ul 15 U Taq DNA polymerase to each tube mix by pipetting overlay with 110 ul mineral oil and incubate 5 min at 72 C Again double the number of PCR tubes and halve the given recipe placed in each tube if using a 96 well PCR machine Perform the following two step PCR program
86. tips Position slide 1 Prior to placing the stained sample on the glass slide on the microscope stage apply a preparation strip Prep Strip to the tissue section or sample to flatten the tissue and remove loose debris Current Protocols in Molecular Biology 2 Position the slide as described in the basic LCM protocol see Basic Protocol 6 steps l to 4 Microdissect 3 Pick up a high sensitivity transfer film HS cap e g HS CapSure from the loaded cassette module on the right side of the microscope stage see instrument user s guide for instructions on loading the caps into the cassette module with the placement arm and position the HS cap on the tissue to be microdissected Enable and focus the laser as previously described see Basic Protocol 6 steps 5 to 8 4 Begin at a starting power of 75 mW and a pulse duration of 1 msec and make adjustments to the spot size by changing the duration setting rather than the power These settings are those recommended for high sensitivity LCM For the smallest spot size keep the duration and power settings low but pulse multiple times at the same target to ensure capture and transfer The laser activates the transfer film which then expands down into contact with the tissue It is preferable to capture cells as close to the center of the cap as possible Unlike basic LCM using the standard caps the HS caps can be repositioned as often as needed to keep the targets toward the center o
87. tively crude preparation and there is lot to lot variation in this product The author s labora tory has tested a number of purified enzymes with varying levels of success however none worked as well as the crude preparation Batches of collagenase must be screened not only for optimum dissociation activity but also for DNase and RNase activity depending upon final use of cells This can be done easily by spiking an aliquot of the enzyme 5x strength with DNA or RNA The sample is then incu bated at 37 C for 1 hr and examined by agarose gel electrophoresis for integrity of the nucleic acids While many batches will be free of DNase RNase free collagenase is less com mon Contamination Careful planning to prevent contamination control is necessary for the success of this procedure uniT 15 7 discusses many of the rele vant issues It is critical that the results obtained from the PCR be related to the contents of the cell being analyzed and not contamination in troduced at any point during the procedure With all aspects of this procedure the final use of the cells will determine the types of contami nation that must be avoided The most meticu lous technique is required if downstream appli cations require intact RNA The introduction of RNases at any point must be avoided Controls Observe the tissue and cells of interest fre quently during the dissociation process Such observation will provide important information
88. to 3 hr aspirate aqueous layer Store up to year in aliquots at 20 C or 6 months at 4 C Commercially available 1 1 v v phenoll chloroform mix can also be substituted as long as the pH is preset to 8 0 Current Protocols in Molecular Biology Discovery of Differentially Expressed Genes 25B 6 31 Supplement 80 Serial Analysis of Gene Expression SAGE 25B 6 32 Supplement 80 PCR primers 5 GGATTTGCTGGTGCAGTACA 3 5 CTGCTCGAATTCAAGCTTCT 3 5 GTAAAACGACGGCCAGT 3 5 GGAAACAGCTATGACCATG 3 Primer 1 Primer 2 M13 forward M13 reverse The authors recommend using Integrated DNA Technologies for ordering oligonucleotides SAGE PCR buffer 10x 166 mM ammonium sulfate 670 mM Tris Cl pH 8 8 APPENDIX 2 67 mM MgCl 100 mM 2 mercaptoethanol Dispense into aliquots and store up to 1 year at 20 C SAGE tag specific primer 5 GACATGXXXXXXXXXX 10 bp SAGE tag 3 If the SAGE tag specific primer has a calculated annealing temperature below 40 C incorporate additional bases further 5 on linker 2A see recipe for linkers to increase the oligonucleotide melting temperature The full linker 2A SAGE tag sequence is as follows 5 TTTCTGCTCGAATTCAAGCTTCTAACGATGTACGGGGACATGXXXXXX XXXX 10 bp SAGE tag 3 The SAGE 2000 software has the ability to extract an additional base for an 11 base tag This may be helpful as any additional sequence specific bases may yield a more speci
89. to avoid contamination of sections by tissue fragments from other tissues and to minimize growth of environmental microorganisms The authors currently do not recommend using formalin fixed paraffin embedded tissue for RNA analysis however the authors and others have successfully performed RT PCR on alcohol fixed paraffin embedded tissues If sections will be microdissected for RNA consideration should be given to using RNase free water UNIT 4 1 Some histopathology laboratories use an adhesive in the water bath to better adhere the tissue section to the slide As this may result in reduced LCM transfer of tissue it is not recommended 3 Mount sections on histologic glass slides Clean uncoated plain charged or silanized histological slides can be used The authors have successfully performed LCM utilizing many brands of uncoated glass slides as well as charged slides with fixed and paraffin embedded tissues It is important to mount the tissue as close to the center of the slide as possible If the tissue is too far off center the slide cannot be positioned so that the vacuum slide holder can function during microdissection Current Protocols in Molecular Biology 4 Air dry the paraffinized sections overnight or bake up to 8 hr at 37 to 42 C As with frozen sections the desired result is for the tissue to remain adherent to the slide during staining but not be so adherent as to prevent tissue transfer by LCM Baking the sli
90. to replace all nucleotides of a given type by enzymatic incorporation of the biotinylated analog into the amplified strands leads to pronounced smearing of the obtained bands due to the incremental mobility shift caused by each of the biotin groups in a DNA molecule 17 Apply the cycle program of step 13 but for only 20 cycles Check for successful amplification by agarose gel electrophoresis also see step 13 Reactions obtained with the same primer combination but from different RNA samples should again look essentially indistinguishable whereas reactions obtained with different primer combinations usually look distinct Other than with first round PCR products usually a small number of discrete bands e g 1 to 5 can be observed 18 Transfer 5 ul of each reaction into a fresh microtiter plate containing 5 ul formamide buffer per well and mix Denature 2 min at 75 C Nonradioactively labeled PCR products in formamide buffer can be stored for several months at 20 C When radioactive labeling is chosen storage time is limited by decay of the incorporated isotope Label nucleotides 19a For radioactive labeling Load 1 to 2 ul sample into the slots of a denaturing 6 polyacrylamide gel and run as described in UNIT25B 3 starting at Basic Protocol step 16 of that unit Current Protocols in Molecular Biology Discovery of Differentially Expressed Genes 25B 4 7 Supplement 56 19b For nonradioactive labeling and use
91. too low Nlalll inactive Ditags insufficiently pure Insufficient quantity of purified ditags used in ligation Ditags used in ligation are insufficiently pure Concatemer ligation not heated properly Solution Store Dynabeads at 4 C only do not freeze Replace reverse transcriptase Minimize delay between tissue harvesting and homogenization Homogenize tissue thoroughly Use homogenization by Polytron only Do not omit or shorten SDS washes or 75 C heat inactivation step Use separate aliquots of LoTE buffer ammonium acetate and PC8 for each large scale ditag purification Use aerosol pipet tips Reduce amount of linkers in ligation See advice in steps 1 11 Titrate dNTP concentration and number of amplification cycles Increase amount of starting material Store enzyme in aliquots at 80 C Do not reuse thawed aliquots Run Qiaquick gel extraction on eluate see step 44 Increase quantity of cDNA used for large scale ditag prep and or increase number of cycles of amplification Run preparative gel longer to more efficiently separate 100 and 80 bp bands Heat at 65 C and chill on ice immediately continued Discovery of Differentially Expressed Genes 25B 6 35 Supplement 80 Serial Analysis of Gene Expression SAGE 25B 6 36 Supplement 80 Table 25B 6 1 Troubleshooting for SAGE Reactions continued Problem Concatemers have a high 5 frequency of dup
92. uM primer ML19Y 5 TGC TAA GTC TCG CGA GAT CY 3 Y A C G or T see UNIT 2 11 for oligonucleotide synthesis 10x PCR buffer see recipe 20 mM MgCl APPENDIX 2 RediLoad Research Genetics 5 U ul Tag DNA polymerase 100 bp DNA size ladder e g Life Technologies Current Protocols in Molecular Biology BASIC PROTOCOL Discovery of Differentially Expressed Genes 25B 4 3 Supplement 64 1 5 agarose gel UNIT 2 54 4 uM primer CP28X X 5 ACC TAC GTG CAG ATT TTT TTT TTT TTT T X X 3 X A C G or T see UNIT 2 11 for oligonucleotide synthesis 4 uM labeled primer ML18Y Y 5 GCT AAG TCT CGC GAG ATC Y Y 3 Y2 A C G or T see unr 2 11 for oligonucleotide synthesis Formamide buffer 5 mM EDTA 0 1 bromophenol blue in 99 deionized formamide 22 37 42 65 and 75 C water bath heat blocks or equivalent Thermal cycler with heated lid 96 well PCR plates e g MJ Research Additional reagents and equipment for ethanol precipitation and phenol chloroform extraction of DNA unr 2 A and pouring and running UNIT 2 54 agarose and 6 polyacrylamide gels UNIT 7 6 Synthesize first strand cDNA 1 Ethanol precipitate 50 ug total RNA unr 2 14 and dissolve in 15 5 ul RNase free water Add 1 5 ul of 10 UM cDNA primer CP29V denature 5 min at 65 C e g in a heat block and cool down on ice It is not necessary to isolate poly A RNA Band patterns obtained with mRNA are vir
93. ul H O Mix and place in a 90 C heating block Shut off the heating block and let cool down slowly to room temperature The linker 0 5 ug ul is now ready for use and should be stored frozen up to to 2 years at 20 C Alternatively a thermocycler programmed to a low cooling rate e g 0 02 C sec can be used as opposed to a heating block PCR buffer 10x 670 mM Tris Cl pH 8 8 APPENDIX 2 170 mM NH SO 1 v v Tween 20 Store up to 2 years at 20 C PEG 8000 50 Add exactly 10 g of PEG 8000 Promega to 10 g water in a 50 ml conical tube e g Becton Dickinson Close the tube and attach to the rotor of a hybridization oven with the heat turned off Rotate at room temperature 12 hr to overnight until all flakes are completely dissolved Store up to 1 to 2 years at 20 C After thawing shake vigorously until no more schlieren can be observed Wait 10 to 15 min until all air bubbles introduced by shaking have come to the surface before slowly and carefully withdrawing the desired volume It is important to adhere to the exact 1 1 weight ratio of PEG and water PEG 8000 28 MgCL 3 6 mM Carefully mix 5 6 ml 50 PEG 8000 see recipe with 3 68 ml water and 720 ul of 50 mM MgCl APPENDIX 2 Store up to 2 years at 20 C Reaction buffer 100 mM NaCl 5 mM Tris hydrochloride 90 mM Tris base Store up to 1 year at room temperature Current Protocols in Molecular Biology Discovery of Differentially Ex
94. used this approach to demonstrate that the expression of a novel stress induced spliced form of a key transcription factor was restricted to the neurons in the trigeminal ganglion unpub observ Primer selection will depend on the transcript of interest The MacVector PCR primer selection program has proven to consistently yield primers that work well If specific Current Protocols in Molecular Biology transcripts are being analyzed primers that span splice sites is a distinct advantage If a nonspliced transcript is being amplified it is imperative to include sufficient controls in which the reverse transcriptase has been omitted to rule out the possibility that DNA rather than RNA is being amplified One limiting factor will be the length of product generated by the reverse transcription reaction The author has had success using this direct fixed cell RI PCR assay with primers to mouse genes that generate a 500 bp product Materials Proteinase K solution see recipe 40 mM PMSF fresh RNase free DNase I 3 U RNase free DNase I Boehringer Mannheim 25 mM DTT 2 5 U placental RNase inhibitor 8 pmols ul reverse transcriptase primer Reverse transcription reaction mix see recipe 200 U ul SuperScript I reverse transcriptase Life Technologies PCR amplification solution see recipe 1 25 U Tag DNA polymerase Life Technologies PCR tubes Additional reagents and equipment for obtaining dissociated perfusion fixed cells see Ba
95. washed using the magnet prior to use Resuspend beads in adequate volume of lysis buffer to which the cells or tissue biopsies are added The beads must completely adhere to the side of the tube at the site of the magnet before the supernatant is removed to avoid loss of beads This wash procedure can take several minutes Do not forget to prepare beads for the negative control 2 Resuspend beads in an equal volume of lysis buffer The amounts of lysis buffer and beads depend on the cell number Table 25B 8 1 suggests the volumes of lysis buffer and beads to use for specific numbers of cells 3 Pick cells in 1x PBS APPENDIX 2 in the smallest possible volume Pick single cells in a 1 to 2 ul volume and add to the beads in lysis buffer in a 0 2 ml PCR tube Individual cells can be isolated from suspensions using a 2 ul automatic pipettor and an inverted microscope Cell numbers gt 3000 in one reaction tube should be avoided because the released genomic DNA will clump the beads and prevent successful isolation of mRNA When more cells are used either use up to 500 ul of lysis buffer with 50 ul of beads use aliquots or isolate total RNA first by classical protocols e g UNIT 4 1 and add the RNA 1 to 10 ug total RNA to the beads 4 Place the 0 2 ml PCR tubes in a 15 to 50 ml tube and rotate the lysate for 30 min at 4 to 20 C room temperature in a roller bottle apparatus Rotation ensures that the beads remain suspended
96. 0 ul lysis binding buffer by flicking the tube or by gently vortexing Leave beads in buffer until ready to add them to the cell lysate step 4 In this and all subsequent washing steps add solution to the tube while keeping it on the magnetic rack in order to minimize drying out of the beads Next close the cap remove the tube from the magnet and resuspend the beads Place back on the magnetic rack for 30 sec to collect beads at the bottom before removing wash 3 Lyse 100 000 to 1 000 000 cells or 2 to 10 mg tissue in 1 ml lysis binding buffer in a 2 ml microcentrifuge tube with a tissue homogenizer for min Before using the homogenizer clean it thoroughly rinse with 100 ethanol and pulse in I liter DEPC ddH gt 0O If necessary remove any cellular debris that remains following homogenization by mi crocentrifuging 1 min at maximum speed 4 Immediately shear genomic DNA by pressing lysed cells through a 23 G needle attached to a 1 ml syringe into the tube containing prewashed Dynabeads step 2 from which the buffer has been removed Incubate 3 to 5 min at room temperature with constant agitation by hand Alternatively total RNA previously isolated and stored at 80 C may be used Total RNA 1 to 10 ug in 500 ul of lysis binding buffer may be added and incubated 3 to 5 min room temperature with constant agitation by hand It is best to run some of the RNA on a denaturing gel to check for degradation Visualiz
97. 1 or cDNA see Basic Protocol 2 with a frequently cutting restriction enzyme Some consideration should be given to which of the two genomes is designated tester and which is designated driver In principle the tester should contain DNA restriction fragments not found in the driver Specific linkers are ligated to DNA restriction fragments from each pool and amplicons are generated by PCR Linkers are then removed from both samples and a new linker is added only to size selected tester amplicons These tester amplicons are mixed and melted with a large excess of driver amplicons lacking linkers Hybridiza tion between complementary single strands is allowed to proceed resulting in the generation of three species of double stranded DNA fragments 1 both strands derived from driver DNA lacking linkers on either strand 2 hybrids with one strand from driver no linker and one from tester with linker and 3 both strands from tester DNA linkers on both strands Excess driver will soak up DNA fragments common to both samples 1 e tester driver and only the DNA fragments unique to the tester 1 e the tester tester population will be exponentially amplified and kinetically enriched when linker specific primers are used Iterative rounds of subtractive kinetic enrichment against driver ampli cons 1s performed until distinct difference products can be cloned GENOMIC REPRESENTATIONAL DIFFERENCE ANALYSIS This protocol describes RDA for gen
98. 1 20 denature reanneal add streptavidin and phenol extract PCRt p A B perform further i subtractions i see Fig 5 9 3 y Y A B a la clone subtracted cDNAs Figure 25B 2 2 Basic steps in PCR based cDNA subtraction cloning mRNAs purified from tissues A and B are used to synthesize double stranded cDNA by standard methods The resulting CDNAs are then digested with restriction endonucleases that have 4 bp recognition sequences Two different sets of adapters a1 a2 and b1 b2 are ligated to the two sets of digested cDNA The cDNAs are amplified with the appropriate primers a1 or b1 to yield Aj and Bo Two sets of subtractions are performed Ap Bo and B Ag In each case the tracer is labeled with small amounts of a P dCTP and the driver is labeled with bio 11 dUTP during PCR synthesis Tracer and driver cDNAs are mixed at a ratio of 1 20 denatured and allowed to reanneal Driver driver and tracer driver hybrids are removed by treatment with streptavidin and extraction with phenol This results in an enrichment of sequences found at greater abundance in tracer versus driver to yield A and B Further subtractions are performed after another round of amplification using the appropriate cDNAs see Fig 5 9 3 When the subtractions are completed the cDNAs are cloned into an appropriate vector for analysis Current Protocols in Molecular Biology preferentially in B more than in A The method uses the polymera
99. 10 min at 16 C T4 DNA polymerase will fill in any remaining internal gaps in the second strand DNA and will fill in any leftover 5 and 3 overhangs to yield blunt ends Extract the double stranded DNA with an equal amount of 1 1 phenol pH 6 6 chloroform 1 1 Extract with an equal volume of chloroform and transfer the aqueous layer to a new microcentrifuge tube Purify the DNA using a Qiagen QJAquick PCR Purification column as follows a Add 35 ul of 100 mM sodium acetate pH 5 2 to each tube b Add 500 ul of Buffer PB to each tube and mix by inverting c Proceed as per manufacturer s instructions until elution d Add 15 ul of H20 to each column allow the column to stand for 1 min and centrifuge 1 min at maximum speed Repeat once Concentrate the sample to 8 ul in a concentrator evaporator at 50 C Prepare the reagents from the MEGAscript T7 Kit a Thaw the rNTP solutions mix by vortexing collect the sample by quick spin centrifugation 30 sec at 600 x g and place on ice b Thaw 10x reaction buffer mix until the precipitate has dissolved and keep at room temperature not on ice Assemble the 20 l reaction in the following order cDNA end product from step 13 8 ul rNTP mix 2 ul each of ATP CTP GTP and UTP 8 ul 10x reaction buffer 2 ul T7 RNA polymerase enzyme mix 2 ul NOTE When preparing a cocktail mixture to accommodate multiple samples excess reagents should be prepared to compensate
100. 10 to 1 1000 diluted template than on undiluted amplicons No or weak signals on cDNA arrays Degraded Dig UTP Film exposure Hybridization temperature Denaturation of DNA Digoxigenin is alkali labile Therefore check pH of all solutions after hybridization Be sure to expose the hybridized exposed side of the filter Re expose cDNA array prolong exposure time correct orientation of coated film Control the hybridization temperature Some hybridization buffers work at 68 C others at 45 C depending on the content of DNA denaturing substances Both probe and target have to be single stranded Check denaturation and the protocol for array preparation Suspiciously identical results with different probes on cDNA arrays Co amplification labeling and hybridization of bacterial plasmid DNA with cellular cDNA Control the quality of the array by hybridizing labeled E coli and plasmid DNA to the array use arrays of which the cDNAs have been amplified by insert specific PCR or oligonucleotide arrays Check for possible sources of contamination in the sample test different batches of reverse transcriptase If contamination is unavoidable label the negative control and add increasing amounts of blocking DNA e E coli or DNA of the most frequently used plasmids used to generate the array until the filters are clean High background of cDNA arrays Probe concentration Addition of probe Restringency washes Alkal
101. 2 min 95 C denaturation 25 cycles 30 sec 95 C denaturation 1 min 56 C annealing 2 min 72 C extension 1 cycle 5 min 70 C final product extension For Taq DNA polymerase based PCR amplifications an extension time of 0 5 to 1 0 minlkb of template amplified is sufficient but in contrast Pfu based PCR ampli fications require a minimum extension time of I to 2 min kb of amplified template to achieve similar target synthesis 82 Analyze on a 1 5 agarose gel at 150 V UNIT 2 5A For large scale screening use multichannel pipettors with an Owl Centipede 50 well horizontal electrophoresis system The tips of the multichannel pipettors fit into every second well of the 50 slot comb used on the Owl Centipede rigs Consequently to maintain a sequential loading order for each 96 well plate the authors prepare a separate 96 well loading plate with sample loading dye The authors typically get 85 to 95 of clones with inserts of which gt 95 are gt 400 bp long Libraries of this quality can be sequenced directly without gel screening and sorting Purify template and sequence amplification product 83 Use 2 ul PCR product the exact amount will depend on the sequencing protocol and should be optimized for clean up using the following 0 1 ul exonuclease I 0 1 ul shrimp alkaline phosphatase 1 8 ul 50 mM Tris Cl pH 8 0 Serial Analysis of Add 2 ul clean up mix to 2 ul DNA Gene Expression l l l l SAGE The exonuclease I d
102. 5B 6 5 for significance analysis Step 3a and for cluster analysis Step 3b Performing significance analysis Significance analysis allows users to compare two or more different libraries and calculate P values The description of the algorithm used for Poisson based significance analysis is in the Appendix at the end of this unit Li Cait Haiyan Huang Seth Blackshaw2 Jun S Liu Constance L Cepko and Wing H Wong The first two authors contributed equally to this work l Department of Research Computing Dana Farber Cancer Institute 2 Department of Biostatistics Harvard School of Public Health 3 Department of Genetics Harvard Medical School 4 Department of Statistics Harvard University Step 1 Upload a Tab Delimited Data File m Click Here to View A Sample SAGE Data File o Step 2 select a Data File for SAGE Data Analysis a Significance Analysis Clustering Analysis SA GEmap Optional click SAGEmap icon to update SAGEmaps Hs amp Mm from NCBI released Oct 25 Human Oct 25 Mouse Download SAGE Data Analysis Application a Windows Version 2 0 30Mb Old version V1 0 31Mb Linux 29Mb please read installation instructions m Just in case you deleted the following files by accident here they are e Download Tutorial Material Download Accepted File Types tzt e Download marker txt o Bug Reports Comments or Suggestions LiCai et al 2003 Figure 25B 6 4 S
103. 70 ethanol without allowing the slide to thaw and dry prior to contact with the ethanol Allow the ethanol to remain in contact with the tissue for 30 sec Deparaffinized fixed sections see Basic Protocol 2 as well as samples prepared by direct smear or cytospin see Basic Protocols 3 and 4 will already be in 70 alcohol and are ready to proceed through the following steps Allow the slide containing the tissue section to remain in the following solutions for the specified times in the specified sequence Sterile distilled or RNase free water 10 sec Mayer s hematoxylin 10 sec Sterile distilled or RNase free water 10 sec Bluing reagent 15 to 30 sec 70 ethanol 15 to 30 sec Eosin Y 15 to 30 sec 95 ethanol 30 sec 95 ethanol 30 sec 100 ethanol 30 sec 100 ethanol 30 sec to 1 min Xylene 1 to 5 min Current Protocols in Molecular Biology 3 Allow the section to air dry completely and proceed to LCM see Basic Protocol 6 and Alternate Protocol 2 Poor LCM transfers will result if the tissue section is not fully dehydrated This may result if the 100 ethanol becomes hydrated after repeated use One way to check the 100 ethanol for water is to put a small amount into xylene If there is water present the xylene will become cloudy The final xylene rinse also facilitates the efficiency of transfer with LCM If a tissue section does not transfer well repeating the dehydration with fresh 100 alcohol and or a longer xyle
104. 98 Commercial application of RMDD including in house research projects of any company thus requires a license No license is required for academic use STRATEGIC PLANNING The RMDD library contains a mixture of restriction fragments of all cDNA molecules obtained from the respective biological sample It has been estimated that a single cell type contains 10 000 different mRNA molecules resulting in 10 000 different cDNA species For successful gel display of the fragments derived from the 3 ends of these cDNA molecules a strategy must be provided to subdivide this rather complex fragment mixture into a number of subpools each containing a sufficiently low number 1 e lt 50 to 100 of different fragment species This can be easily achieved by fragment amplifica tion employing oligonucleotide primers each carrying one additional selective base at the 3 end Theoretically such a selective base allows primer extension by a polymerase only if it perfectly matches the corresponding base on the other strand Combining selective primers directed against the ligated linker and against the sequence introduced by the cDNA primer thus allows subdivision of fragments into nonoverlapping subpools The RMDD protocol see Basic Protocol and Alternate Protocol involves two subsequent rounds of amplification the first employing selective primers extended by one base each and the second employing primers extended by one more base providing
105. A A 24 55 24 7 AAAAAALATG 17 52 9 CECCCCCCCAA 17 S 46 ccececccecca Afi 10 49 CCCCCCCCTA 23 11 45 CCCCCCCGAC 19 9 45 CCCCCCGGTG 23 10 45 GGGGGGGAAA 12 9 GGGGGGGCCC 9 11 S GGGGGGGCCG 8 10 ti GGGGGGGCGC 92 93 GGGGGGGTCC 9 10 8 TITTTTTTCCT 11 46 TTTTTTTTAA 11 z 45 TTTTTTTTTC 10 9 48 TUPTTTT TTS 10 9 47 TTTTTTTTTT 11 11 48 Figure 25B 6 3 Screen shot of a sample SAGE data file SAGE data file needs to be in tab delimited format All columns of SAGE libraries tag counts need to be arranged next to each Discovery of other Column 1 is SAGE tag columns 2 to 6 are tag counts for five different SAGE libraries For Differentially i Hi Expressed Genes online version the column headers are removed to keep data unidentifiable by other users 25B 6 25 Current Protocols in Molecular Biology Supplement 80 Serial Analysis of Gene Expression SAGE 25B 6 26 Supplement 80 Uploading a data file 1 Navigate to the home page for the SAGE Data Analysis Application shown in Fig 25B 6 4 at http genome dfci harvard edu sager Upload a tab delimited data file by clicking Browse under Step 1 Navigate to the data file select it and then click Send Fig 25B 6 4 A new screen appears showing your data alongside some other previously uploaded data sets 2 Select the data file of interest under Step 2 on the screen The choice of data file is confirmed and two calculation options are given Fig 2
106. AFLP Based Transcript Profiling 25B 5 16 Supplement 57 Velculescu V Zhang L Vogelstein B and Kin Zler K W 1995 Serial analysis of gene expres sion Science 270 484 487 Vos P Hogers R Bleeker M Reijans M van de Lee T Hornes M Frijters A Pot J Peleman J Kuiper M and Zabeau M 1995 AFLP A new technique for DNA fingerprinting Nucleic Acids Res 23 4407 4414 Vos P and Kuiper M 1998 AFLP analysis Jn DNA Markers Protocols Applications and Overviews G Caetano Anolles and P M Gresshoff eds pp 115 131 John Wiley and Sons New York Welsh J B Zarrinkar P P Supinosos L M Kern S G Behling C A Monk B J Lockhart D J Burger S A and Hampton G M 2001 Analy sis of gene expression profiles in normal and neoplastic ovarian tissue samples identifies can didate molecular markers of epithelial ovarian cancer Proc Natl Acad Sci 98 1176 1181 Wodicka L Dong H Millmann M Ho M H and Lockhart D J 1997 Genome wide expres sion monitoring in Saccharomyces cerevisiae Nature Genet 15 1359 1367 Zabeau M and Vos P 1993 Selective restriction fragment amplification A general method for DNA fingerprinting European Patent EP 0534858 B1 Contributed by Pieter Vos and Patrick Stanssens Keygene N V The Netherlands Current Protocols in Molecular Biology Serial Analysis of Gene Expression SAGE Experimental Method and Data Ana
107. AGE Data Analysis on the desktop Double click the icon to start the program The instructions and tutorial of the stand alone ver sion are included in the software download package The program is free for public use This program is distributed in the hope that it will be useful for research purpose but WITHOUT ANY WARRANTY REAGENTS AND SOLUTIONS Use double distilled water in all recipes and protocol steps For common stock solutions see APPENDIX 2 for suppliers see APPENDIX 4 BRSI primer 5 Biotin CCGGGCGCGCCGTAAAACGACGGCCAG T 9 3 Order HPLC purified from a trusted supplier The authors recommend using Integrated DNA Technologies IDT BW buffer 1x For 2 stock 10 mM Tris Cl pH 7 5 APPENDIX 2 1 mM EDTA 2 0 M NaCl Store up to 1 year at room temperature Dilute to 1 x with H20 just before use Linkers Linker age 5 TTTGGATTTGCTGGTGCAGTACAACTAGGCTTAATAGGGA a 2 5 TCCCTATTAAGCCTAGTTGTACTGCACCAGCAAATCC amino ieee 2A 5 TTTCTGCTCGAATTCAAGCTTCTAACGATGTACGGGGA Linker 28 5 TCCCCGTACATCGTTAGAAGCTTGAATTCGAGCAG amino mo The authors recommend using Integrated DNA Technologies for ordering oligonucleotides LoTE buffer 3 mM Tris Cl pH 7 5 APPENDIX 2 0 2 mM EDTA pH 7 5 APPENDIX 2 Store up to 1 year at room temperature PC8 480 ml phenol warmed to 65 C 320 ml 0 5 M Tris Cl pH 8 0 APPENDIX 2 640 ml chloroform Add in sequence and place at 4 C After 2 to 3 hr shake again After an additional 2
108. All experiments carried out according to the the transcript profiles of various organisms Profiling protocol outlined above will give satisfactory 25B 5 14 Supplement 57 Current Protocols in Molecular Biology Table 25B 5 1 Typical AFLP Experiment Time Course Poly A RNA isolation and synthesis of ds cDNA AFLP cDNA template preparation and nonselective Selective amplification gel electrophoresis and overnight exposure of the gels to X ray films or Day 1 Day 2 preamplification reactions Day 3 phosphoimaging screens Day 4 Analysis of results Time Considerations Starting from total RNA the following time considerations are expected for up to 96 sam ples 1 Isolating poly A RNA 1 to 2 hr de pending on the number of samples 2 Synthesizing ds cDNA from the poly A RNA 5 to 6 hr 3 Preparing the AFLP cDNA templates from the ds cDNA 5 to 6 hr 4 Nonselective preamplification 3 to 4 hr up to 96 samples 5 Selective amplification 3 to 4 hr up to 96 samples 6 Gel electrophoresis up to 4 x 96 sam ples 6 to 8 hr The procedure may be interrupted after each of above steps A typical experiment time course starting from poly A RNA is given in Table 25B 5 1 Literature Cited Adams M D Kelley J M Gocayne J D Dub nick M Polymeropoulos M H Xiao H Mer ril C R Wu A Olde B Moreno R F Ker valage A R McCombie W R and Venter J G 1991 Complementary DNA sequencing
109. Biology 25B 6 1 25B 6 39 October 2007 Published online October 2007 in Wiley Interscience www interscience wiley com DOI 10 1002 0471142727 mb25b06s80 Copyright 2007 John Wiley amp Sons Inc UNIT 25B 6 Discovery of Differentially Expressed Genes 25B 6 1 Supplement 80 BASIC MicroSAGE PECET OE SAGE library construction involves anchoring mRNA molecules via their poly A tails to magnetic beads cDNA synthesis is then conducted and the cDNAs are cleaved with Niall to completion MicroSAGE which is described here differs from conventional SAGE in that this anchoring at the 3 end takes place prior to cDNA synthesis rather than after cDNA synthesis This results in the loss of all cDNA sequence 5 to the cleavage site and ensures that only the 3 most Nlalll site is exposed at the 3 end of the cDNA The cDNA sample is then divided into two equal pools and two sets of linkers which contain a BsmFI site PCR primer sites and modified 3 bases to prevent ligation to each other are then added by ligation BsmFI is a type IIS restriction enzyme with a cut site 15 bp 3 of the recognition site The resulting cDNAs are then digested with BsmFI which results in the release of the linker the NiallI site and 10 to 11 bp 3 of the NialII site The resulting tags are then blunt ended with the Klenow fragment of DNA polymerase I and the two separate pools of tags are ligated together via blunt end ligation
110. CGACGTCGACTATCCATGAACx 3 12 mers OBgl12 5 GATCTGTTCATG 3 OBam12 5 GATCCGTTCATG 3 OdHind12 5 AGCTTGTTCATG 3 OXxx24 5 xxxxx GTTCATG 3 Even cycle 24 mers EBg 24 5 AGGCAACTGTGCTATCCGAGGGAA 3 EBam24 5 AGGCAACTGTGCTATCCGAGGGAG 3 EHind24 5 AGGCAGCTGTGGTATCGAGGGAGA 3 EXxx24 5 AGGCAACTGTGCTATCCGAGGGAx 3 12 mers EBgl12 5 GATCTTCCCTCG 3 EBam12 5 GATCCTCCCTCG 3 EHind12 5 AGCTTCTCCCTC 3 EXxx12 5 xxxxx TCCCTCG 3 R primers are used only in making representations of the tester and driver DNAs The O and E primers are used in odd and even iterations of the subtractive enrichment process These were previously designated J and N in the original protocol Lisitsyn et al 1993 gt Underscores indicate restriction sites that are variable but limited to those comprising restriction sites 1 e can be changed to accommodate other enzymes Nucleotides shown in bold outline invariant core sequences of the primers Nucleotides which are neither bold nor underscored are completely variable 100 ethanol ice cold 70 ethanol room temperature 3 M sodium acetate pH 5 2 APPENDIX 2 EE x 3 hybridization buffer see recipe 5 M NaCl 5 ug ul glycogen in TE buffer see APPENDIX 2 for TE buffer 10 U ul mung bean nuclease and 10x buffer New England BioLabs UNIT 3 12 50 mM Tris Cl pH 8 9 APPENDIX 2 Thermal Cycler Perkin Elmer Model 480 preferred 24 mm GF C glass microfibre fil
111. CR primers UNIT 15 7 10 Expose blot to a storage phosphor screen APPENDIX 3A and analyze using Imagequant software ANALYSIS OF ENRICHED CELL POPULATIONS BY RT PCR Presented in this section is a protocol that can be adapted to examine either specific or general transcriptional patterns in groups of selected populations of cells harvested from solid tissues The cells in the tissue are first stabilized by fixation avoiding the transcrip tional changes that would occur with the manipulation and dissociation of living cells Using carefully screened reagents it is possible to maintain the integrity of the RNA within the cells during the dissociation process so that RT PCR analysis is possible Sawtell 1997 The goal of the author was to analyze the RNA contained within just a few cells using RT PCR In PCR analysis see Basic Protocol 2 the integration of the pretreatment steps and the PCR reaction in a single assay tube was straightforward however in the case of RT PCR establishing the compatibility of all of the enzymatic steps required for the pretreatment reverse transcription and subsequent PCR without an extraction step was more challenging The assay developed is presented below This protocol has been successfully utilized to detect transcripts in samples of fewer than ten neurons This approach has proven to be especially useful to examine cell type specific expression of transcripts within solid tissues For example the author
112. DNA RDA to detect rare transcripts or smaller fold differences in expression between tester and driver Ifno DNA products appear as bands by agarose gel elec trophoresis in the later rounds of RDA it may help to start either the particular hybridization round or the entire RDA again with a less strin gent tester driver hybridization ratio relatively more tester DNA If too much background smearing occurs in later rounds of RDA and primer problems have been ruled out see be low then a more stringent tester driver hybridi zation ratio in the preceding round may help No difference products RDA requires the generation of restriction fragments between 200 to 1000 bp to ensure optimal PCR amplification Because of this simplification step a particular restriction strat Current Protocols in Molecular Biology egy may fail to find sought after differences Therefore if no difference products are isolated after iterative rounds of kinetic subtractive en richment alternate restriction endonucleases may be tried The placement in the tester sample of an internal control with known restriction characteristics at the beginning of an RDA experiment can be used however to prevent preferential amplification of the internal con trol the internal standard should be spiked at sufficiently low concentrations lt 1 100 000 on a weight basis Too many difference products or high background HPLC purification of oligomers is critical f
113. DNA representational differ ence analysis for the identification of differen tially expressed mRNAs Anal Biochem 283 89 98 Reick M Garcia J A Dudley C and McKnight S L 2001 NPAS2 An analog of clock operative in the mammalian forebrain Science 293 506 509 Shields J M Der C J and Powers S 2001 Iden tification of Ras regulated genes by repre sentational difference analysis Methods Enzy mol 332 221 232 Contributed by Yuan Chang Hillman Cancer Center University of Pittsburgh Pittsburgh Pennsylvania Current Protocols in Molecular Biology Gene Expression Analysis of a Single or Few Cells The need to analyze rare or even single cells is based on the dynamic nature of tissue differentiation and regeneration the initiation and propagation of disease processes in multicellular organisms and the functional diversity of individual cells Gene transcrip tion is the most important regulatory mechanism by which a phenotype and functional state of a cell is determined Therefore qualitative and quantitative assessment of mRNA abundance is not only a first step into the nature of biological processes but is easier to investigate in a comprehensive way than protein expression when small cell numbers are used In this unit a protocol that allows a semi quantitative analysis of gene expression of a single cell and a quantitative representation of expressed genes from gt 10 to 30 cells is described This unit co
114. Deparaffinize tissue by incubation in two changes of xylene 10 min each followed by one wash in 100 ethanol 2 min Air dry the slide and place onto the microscope stage to mark tissue domains to be collected Keep remaining slides in 100 ethanol until needed Prior to sample microdissection optimize the energy and focus of the laser for the sections that include target cells Test and optimize the PALM capturing settings for each tissue type To prevent tissue damage always utilize the minimal laser energy that is required to cut and catapult the tissue from the slide Cell wall thickness can vary greatly among different cell types and is a common barrier to successful laser microdissection of plant cells Laser settings MUST be optimized to each tissue type Mark areas of target cells using the PALM sample selection software see Video 1 at http www currentprotocols com Harvest targeted cells into the adhesive cap of the collection tubes via the Close and Cut plus AutoLPC method according to the vendor s manual As an alternative to adhesive caps samples can be microcatapulted into the cap of a standard 0 5 ml centrifuge tube containing a drop of mineral oil as a tissue adhesive The mineral oil will not inhibit RNA extraction described below The focused laser first cuts the outline of the target cells to isolate the tissue of interest from surrounding tissues Subsequently the defocused laser catapults the targeted cell
115. ELT PCR system Roche Diagnostics including 10x ELT buffer 1 17 5 mM MgCl 3 5 U ul DNA polymerase mix 1 7 dNTP mix see recipe 20 formamide CP2 primer 5 TCA GAA TTC ATG CCC CCC CCC CCC CCC 3 24 uM Digoxigenin 11 dUTP Dig UTP alkali labile Roche Diagnostics Sample DIG Easy Hyb solution Roche Diagnostics E coli DNA DNase I Labeled probe Herring sperm DNA Invitrogen 20x SSC 10 SDS Development buffer 1 see recipe Development buffer 2 see recipe DIG Luminescent Detection Kit Roche Diagnostics containing Blocking reagent 750 U ml anti digoxigenin AP Fab fragment antibody 11 6 mg ml CSPD Tween 20 Sigma Development buffer 3 see recipe Thermal cycler Nylon membrane containing an array of cDNAs either self prepared or commercially available Hybridization tubes Hybridization oven or other rotator with temperature control 1 5 ml microcentrifuge tubes Acetate sheets Whatman 3MM filter paper Biomax ML film Kodak Label amplifications with Dig UTP 1 Prepare PCR master mix as in Table 25B 8 5 Pipet 49 ul aliquots in sterile PCR tubes add 1 ul from the sample 1 e from the PCR product obtained in Basic Protocol 1 step 15 and program the thermal cycler with the following parameters 1 cycle 2 min 94 C 4 min 68 C 10 cycles 15 sec 94 C 4 min 68 C 2 cycles 15 sec 94 C 4 min 10 sec cycle 68 C 1 cycle 7 min 68 C 2 Determine the concentration of the amplified DNA see UNIT 2 6
116. EcoRI ends with respect to the input DNA the ends of which must be considered even though only a small fraction of the insert DNA is clonable after the melting and hybridization steps The recommended 10 ug of vector and no less than 8 to 10 packaging extracts will ensure a library of good complexity 21 Add suspension medium SM to the packaging mixtures and pool them in a 5 ml polypropylene tube to a final volume of 2 ml Add two drops of chloroform shake by hand for 3 sec and allow the chloroform to settle 22 Plate 0 2 ml packaged phage with 3 ml fresh C600AfIA plating bacteria on each of ten 150 mm plates as described in the library amplification protocol UNIT 25B 2 however allow the plates to incubate overnight at 37 C 23 The following morning count the number of plaques on a representative plate and multiply by 10 to determine the total number of recombinants in the library Typically 300 to 15 000 phage per library are obtained 24 Elute the plates with SM as in UNIT 258 2 or directly select individual plaques for screening Evaluate the library 25 Evaluate a newly prepared subtracted library as described in UNIT 5 84 first support protocol The best approach is to amplify the library and differentially screen duplicate nitrocellulose filters from a single 150 mm plate of 20 000 to 40 000 recombinants Hybridize one lift with a total cDNA probe and the other with a total cDNA probe The total a
117. Fig 25A 1 4 This targeting and capturing can be repeated many times on the same tissue section or cytologic sample The temperature rise in the tissue created by the laser is limited to 90 C Suarez Quian et al 1999 and is transient lasting only a few milliseconds Experimental results indicate that DNA mRNA and proteins are not degraded by the LCM process Goldsworthy et al 1999 Suarez Quian et al 1999 Critical Parameters LCM can be performed on solid tissues that have been either frozen or fixed under specified conditions cytologic smears or cytospin preparations derived from animals or patient samples The choice of specimen type depends on the type of tissue or cytologic specimen that is available the physiologic or pathologic con dition to be investigated and the molecule to be analyzed 1 e DNA RNA or protein Solid tissues are typically sectioned for histologic examination whereas cells from blood or cy tologic samples such as fine needle aspirates are prepared as direct smears or cytospins Fro zen tissues have the benefit of being processed more rapidly for LCM than fixed tissue and are considered to be the most reliable source for Current Protocols in Molecular Biology NIH Laser capture microdissection cancerous cell cell transferred to film OOO plastic cap glass slide laser beam transport arm plastic cap joystick transfer film individual transfer of De ae backing cell s
118. Gutkind J S 2000 Dis tinct pattern of expression of differentiation and growth related genes in squamous cell carcino mas of the head and neck revealed by the use of laser capture microdissection and cDNA arrays Oncogene 19 3220 3224 Luo L Salunga R C Guo H Bittner A Joy K C Galindo J E Xiao H Rogers K E Wan J S Jackson M R and Erlander M G 1999 Gene expression profiles of laser captured adja cent neuronal subtypes Nature Medicine 5 117 122 published erratum appears in Nature Medi cine 5 355 Masuda N Ohnishi T Kawamoto S Monden M and Okubo K 1999 Analysis of chemical modification of RNA from formalin fixed sam ples and optimization of molecular biology ap plications for such samples Nucl Acids Res 27 4436 4443 Murakami H Liotta L and Star R A 2000 IF LCM Laser capture microdissection of im munofluorescently defined cells for mRNA analysis rapid communication Kidney Int 58 1346 1353 Natkunam Y Rouse R V Zhu S Fisher C and van De Rijn M 2000 Immunoblot analysis of CD34 expression in histologically diverse neo plasms Am J Pathol 156 21 27 Ohyama H Zhang X Kohno Y Alevizos I Posner M Wong D T and Todd R 2000 Laser capture microdissection generated target sample for high density oligonucleotide array hybridization BioTechniques 29 530 536 Current Protocols in Molecular Biology Ornstein D K Englert C
119. In Vitro Transcriptional Amplification of Plant RNA Michael J Scanlon Kazuhiro Ohtsu Marja C P Timmermans and Patrick S Schnable l Cornell University Ithaca New York Iowa State University Ames Iowa 3Cold Spring Harbor Laboratory Cold Spring Harbor New York ABSTRACT Protocols for laser microdissection and linear amplification of RNA from fixed sectioned plant tissues are described When combined with quantitative RT PCR microarray anal ysis or RNA sequencing these procedures enable quantitative analyses of transcript accumulation from microscopic quantities of specific plant organs tissues or single cells Curr Protoc Mol Biol 87 25A 3 1 25A 3 15 2009 by John Wiley amp Sons Inc Keywords laser microdissection e plants e RNA amplification e transcriptomics INTRODUCTION This unit describes a method for the isolation of RNA from plant structures using laser mi crodissection LM LM technology permits precise isolation of specific tissues organs or cells from fixed and sectioned plant tissues adhered to microscope slides In many cases the quantity of sample material isolated by LM is limiting However nanogram quantities of RNA extracted from microdissected plant tissue or any RNA sample can be linearly amplified using T7 RNA polymerase Luo et al 1999 to generate microgram quantities of RNA This microdissected amplified RNA aRNA is subsequently used as a template for the preparation of cDNA
120. M ammonium acetate 3 ul SeeDNA 825 ul 100 ethanol Vortex and place in dry ice methanol bath for 15 min Warm 2 min at room temperature until solution has melted then microcentrifuge 15 min at 4 C Wash once with cold 75 ethanol removing ethanol traces with a gel loading pipet tip Resuspend pellet in 40 ul LoTE buffer On ice add 10 ul of 5x loading buffer 50 ul total Load this sample into four lanes of a 20 polyacrylamide TBE gel load the 20 bp ladder into a separate lane and run 2 5 hr at 160 V Stain as described in step 37 Optimal electrophoresis time may vary somewhat Be careful not to run the gel too long Cut out the 24 to 26 bp band from four lanes under long wavelength UV illumina tion and place two cut out bands in each of two 0 5 ml microcentrifuge tubes which have an 0 5 mm diameter hole in the bottom Current Protocols in Molecular Biology 51 Microcentrifuge as described in step 39 52 Discard the 0 5 ml microcentrifuge tubes Add 250 ul LoTE buffer and 50 ul of 53 54 7 5 M ammonium acetate to each of the 2 0 ml microcentrifuge tubes Vortex the tubes and incubate 1 hr at 37 C IMPORTANT NOTE Do not incubate at 65 C This will cause the 26 bp ditags to denature Longer incubations even overnight can be performed but do not appear to result in significantly higher yields Use four Spin X centrifuge tube filters to isolate eluate as described in step 42 Ethanol precipitate in
121. Mix contents gently but well using a pipet Current Protocols in Molecular Biology 19 Incubate 1 hr at 37 C agitating intermittently by hand every 15 min 20 After digestion collect supernatant carefully with a magnet Place supernatant into a fresh nonsiliconized microcentrifuge tube Add 50 ul LoTE to sample Extract with PC8 as described in step 7 21 High concentration ethanol precipitate by combining the following 150 ul sample 2 ul SeeDNA 70 ul 7 5 M ammonium acetate 500 ul 100 ethanol Microcentrifuge 20 min at full speed room temperature Wash with 70 ethanol and resuspend in 25 ul LoTE This is the concentrated rSAGE product which may be stored indefinitely at 20 C Avoid repeated freeze thaw Amplify rSAGE library dilutions by PCR 22 Make several dilutions of rsAGE product in LoTE Usually I ul of 1 25 1 50 and 1 100 dilutions are recommended for PCR Due to frequent variations in yield this can vary widely These dilutions are good starting point however 23 Prepare the following PCR reaction 1 ul rSAGE dilution 5 ul 10x SAGE PCR buffer 3 ul DMSO 3 ul 10 mM dNTPs 1 ul 350 ug ul M13 forward primer 1 ul 350 ug ul primer 2 36 ul ddH20O 1 ul 5 U ul Platinum Tag DNA polymerase Repeat for all dilutions 24 Use the following PCR cycling conditions Initial step 2 min 94 C denaturation 25 cycles 45 sec 94 C denaturation min SC annealing 1 min 70 C extension 1 cyc
122. NA sequence organization in the genome of Nico tiana tabacum Chromosoma 59 227 252 Internet Resources http www palm microlaser com dasat index php cid 100113 amp conid 0 amp sid dasat Offers product information for PALM MicroLaser Systems at Carl Zeiss Discovery of Differentially Expressed Genes 25A 3 15 Supplement 87 MOLECULAR METHODS FOR DISCOVERY SECTION B OF DIFFERENTIALLY EXPRESSED GENES Production of a Subtracted cDNA Library UNIT 25B 1 PRODUCTION OF A SUBTRACTED LIBRARY BASIC For some experiments a complete cDNA library UNIT 5 84 is unnecessary and instead a PRO EOE NIE subtracted cDNA library is useful A subtracted cDNA library contains cDNA clones corresponding to mRNAs present in one cell or tissue type and not present in a second type This cDNA library is used to isolate a set of cDNA clones corresponding to a class of mRNAs or to aid in the isolation of a cDNA clone corresponding to a particular mRNA where the screening procedure for the cDNA clone is laborious because a specific DNA or antibody probe is unavailable A technique known as differential screening is an alternative to creating subtracted libraries see Commentary In this protocol the tissue library RNA or cDNA designated with a contains the target or desired sequence s and that which is to be subtracted from the is termed Since relatively few recombinants are obtained after subtraction this protocol is for a cDNA libra
123. NITS 25B 3 25B 5 Since very few mRNAs lack Nlalll sites SAGE generates a tag for vir tually every cellular mRNA providing a level of coverage unequaled by any microarray yet available for humans or mice For these same reasons SAGE can also serve as a tool for gene discovery and transcript annotation even in species with fully sequenced genomes The sensitivity of SAGE is limited only by the number of tags that one has the desire or resource to sequence and with larger num bers of tags sequenced it becomes possi ble to determine relatively small lt 2 fold changes in gene expression between sam ples Since individual SAGE tag levels are expressed as a percentage of total tags it is straightforward to compare tag levels among libraries generated by other labs As more SAGE libraries are generated and made pub lic these data sets can be used to generate a large scale atlas of gene expression that is of great use to the whole scientific community Such a resource is already available for hu man normal and malignant tissues at NCBI http www ncbi nim nih gov SAGE and li braries from other species are available from various sources see Internet Resources for a partial list SAGE data have been poorly exploited by clustering analysis owing to the lack of appro priate statistical methods that consider their specific properties In the analysis methods proposed in Basic Protocol 3 SAGE data were modeled by Poisson statistic
124. NUCLEIC ACID AMPLIFICATION FROM INDIVIDUAL CELLS Laser Capture Microdissection Mammalian tissues are histologically and biologically heterogeneous and typically contain multiple cellular components such as epithelial mesenchymal 1 e stromal and inflammatory cells Laser capture microdissection LCM offers a rapid and precise method of isolating and removing specified cells from complex tissues for subsequent analysis of their RNA DNA or protein content thereby allowing assessment of the role of the cell type in the normal physiologic or disease process being studied LCM has been utilized to study molecular changes during the neoplastic progression of specific cell types Sgroi et al 1999 Paweletz et al 2000 and to understand the role of particular cell types in normal organ function Glasow et al 1998 Jin et al 1999 and in various disease processes Fend et al 1999a Sawyer et al 2000 LCM has the potential to contribute to the understanding of many cellular processes particularly processes involving multiple cell types such as embryonic development tissue differentiation and function aging and disease There are methods for tissue microdissection other than LCM such as laser microbeam microdissection and laser pressure catapulting in which a fine laser beam is used to cut around individual or groups of cells and then laser energy is used to catapult the cells out of the tissue section and allow their collec
125. Press San Diego Duguid J R Rohwer R G and Seed B 1988 Isolation of cDNAs of scrapie modulated RNAs by subtractive hybridization of a cDNA library Proc Natl Acad Sci U S A 85 5738 5742 Duguid J R and Dinauer M C 1989 Library sub traction of in vitro cDNA libraries to identify differentially expressed genes in scrapie infec tion Nucl Acids Res 18 2789 2792 Hara E Yamaguchi T Tahara H Tsuyama N Tsurui H Ide T and Oda K 1993 DNA DNA subtractive cDNA cloning using oligo dT Latex and PCR Identification of cellular genes which Table 25B 2 3 Time Requirements for Preparation of Subtracted cDNA Day Procedure Restriction endonuclease digestion 2 cDNA preparation Adapter preparation Adapter ligation Time required Overnight 0 5 hr to set up 1 5 hr 3 5 hr Amplification of ligated cDNA and checking 5 hr by gel electrophoresis Tracer and driver synthesis 3 First short subtraction Overnight 0 5 hr to set up Tracer and driver purification and quantitation 1 hr Tracer and driver annealing Removal of annealed and ssDNA Tracer and driver synthesis 2 hr short 3 hr Overnight 0 5 hr to set up 4 to 6 Second long subtraction Tracer and driver purification and quantitation 1 hr Tracer and driver annealing 40 hr long Removal of annealed and ssDNA 3 hr Tracer and driver synthesis Overnight 0 5 hr to set up 7to30 Further subtractions Variable Alternat
126. R primer 2 Adjust volume to 49 ul with ddH20 0 7 ul 5 U ul Platinum Tag DNA polymerase Aliquot 49 ul of reaction mix to each well then add 1 ul template at appropriate dilution see Support Protocol 2 The authors usually use a 300 reaction PCR premix that is dispensed into 96 well plates at 50 ul per well The volume of dNTPs to use is determined through optimization see Support Protocol 2 Platinum Taq DNA polymerase is used because it allows for a room temperature hot start reaction the Taq DNA polymerase is complexed with an anti Tag antibody that denatures when heated to 94 C 29 Carry out the amplifications in a thermal cycler with the following parameters 1 cycle 2 min 94 C denaturation 26 to 32 cycles 30 sec 94 C denaturation 1 min 55 C annealing 1 min 70 C extension 1 cycle 5 min 70 C final product extension The number of cycles to use is determined through optimization see Support Protocol 2 The ligase sample should be amplified for 35 cycles If a thermal cycler with heated lid is not available oil can be used to prevent evaporation see UNIT 15 1 Do not substitute conventional hot start PCR for use of Platinum Taq DNA polymerase Serial Analysis of The authors have found that yields are much lower if this is done There is no need to Gene Expression refrigerate the PCR mix while setting up the reactions SAGE 25B 6 8 Supplement 80 Current Protocols in Molecular Biol
127. S Fisher Scientific MEGAscript T7 Kit Ambion including rNTP solutions 10x reaction buffer T7 RNA polymerase enzyme mix RNase free DNase I Nuclease free H O RNeasy Mini Kit 50 columns Qiagen includes 1 5 and 2 0 ml collection tubes RNase free reagents and buffers including Buffer RLT and Buffer RPE Current Protocols in Molecular Biology BASIC PROTOCOL 2 Discovery of Differentially Expressed Genes 25A 3 7 Supplement 87 Ethanol Absolute Aaper Alcohol Random hexamer primer 1 ug ul Roche Diagnostics Microcentrifuge tubes nuclease free Heating block or water bath preset to 16 C 37 C 42 C 65 C 70 C 95 C Concentrator evaporator Vortex Perform first round RNA amplification 1 For each reaction mix the following components in a nuclease free microcentrifuge tube 0 5 ug l T7 oligo dT primer 1 ul total RNA extracted from LM sample 20 to 100 ng H20 DEPC treated to 10 5 ul 2 Incubate the samples 10 min at 65 C and cool on ice for 5 to 10 min The primer anneals to poly A containing RNA during this step and thereby attaches a copy of the T7 RNA polymerase promoter sequence to the cDNA molecules that will be synthesized in the following steps 3 Collect the samples by quick spin centrifugation 30 sec at 600 x g 4 Add 8 5 ul of the following mixture to each tube 10 mM dNTP mix 1 ul 5x first strand buffer 4 ul 0 1 M DTT 2 ul 40 U ul RNAseOUT 1 ul 5 ug ul T4 gene 32 protein
128. SIC PROTOCOL 3 Preparation of Single Cells from Solid Tissues for Analysis by PCR 25A 2 10 Supplement 66 4 Place samples in a PCR Gene Amp 2400 or equivalent and heat to 94 C for 5 min to inactivate DNase Reduce temperature to 50 C add 34 ul PCR PK solution to each sample and incubate 3 hr 5 Prepare standards and quantitate as described UNIT 15 7 Sawtell and Thompson 1992 Prepare standard dilutions representing 10 000 1 000 100 10 and O HSV viral genomes in 6 ul Standards are treated identically to the cell samples with the exception of DNase treatment To quantify other nucleic acids of interest use appropriate standards and optimized PCR assays UNIT 15 1 6 Incubate samples and standards 7 min at 94 C to inactivate proteinase K 7 Incubate at 63 C while adding 10 ul PCR amplification solution and 1 25 U Tag DNA polymerase per reaction 50 ul total 8 Amplify using the following program parameters 45 cycles 30 sec 94 C denaturation 30 sec DL annealing 30 sec RE extension Final step 7 min T2 extension hold PCR conditions should be optimized for the primer target of interest as described in UNIT 15 1 9 Electrophorese 5 ul each PCR product through a nondenaturing 12 polyacrylamide gel UNITS 2 5A amp 2 7 transfer to a Gene screen plus nylon membrane UNIT 2 9A and perform hybridization analysis UNIT2 94 amp 6 4 using a P end labeled oligonucleotide internal to the P
129. Spin X tube 5 min at maximum speed Pool eluates from two Spin X centrifuge tube filters into one 1 5 ml microcentrifuge tube and ethanol precipitate by adding the following 300 ul eluate 2 ul SeeDNA 133 ul 7 5 M ammonium acetate 1000 ul 100 ethanol Glycogen can be substituted for SeeDNA but the authors obtained better results when only SeeDNA was used Microcentrifuge 15 min at maximum speed Wash two times with 70 ethanol and air dry 5 min Resuspend purified concatemer DNA in 6 ul LoTE buffer Ligate the concatemers into vector 65 66 67 Digest 1 ug pZErO 1 plasmid with SphI in a total volume of 10 ul by adding the following 1 ul pZErO 1 plasmid 7 ul ddH2 O 1 ul 10x NEBuffer 2 1 ul 10 U l SpA Incubate 15 to 30 min at 37 C then heat inactivate 10 min at 65 C Do not digest gt 30 min Concatemers can be cloned and sequenced in a vector of choice The authors currently clone concatemers into a Sphl cleaved pZErO 1 Check for complete digestion on an agarose gel UNIT 2 54 Dilute the cut vector with 90 ul TE buffer pH 8 0 then extract with equal volume of PC8 Ethanol precipitate UNIT 2 1A Wash two times with 70 ethanol and resuspend in 40 ul water or TE buffer 25 ng ul of vector The authors recommend using the linearized DNA immediately but it may be stored for up to 2 weeks at 20 C with decreased ligation efficiency Ligation efficiency varies beyond 2 week storage A 2 to 5 fold inc
130. Supplement 55 42 Determine whether the clones are truly differentially expressed in the starting tissues by RNA expression analysis e g northern blot hybridization UNIT 4 9 RNase protection assay UNIT 4 7 quantitative RT PCR um 15 5 or in situ hybridization UNITS 14 3 amp 14 7 SUPPORT SLOT BLOT HYBRIDIZATION TO MONITOR SUBTRACTION PRTC OL After every three to four subtractions the progress of enrichment for differentially expressed genes is monitored by slot blot hybridization also see UNITS 2 9B amp 2 10 Additional Materials also see Basic Protocol cDNA from each subtraction see Basic Protocol step 28 3 M NaOH 2 M ammonium acetate pH 7 0 Probe dNTP mix see recipe Sephadex G50 80 spin column Pharmacia Biotech in sterile 1 ml syringe Additional reagents and equipment for slot blotting UNIT 2 98 and hybridization UNIT 2 10 1 Denature 1200 ng cDNA from each subtraction A B and B A by adding 0 1 vol of 3 M NaOH to cDNA and heating 30 to 60 min at 65 C 2 Neutralize the DNA by adding 1 vol of 2 M ammonium acetate pH 7 0 3 Spot duplicate 100 ng aliquots of denatured and neutralized cDNA from each subtraction onto each of six or more slot blots UNIT 2 9B 4 Use cDNA from A B Ap Bo a gene expressed at high levels in both A and B and one or more genes expressed differentially by A or B or a gene used to spike the reaction to prepare radiolabeled subtraction probes P
131. System the sections have to be completely dried otherwise the heat generated by the laser beam will be transmitted boil the tissue and destroy the mRNA If using a different microdissection system individually establish the conditions and parameters 5 To catch the catapulted tissue area in the lid of a PCR reaction tube pipet 5 ul lysis buffer on the inner wall of the lid 6 Centrifuge the lysed tissue mRNA and DNA at maximum speed and proceed with mRNA isolation and global amplification see Basic Protocol 1 NON RADIOACTIVE GENE EXPRESSION ANALYSIS ON NYLON ARRAYS This protocol allows one to assay the expression of many genes whose mRNAs are represented in the amplification in Basic Protocol 1 without expensive equipment It also assesses the complexity of sequences within the amplification which can be helpful before proceeding to more detailed analyses Test filters may be self prepared by spotting 5 to 50 ng of each cDNA sequence each should have a length of 300 to 700 bp in 1 to 2 ul of 0 1 M NaOH on a positively charged nylon membrane There are also several commercially available products See Chapter 22 for methods to prepare and assay arrays on glass slides Current Protocols in Molecular Biology BASIC PROTOCOL 2 Discovery of Differentially Expressed Genes 25B 8 9 Supplement 70 Gene Expression Analysis of A Single or Few Cells 25B 8 10 Supplement 70 Materials Expand Long Template
132. TOCOL 1 Particularly bloody specimens may benefit from separating red blood cells from other cellular elements thereby concentrating the desired cells especially epithelial cells This can be accomplished by utilizing the Ficoll Paque density gradient technique described here The specimen is layered onto an undiluted Ficoll Paque solution and centrifuged Differential migration during centrifugation results in the formation of layers enriched in different cell types This allows extraction of other cells in the sample from red blood cells This method is not ideal for isolating white blood cells for microdissection as many of them separate with the red blood cells See the Arcturus Engineering web site http www arctur com for a protocol for isolating the buffy coat of blood Materials Cytologic sample Sterile saline 1 e 0 9 w v NaCl or balanced salt solution Ficoll Paque Pharmacia 50 ml centrifuge tubes Concentrate cellular components 1 Centrifuge the cytologic sample for 10 min at 350 x g room temperature in a 50 ml centrifuge tube 2 Aspirate the supernatant with a pipet 3 Resuspend the cell button in 5 to 10 ml sterile saline or balanced salt solution Discovery of Differentially Expressed Genes 25A 1 7 Current Protocols in Molecular Biology Supplement 55 BASIC PROTOCOL 5 Laser Capture Microdissection 25A 1 8 Supplement 55 Separate cellular components 4 Add 20 ml Ficoll Paque to a
133. Tissues for Analysis by PCR 25A 2 6 Supplement 58 13 14 15 16 17 18 Centrifuge the gradient in a benchtop centrifuge 10 min at 1800 rpm 900 x g 4 C The Percoll gradient resulting in the optimum separation of neurons from support cells was determined empirically Remove tube from the centrifuge and place in a stable rack taking care not to disturb the gradient Visually inspect the gradient Carefully draw off the top myelin con taining layer to reduce contamination of cells banding lower on the gradient A band of cells should be apparent at the 50 60 interface This band will contain highly enriched neurons Insert a baked 9 in glass Pasteur pipette into the band of neurons and draw the banded cells into the pipette Place the Percoll cell mixture into a 15 ml polystyrene conical tube Rinse by filling the tube with 3xF H O and pelleting the cells by centrifuging in a benchtop centrifuge 10 min at 1800 rpm 900 x g 4 C A second gradient is not useful unless the first gradient has been overloaded Decant supernatant and resuspend the pellet in 12 ml 3xF H O Repeat two additional times After the final rinse decant the supernatant and resuspend the pellet in a small volume e g 300 to 500 ul 3xF H O Transfer resuspended cells to a 1 5 ml centrifuge tube and examine one drop using a microscope Determine number of neurons see Support Protocol For examples of results see Figure 25A 2
134. U ul E coli DNA ligase 4 ul 10 U ul E coli DNA polymerase I 1 ul 2 U ul E coli RNase H Vortex gently to mix Incubate 2 hr at 16 C Intermittently mix by gentle flicking Add 2 ul 5 U ul T4 DNA polymerase and incubate 5 min at 16 C Place tubes on ice and terminate reaction by adding 10 ul of 0 5 M EDTA pH 7 5 T4 DNA polymerase is used in the reverse SAGE protocol to fill in 5 overhangs generated after second strand synthesis Add 150 ul PC8 and vortex thoroughly Microcentrifuge 5 min at maximum speed room temperature Remove and save aqueous layer 150 ul Unlike microSAGE the reverse SAGE protocol synthesizes DNA onto unbound biotiny lated oligonucleotides making purification i e phenol chloroform extraction followed by ethanol precipitation easier As a result the heat denaturation and multiple wash steps in the SAGE protocol are unnecessary Ethanol precipitate aqueous layer in a fresh standard 1 5 ml microcentrifuge tube by adding the following reagents 2 ul SeeDNA 70 ul 7 5 M ammonium acetate 500 ul 100 ethanol Vortex thoroughly then microcentrifuge 20 min at maximum speed 4 C Wash pellet in 70 ethanol Resuspend in 20 ul LoTE buffer Samples may be stored at 4 C up to a week or frozen at 20 C for months However it is best to leave at 4 C overnight and resume the protocol the following day Cleave cDNA with anchoring enzyme NlallID and ligate linkers 10 Cleave cDNA with th
135. a 1 ul aliquot for RNA quantification a low volume spectrophotometer such as a NanoDrop can be used The purified concentrated RNA may now be used in cDNA synthesis to generate templates for qRT PCR microarray analyses or RNA seq COMMENTARY Background Information The use of LM technology was first de scribed for high resolution analyses of gene expression in mammalian cells and tissues Becker et al 1996 Emmert Buck et al 1996 Luo et al 1999 and has been especially utilized in analyses of the molecular patho genesis of human disease reviewed in Espina et al 2007 Protocols utilizing LM to ana lyze gene expression in mammalian systems are presented in UNIT 25A 1 Owing to the rela tively small amount of tissue harvested during a typical LM experiment a key innovation in the use of LM for global expression profil ing was the development of reliable protocols for the amplification of nucleic acids includ ing linear amplification of RNA using T7 RNA polymerase Van Gelder et al 1990 Eberwine et al 1992 Indeed the combined use of LM and RNA amplification has enabled analyses of gene expression from picogram quantities of RNA extracted from a single animal cell Becker et al 1996 Schiitze and Lahr 1998 Kamme et al 2004 Further the use of LM for proteomic analyses is hampered by the inabil ity to amplify harvested proteins such that its use is restricted to analyses of very abundant proteins extr
136. acted from a relatively large num ber of microdissected cells Schad et al 2005 Dembinsky et al 2007 reviewed in Mustafa Initially the biological and histological pe culiarities of plant cells presented procedural challenges to the use of LM in plants For ex ample many plant cells are especially small in comparison to animal cells whereas other plant cells contain extremely large vacuoles harboring hydrolytic enzymes Perhaps the greatest obstacle in adapting LM technology to plants is the presence of extremely rigid in terconnected cellulosic cell walls that present a formidable barrier to laser cutting and cell harvesting However protocols are now de veloped for the fixation infiltration and em bedding of a wide range of plant cell and tis sue types amenable to laser microdissection mediated transcriptional profiling including the vasculature leaf epidermis hypocotyl em bryo root shoot apical meristem organ exci sion zone and fibers Asano et al 2002 Kerk et al 2003 Nakazono et al 2003 Casson et al 2005 Klink et al 2005 Schad et al 2005 Woll et al 2005 Jiang et al 2006 Dembinsky et al 2007 Ohtsu et al 2007 Spencer et al 2007 Wu et al 2007 Yu et al 2007 Zhang et al 2007 Cai et al 2008 Critical Parameters and Troubleshooting Tissue fixation The fixative must penetrate plant tis Differentially et al 2008 sues and arrest biological activities while
137. adapter remnant of Taql site the original sequence between the TaqI and Msel recognition sequence and a second different from TaqI universal sequence at the Msel end Msel adapter remnant of Msel site Figure 25B 5 3 The primer design matches the newly created fragment ends The use of the restriction endonuclease combination TagI Msel and primers containing four selective nu cleotides two selective bases for JagI and two selective bases for Msel divides the mixture of transcript fragments into 256 different frag ment subsets Each fragment subset will be amplified by a specific combination of TaqI and Msel primers 1 e a primer combination and will display a small amount 1 e 1 256 of the transcript fragments in a specific sample From various experiments it is known that an AFLP fragment will be detected if at least 1 1000 part of the AFLP primer is incorporated in the AFLP Current Protocols in Molecular Biology Tagl fragment P Vos unpub observ P Stanssens unpub observ therefore the detection sensi tivity of the protocol described in this unit will generally be quite high However it should be noted that the detection sensitivity may vary from one primer combination to another as a result of the specific subset of transcript frag ments that will be amplified within each primer combination In conclusion the use of cDNA AFLP is an attractive technology for gene expression analysis and transcrip
138. agents and materials for casting denaturing polyacrylamide gels UNIT 2 12 agarose gel electrophoresis UNIT 2 54 and molecular cloning of PCR products UNIT 15 7 NOTE For details concerning use of the GATC 1500 Direct Blotting Electrophoresis apparatus consult the manufacturer s instructions Prepare the gel 1 Cast a denaturing 4 5 polyacrylamide gel UNIT 2 12 Attach a 40 to 45 cm long piece of blotting membrane to the conveyor belt of the direct blotting electrophoresis system Mount the gel on the apparatus and fill with the appropriate amount of TBE electrophoresis buffer using degassed buffer in the lower chamber Move the leading edge of the membrane 1 cm past the lower edge of the gel Connect apparatus to a high voltage power supply When choosing the direct blotting technique all fragments including the largest ones pass through the whole length of the gel Thus a lower acrylamide concentration i e 4 5 instead of 6 is used as compared to the concentration used for standard sequencing gels 2 Prerun 1 e with no sample the gel for 30 min with the power supply set to 2000 V and 30 W as limiting parameters Electrophorese samples and transfer to the membrane 3 Rinse gel slot with TBE buffer using a 10 ml syringe and 25 G needle and insert a 32 well sharkstooth comb Using GELoader tips with the capillary like part cut away load 1 to 1 5 ul denatured reaction see Basic Protocol step 18 per well bei
139. ailable Metal weighing dish Tweezers or paintbrush fine point Paraffin embedding rings Simport Paraffin clear base molds Surgipath Plastic bags Rotary microtome Probe on Plus slides Fisher Scientific or PEN Membrane Slides P A L M microbeam Slide warming tray Fisher Scientific Paper towels Dissecting microscope PALM MicroBeam System Carl Zeiss PALM adhesive cap tubes Carl Zeiss or 0 5 ml centrifuge tubes with caps NOTE Work in a fume hood until samples are securely capped and placed at 4 C Keep fixative cold at all times to ensure slow penetration of fixative Fix samples 1 Using a fresh single edged razor blade separate the seedling shoot from the root by slicing at the coleoptile node which is the point of insertion of the first leaf like organ of the shoot Retain the apical portion 1 e the shoot and place in a glass petri dish containing ice cold acetone Immediately execute a second cut 1 cm above the coleoptile node and retain the lower portion which will isolate the base of the shoot containing the SAM from the upper portion of the shoot containing expanded leaves IMPORTANT NOTE High concentrations of acetone can cause dizziness confusion unsteadiness and unconsciousness if it comes into contact with the lungs digestive tract or Skin Wear gloves and always work in a fume hood Current Protocols in Molecular Biology BASIC PROTOCOL 1 Discovery of Differentially Expressed Genes
140. al steps prior to hybridization are comparable in both intensity and size distribution Agarose gel electrophoresis is the preferred method for evaluating products in the protocol since this method allows not only concentration determi nation but also visualization of DNA integrity When preparing cDNA any standard protocol or kit may be used however be aware that some reverse transcriptases may contain minute amounts of contaminating vector which can give false positive results To ensure the highest quality full length cDNA poly A RNA should be immediately subjected to reverse transcrip tion and second strand cDNA synthesis with no intermediate storage or precipitations If the amount of amplicon generated is suboptimal several more cycles of PCR may be performed with the addition of new Taq DNA polymerase however PCR introduced distortions of representations can be expected to be more pronounced at higher cycle num bers Subtractive kinetic enrichment In every round of subtractive hybridization the amount of driver DNA remains constant The amounts of tester the product from the previous round will diminish round by round to ultimately yield only the difference product or the differentially expressed targets For DNA RDA increasing stringency occurs with suc cessive tester driver ratios of 1 100 1 800 1 400 000 and 1 8 000 000 The tester driver hybridization ratios may be modified particu larly when performing c
141. aling temperatures allow for an extended touchdown starting at a tem perature that is well above the oligonucleotide melting point However if the rs AGE specific primer has an annealing temperature which is too low there is a risk of the primers melting off the template before the extension cycle Therefore if the calculated Tm of the SAGE tag specific primer is below 40 C it is advisable Current Protocols in Molecular Biology Table 25B 6 1 Troubleshooting for SAGE Reactions Problem MicroSAGE No PCR product with control primers following cDNA synthesis Ditag PCR product is slightly shorter running at 90 bp and will not redigest with Nlalll PCR product in no ligase control at 100 bp Ditag yield low 100 bp band lt 80 bp band Ditags do not cut with N alll following purification Ditag concatemers not generated efficiently Ditag concatemers most concentrated at high molecular weight 3kb and do not clone efficiently Current Protocols in Molecular Biology Possible Cause Dynabeads inactive Reverse transcriptase inactive RNA degraded prior to homogenization Cells insufficiently lysed Failure to completely remove E coli DNA polymerase I following second strand cDNA synthesis Contamination of reagent by ditags from a previously constructed SAGE library Ratio of linkers to cDNA too high cDNA synthesis inefficient PCR conditions not optimized Quantity of starting material
142. alysis To view or download results with calculated F values please click the following link sample txt 1370 txt 2 Select Organism for SAGE Tag Mapping annotation o Human x Back to main page Figure 25B 6 6 Selection of libraries 1 3 and 5 for significance analysis Mozilla Firefox File Edit View History Bookmarks Tools Help gt E tt __ http genome dfci harvard edu sager sig sample txt 1371 S mozilla org mozillaZine S mozdev org Genome Biology P BioMed Central My AARARARAAAL 23 53 23 10 AAAAAAAAAC 22 50 24 1i AAAAAARAAG 19 67 26 12 JAAAAAAAGA 24 55 24 7 AAAAAAAATG 1 Sz 15 9 ecececccaa 17 8 z 43 ccceccccca 27 10 6 49 ecceccecccTa 23 Li 10 45 eccccccGac 19 g 7 45 CECCCCGGTG 23 10 8 45 GGGGGGGAAA 10 12 10 9 GGGGGGGCCC 9 11 10 5 GGGGGGGCCG 8 10 8 7 GGGGGGGCGC 92 93 GGGGGGGTCC gq 10 g amp TTTTTTTECT 1i 10 10 46 TTTTTTTTAA 11 g 10 45 TTTTTTTTTC 10 9 10 48 TTTTTTTTTG 10 9 10 47 TTTTTTTTTT 11 11 g 48 09786 09 15989e 09 60412e 13 77473e 11 3842 6e 10 72739e 05 000330172 00191342 000314162 000822465 317675 367276 420583 4702 6e 08 553863 00042344 000314162 94093e 05 0 000136754 0 000369744 mooomooooqo0qooqo orrrnv wi Ww Figure 25B 6 7 Results from the significance analysis Column 1 is the SAGE tag columns 2 to 6 are five different SAGE libraries column 7 is calculated P value Current Protocols in Molecular Biology
143. alyze nucleic acids in individual cells using PCR or other methods The LCM protocols in UNIT 25A 1 are optimized for analysis of animal cells and tissues while those in UNIT 25A 3 are optimized for plant cells and tissues Additionally UNIT 254 3 describes a protocol for in vitro transcriptional amplification of RNA which is a frequently used alternative to PCR that entails linear rather than exponential amplification and thus has certain advantages and disadvantages relative to PCR UNIT 254 2 describes methods for fixation of tissues and subsequent dissociation of the fixed tissue into single cells whose nucleic acids can be analyzed by PCR based or other methods Section 25B contains molecular methods for discovery of differentially expressed genes UNIT 25B 1 formerly UNIT 5 8B describes production of a subtracted cDNA library while UNIT 25B 2 formerly UNIT 5 9 describes the refinement of PCR based subtractive cDNA cloning with a support protocol for slot blot hybridization to monitor sublibraries Sub tracted cDNA libraries provide a method where cDNAs are synthesized from mRNA from the desired tissue or cell type and then sequences that are also expressed in a control tissue or cell type are removed by hybridization and selection UNIT 25B 3 describes a powerful application of PCR to gene discovery differential dis play This technique allows the identification and subsequent isolation of differentially expressed genes that requires
144. ample selected cell s cell s of interest glass slide Figure 25A 1 4 LCM Instrument Schematic of the operation of the PixCell Laser Capture Microdissection Instrument indicating the location of the transfer arm transfer film cap and the glass slide with the specimen to be microdissected Also shown is a cross section of the tissue specimen with overlying cap demonstrating the effect of laser firing Reprinted with permission from Bonner et al 1997 molecular i e DNA RNA and protein re covery Lengths of RNA and DNA of up to 800 base pairs have been recovered from sections prepared from frozen tissue http www arctur com Dietmaier et al 1999 Shibu tani et al 2000 however histologic and cy tologic detail are poor compared to fixed par affin embedded tissue and subtle diagnostic features may be difficult to discern The most frequently utilized tissue fixative is neutral buffered formalin NBF 1 e 10 buffered formaldehyde followed by paraffin embed ding to allow histologic sectioning This com bination results in cross linking and break age of proteins RNA and DNA which must be considered when utilizing tissues prepared in this manner Regardless of the preparation cells or tissue are usually stained in order to be visualized for Current Protocols in Molecular Biology LCM although LCM can be performed suc cessfully without staining Hematoxylin and eosin H amp E
145. and however the majority of the clones should contain a single true positive difference product Time Considerations Preparation of amplicons and repre sentations requires 4 days Each round of DNA Discovery of Differentially Expressed Genes 25B 7 11 Supplement 60 Representational Difference Analysis 25B 7 12 Supplement 60 kinetic subtractive enrichment also requires 4 days If three rounds are performed an RDA experiment exclusive of DNA and cDNA preparation or subsequent cloning can be com pleted in 16 days Four rounds require 20 days With some consideration for life s distractions an RDA experiment can be performed in 4 weeks Acknowledgments The contributor would like to thank Nikolai A Lisitsyn Michael Wigler and Craig V Byus for providing detailed laboratory protocols for RDA Roy Bohenzky and Patrick S Moore for helpful discussion and Patrick S Moore for review of the protocol Literature Cited Bakin A V and Curran T 1999 Role of DNA 5 methylcytosine transferase in cell transforma tion by fos Science 283 387 390 Birkenmeyer L G Desai S M Muerhoff A S Leary T P Simons J N Montes C C and Mushahwar I K 1998 Isolation of a GB virus related genome from a chimpanzee J Med Vi rol 56 44 51 Chang Y Cesarman E Pessin M S Lee F Culpepper J Knowles D M and Moore P S 1994 Identification of herpesvirus like DNA se quences in AIDS asso
146. and nonradioactive in gel detection of DNA by silver staining turned out to lack sufficient sensitivity and also significantly reduced the dynamic range of display patterns A Fischer unpub observ Attempts to bypass the physi cal fragment isolation step by defining frag ment signatures and performing database searches after fluorescent gel display on an automatic DNA sequencer A Fischer unpub observ Shimkets et al 1999 Sutcliffe et al 2000 are hampered by the unpredictable influ ence of base composition on the electrophoretic mobility of a DNA strand which introduces considerable inaccuracies when fragment sizes are to be determined and are unsuitable for organisms less well characterized molecularly Current Protocols in Molecular Biology Table 25B 4 1 Troubleshooting Guide for RMDD Problem Possible cause Solution Low amount of first round PCR RNase contamination Take care to use only RNase free solutions product Make sure RNA is not contaminated by remaining traces of RNase Check integrity of ribosomal bands after cDNA first strand synthesis RNA preparation contaminated Use only RNA that is as pure as possible by inhibitors of cDNA synthesis Usually standard purification protocols e g the classic guanidinium method UNIT 4 2 or more modern commercially available RNA purification columns if not overloaded yield RNA of sufficient purity Should problems persist in very tenacious cases purifi
147. and Feurstein G Z 1995 Direct sequenc ing of DNA isolated from mRNA differential display BioTechniques 18 448 453 Wodicka L Dong H Mittmann M Ho M H and Lockhart D J 1997 Genome wide expres sion monitoring in Saccharomyces cerevisiae Nature Biotechnology 15 1359 1367 Wybranietz W and Lauer U 1998 Distincet com bination of purification methods dramatically improves cohesive end subcloning of PCR prod ucts BioTechniques 24 578 580 Zhang H Zhang R and Liang P 1996 Differen tial screening of gene expression difference en riched by differential display Nucleic Acids Res 24 2454 2455 Discovery of Differentially Expressed Genes 25B 3 9 Supplement 56 Differential Display of mRNA by PCR 25B 3 10 Supplement 56 Zhang L Zhou V E Velculescu S E Kern R H Hruban S R Hamilton B Volgelstein B and Kinzler K W 1997 Gene expression profiles in normal and cancer cells Science 276 1268 1272 Zhao S Ooi S L and Pardee A B 1995 New primer strategy improves precision of differen tial display BioTechniques 18 842 850 Zhao S Ooi S L and Pardee A B 1996 Three methods for the identification of true positive cloned cDNA fragments in differential display BioTechniques 20 400 402 Key Reference Liang et al 1993 See above Uses the protocol outlined here and presents exam ples of data generated Contributed by Peng Liang Vanderbilt Ing
148. and terminate reaction by adding 100 ul of 0 5 M EDTA pH 8 0 Wash beads one time with 0 5 ml of 1x BW buffer 2x BSA 0 1 w v SDS The BSA appears to reduce the stickiness of the beads and improves the efficiency of the washes and the quality of the library Extra washes with SDS can cause beads to clump severely Wash beads three times each in 500 ul of 1x BW buffer 2x BSA Resuspend beads in 500 ul of 1x BW buffer 2x BSA and heat 20 min at 75 C This heating step is crucial as it inactivates the nuclease activity of Poll Wash three times in 500 ul of 1x BW buffer 2x BSA Wash twice with 200 ul of 1x NEBuffer 4 2x BSA transferring to new tubes after the first wash in NEBuffer 4 BSA and saving 5 ul of the last bead suspension Using the saved 5 ul aliquot check the integrity of the cDNA by PCR see Support Protocol 1 using primers for genes known to be in the cDNA used for library construction Cleave cDNA with anchoring enzyme NlalID and ligate linkers to cDNA 14 15 16 17 Resuspend beads in following mix 171 ul LoTE buffer 4 ul 100x BSA 20 ul 10x NEBuffer 4 5 ul 10 U ul Niall Incubate 1 hr at 37 C After incubation place on a magnetic rack 30 sec then wash beads with the following solutions by pipetting up and down several times with a 200 ul aerosol barrier pipet tip Twice with 500 ul 1x BW 2x BSA 1 Tween 20 Four times with 500 ul 1x BW 2x BSA Twice with 1x T4 DNA ligase buffer Aft
149. andard methods e g UNIT 4 2 Trizol Sigma is the preferred method in the authors laboratory The same RNA with which the original SAGE library was generated would be ideal see Basic Protocol 1 steps 3 and 4 It is advisable to also generate a control rSAGE library that will not express the genes of interest As PCR cloning from the rSAGE library might generate more than one clonable band PCR of a control rSAGE library would allow the researcher to discriminate and identify the likely rSAGE product representing the gene of interest 2 Add 2 ul of 1 ug ul gel purified BRS1 primer to a nonsiliconized 1 5 ml microcen trifuge tube Add 6 ul total RNA 5 to 10 ug total and mix Current Protocols in Molecular Biology Heat mixture to 70 C for 10 min and quick chill on ice Microcentrifuge briefly at room temperature Prepare first strand synthesis mix as shown below 8 ul BRS1 primer RNA 4 ul 5x first strand buffer 2 ul of 0 1 M DTT 1 ul of 10 mM dNTP Mix gently by vortexing and microcentrifuge briefly at room temperature Incubate 2 min at 37 C then add 5 ul of 200 U ul SuperScript II reverse transcriptase and mix well Incubate an additional 1 hr at 37 C After incubation place tube on ice to terminate the reaction Add the components of the second strand synthesis mixture to the first strand reaction on ice in the order shown 93 ul DEPC ddH20 4 C 30 ul 5x second strand buffer 3 ul 10 mM dNTP 1 ul 10
150. aq DNA polymerase buffer 6 ul 25 mM MgCl 2 ul 10 mM 4dNTP mix 1 ul diluted P dCTP 1 ul 2 5 ug ul oligonucleotide a2 or b2 2 ul Ay or Bo cDNA 0 4 ug 1 ul 5 U ul Taq DNA polymerase Add a few drops of sterile PCR grade mineral oil to cover the reaction The amount of cDNA used for these initial A and B tracer synthesis reactions is 400 ng this may be decreased but use 240 ng for the first amplification In subsequent amplifica tions use 5 to 10 ng A or B cDNA These reactions yield P labeled tracer cDNA P JAj and 32 P Bo in the first round and P A and P P B in subsequent rounds see Fig 25B 2 2 16 For both sets of amplified cDNAs set up three or four driver synthesis PCRs 100 ul 17 18 per reaction 73 3 ul H O 10 ul 10x Taq DNA polymerase buffer 6 ul 25 mM MgCl 6 7 ul driver dNTP mix 1 ul 2 5 ug ul oligonucleotide a2 or b2 2 ul Ay or B cDNA 1 to 5 ng 1 ul 5 U ul Tag DNA polymerase Add a few drops of sterile PCR grade mineral oil to cover the reaction The driver dNTP mix contains 0 5 mM bio 11 dUTP and 1 0 mM dTTP In the authors hands this ratio of bio 11 dUTP ATTP gives the highest overall subtraction efficiency and still allows efficient base pairing These reactions yield biotinylated driver cDNA Bio Ay and Bio B in the first round and Bio A and Bio B in subsequent rounds see Fig 25B 2 2 Use the PCR amplification program described in step 13 for tracer an
151. ard PCR amplification Therefore if the targeted genetic change does not result in a unique DNA fragment after digestion then the change cannot be detected In the case of DNA RDA it is critical that the two samples to be compared are extracted from tissues or cells of nearly identical genetic background To look for polymorphism tissues from closely related individuals of the same gender may be used To look for genetic changes associated with a neo plastic phenotype tumor and normal tissue from the same individual is appropriately matched unless the genetic change is germline Although translocations may be identified whether the neoplastic tissue is used as the driver or tester deletions require the neoplastic DNA to be used as driver When the nature of the genetic change is not known it is reasonable to perform two RDA with the samples switched from their designation as driver or tester Several issues arise when hunting for a mi crobial agent The agent s genome must be large enough to offer a DNA fragment which when digested is big enough to PCR and the genome must go through a DNA stage in its life cycle RNA viruses must be pursued using cDNA RDA Optimally samples are acquired in a sterile manner and are free from contami nating organisms In particular epithelial or mucosal surfaces should be dissected off prior to DNA extraction Diseases primarily involv ing such tissues are difficult to analyze by RDA unless ex
152. are per formed the remaining single stranded plas mids are transformed into bacteria for amplifi cation Duguid et al 1988 Rubenstein et al 1990 The subtracted library can be used in further rounds of subtractions however the method is laborious and care must be taken to avoid contamination with the double stranded ds forms of the phagemid Contaminating ds phagemid DNA will not be subtracted away and will transform bacteria much more efficiently than single stranded DNAs do thus reducing the overall subtraction effect Other methods have used cDNA attached to oligo dT Latex in combination with the polymerase chain reac tion PCR This allows the driver to be reused Hara et al 1993 An alternative solution described in this pro tocol regenerates the cDNAs by PCR Duguid and Dinauer 1989 Wang and Brown 1991 A problem with PCR is that it amplifies smaller fragments better than larger fragments and therefore selects for smaller mRNAs Wang and Brown 1991 overcame this difficulty by cut ting the original cDNAs to smaller sizes before PCR This approach allows multiple rounds of subtractions and has allowed isolation of many genes that are differentially expressed in meta morphosis stage Xenopus embryos after thy roid hormone treatment Buckbinder and Brown 1992 With the modified protocol de tailed here the authors have isolated many genes that delineate the early events of neural induction and anteroposterio
153. area without tissue fire the laser by clicking the red button on the remote thumb switch to assess the effectiveness of the laser focus and settings Effective melting wetting of the polymer on the lower surface of the cap is indicated by a circle with a well defined black outline see Fig 25A 1 2 If the edges of the circle are not well delineated check to make sure that the tissue section where the cap is placed is flat and refocus the beam If this fails increase the power and or duration gradually and as little as possible see Troubleshooting 11 Test the effectiveness of LCM in the tissue section by moving the tracking beam to the cells to be microdissected After targeting the cells fire the laser Move the slide Current Protocols in Molecular Biology Discovery of Differentially Expressed Genes 25A 1 11 Supplement 55 Figure 25A 1 2 Polymer Melting After Laser Firing A An adequate and effective melt has a sharp delineated border B The border of an inadequate melt is blurred and indistinct with the joystick to another group of cells and fire the laser again Limit the number of pulses for this test to two or three The delineation of the circle may be more difficult to visualize on the tissue section but the tissue in an area of proper wetting should become more sharply focused because the melted polymer acts as a coverslip Lift the placement arm and inspect the area in which the laser was
154. at a driver cDNA tracer cDNA ratio of 20 1 and a driver concentration of 2 mg ml or for a driver with fragment sizes of 200 bp 15 umol liter In order to achieve this concentration hybridizations are performed in small volumes 5 to 10 ul Subtractions are performed in driver excess to ensure that the reannealing rate is a function of the driver concentration only and to drive hybridization of tracer as close to completion as possible Subtractions are performed either for a short period of time to remove sequences that are common to both A and B and abundant in both or for much longer to remove rarer sequences that are common to both A and B see Critical Parameters After annealing tracer driver and driver driver hybrids are efficiently removed by addi tion of streptavidin a protein that specifically and tightly binds biotin and extraction with phenol Biotinylated nucleic acid that has bound streptavidin is taken into the organic phase or remains at the interface Sive and St John 1988 Unhybridized tracer or tracer hybrids are not removed by the streptavidin phenol treatment because they are not biotinylated and so remain in the aqueous phase This constitutes subtraction and enrichment for differentially expressed genes cDNAs remaining after the first set of subtractions are termed A and B these are used for the next round of subtraction The subtraction sequence is shown in Figure 25B 2 3 The number of subtractions necessary dep
155. ate aRNA that is in antisense orientation whereas other protocols produce sense oriented aRNA Before choos ing a particular RNA amplification method re searchers planning to perform LM microarray analyses should be particularly attentive to the strand orientation of the microarray probe el ements to ensure that the aRNA is compatible with the array platform of choice Although capable of gt 10 fold amplifi cation VT also introduces some degree of bias that may be exacerbated following mul tiple rounds of RNA amplification Amplified RNA prepared in this manner is 3 truncated and may contain some degree of non linear amplification some transcripts may amplify more efficiently than others such that the rela tive transcript abundances may not be exactly equivalent to the starting mRNA Notably Current Protocols in Molecular Biology these VT introduced biases tend to be system atic and reproducible such that direct compar isons of any two samples subjected to equiv alent RNA amplification protocols are usually compensated for inherent biases Nakazono et al 2003 Schneider et al 2004 Wilson et al 2004 Day et al 2007 Kerk et al 2003 analyzed the linearity of IVT ampli fication using Arabidopsis RNA and reported correlation coefficients of 0 92 unamplified RNA amplified RNA after a single round of RNA amplification versus 0 87 after two sequential amplifications results that are in agreement with those
156. aterials Dynabeads mRNA DIRECT kit Dynal Biotech Dynabeads oligo dT 25 Lysis binding buffer Washing buffer A add 1 ul 20 mg ml molecular biology grade glycogen Roche Diagnostics per milliliter Washing buffer B Cells or tissue of interest SuperScript Choice System cDNA synthesis kit Invitrogen 5x first strand buffer DEPC treated UNIT 4 1 double distilled water DEPC ddH20 1x first strand buffer dilute from 5x stock in DEPC ddH O 0 1 M DTT 10 mM dNTP 200 U ul SuperScript I reverse transcriptase 5x second strand buffer 10 U pl E coli DNA ligase 10 U ul E coli DNA polymerase I 2 U ul E coli RNase H 1x and 5x T4 DNA ligase buffer 1 U ul T4 DNA ligase 0 5 M EDTA pH 8 0 APPENDIX 2 1x BW buffer see recipe 2 x BSA New England Biolabs 0 1 w v SDS 1x BW buffer 2x BSA 1x NEBuffer 4 New England Biolabs 2 BSA LoTE buffer see recipe 100x BSA New England Biolabs 10 U ul Niall and 10x NEBuffer 4 New England Biolabs store at 80 C 1x BW buffer 2x BSA 1 v v Tween 20 Annealed linkers see Support Protocol 3 5 U l high concentration T4 DNA ligase Invitrogen 2 U ul BsmFI New England Biolabs PC8 see recipe SeeDNA Amersham Pharmacia Biotech 3 1 solution of 20 mg ml glycogen SeeDNA optional 3 M sodium acetate APPENDIX 2 70 and 100 ethanol Klenow fragment of DNA polymerase I and 10x buffer Amersham Pharmacia Biotech or Roche Buffer H 3 mM Tris Cl pH 7 5 APPENDIX 2 10x SAGE PCR amplification buffer
157. ating libraries UNIT 6 1 preparing replica filters UNIT 6 2 hybridizing replica filters UNIT 6 3 preparing minipreps of plasmid DNA uniT 1 6 and sequencing plasmid DNA UNIT 7 4A amp 7 4B Discovery of Differentially Expressed Genes 25B 2 5 Current Protocols in Molecular Biology Supplement 55 Digest ds cDNA with restriction endonucleases Double stranded cDNA ds cDNA is digested with frequent cutting restriction endonu cleases into 200 to 600 bp fragments so PCR will not be biased towards smaller fragments 1 For each set of ds cDNA A and B set up two digestions Alul and Alul Rsal as follows 30 ng ds cDNA 3 ul 10x Alul buffer 10 U Alul or 10 U Alul 10 U Rsal H O to 30 0 ul Incubate overnight at 37 C to ensure complete digestion Any other frequent cutting restriction endonucleases may be used but enzymes that generate blunt ends are preferable If an enzyme does not generate blunt ended DNA fragments an additional filling in or chewing back step is required This protocol starts with double stranded cDNA full length if possible and primed with oligo dT from each cell type being compared see UNIT 5 5 Commercially available CDNA synthesis kits from several companies e g Pharmacia Biotech or Life Technolo gies work well even with lt 100 ng poly A RNA Silanized tubes and glycogen are used during ethanol precipitation to avoid loss of cDNA Sephacryl S 400 columns Pharmacia Biotech
158. atio of 1 800 1 400 for HindIII representations For a third subtractive kinetic enrichment mix 40 ul 100 pg difference product from the second subtractive kinetic enrichment 400 pg for HindIII representation and 80 ul 40 ug driver amplicon DNA digest Proceed exactly as outlined in steps 28 to 51 using O primers oligomers The third hybridization is done at a tester driver ratio of 1 400 000 1 200 000 for HindIII representations For Hind lll Use 5 pg difference product from the third subtractive kinetic enrich ment tester driver ratio of 1 8 000 000 Again proceed through steps 27 to 51 of the protocol except substitute E for O primers oligomers and use 27 cycles in the final PCR of the selective amplification step 44 For HindIII representation sometimes this fourth subtractive kinetic enrichment is needed Clone products following gel isolation UNIT 2 6 or use shotgun cloning and sub sequent sequencing UNIT 7 1 Current Protocols in Molecular Biology cDNA REPRESENTATIONAL DIFFERENCE ANALYSIS cDNA RDA works under the same principles as RDA of genomic DNA and requires only minor modification from the procedure described above see Basic Protocol 1 Two RDAs may be performed at the same time with the testers and drivers reversed in order to detect both induced as well as suppressed transcripts There are two other modifications to Basic Protocol 1 The first is the substitution of DpnII or its isoschizomer Sau3A
159. ation of sharp 28S and 18S ribosomal bands should be seen 5 Place the tube on a magnetic rack for 2 min then remove the supernatant This supernatant can be used for a genomic DNA prep if desired 6 Wash beads by pipetting up and down several times with a 200 ul aerosol barrier pipet tip in the following sequence Twice with ml washing buffer A Once with ml washing buffer B Four times with 1x first strand buffer Pipetting the beads is more efficient than flicking the tubes 7 Resuspend beads in the following first strand synthesis mix 54 ul DEPC ddH2 O 18 ul 5x first strand buffer 9 ul 0 1 M DTT 4 5 ul 10 mM dNTP Heat tube 2 min at 37 C then add 3 ul of 200 U ul SuperScript II reverse transcrip tase Incubate 1 hr at 37 C mixing beads every 10 min by hand Terminate reaction by placing tube on ice 8 Add the following components of the second strand synthesis to the first strand reaction on ice in the order shown 227 ul ddH20 prechilled 150 ul 5x second strand buffer 15 ul 10 mM dNTP 3 ul 10 U ul E coli DNA ligase 12 ul 10 U ul E coli DNA polymerase I Discovery of 3 ul 2 U ul E coli RNase H Differentially Expressed Genes 25B 6 5 Incubate 2 hr at 16 C mixing beads every 10 min by hand Current Protocols in Molecular Biology Supplement 80 Serial Analysis of Gene Expression SAGE 25B 6 6 Supplement 80 10 11 12 13 After incubation place tubes on ice
160. ation of the LCM specimens Clean the microscope stage and capping station before beginning the microdissection e g use 95 ethanol wipes to reduce the possibility of contamination Position slide section to be microdissected 1 Turn on the PixCell I or I Laser Capture Microdissection System Open the Arcturus LCM software if it is to be used The Arcturus LCM software is not required for LCM as all adjustments of parameters can be made on the laser electronics box however it eases the use of the instrument and performs useful functions such as counting the pulses of the laser shots and allowing the procurement and archiving of images 2 Place the glass slide with the stained section to be microdissected on the microscope stage Move the joystick so that it is perpendicular to the tabletop to allow proper placement of the CapSure transfer film cap Focus the microscope to view the tissue or cells Locate the area to be microdissected moving the slide by hand rather than with the joystick so that the joystick will be in proper alignment when the area to be microdissected is located Samples are usually stained in order to be visualized for LCM however LCM can be performed successfully without staining but desired cells may not be identifiable The area selected should be located such that a portion of the slide covers the vacuum chuck hole and the slide spans the central hole in the stage Current Protocols in Mol
161. ation of the selective amplification principle The smallest squares indicate subsets of the transcript fragment population amplified with four selective nucleotides two for Taql and two for Msel and exemplified by the black square amplified with Taql AT and Msel CT The 16 larger squares composed of 16 of the smallest squares indicate the transcript fragment subsets amplified using two selective nucleotides exemplified by the dark gray square of Jagl A and Msel C The total transcript fragment population is depicted by the full square composed of 256 of the smallest squares but require the use of adaptors and primers that match the recognition sequences of the corresponding enzymes see Reagents and Solutions Restriction enzymes that cut less frequently in the cDNA are not advised since these enzymes target only a small subset of the mRNAs To generate specific subsets of fragments three PCR steps are used which minimizes mismatch amplification When all combinations of PCR primers are used at each step as prescribed in the protocol this generates an expression profile consisting of 256 finger prints Fig 25B 5 2 One can modify the protocol to use only certain primer combina tions but this will yield fewer fingerprints and less information The first PCR step entails no selective nucleotides on each primer 1 e nonselective preamplification 0 0 The second step entails one selective nucleotide at each primer selective prea
162. bes and 28 for the other 5 Remove 10 ul from each reaction and run on a prepoured 20 polyacrylamide TBE gel using a 20 bp ladder as a marker 10 ul of 1 5 dilution of the marker stock solution see Basic Protocol 1 steps 35 and 36 Stain gel and visualize as described see Basic Protocol 1 step 37 The amplified ditags should be 102 bp in size A background band of equal or lower intensity due to linker linker dimers occurs at 80 bp All other background bands should be of substantially lower intensity The ligase samples should not contain any amplified product of the size of the ditags even at 35 cycles REVERSE CLONING UNKNOWN SAGE TAGS rSAGE SAGE is a technique that allows a generally unbiased evaluation of cellular mRNAs ona genome wide scale thus providing a generally more quantitative analysis than subtrac tive cloning or microarray approaches Furthermore the sequencing of 14 bp SAGE tags has a significantly higher throughput than conventional expressed sequence tag EST approaches however the cDNA that a SAGE tag represents may not be readily identi fiable due to the lack of an appropriate anchored cDNA sequence or multiple potential tag to gene matches This protocol describes an approach reverse SAGE rSAGE by which the native 3 sequence can be cloned from cDNA utilizing a variation of the original SAGE protocol and PCR primers based upon sequences in the SAGE tag The advantage of this protocol is
163. but less abundantly expressed gene is recommended The negative control must be negative for all gene specific PCRs Gene ex pression analysis on nylon arrays should result in films with low background and 20 to 40 positive hybridization signals for gt 10 to 20 cells Positive signals from single cells should range from 5 to 25 of spotted cDNAs depending on activation stage The housekeep Current Protocols in Molecular Biology ing genes spotted on each filter should yield strong positive signals The negative control spots show no signal unless sample and array are contaminated with bacterial plasmid de rived DNA Time Considerations Global amplification of cellular cDNA The time needed depends on the incuba tion reaction times and the number of samples washing gt 7 samples using the magnet is time consuming It takes 45 to 60 min for cell lysis mRNA capture to the beads and washing steps At this point the mRNA on the beads can be frozen and stored at 80 C The subsequent cDNA synthesis tailing reaction and PCR am plification must be performed without interrup tion cDNA synthesis including the wash steps will take 1 5 hr and the tailing reaction will take an additional 1 5 hr The PCR will take 3 to 4 hr and can be run overnight Non radioactive gene expression analysis on nylon arrays It takes 30 min to set up the labeling PCR and the PCR itself will take 1 5 hr Pre hy bridization of samples requi
164. can be used to purify the synthesized cDNA which must be cuttable and clean enough for adapter ligation Between 10 and 100 ng cDNA is a suitable quantity for this digestion 2 Heat inactivate restriction endonucleases by incubating the reactions 210 min at 65 C Some restriction endonucleases are not susceptible to heat inactivation phenol chloroform extraction UNIT 2 1A is required to remove them Prepare adapters The adapters are made by annealing kinased oligonucleotide primers al or b1 to unphos phorylated primers a2 or b2 respectively 3 Kinase oligonucleotides al and b1 using the following reaction 25 ul per reaction 18 0 ul H O 2 5 ul 10 mM ATP 2 5 ul 10x T4 polynucleotide kinase buffer 1 5 ul 3 ug ul oligonucleotide al or oligonucleotide b1 0 5 ul 10 U ul T4 polynucleotide kinase Incubate 60 min at 37 C It is important that the ligated adapters do not contain or regenerate the restriction endonuclease recognition site in case the enzymes are not totally inactivated see Critical Parameters 4 Heat inactivate the kinase by incubating 20 min at 65 C 5 Add 1 5 ul of 2 5 ug ul oligonucleotide a2 or 2 5 ug ul oligonucleotide b2 to form al a2 or b1 b2 adapters Mix and microcentrifuge briefly at maximum speed Incu bate 10 min at 45 C The adapters can be stored at 20 C at this stage PCR B a Ligate adapters to cDNA cDNA Cloning Adapters are ligated onto the cDNAs and excess adapters are removed
165. cation of RNA by CsCl density gradient centrifugation UNIT 4 2 might be considered Incomplete PEG precipitation Be sure to exactly balance the amounts of DNA solution and of PEG solution Inefficient ligation Check activity of ligase or use a fresh batch Make sure linkers fit to the fragment ends generated by the employed restriction enzyme Agarose gel appearance of Very low amounts of template See low amount of PCR product first round PCR products DNA lead to stochastical effects obtained with identical primer in early PCR cycles Monte combinations between samples Carlo effect Karrer et al 1995 Fuzzy bands on DBE membrane Glass plates accumulated too Immerse glass plates for 1 hr in 0 5 M NaOH much silane Edges of glass plates not exactly Make sure plates are carefully aligned parallel immediately after pouring gel Low signal intensity after color Biotin label of blotted DNA not Use biotinylated PCR primers distinguished development sufficiently accessible by a TEG spacer Insufficient amounts of Check primer concentration second round PCR primers Since primers are used at limiting concentration inaccuracies upon determination of concentration may hamper generation of sufficient PCR product White vertical stripes interrupt Air bubbles accumulated at the Degas running buffer for lower chamber by band pattern on membrane lower edge of the gel stirring 20 min under vacuum Insert glass plates slightly incline
166. ch degenerate anchored oligo dT primer set e g T 2MA will in theory reverse transcribe one fourth of the total mRNA population In com bination with a decamer oligonucleotide of arbitrary sequence which in theory can hybrid ize to any MRNA cDNA fragments repre senting the 3 termini of mRNAs defined by both primers are amplified Thus this proce dure allows amplification of an mRNA sub population without knowledge of sequence in formation If any given arbitrary decamer does not actually sample all mRNAs different de Current Protocols in Molecular Biology camers can be used to permit sampling of dif ferential mRNA populations Differential display can be used for many purposes One is to provide a picture of mRNA composition of cells by displaying subsets of mRNAs as short DNA bands This mRNA fingerprinting is useful in the same way as are two dimensional protein gels for example for observing alterations in gene expression Sec ondly these DNAs can be quickly reamplified cloned sequenced and compared with se quences in data banks Finally reamplified cDNAs can be used as probes for northern or Southern blot hybridization and to isolate genes from genomic or cDNA libraries for further molecular characterization Investigations of expression genetics Sager 1997 has gained in preeminence The differential display procedure is being success fully employed by many research groups to identify numerous expr
167. ciated Kaposi s sarcoma Science 266 1865 1869 Geng M Wallrapp C Muller Pillasch F Fro hme M Hoheisel J D and Gress T M 1998 Isolation of differentially expressed genes by combining representational difference analysis RDA and cDNA library arrays Biotechniques 25 434 438 Hubank M and Schatz D G 1994 Identifying differences in mRNA expression by repre sentational difference analysis of cDNA Nucleic Acids Res 22 5640 5648 Lisitsyn N and Wigler M 1995 Representational difference analysis in detection of genetic lesions in cancer Methods Enzymol 254 291 304 Lisitsyn N Lisitsyn N and Wigler M 1993 Cloning the differences between two complex genomes Science 259 946 951 Lowrey P L Shimomura K Antoch M P Yamazaki S Zemenides P D Ralph M R Menaker M and Takahashi J S 2000 Posi tional syntenic cloning and functional charac terization of the mammalian circadian mutation tau Science 288 483 492 Nishizawa T Okamoto H Konishi K Yoshi zawa H Miyakawa Y and Mayumi M 1997 A novel DNA virus TTV associated with ele vated transaminase levels in posttransfusion hepatitis of unknown etiology Biochem Bio phys Res Commun 241 92 97 O Neill M J and Sinclair A H 1997 Isolation of rare transcripts by representational difference analysis Nucleic Acids Res 25 2681 2682 Pastorian K Hawel L 3rd and Byus C V 2000 Optimization of c
168. coRI sites present in the cDNA inserts will be cut If this occurs the partial length cDNA clone obtained through this procedure can be used to generate a probe with which to screen the initial library for a full length clone The advent of newer vectors e g AZAP see Fig 1 10 8 with cloning sites for enzymes such as NotI will nearly eliminate this difficulty Current Protocols in Molecular Biology Run the sucrose gradients 4 Mix each digest with an equal volume of 10 sucrose solution and carefully layer the digested library DNA onto the two 10 to 40 sucrose gradients labeled Split the sample between the two tubes evenly Similarly load the DNA onto the two gradients labeled Centrifuge the gradients overnight 18 to 24 hr at 122 000 x g 26 000 rpm in an SW 28 rotor 20 C The insert fragments will remain near the top of the gradient while the phage arms will migrate half the length of the tube 5 Harvest the gradients by gently removing 0 2 ml fractions from the top of the tube with a pipettor Place each fraction into a separate labeled microcentrifuge tube at 4 C Twenty fractions per gradient are sufficient as the insert DNA is small and barely enters the gradient under these conditions Save the remainder of the gradient until the fractions containing the inserts have been identified just in case Recover the DNA 6 Identify the tubes containing the insert DNA by analyzing 20 ul of every other
169. concentrations RNA amplification is dependent on reverse transcription Because total RNA isolated with various methods is generally found to be contaminated with DNA itis recommended that as a good practice RNA samples be treated with DNase I before being used for differential display Design of arbitrary decamers Generally any arbitrary decamer can be used as long it does not contain palindromic se quences and has a G C content of 50 to 70 The original decamer chosen for this applica tion was from the mouse thymidine kinase gene Liang and Pardee 1993 but it has been used successfully to detect multiple mRNAs in cells of various species Because the arbitrary de camers have been shown to contain up to 4 bp mismatches with the original cDNA templates and these mismatches are often clustered at the 5 end of the primers Liang et al 1993 the arbitrary decamers can be designed in such a way that the 3 sequences are maximally ran domized while the 5 bases up to four bases are fixed The G C content of the arbitrary decamers can be increased or decreased to re flect the G C content of the genome of the organism from which the mRNA is isolated False positive difference The intrinsic problem encountered with dif ferential display as with any method based on PCR is that it is highly sensitive to minor variations True differences in expression must be differentiated from the noise that is the major sourc
170. creen shot of the main page of the online version of the SAGE Data Analysis Application Current Protocols in Molecular Biology Mozilla Firefox File Edit View History Bookmarks Tools Help gt G O http genome dfci harvard edu sager step2 php id 605 gt G Rs mozilla org mozillaZine K mozdey org Genome Biology Ky BioMed Central My You have selected data file sample txt which contains 20 rows of results To select a different data fle Click Here To Go Back Step 3a Significance Analysis Select SAGE libraries columns for Significance Analysis comparison Check 2 3 or 4 boxes to compare between or among selected samples IM20U3M405M To compare more than 4 samples will take quite a long time Please be patient to wait for result Step 3b Clustering Analysis select Clustering Algonthm Poisson based Chi square distance iy specify Number of Clusters K e g 4 F Back to Man Page Figure 25B 6 5 Screen shot for SAGE data significance analysis 3 Click the numbered boxes to select SAGE libraries under Step 3a As shown in Figure 25B 6 5 boxes 1 3 and 5 are selected for significance analysis 4 Click Submit A new screen appears Fig 25B 6 6 5 Click the link to the result file sample txt 1370 txt
171. crylamide gel electrophoresis for separation of amplified cDNA products The basic principle is to reverse transcribe and systematically amplify the 3 termini of mRNAs with a set of anchored oligo dT primers and an arbitrary decamer Figure 25B 3 1 illustrates the general strategy of differential display Specifi cally an RNA sample is reverse transcribed with each of the four sets of degenerate anchored oligo dT primers T MN where M can be G A or C and N is G A T and C Each primer set is dictated by the 3 base N with degeneracy in the penultimate M position For example the primer set where N G consists of 5 TTTTTTTTTTTTGG 3 5 TTTTTTTTTTTTAG 3 5 TTTTTTTTTTTTCG 3 The resulting cDNA population is PCR amplified using the degenerate primer set an arbitrary decamer and radioactive nucleotide The radioactively labeled PCR products that represent a subpopulation of mRNAs defined by the given primer set are separated on a denaturing polyacrylamide gel By changing primer combinations most of the RNA species in a cell may be represented Side by side comparison of RNA samples from different cells allows the identification and cloning of differentially expressed genes Materials Total cellular human RNA unr 4 2 or poly A RNA UNIT 4 5 1 U ul human placental RNase inhibitor 10 U ul DNase I RNase free 0 1 M Tris Cl pH 8 3 APPENDIX 2 0 5 M KCl 15 mM MgCl 3 1 v v phenol chloroform 3 M
172. ct in histologic sections that is undesirable to diagnostic pathologists as it results in tissue that is difficult to section and at low dilutions is inadequate for long term storage of tissues Vardaxis et al 1997 On the other hand Bostwick et al 1994 successfully utilized an alcohol based fixative in their pathology laboratory for one year without reporting these difficulties Fixed tissue is typically embedded in paraffin to stiffen it so that thin histologic sections can be cut Most paraffin used in pathology laboratories melts at 60 C which may accelerate formaldehyde reactions and damage RNA DNA and proteins therefore waxes or paraffins that have a lower melting point can be used but they make softer tissue blocks that are more difficult to cut and may Current Protocols in Molecular Biology SUPPORT PROTOCOL Discovery of Differentially Expressed Genes 25A 1 15 Supplement 55 Laser Capture Microdissection 25A 1 16 Supplement 55 require refrigerated storage Tissue processing embedding and sectioning are generally performed in a histology laboratory by histotechnologists and generally require some degree of training and skill The processing steps provided are suggested for utilization by histology laboratories processing tissue for LCM http www arctur com however other processing sequences may also provide good LCM results Materials Fresh tissue Fixative of choice e g 70 ethanol Neu
173. ctional in serts Nucl Acids Res 18 4833 4842 Sive H L and St John T 1988 A simple subtrac tive hybridization technique employing photoac tivatable biotin and phenol extraction Nucl Ac ids Res 16 10937 Sive H L Hattori K and Weintraub H 1989 Progressive determination during formation of anteroposterior axis in Xenopus laevis Cell 58 171 180 Soares M B Bonaldo M F Jelene P Su L Lawton L and Efstratiadis A 1994 Construc tion and characterization of a normalized cDNA library Proc Natl Acad Sci U S A 91 9228 9232 Straus D and Ausubel F M 1990 Genome sub traction for cloning DNA corresponding to dele tion mutants Proc Natl Acad Sci U S A 87 1889 1893 Uhlen M 1989 Magnetic separation of DNA Na ture 340 733 734 Wang Z and Brown D D 1991 A gene expression screen Proc Natl Acad Sci U S A 88 11505 11509 Contributed by Mukesh Patel and Hazel Sive Whitehead Institute for Biomedical Research Cambridge Massachusetts Current Protocols in Molecular Biology Differential Display of mRNA by PCR This unit describes differential display to identify mRNA species for differentially expressed genes DNA sequences corresponding to these mRNAs can be recovered cloned sequenced and used for hybridization or library screening probes This approach combines both the power of polymerase chain reaction PCR amplification and the high resolution of denaturing polya
174. ctive AFLP amplifi cation The most useful expression profiles consist of the 256 fingerprints obtained with all combinations of the TagI 2 and Msel 2 primers This implicates a series of 3 consecutive PCRs the first with no selective nucleotides nonselective preamplification 0 0 the second with one selective nucleotide at both the Taql and Msel primer selective pream plification 1 1 and the third with two selective nucleotides at each primer final selective amplification 2 2 Similar to the nonselective preamplification it is advisable to check 10 ul of the reaction mixtures on an agarose gel Label selective TagI 2 primers 23 Prepare the following phosphorylation reaction mixture 2 0 ul 10 uCi ul 2000 Ci mmol P y ATP 1 0 ul 10x T4 polynucleotide kinase buffer 4 U T4 polynucleotide kinase Adjust volume to 8 ul with water 24 To phosphorylate 16 pmol selective JagI 2 primer the amount required for 20 AFLP reactions 1 e the amount required to perform all 16 2 2 reactions for a given Taql 2 primer in the complete set of 256 primer combinations combine 2 0 ul of 8 pmol ul selective primer 2 and 8 0 ul phosphorylation reaction mix step 23 yielding labeled primer at a concentration of 12 6 pmol ul and a final volume of 10 0 ul Incubate 60 min at 37 C followed by 10 min at 70 C to inactivate the kinase 33 P labeled primers are preferred because they give a better resolution of the PCR products on p
175. ctosidase on Xgal The presence of this blue reaction product indicates that these neurons contain virus actively transcribing the B galactosidase gene The ganglia were then dissociated into single cell suspensions E 2 and the blue neurons enriched by density gradient centrifugation E 3 These neurons can be analyzed individually or in groups using PCR strategies 11 Harvest desired cell populations by Percoll gradient centrifugation steps 12 to 16 or by another suitable method The end application will strongly influence the procedure selected The following steps enrich for neurons but the protocol can also be used to enrich for other cell types Enrich for neurons by Percoll gradient 12 Prepare a discontinuous Percoll gradient as follows a Mix Percoll and 3xF H O to make 40 50 and 60 v v Percoll solutions Keep on ice b Place the dissociated cell mixture on the bottom of a 15 ml polystyrene for greater visibility conical tube c Using a baked 9 in Pasteur pipette layer 2 5 ml of 40 solution beneath the cell suspension then carefully dispense the 50 solution under the 40 layer Finally carefully dispense the 60 solution beneath the 50 layer Be sure to dispense all solutions from the tip of the pipette in a slow continuous stream Current Protocols in Molecular Biology Discovery of Differentially Expressed Genes 25A 2 5 Supplement 58 SUPPORT PROTOCOL Preparation of Single Cells from Solid
176. d Band reamplification fails UV fixation too strong Apply 110 the UV dose usually chosen for fixing DNA blots recommended dose is 10 000 uJ cm Membrane has become dry before Keep wet membrane between two sheets of reamplification thick polyethylene wrap until bands are cut out After cutting out bands immediately submerge in buffer False positive clones no Reamplification product Sequence more than one clone per band regulation detectable contained more than one DNA If several inserts are identified choose the species most frequently occurring one 25B 4 15 Current Protocols in Molecular Biology Supplement 56 Restriction Mediated Differential Display RMDD 25B 4 16 Supplement 56 than man or mouse Attempts to use such an approach for analysis of rat RNA resulted in an unacceptably low hit rate 1 e lt 10 of cor rectly identified fragments A Fischer unpub observ Thus although the RMDD technique could be very well performed using P or 3P as a label the authors developed a protocol using nonradioactive detection of biotinylated amplification products These are transferred to a membrane by use of direct blotting electro phoresis DBE Beck and Pohl 1984 visible bands are rendered directly accessible by sim ply cutting them out of the stained membrane eliminating one of the most common sources of false positives Besides providing conven ient access to differential bands DBE proved
177. d by the manufacturer that resulted in 1 5 x 10 cfulug pUC19 77 Spread 100 ul of a 1 100 dilution of control cells pUC19 in SOC or LB medium on LB plates containing 100 ug ml ampicillin Current Protocols in Molecular Biology Discovery of Differentially Expressed Genes 25B 6 13 Supplement 80 78 Plate 1 10 transfected bacteria onto each of ten 10 cm zeocin containing low salt LB plates Incubate and analyze 12 to 16 hr later Insert containing clones should have hundreds to thousands of colonies while no insert control plates should have zero to tens of colonies Save all ten plates for each concatemer ligation reaction since if insert size appears appropriate these may be used for sequencing described below Check insert size by PCR 79 Prepare a reaction master mix using the following recipe for one reaction as a guide 2 5 ul 10x SAGE PCR amplification buffer 1 25 ul DMSO 1 25 ul 10 mM dNTP 0 5 ul 350 ng ul M13 forward PCR primer 0 5 ul 350 ng ul M13 reverse PCR primer 18 5 ul ddH O 0 5 ul 10 1 U ul Tag Pfu DNA polymerase Pipet 25 ul master mix to wells of 96 well PCR plates Any thermostable polymerase can be used with the appropriate buffer but the Taq Pfu mixture works well 80 For each reaction use a sterile toothpick or pipet tip to gently touch colony and then dip tip with a twirl into PCR mix 81 Carry out the amplifications in a thermal cycler with the following parameters 1 cycle
178. d driver synthesis Purify amplified cDNAs away from unincorporated nucleotides primer and salts using a commercial anion exchange PCR spin column Qiagen as directed by the manufacturer UNIT 2 1B An alternate way to purify the PCR products is by agarose gel purification UNIT 2 5A but care must be taken to avoid contamination with other DNAs Current Protocols in Molecular Biology 19 Determine the yields by spectrophotometric quantitation of nucleic acids APPEN DIX 3D Typical amplifications yield 12 to 16 ug P labeled cDNA per 100 ul tracer reaction and 7 to 10 ug biotinylated cDNA per 100 l driver reaction The quality and size range of the purified cDNA should be checked using agarose gel electrophoresis UNIT 2 5A after every third PCR amplification before proceeding to the next subtraction step The size range should not change significantly Anneal tracer and driver This is a hybridization between P labeled tracer and biotinylated driver cDNAs 20 21 Bape Set up two hybridization reactions P A Bio B and P B Bio A Ethanol precipitate 1 ug radiolabeled tracer and 20 ug biotinylated driver DNAs in a 1 5 ml silanized microcentrifuge tube without freezing Air dry the pellet and when just dry resuspend in 5 ul HEPES buffer by gentle pipetting Monitor resuspension of the pellet with a hand held Geiger counter A small radioactive pellet should be clearly visible By not fre
179. de primers will interfere with cloning 18 Check products by agarose gel electrophoresis UNIT 2 54 Clone products 19 Clone reamplification products as described in UNIT 15 7 or by using one of the commercially available T A cloning systems In the authors laboratory 4 to 5 clones per band are usually sequenced Depending on band intensity all clones may be identical or there may be more than one sort of insert In the latter case choose the most frequently occurring insert for further processing Restriction Mediated Differential Display RMDD 25B 4 12 Supplement 56 Current Protocols in Molecular Biology REAGENTS AND SOLUTIONS Use deionized distilled water in all recipes and protocol steps For common stock solutions see APPENDIX 2 for suppliers see APPENDIX 4 Blocking reagent 1 5 Prepare stock solution by suspending blocking reagent Roche Molecular Bio chemicals to 10 w v in maleic buffer pH 7 5 see recipe and autoclaving Store frozen up to year at 20 C Immediately before use dilute 1 5 parts v v of the 10 stock with 8 5 parts v v of maleic buffer Maleic buffer pH 7 5 100 mM maleic acid 150 mM NaCl 200 mM NaOH Store indefinitely at room temperature Mbol linker ML2025 Combine 150 ul 100 pmol ul ML20 5 TCA CAT GCT AAG TCT CGC GA 3 see UNIT 2 11 150 ul 100 pmol ul LM25 5 GAT CTC GCG AGA CTT AGC ATG TGA C 3 see UNIT 2 11 55 ul 10x ligation buffer 195
180. depend on the type and size of array It is estimated that a typical mammalian cell contains 20 pg total RNA cell therefore to achieve 5 ug RNA the lower limit for some expression arrays will require the microdissection of 2 5 x 10 cells a daunting task Thus some authors have ad vocated amplification of RNA or resultant cDNA prior to hybridization with these larger arrays even though this may introduce some degree of amplification bias Luo et al 1999 Ohyama et al 2000 For protein analysis using 50 000 cells for two dimensional PAGE analysis has been a successful starting point For western blot analysis the number of cells Discovery of Differentially Expressed Genes 25A 1 21 Supplement 55 Laser Capture Microdissection 25A 1 22 Supplement 55 required is at least 2000 to 3000 http www arctur com Some molecular assays may re quire modification in order to accommodate the relatively small amount of cells obtained by LCM Time Considerations The time required for LCM is highly vari able and depends on the method of tissue pro cessing and staining the number of cells to be microdissected and the location and number of the desired cells in each section H amp E staining see Basic Protocol 5 requires only 10 to 15 min Microdissecting 5000 cells roughly equal to 1000 shots using a 30 Um spot size will require 15 to 30 min provided all the cells required are present within a single tis
181. des will cause the sections to be more adherent than air drying Relevant variables that affect LCM include the type of slide whether the sample is air dried or baked the duration of baking and the type of tissue being microdissected Remove paraffin 5 Allow the slide containing the tissue section to remain in the following solutions in Coplin jars or other solvent containers for the specified times in the specified order Xylene 5 min Xylene 5 min 100 ethanol 30sec 95 ethanol 30sec 70 ethanol 30sec In order to proceed with histologic staining and LCM following sectioning paraffin must be removed from the tissue sections If RNA is to be analyzed consideration should be given to preparing the 95 and 70 ethanol solutions with RNase free water The authors routinely utilize sterile or distilled water and typically achieve good RNA recovery 6 Proceed with hematoxylin and eosin staining see Basic Protocol 5 PREPARATION OF CYTOLOGIC SPECIMENS FOR LCM DIRECT SMEARS Cellular elements in body fluids or fine needle aspirates and cultured cells do not readily lend themselves to sectioning but can easily be prepared for LCM by making direct smears or cytospin preparations The choice as to which to use will depend upon the anticipated cellularity of the sample Highly cellular samples can be easily and rapidly prepared as direct smears and effectively utilized for LCM whereas less cellular samples are better concentrated and pre
182. detect differentially expressed tags in SAGE data The input to the SA algorithm is a tab delimited file containing multiple sage libraries The SA algorithm can simultaneously compare two or more SAGE libraries The output of SA algorithm is a set of P values of tests for the significance of the difference in gene expression Genes with significantly small P values are identified as differentially expressed across different libraries The P values are calculated in the following way Letting X be the number of copies of tag i in library j three sums are defined M gt X The sum of counts of tag i over all libraries M 2 X The sum of tag counts over all tags in library j M gt X The sum of tag counts over all tags and libraries ij Under the null hypothesis that there is no expression difference across libraries M M M copies are then expected to be observed for tag i in library j Further considering that the tags are extracted from a random sample of transcripts in cell it is reasonable to assume X is Poisson distributed with means 4 M M M The x statistic is used to test the deviation of observed counts from expected counts rey s Xi i y where k is the number of libraries compared Current Protocols in Molecular Biology When kis large or Aj is not small lt 5 TS is approximately x distributed with degree of freedom of k 1 y7 _1 the SA algorithm calculates the P values using t
183. e amplification of subsets of genomic restriction fragments or cDNAs which can subsequently be displayed on DNA sequencing gels One of the characteristics of the AFLP technique is that the reaction proceeds until the primer is de pleted from the reaction mixture Vos et al 1995 This is different from a standard PCR where the amplification process is inhibited in the final stage of the reaction due to competition between fragment to fragment reannealing and primer to template annealing This differ ence is probably caused by the fact that the concentration of individual AFLP fragments is much lower compared to standard PCR due to many fragments competing for the same primer set This characteristic of the AFLP technique is of great importance for the quantitative am plification and display of transcript fragments Another important characteristic of the AFLP technique is the preferential amplifica tion of Taql Msel fragments compared to the Taq TaqI fragments and Msel Msel fragments that will also result from template preparation It is the authors belief that the TagI TagI frag ments and Msel Msel fragments amplify less efficiently because they contain inverted re peats at the fragment ends after adapter ligation As aresult intramolecular self ligation of TagI Taql fragments and Msel Msel fragments will Current Protocols in Molecular Biology Adapter top strand and primer sequences for Msel Adapter End After adap
184. e anchoring enzyme NlallI using the following mixture 20 ul cDNA step 9 148 ul H2O 2 ul 100x BSA 20 ul 10x NEBuffer 4 10 ul 10 U ul Nal II Current Protocols in Molecular Biology Discovery of Differentially Expressed Genes 25B 6 19 Supplement 80 Serial Analysis of Gene Expression SAGE 25B 6 20 Supplement 80 11 12 13 14 15 16 Mix and incubate 1 hr at 37 C It is best to proceed with prewashing the streptavidin Dynabeads step 11 during this incubation such that the beads will be ready for use in the subsequent steps Thoroughly resuspend Streptavidin Dynabeads exercising care to avoid excessive vortexing as streptavidin may be sheared off the magnetic beads Transfer 200 ul beads to a No stick siliconized 1 5 ml microcentrifuge tube and place in a magnetic rack After 1 min remove supernatant Wash beads twice in 200 ul of 1x BW then let stand in 200 ul of 1x BW until ready for use up to several hours All manipulations with Dynabeads are done using siliconized microcentrifuge tubes to avoid loss of yield due to products sticking to tube walls All other manipulations espe cially ethanol precipitations should be done in standard microcentrifuge tubes Dynabead washes are executed in the same fashion as done in the primary method see Basic Protocol 1 step 2 Briefly the beads are placed in the magnet I to 2 min While the siliconized tube is still in the magnet the buffe
185. e bottom of the cryomold in the medium before it hardens this may take lt 1 min depending on the amount of OCT used To facilitate cutting the tissue should be relatively small i e 1 cm in maximum dimension and the desired cutting surface should be flush against the bottom Fill the cryomold containing the base of embedding medium and frozen tissue with more embedding medium Cover the dry ice container and allow the embedding medium to harden several minutes The medium will turn from translucent to white when frozen Wrap the resulting tissue block still in the cryomold in aluminum foil and keep in a 80 C freezer or in liquid nitrogen until cutting Tissue for RNA extraction should be frozen as quickly as possible after resection The method described here is preferred for LCM because tissue processed in this manner is more amenable to cryostat sectioning and offers acceptable histomorphology More rapid methods of freezing tissue such as direct immersion into liquid nitrogen isopentane chilled to 160 C Sheehan and Hrapchak 1987a or the vapor phase of liquid nitrogen can also be utilized however these methods are more technically difficult when incorporating cryostat embedding media and are more likely to result in cracking of the tissue block Tissues that were rapidly frozen without embedding medium can be postembedded in cryostat embedding medium but will thaw somewhat in the process This can compromise
186. e dissection which prevents the possibility of any carryover however it should be adequate to clean instruments in detergent e g liquinox rinse and soak in 3 hydrogen peroxide for 2 hr then rinse in 3XF H O and bake overnight 3 hr minimum at 250 C Any procedure for cleaning potentially contaminated instruments should be confirmed to be effective Visualization of the mincing procedure under a dissecting microscope is helpful Separate instruments must be used for each tissue unit if cross contamination will present a problem in the interpretation of downstream analyses 7 Place minced tissue into 0 25 w v collagenase CLS I in HBSS and incubate in a 1 5 or 2 ml microcentrifuge tube 5 to 10 min at 37 C The volume of collagenase used will depend upon the amount of tissue Six fixed mouse trigeminal ganglia TG are routinely digested in 1 5 ml collagenase The investigator must screen batches of collagenase and select a batch that is free of DNase activity If RNA will be analyzed a batch free of RNase must be selected see Critical Parameters and Troubleshooting Collagenase 8 After collagenase treatment facilitate dissociation by gentle trituration first using 1000 ul then 200 ul as the tissue dissociates into smaller pieces aerosol resistant pipet tips In the author s studies dissociation of TG is generally complete within 30 min Depending on the application the requirement for complete dissociation may b
187. e fixative STF Streck Laboratories Animal e g mouse Sodium pentobarbital 95 ethanol 0 25 w v collagenase CLS I Worthington in Hank s balanced salt solution HBSS see recipe Triple 0 2 um filtered nanopure 3xF H O Percoll Pharmacia adjust to pH 6 0 with HCl Peristaltic pump BRL CP 600 or equivalent and appropriate tubing 15 and 50 ml conical tubes 27 G needle 80 C water bath Current Protocols in Molecular Biology Dissecting microscope optional Clean dissection tools e g forceps scalpel blades hemostat 25 G needles Glass slides bake overnight 3 hr minimum at 250 C 200 and 1000 1 aerosol resistant pipette tips 15 ml polystyrene conical tubes 9 in Pasteur pipettes bake overnight 3 hr minimum at 250 C Additional reagents and equipment for determining number of neurons recovered see Support Protocol and analyzing DNA or RNA from single cell populations see Basic Protocols 2 and 3 NOTE All protocols using live animals must first be reviewed and approved by an Institutional Animal Care and Use Committee ACUC or must conform to governmental regulations regarding the care and use of laboratory animals NOTE Depending upon the final application of the cells all materials must be DNase and RNase free and free of contaminating nucleic acids which could interfere with the interpretation of downstream PCR Perform perfusion fixation as performed in mice 1 Set up perfusion
188. e g BioRad 38 x 50 x 0 04 cm SequiGen sequencing gel system PhosphorImager Fujix BAS 2000 Molecular Dynamics STORM 824 Additional reagents and equipment for agarose gel electrophoresis UNIT 2 5A analysis by denaturing polyacrylamide gel electrophoresis UNIT 2 12 and detection of DNA by autoradiography or phosphor imaging APPENDIX 3A NOTE Suppliers and brands are generally not very critical however in case of problems it is advised to use the suggested suppliers for at least the reverse transcriptase Super Script II and Taq polymerases AmpliTag and AmpliTaq Gold NOTE When preparing AFLP amplifications it is advisable to work with mixes of reagents as much as possible Working with mixes facilitates assembly and is also important for the reliability and reproducibility of the reactions In practice the assembly of the mixes depends on the experiment 1 e which components remain constant in a series of reactions the template DNA or the primer combinations e g one sample with many primer combinations many samples with one primer combination Isolate poly A RNA l Combine 200 ug total RNA 600 ng 5 biotinylated oligo dT 5 biotin dT and 300 ul 2x binding buffer in an RNase free microcentrifuge tube Adjust the volume to 600 ul with water Incubate 5 min at 70 C followed by 15 to 20 min at room temperature Sufficient poly A RNA to perform the subsequent steps i e cDNA synthesis and template pr
189. e less critical It is helpful to monitor progress of dissociation by viewing a drop of the suspension under the microscope 9 Pellet dissociated tissue by microcentrifuging 5 min at 5000 rpm room temperature Resuspend gently in STF at room temperature Heat resuspended cell suspension to 70 C for 10 min Place on ice briefly repellet and resuspend in triple 0 2 um filtered nanopure 3xF water At this point the integrity of the DNA RNA and or protein depending upon what will be analyzed should be tested DNA can be isolated using standard proteinase K SDS digestion followed by phenol chloroform extractions and ethanol precipitation UNIT 2 1A RNA can be isolated from the cells using commercially available reagents such as Ultraspec Biotecx When isolating RNA cells should be homogenized using a tissue grinder to ensure complete disruption of the cell membrane Protein should be prepared from cells by boiling in standard Laemmli cocktail e g 0 125 M Tris Cl 4 SDS 20 glycerol 10 2 mercaptoethanol Integrity of nucleic acid or protein is then determined by appropriate gel electrophoresis Chapter 10 If information about the integrity of a specific nucleic acid or protein is desired Southern UNIT 2 94 northern UNIT 4 9 and or immunoblotting UNIT 10 8 can then be performed probing the membrane with the relevant labeled nucleic acid probe or antibody One should not necessarily expect that the integrity of these cells will
190. e of false positive differences If a pair of RNA samples is to be compared the displayed DNA pattern differences must be reproducible An advantage of differential dis Current Protocols in Molecular Biology play is the ability to simultaneously compare more than two relevant RNA samples e g from different cell types or stages of develop ment multiple display thus has a built in in ternal control for distinguishing noise from true differences This also facilitates isolation of genes that really give useful results for the system under study Size of DNA probe Short DNA probes lt 150 bp have been found to be hard to label and often fail to produce any signals in northern blot hybridiza tions Therefore it 1s advised that only DNA bands gt 150 bp be further characterized by northern blot analysis and that smaller bands be ignored Anticipated Results This method should produce reproducible amplified DNA patterns The reproducible DNA bands representing differentially ex pressed genes should be readily reamplifiable and usable as probes for northern blot analysis or cDNA library screening Time Considerations The whole procedure from RNA to DNA samples ready to use as probes can be per formed within three days Treating RNA with DNase I and checking its integrity by gel elec trophoresis takes 2 hr Reverse transcription takes lt 2 hr Setting up 40 PCR samples requires 1 to 2 hr PCR amplification requi
191. e originally used because they reduced the length of an amplicon and allowed amplification of 5 sequences These random primers combined with oligo dT primers slightly improve the results when single cells are used CFLS primer mix However when higher cell numbers gt 100 are used it appears that random primers alone work at least as well as the combination For single cells a random octamer increases the average fragment length compared to a random hexamer by 100 to 200 bp Due to the increasing number of commercially available oligo arrays that are restricted to the 3 end it might be advantageous to use oligo dT primers alone The authors first experiments indicate that the CFISCT o4 primer should be used in this instance Materials Oligo dT kit Dynal including Dynabeads Oligo dT Washing buffer containing LiDS Lysis buffer Phosphate buffered saline PBS APPENDIX 2 5x RT buffer Life Technologies 0 1 M DTT Life Technologies 10 v v Igepal cDNA synthesis primers For mRNA amplification for 2100 cells CFLSC6 5 CCC GTC TAG ANN NNN N 3 200 uM For single cells and 5 and 3 coverage CFI5C8 5 CCC GTC TAG ANN NNN NNN 3 200 uM CFISCT 5 CCC GTC TAG ATT TTT TTT TTT TTT TVN 3 100 uM CFLS primer mix 1 vol CFI5c8 200 UM 1 vol CFI5ScT 100 uM For the use of 3 restricted oligo arrays CFISCT 4 5 CCC GTC TAG ATT T VN 3 10 mM and 200 UM dNTPs Reverse tran
192. e reactions 1 100 with 0 25x TE buffer pH 8 0 Diluted reactions can be indefinitely stored at 20 C Perform second round amplification of 3 cDNA fragments 16 Set up second round amplification mix by combining in 96 well plates each of the 12 CP28X X primers with each of the 16 ML18Y Y primers 192 different reac tions per sample 20 ul each 2 0 ul template diluted first round PCR 2 0 ul 10 x PCR buffer 1 5 ul 20 mM MgCl 0 4 ul 10 mM standard dNTPs 2 0 ul 4 uM primer CP28X X X A C G or T 2 0 ul 4 uM labeled primer ML18Y Y Y A C G or T 2 0 ul RediLoad 7 9 ul H O 0 2 ul 5 U ul Taq DNA polymerase Make sure that for every reaction X and Y of the second round amplification are identical to X and Y of the first round amplification PCR can be conveniently performed in two 96 well plates per RNA sample It is highly preferable to use a thermocycler equipped with a hot top obviating the need to cover reactions with oil Use of labeled primers instead of incorporating labeled nucleotides has the advantage that 1 only one of two complementary strands is visualized thus limiting complexity of band patterns usually two complementary strands of equal length show slightly different mobility in polyacrylamide gels and 2 label intensity does not increase with fragment length In addition if biotin is used as a label incorporation of an undefined number of biotin molecules it is not possible
193. e tissue section as far as possible so that the arm is over the tissue Make sure that the area to be microdissected is still in the microscopic field of view by looking through the microscope eyepieces or at the monitor Gently lower the arm so that the cap contacts the tissue section If there are folds in the tissue the cap may not make direct contact with the entire surface in the area to be microdissected and transfer efficiency will be compromised therefore it is advisable to inspect the tissue before placing down the cap If any tissue is mounded or folded it is best not to place the cap over that area Alternatively the area of the tissue with folds can be scrapped off the slide using a sterile razor blade leaving only flat portions of the tissue section The tissue section must be dry and cannot be coverslipped for LCM transfer Enable the laser by turning the key on the laser electronics box and pushing the laser enable button The laser tracking beam should now be visible on the monitor as well as the area to be microdissected If it is not try lowering the light from the microscope or raising the intensity of the tracking beam If it is still not visible check that the laser is enabled and that the Joystick is perpendicular Avoid passing hands through the path of the laser when it is enabled Using the 20x objective adjust the focus of the tissue by moving the slide via the joystick to an area of the slide witho
194. e tube sizes and volumes given are appropriate for 30 to 40 mg of tissue If larger amounts of tissue are used tube sizes and volumes should be scaled up accordingly 2 Transfer minced tissue to a 1 5 to 2 ml tube containing 1 ml STF and incubate for the desired time at room temperature The optimum fixation time must be determined empirically In a preliminary experiment divide minced tissue into several tubes and fix 5 to 15 min Fixation is carried out at room temperature so that subsequent dissociation is possible therefore this method is not recommended for separation of cells to be used for downstream analysis of RNA 3 Following fixation rinse minced tissue by microcentrifuging tissue 5 min at 5000 rpm room temperature then drawing off the supernatant and resuspending the pellet in HBSS Repeat this process four times 4 Treat the fixed minced tissue Basic Protocol 1 steps 7 to 9 Examine the dissociation properties of the cells and the integrity of the nucleic acids and proteins Select the fixation time yielding good separation and integrity 5 Proceed as described for perfusion fixation see Basic Protocol 1 steps 10 to 18 PREPARATION OF lacZ EXPRESSING CELLS FROM SOLID TISSUES ALTERNATE In this example a procedure used in the author s laboratory mice expressing an E coli PROTOCOLE B galactosidase expression cassette are perfusion fixed using a modification of the procedure described above see Basic Protoco
195. echnology Bead suspension see Basic Protocol 1 step 13 Additional reagents and equipment for agarose gel electrophoresis UNIT 2 5A 1 Prepare the following PCR mixture 5 ul 10x SAGE PCR buffer 3 ul DMSO 4 ul 10 mM dNTP mix 0 5 ul 350 ng ul 5 primer 0 5 ul 350 ng ul 3 primer 31 3 ul ddH2 O 0 7 ul 5 U ul Tag DNA polymerase 5 ul bead suspension It is possible to test smaller aliquots of bead suspension depending on the abundance of the template 2 Perform PCR using the following program Initial step 2 min 95 C denaturation 30 cycles 30 sec 95 C denaturation 1 min 53 58 C annealing 1 min 72 C extension Final step 5 min 70 C final extension Annealing temperature should be 2 to 3 C lower than the lowest predicted T for the primers 3 Analyze 5 ul of each PCR product on a 1 5 agarose gel in TAE buffer and visualize bands by ethidium bromide staining UNIT 2 54 Current Protocols in Molecular Biology SUPPORT PROTOCOL 1 Discovery of Differentially Expressed Genes 25B 6 15 Supplement 80 SUPPORT PROTOCOL 2 BASIC PROTOCOL 2 Serial Analysis of Gene Expression SAGE 25B 6 16 Supplement 80 OPTIMIZING DITAG PCR AMPLIFICATION The following protocol gives a method for optimizing ditag PCR by varying template concentration nucleotide concentration and number of cycles The optimal template concentration to use is the one which gives a high yield of t
196. ection 25A 1 24 Supplement 55 paraffin embedded tissue specimens Lab In vest 80 199 208 Simone N L Remaley A T Charboneau L Pet ricoin E F HI Glickman J W Emmert Buck M R Fleisher T A and Liotta L A 2000 Sen sitive immunoassay of tissue cell proteins pro cured by laser capture microdissection Am J Pathol 156 445 452 Sirivatanauksorn Y Drury R Crnogorac Jurcevic T Sirivatanauksorn V and Lemoine N R 1999 Laser assisted microdissection Applica tions in molecular pathology Journal of Pathol ogy 189 150 154 Slebos R J C Hoppin J A Tolbert P E Holly E A Brock J W Zhang R H Bracci P M Foley J Stockton P McGregor L M Flake G P and Taylor J A 2000 K ras and p53 in pancreatic cancer Association with medical his tory histopathology and environmental expo sures in a population based study Cancer Epidemiol Biomark Prev 9 1223 1232 Suarez Quian C A Goldstein S R Pohida T Smith P D Peterson J I Wellner E Ghany M and Bonner R F 1999 Laser capture mi crodissection of single cells from complex tis sues Biotechniques 26 328 335 Vardaxis N J Hoogeveen M M Boon M E and Hair C G 1997 Sporicidal activity of chemical and physical tissue fixation methods J Clin Pathol 50 429 433 Wright G L Jr Cazares L H Leung S M Nasim S Adam B L Yip T T Schellham mer P F Gong L and Vlah
197. ecular Biology BASIC PROTOCOL 6 Discovery of Differentially Expressed Genes 25A 1 9 Supplement 55 Laser Capture Microdissection 25A 1 10 Supplement 55 3 Turn on the vacuum slide holder IMPORTANT NOTE The joystick should now be used to move the slide 4 Use the visualizer to more precisely locate the cells to be microdissected The light from the microscope will need to be increased when using the visualizer The area to be microdissected should be in the field of view The sections are not coverslipped therefore the area of interest may be difficult to visualize All models of the PixCell System are equipped with a visualizer which acts to diffuse light and improves resolution however the visualizer is engaged differently on different models see instrument user s guide Microdissect with the laser 5 Pick up a cap from the loaded cassette module on the right side of the microscope stage see instrument users guide for instructions on loading the caps into the cassette module with the placement arm Swing the placement arm toward the caps until the arm overrides the first cap in the cassette module Ensure that the cassette module 1s engaged in the proper indent so that the first available cap is aligned with the arrow on the microscope stage Lift the transport arm until the cap detaches from the base slide in the cassette module Without lowering the placement arm swing the arm back toward th
198. egrades unincorporated primers while the alkaline phosphatase de grades unincorporated free nucleotides 25B 6 14 Supplement 80 Current Protocols in Molecular Biology 84 Perform reactions in 96 well plates on a thermal cycler incubating 15 min at 37 C then 15 min at 80 C Add ddH20 to 15 ul Sequence PCR products directly UNIT 15 2 Use as little as 2 ul of diluted product for the sequencing reaction optimize according to protocol The authors run reactions on an ABI 3700 96 capillary machine though any sequencing system may be used 85 Download SAGE analysis software from SAGEnet see Internet Resources and follow easy to use instructions VERIFYING cDNA PRODUCTION BY PCR ANALYSIS The PCR primers used to test efficiency of the reverse transcription will depend on the species and tissue type from which the library is constructed Working in mouse the authors typically test a ubiquitously expressed mRNA RPS17 and a more tissue restricted mRNA Design primers to be 18 to 22 bp in length and have a Tm of 55 to 60 C Tm for the two primers should not differ by more than 1 to 2 C The PCR product should be 300 to 700 bp in length with a 5 end not more than 1 kb from the 3 end of the mRNA The following describes the authors method however conditions will have to be optimized for each primer set see UNIT 15 1 Materials also see Basic Protocol 1 350 ng ul 5 and 3 primers e g Integrated DNA T
199. en months at SO C may preserve the analyte of interest well if this has not been assessed we recommend limiting storage of frozen sections prior to microdissection to one week 10 Stain slides see Basic Protocol 5 just prior to LCM IMPORTANT NOTE Do not allow the slides to dry or thaw at room temperature prior to staining and dehydration This is critical for successful LCM Drying and thawing causes the tissue to adhere tightly to the slide and will decrease the transfer efficiency of LCM Additionally it may contribute to the degradation of RNA PREPARATION OF FIXED PARAFFIN EMBEDDED SECTIONS Paraffin embedding is a process in which fixed tissue utilizing neutral buffered formalin NBF or another fixative is infiltrated and then placed into liquefied paraffin to stabilize it for long term storage and easy sectioning UNIT 14 1 While fixation is performed to preserve the morphology of the tissue for histologic examination it also effects the DNA RNA and protein content Formalin fixation is the standard for morphologic preservation of tissue and has been used by most pathology laboratories for decades however it creates cross links between nucleic acids and proteins and between different proteins This cross linking interferes with recovery of DNA RNA and proteins from fixed tissue as well as the amplification of DNA and RNA by PCR Arnold et al 1996 Coombs et al 1999 Goldsworthy et al 1999 Masuda et al 1999
200. ence 289 1197 1202 Velculescu V E Zhang L Vogelstein B and Kinzler K W 1995 Serial analysis of gene ex pression Science 270 484 487 Velculescu V E Zhang L Zhou W Vogelstein J Basrai M A Bassett D E Hieter P Vogelstein B and Kinzler K W 1997 Char acterization of the yeast transcriptome Cell 88 243 251 Virlon B Cheval L Buhler J M Billon E Doucet A and Elalouf J M 1999 Serial mi croanalysis of renal transcriptomes Proc Natl Acad Sci U S A 96 15286 15291 Zhang L Zhou W Velculescu V E Kern S E Hruban R H Hamilton S R Vogelstein B and Kinzler K W 1997 Gene expression profiles in normal and cancer cells Science 276 1268 1272 Discovery of Differentially Expressed Genes 25B 6 37 Supplement 80 Serial Analysis of Gene Expression SAGE 25B 6 38 Supplement 80 Internet Resources http www sagenet org SAGEnet Contains instructions for obtaining SAGE analysis software downloadable SAGE li braries from human mouse and yeast and a com prehensive bibliography of SAGE papers http www ncbi nlm nih gov SAGE Serial analysis of gene expression at NCBI http www ncbi nlm nih gov CGAP Cancer Genome Anatomy project Contains full downloadable predicted tag data for human mouse rat zebrafish and cow Also contains a large num for searching tag abundance levels in the publicly available human SAGE data http
201. ends primarily on the complexity of the cDNAs where complexity refers to the total number of different cDNAs or fragments of cDNA from each cell type Davidson 1986 The complexity should not be confused with the number of differen tially expressed cDNAs which is only a subset of the total cDNA populations The greater the complexity of the starting mRNA pool or in general the greater the number of cell types contributing to the starting mRNA the more subtractions will be required Ideally subtraction should be repeated until no more cDNA is removed after hybridization and or until the subtracted cDNAs A and B do not cross hybridize In practice with the scheme described here this is usually between five and twenty subtractions Current Protocols in Molecular Biology Discovery of Differentially Expressed Genes 25B 2 3 Supplement 55 BASIC PROTOCOL PCR Based Subtractive cDNA Cloning 25B 2 4 Supplement 55 Subtraction series A Subtraction series B day 1 Ao Bo Bo Ao short hybridization to remove abundant common sequences day 2 A B B A long hybridization to remove rare and abundant common sequences day 5 A gt Bo Bo Ao short hybridization to remove abundant common sequences day 6 A3 B3 B3 A3 long hybridization to remove rare and abundant common sequences day 9 A4 B4 Bo Ao short hybridization to remove abundant common sequences day 10 As Bs B y An Bh A specific genes B
202. ents should be prepared to compensate for reagent loss during pipetting 26 Mix gently add 1 ul of Superscript II 200 U l and incubate 1 hr at 37 C This step generates first strand cDNA from the aRNA 27 Add 1 ul of RNase H 2 U wl and incubate 30 min at 37 C This step removes the RNA strand from the RNA DNA hybrids generated in the previous step 28 Heat for 2 min at 95 C Cool sample on ice for 5 min 29 Add 1 ul of 0 5 ug ul T7 oligo dT primer and incubate 5 min at 70 C Cool the sample on ice for 5 min Collect the sample by quick spin centrifugation 30 sec at 600 x g This step anneals the primer to the cDNA 30 Incubate 10 min at 42 C and place sample on ice for 5 min Current Protocols in Molecular Biology 31 Add 128 ul of the following mixture to each tube 10x E coli DNA polymerase I buffer 10 mM dNTP mix 260 uM B NAD 10 U ul E coli DNA polymerase I 2 U ul RNase H H20 15 ul 3 ul 15 ul 4 ul 1 ul 90 ul NOTE When preparing a cocktail mixture to accommodate multiple samples excess reagents should be prepared to compensate for reagent loss during pipetting 32 Follow steps 8 to 20h of first round RNA amplification 33 To elute the aRNA transfer the RNeasy column to a new 1 5 ml collection tube pipet 30 ul of H20 onto the RNeasy column and centrifuge 1 min at 8000 x g 34 Pipet another 30 ul of H20 onto the RNeasy column and centrifuge min at 8000 xg 35 Use
203. eparation in duplicate is yielded from 200 ug total RNA Wash 150 ul streptavidin coated magnetic beads with 0 5 ml of 1x binding buffer see step 4 below for technique or use microcentrifuge Resuspend the beads in 50 ul of the same buffer Mix the magnetic beads solution well before use to obtain a homogeneous suspension Do not let the magnetic beads dry for a long period of time as drying may lower their capacity see Dynal 1995 Add these prewashed beads to the RNA containing mixture step 1 and incubate 30 min at room temperature with gentle agitation Place the microcentrifuge tube in the magnetic plate chamber MPC for 30 sec and then remove as much of the supernatant as possible without disturbing the beads Remove the tube from the MPC add 0 5 ml wash buffer and mix thoroughly Repeat two more times removing the supernatant after the final wash Do not allow the beads to dry out Elute poly A RNA by resuspending the beads in 20 ul of 2 mM EDTA and incubating 5 min at 70 C Collect the beads with the MPC as in step 4 and transfer the supernatant to a new RNase free microcentrifuge tube as quickly as possible without transferring any beads Repeat once to obtain 40 ul of poly A RNA solution For long term storage add 0 1 vol 2 M sodium acetate pH 5 5 and mix Add 3 vol 100 ethanol and store indefinitely at 20 C UNIT 2 1A To recover microcentrifuge 5 min at maximum speed remove supernatant dry in a
204. equivalent Microsoft SPSS software or equivalent SPSS Perform intensity calibration of the scanner 1 Define the known density values from the photographic step tablet To analyze the signal intensity on the X ray film it is important to measure its optical density Signal intensity is usually measured in units which do not necessarily represent the same real world values in different images It is important to calibrate a scanner before measuring the optical density of the signals Therefore by indicating raw intensity values in an image and defining their corresponding optical density the system can be provided with the information it needs to convert its measurements to real world quantities Current Protocols in Molecular Biology 2 Scan the photographic step tablet in the grayscale mode values that have been entered The Kodak No 2 Photographic Step Tablet Standard values are provided as optical density values starting at 0 05 and proceeding at 0 15 OD increments to 3 05 OD units At least four calibration points are necessary to compute a calibration curve 3 Compute a calibration curve At least three different curve models are available The linear option calculates the curve with the formula y ax b the quadratic option with the formula y ax b and the log linear option with the formula y a log 255 x 255 b The authors recommend the log linear option Scan the developed films 4 Scan the g
205. er M Walker K and Lindsey K 2005 Laser capture microdissection for the Discovery of Differentially Expressed Genes 25A 3 13 Supplement 87 Laser Microdissection and Amplification of Plant RNA 25A 3 14 Supplement 87 analysis of gene expression during embryogen esis of Arabidopsis Plant J 42 111 123 Day R C Grossniklaus U and Macknight R C 2005 Be more specific Laser assisted mi crodissection of plant cells Trends Plant Sci 10 397 406 Day R C McNoe L and Macknight R C 2007 Evaluation of global RNA amplification and its use for high throughput transcript analysis of laser microdissected endosperm Int J Plant Genomics 61028 Dembinsky D Woll K Saleem M Liu Y Fu Y Borsuk L A Lamkemeyer T Fladerer C Madlung J Barbazuk B Nordheim A Nettleton D Schnable P S and Hochholdinger F 2007 Transcriptomic and proteomic analyses of pericycle cells of the maize primary root Plant Physiol 145 575 588 Dixon A K Richardson P J Pinnock R D and Lee K 2000 Gene expression analysis at the single cell level Trends Pharmacol Sci 21 65 70 Eberwine J Yeh H Miyashiro K Cao Y Nair S Finnell R Zettel M and Coleman P 1992 Analysis of gene expression in single live neu rons Proc Natl Acad Sci U S A 89 3010 3014 Emmert Buck M R Bonner R F Smith P D Chuaqui R F Zhuang Z Goldstein S R Weiss
206. er final resuspension in ligase buffer transfer 100 ul of each sample into two new 1 5 ml siliconized microcentrifuge tubes Remove last wash and resuspend beads with the following 5 ul LoTE buffer both tubes 2 ul 5x T4 DNA ligase buffer both tubes 3 ul 2 ng ul annealed linkers 1A and 1B only in tube 1 3 ul 2 ng ul annealed linkers 2A and 2B only in tube 2 Heat tubes 2 min at 50 C then let sit for 5 to 15 min at room temperature Add 1 ul of 5 U ul high concentration T4 DNA ligase to each tube and incubate 2 hr at 16 C Mix beads intermittently Release cDNA tags using tagging enzyme BsmF I 18 After ligation place on a magnetic rack 30 sec then wash each sample two times with 500 ul of 1x BW 2x BSA 0 1 SDS each pooling tube 1 and tube 2 together after first wash in order to minimize loss in subsequent steps Current Protocols in Molecular Biology 19 20 21 22a Wash four times with 500 ul of 1x BW 2x BSA each and twice with 200 ul of 1x NEBuffer 4 2x BSA transfer to new tubes after first wash in NEBuffer 4 BSA Preheat the following mix 2 min at 65 C 170 ul LoTE buffer 20 ul 10x NEBuffer 4 4 ul 100x BSA 2 ul 2 U ul BsmFI Resuspend beads in the mixture and incubate hr at 65 C mixing intermittently After incubation microcentrifuge 2 min at maximum speed then transfer supernatant to anew 1 5 ml microcentrifuge tube Wash beads once with 40 ul LoTE buffer then resuspend to a final
207. er microdissection of plant tissue What you see is what you get Annu Rev Plant Biol 57 181 201 Ohtsu K Takahashi H Schnable P S and Nakazono M 2007 Cell type specific gene ex pression profiling in plants by using a com bination of laser microdissection and high throughput technologies Plant Cell Physiol 48 3 7 Ruzin S E 1999 Plant Microtechnique and Mi croscopy Oxford University Press New York Schad M Mungur R Fiehn O and Kehr J 2005 Metabolic profiling of laser microdis sected vascular bundles of Arabidopsis thaliana Plant Methods 18 2 Schneider J Buness A Huber W Volz J Kioschis P Hafner M Poustka A and S ltmann H 2004 Systematic analysis of T7 RNA polymerase based in vitro linear RNA am plification for use in microarray experiments BMC Genomics 5 29 Sch tze K and Lahr G 1998 Identification of expressed genes by laser mediated manipulation of single cells Nat Biotechnol 16 737 742 Spencer M W Casson S A and Lindsey K 2007 Transcriptional profiling of the Arabidopsis em bryo Plant Physiol 143 924 940 Van Gelder R N von Zastrow M E Yool A Dement W C Barchas J D and Eberwine Current Protocols in Molecular Biology J H 1990 Amplified RNA synthesized from limited quantities of heterogeneous cDNA Proc Natl Acad Sci U S A 87 1663 1667 Wilhelm J Muyal J P Best J Kwapiszewska G Stein M M Seeger
208. ere made to the protocol by a number of groups Datson et al 1999 Virlon et al 1999 St Croix et al 2000 which col lectively gave rise to a version of the protocol known as microSAGE see Basic Protocol 1 owing to the fact that over 1000 fold less starting material could be readily used for li brary construction The critical modifications Current Protocols in Molecular Biology appear to have been anchoring the mRNA to magnetic beads prior to cDNA synthesis rather than after cDNA sythesis via incor poration of a biotinylated oligo dT primer as in the original protocol and optimization of the quantities of reagents used in particu lar the quantities of linkers Additional im provements such as heating the ditag con catemers prior to gel purification Angelastro et al 1999 have resulted in SAGE libraries with substantially higher insert frequency and larger insert size than in the original proto col These technical improvements coupled with the drop in the cost of DNA sequencing have combined to allow the generation of over 3 5 million human SAGE tags alone many of which are publicly available for analysis http www ncbi nim nih gov SAGE SAGE analysis has a number of unique ad vantages over hybridization based measures of global gene expression such as microar ray analysis Chapter 22 or approaches such as subtractive hybridization UNITS 25B 1 amp 25B 2 and differential display methodologies U
209. ered phenol UNIT 2 1 Chloroform 5 U ul Tag DNA polymerase and 10x Tag DNA polymerase buffer see recipe 25 mM MgCl 10 mM 4dNTP mix UNIT 3 4 Mineral oil PCR grade sterile 800 Ci mmol P dCTP 10 Ci ul Driver dNTP mix see recipe Ethanol 1 and 5 M NaCl HEPES buffer see recipe 2x hybridization buffer for subtractions see recipe Streptavidin solution see recipe EcoRI and 10x EcoRI buffer see recipe or EcoRV and 10x EcoRV buffer see recipe pBluescript vector cut with EcoRI pBluescript vector cut with EcoRV Tranformation competent bacterial strain UNIT 1 8 Radiolabeled subtraction probes see Support Protocol 0 5 ml PCR tubes Sephacryl S 300 spin columns Pharmacia Biotech Beckman Accuspin FR centrifuge with swinging bucket rotor or equivalent Thermal cycler Anion exchange PCR spin columns Qiagen 1 5 ml microcentrifuge tubes silanized APPENDIX 3B Hand held Geiger counter Heating block Additional reagents and equipment for restriction endonuclease digestion UNIT 3 1 agarose gel electrophoresis UNIT 2 54 chromatography to remove oligonucleotide fragments UNIT 2 6 phenol chloroform extraction and ethanol precipitation UNIT 2 14 anion exchange Qiagen column purification of oligonucleotides UNIT 2 1B Spectrophotometric quantitation of nucleic acids APPENDIX 3D hybridization of slot blots UNIT 2 9B amp 2 10 also see Support Protocol bacterial transformation UNIT 1 8 pl
210. erse transcriptase contain traces of bacterial DNA RNA that will be co amplified with the desired single cell mRNA For many assays this bacterial DNA will not interfere but may be a potential source of trouble Degradation of RNA by RNases can be avoided by the use of powder free gloves changing them frequently and being cautious when preparing buffers RNase inhibitors are not added because they are frequently derived from human placenta and might therefore be contaminated with human nucleic acids Working quickly and placing probes on ice is also recommended GLOBAL AMPLIFICATION OF SINGLE CELL cDNA This PCR based protocol has been developed for maximal sensitivity of transcript detection This raises the concern of exponential error transmission which will be discussed in detail along with the means that have been undertaken to reduce this error However one has to be aware that by using this method an exact quantification of the transcripts from a single cell is not possible rather semi quantitative results are obtained Contributed by Christoph A Klein Dietlind ZohInhofer Karina Petat Dutter and Nicole Wendler Current Protocols in Molecular Biology 2003 25B 8 1 25B 8 18 Copyright 2003 by John Wiley amp Sons Inc UNIT 25B 8 BASIC PROTOCOL 1 Discovery of Differentially Expressed Genes 25B 8 1 Supplement 61 To achieve maximal sensitivity conditions were sought to avoid unnecessary loss of mRNA during the
211. es of acetone xylene Perform paraffin infiltration and embedding of samples 7 Add a small amount 1 10 to 1 5 the volume of the vial of Paraplast chips to each vial and incubate overnight at room temperature on a rotator From this point on care should be taken to avoid introduction of RNases during handling of samples 8 The next day incubate a separate container of Paraplast chips at 60 C for several hours or until completely melted At the same time place the vials containing the plant tissue in an oven at 60 C to dissolve any remaining Paraplast chips When chips are dissolved gently invert the vials to mix xylene and Paraplast The temperature of the molten Paraplast 60 C is critical overheating will shrink the paraffin and cause tissue damage Current Protocols in Molecular Biology 10 ine 12 13 14 Incubate the vials containing the plant tissue for an additional 1 5 hr at 60 C add more Paraplast chips up to half the volume of the vial and incubate for an additional 1 5 hr at 60 C Carefully decant half the volume of the xylene Paraplast mixture and discard while ensuring that the tissue samples remain in the vials Replace the decanted solution with 60 C molten 100 Paraplast from step 8 Mix by inversion and incubate overnight at 60 C Be sure to maintain a container of 60 C molten 100 Paraplast for use in steps 11 to 14 The next day decant the contents of the vial into a waste
212. essed genes Related publications have increased exponentially and currently there are 2000 For a cross section of results see Liang et al 1994 Thus differ ential display is a viable method for the identi fication of novel gene targets Critical Parameters and Troubleshooting The most important powerful application of differential display is to identify and clone differentially expressed genes in various bio logical systems Because the method is based on reverse transcription PCR RT PCR unr 15 5 critical parameters relevant to that proce dure generally apply for this protocol Utilization of this technique has encoun tered the problem of isolation of false posi tive transcripts i e PCR products that ap pear to be differentially expressed but which cannot be verified when subsequent northern analysis is performed using the same RNA source PCR is highly sensitive to minor vari ations in experimental procedures and is noto Discovery of Differentially Expressed Genes 25B 3 7 Supplement 56 Differential Display of mRNA by PCR 25B 3 8 Supplement 56 riously difficult to make quantitative In the authors experience success with differential display is dependent to a large degree on ex perimental design great care in achieving con sistency the use of core reagent mixes and duplicate assays among other things Many modifications of the original protocol have been described
213. essive exposure and radioactive contamination of personnel and equipment should be followed at all times NOTE Experiments involving RNA require careful technique to prevent RNA degrada tion UNIT 4 1 Remove chromosomal DNA contamination from RNA 1 Digest DNA from total cellular RNA or poly A RNA by mixing 50 ug RNA 10 ul 1 U ul human placental RNase inhibitor 1 ul 10 U ul RNase free DNase I 5 ul 0 1 M Tris Cl pH 8 3 5 ul 0 5 M KCl 5 ul 15 mM MgCl H 0 to 50 ul Incubate 30 min at 37 C When performing differential display it is essential that the RNA sample be free from any genomic DNA contamination RNA preparations isolated by various methods are often found to be contaminated with trace amounts of chromosomal DNA that results in reverse transcription independent DNA amplification Amounts from 15 to 100 ug of total RNA can be cleaned with this procedure 2 Add 50 ul phenol chloroform 3 1 vortex and microcentrifuge 2 min at maximum speed to separate phases This step serves to inactivate DNase I before cDNA synthesis during reverse transcription so vigorous mixing is important to allow complete extraction of DNase I 3 Transfer upper phase to a clean microcentrifuge tube and add 5 ul of 3 M sodium acetate and 200 ul of 100 ethanol Incubate 30 min at 70 C to precipitate RNA 4 Microcentrifuge 10 min at high speed Remove supernatant and wash pellet precipi tated RNA once with 500 ul of 70 ethan
214. estion of the genome and is accomplished by selective am plification of digested DNA fragments with lengths amenable to PCR followed by physical size selection This simplification is key to successful RDA but its disadvantage is that not all of the potential differences between two genomes will be found Many techniques are available for scanning differential gene expression whether to ascer tain changes that occur in development and differentiation or that are associated with dis ease phenotypes These include differential dis play UNIT 25B 3 CDNA array serial analysis of gene expression SAGE UNIT 258 6 and rapid analysis of gene expression RAGE Ina novel combination of two techniques RDA is per formed first to generate products used as hy bridization probes which are then applied to cDNA microarrays Geng et al 1998 Con sideration must be given to the strengths and weakness of each tool in individual applica tions The main advantages of using RDA are that the analysis is not limited to known se quences it is efficient and it is affordable for even small laboratories Critical Parameters and Troubleshooting General considerations DNA RDA is dependent on the generation of different DNA restriction fragments between driver and tester after restriction endonuclease digestion Furthermore the extra DNA frag ment s must be found in the tester and not the driver and must be within the size range for stand
215. ey components of the system a preparation strip that flattens the tissue section and removes loose debris the high sensitivity transfer cap HS cap that keeps the tissue surface area adjacent to the cells being captured out of contact with the sample and a low volume reaction chamber that fits onto the high sensitivity transfer caps and accepts a low volume of lysis or digestion buffer while sealing out any nonselected material from the captured cells The HS cap has a raised ridge on the contact surface so that only the ridge actually touches the tissue section The surface coated with polymer only contacts the tissue in the area in which the laser is fired thus contamination by unwanted tissue is greatly reduced The basic steps of LCM as described see Basic Protocol 6 are applicable to the use of the high sensitivity consumables with a few modifications The modifications to the standard LCM protocol are described briefly below These products can be purchased as a kit from Arcturus Engineering which includes detailed instructions on their use Additional Materials also see Basic Protocol 6 Preparation strips Prep Strips Arcturus Engineering High sensitivity transfer film HS CapSure Arcturus Engineering Tweezers clean Alignment tray designed for use with the high sensitivity system Low volume reaction chamber ExtracSure Arcturus Engineering NOTE All pipetting steps should be performed using filtered aerosol resistant pipet
216. ezing during ethanol precipitation the possibility of a large salt pellet is avoided Resuspension of the pellet sometimes requires a little patience warming the tube to 60 C usually helps Also check that none of the counts i e cDNA are stuck to the pipet tip as this can greatly reduce the subtraction efficiency The use of silanized pipet tips may help reduce Sticking The pellet should not be resuspended in a larger volume because this will lower the concentration of driver and hence the reannealing rate Transfer resuspended DNA to a 0 5 ml PCR tube Add 5 ul of 68 C 2x hybridization buffer for subtractions Mix by gentle pipetting and add a few drops of sterile PCR grade mineral oil to cover the DNA solution Microcentrifuge briefly at maxi mum speed If a pellet is visible the DNA has come out of solution Incubate the two tubes 10 min at 95 C and cool slowly over 1 hr to 68 C Continue incubation 2 hr at 68 C short hybridization Either a thermal cycler or a heat block may be used for this step Subsequent hybridizations alternate between long 30 to 40 hr hybridizations during which both rare and abundant common sequences form hybrids and short 2 hr hybridi zations during which only abundant common sequences form hybrids Remove biotinylated annealed and single stranded DNA Tracer driver and driver driver hybrids and biotinylated single stranded driver cDNA are removed by addition of streptavidin and extracti
217. f plastic without producing any bubbles 11 Incubate on the bench 5 min at room temperature Remove the membrane from the plastic sheets and place on a sheet of Whatman 3MM paper for a few seconds to remove excessive chemiluminescent substrate then put the membrane back between two clean dry acetate sheets It is important to remove any excess moisture from the membrane This avoids the development of background during film exposures up to 60 min However the membrane should not completely dry out because this would exclude any further use 12 Incubate 15 min at 37 C and place the membrane on film to be exposed The 37 C incubation allows the alkaline phosphatase reaction to reach a steady state quickly The authors recommend 15 min for the first exposure then adjust the time according to the signal strength DATA ANALYSIS OF HYBRIDIZED cDNA ARRAYS There are several ways to analyze and normalize the data obtained by gene expression profiling with cDNA arrays This protocol describes a method to measure differences of signal intensities of differentially expressed genes and to normalize the signal intensities to several housekeeping genes See UNIT 22 3 for other information regarding data analysis Materials Photographic step tablet Kodak Transparency scanner that can be calibrated e g SNAPSCAN Agfa Labscan software or equivalent Scanwise v 1 2 1 Agfa Array Vision software or equivalent Clontech Excel software or
218. f the cap because the cap surface does not contact the tissue except at the area that the laser is fired It is important to stay within the capture ring because areas outside the ring will be excluded from the low volume reaction tube 5 Test the effectiveness as described Basic Protocol 6 step 11 Collect microdissected cells 6 After completing the intended microdissection place the HS cap on the unload platform and pick up the HS cap with the cap insertion tool 7 Remove the HS cap from the insertion tool using clean tweezers and place the HS cap into the alignment tray so that the captured sample is facing up 8 Using clean tweezers position the specialized low volume reaction chamber over the cap The chamber has a port for insertion of the appropriate lysis buffer e g DNA or protein lysis buffer which should be facing up 9 Push the chamber down onto the cap until it snaps into place 10 Pipet 10 ul desired buffer into the fill port Cover the port with a 0 5 ml microcentri fuge tube or thin walled PCR tube and press down to fit securely 11 Proceed to extraction and analysis of the desired analyte TISSUE FIXATION AND PARAFFIN EMBEDDING If the researcher can choose a fixative one which is alcohol based e g 70 ethanol is preferable for nucleic acid and protein recovery and provides adequate morphologic detail for most LCM uses however alcohol based fixatives have been reputed to confer a shrinkage artifa
219. f these assays Specimens can also be stained immunohistochemically or with fluorescent la bels prior to microdissection Fend et al 1999b Murakami et al 2000 There are two alternative methods for speci men staining One is to place the staining solu tions into either Coplin jars or staining dishes and immerse the slides in the appropriate solu tions If this method is used the stains should be changed frequently to prevent contamina tion by tissue fragments from other tissue sam ples or microorganisms found in the environ ment and to avoid excessive dilution of the staining solutions The second alternative and the one that the authors prefer is to keep the solutions in clean plastic squirt bottles and use a Slide staining rack The slide to be stained can then be placed on the staining rack and the solutions can be applied gently to the slide to cover the tissue or cells allowed to remain the appropriate time and then drained from the slide and replaced by the next solution This reduces any possible contamination minimizes dilution of solutions and has the added advan tage of using less reagents For solutions requir ing a duration of contact with the slide that is longer than 1 min 1 e xylene we utilize small Coplin jars Thus the best features of both systems may be used efficiently For a successful LCM transfer the polymer film must be bonded to the targeted tissue so it forms a stronger bond than that bet
220. fic product Zeocin containing low salt LB plates For l liter 10 g tryptone 5 g yeast extract 5 g NaCl Adjust the pH to 7 5 and add 15 g bactoagar Autoclave solution and allow to cool before adding zeocin to 100 mg ml COMMENTARY Background Information Serial analysis of gene expression SAGE was first developed in 1995 Velculescu et al 1995 and has since been used to generate a large variety of data from normal and cancer ous human tissue Zhang et al 1997 Boon et al 2002 yeast Velculescu et al 1997 C elegans Halaschek Wiener et al 2005 D melanogaster Gorski et al 2003 mouse Virlon etal 1999 Blackshaw et al 2004 rat Klimaschewski et al 2000 and even with modifications human oocytes Neilson et al 2000 SAGE is a powerful method for providing genome wide gene expression data In much the same fashion as EST libraries SAGE uti lizes cDNA tags which are sequenced and quantified The 14 bp SAGE tags differ from ESTs essentially by size allowing subsequent concatenation and high throughput sequenc ing in much greater volumes The location of the anchoring enzyme site is essentially suffi cient to uniquely identify the cognate cDNA or gene The original protocol required rela tively large amounts of starting material 2 to 5 ug of polyA mRNA and was technically quite challenging frequently giving variable results even in experienced hands Major im provements w
221. fication buffer and or enzymes Incomplete digestion of cDNA before amplification due to Inhibitors in ds cDNA Inactive restriction buffers or enzyme Loss of DNA during ethanol precipitation or resuspension Incomplete resuspension of DNA before hybridization Incomplete digestion of DNA Inactive enzymes or buffers Poor ligation efficiency Low transformation efficiency Contamination of RNA or cDNA with genomic DNA before ligation of adaptors Current Protocols in Molecular Biology Remedy Kinase correct primer Test and replace as necessary Repurify cDNA by phenol chloroform extraction and ethanol precipitation using glycogen as carrier Test and replace as necessary Purify ds cDNA by phenol chloroform extraction and ethanol precipitation using glycogen as carrier Test and replace as necessary Repeat with careful monitoring using hand held Geiger counter Avoid complete drying of DNA pellet before resuspension Warm sample to 60 C to aid resuspension Repurify DNA treat with proteinase K phenol chloroform extract ethanol precipitate and wash with 70 ethanol Test and replace as necessary Repurify DNA test and replace enzymes or buffers Test and replace competent cells Restart with fresh RNA and treat it with DNase before reverse transcription Discovery of Differentially Expressed Genes 25B 2 17 Supplement 55 PCR Based Subtractive cDNA Cloning 25B 2 18 Supplement 55
222. fication products of the same cDNA attributable to variable oligo dT priming along the poly A tract during reverse transcription 29 Load 25 ul of PCR products into a 1 5 TBE agarose gel and electrophorese until in dividual bands can be resolved Carefully excise the amplicon in the smallest agarose Serial Analysis of piece possible without sacrificing yield and place into a preweighed microcentrifuge Gene Expression 6 SAGE tube 25B 6 22 Supplement 80 Current Protocols in Molecular Biology 30 Purify PCR product using the Qiaquick gel extraction kit according to manufacturer s instructions Elute Qiaquick columns with 30 ul EB Buffer Proceed immediately to cloning using 4 ul eluant and the TOPO TA Cloning Kit or Cloning Kit for Sequencing per manufacturer s instructions If the only goal for the rSAGE procedure is to sequence the cDNA fragment then the standard TA cloning vector pCR2 1 Invitrogen should suffice However if there are future plans for in vitro transcription of the cloned cDNAs then it is advisable to use the TA cloning vector pCR4 TOPO Invitrogen which has both T7 and T3 RNA polymerase recognition sequences flanking the multiple cloning site IMPORTANT NOTE After TOPO TA cloning do not use the M13 forward primer for subsequent colony PCR or cycle sequencing as the M13 forward site will be embedded in the cloned cDNA The M13 forward primer will not discriminate between M13 forward sites in the CDNA cl
223. fired for removal of cells see before and after photomicrographs in Fig 25A 1 3 If the LCM was successful the area where the polymer was melted should no longer be occupied by tissue and should be empty although a small amount of cellular and stromal material may remain The great majority of the tissue that occupied those spots should now be attached to the cap This can be checked by releasing the vacuum slide holder moving the slide so that a clean area without tissue is in the microscopic field of view lowering the cap to the slide and scanning the surface of the cap The microdissected tissue should be visible on the cap surface If this is not the case there are several explanations and potential remedies see Troubleshooting Avoid lifting and lowering the cap repeatedly after firing the laser and capturing some tissue It is difficult to replace the captured tissue in the exact spot from which it came Consequently the captured tissue and tissue that may nonspecifically stick to the cap will be placed on the histologic section resulting in a layering effect which can limit contact of the cap with the tissue and compromise the effectiveness of LCM therefore limit the number of shots used to test the adequacy of capture and if the test capture is successful avoid lifting the cap again until the microdissection is complete Dense dark or thick samples may occlude the tracking beam If this occurs increase the intensity of the
224. form the PCR amplifications for the two sets of cDNAs A and B at the same time it is important that the primers have similar melting temperatures Tmn Fifth the Tn should not be so high that it approaches the hybridization temperature of 68 C so the GC content should be kept lt 50 and the primers should not be excessively long gt 50 bases Standard oligonucleotide software e g Oligo Primerselect is helpful for design ing primers Primer sequences should also be checked against a database such as GenBank for any similarities to sequences in known genes Restriction digestion of cDNAs It is very important that the cDNAs of both the tracer and driver sides be cut to completion before adapter ligation If for example A cDNA has not digested as well as B cDNA PCR may be biased for smaller fragments in A but not B resulting in false positives at the end of the procedure The Ag and Bo populations should be checked on a gel to ensure that the size ranges of amplified cDNAs are the same Monitoring subtractions It is necessary to monitor efficiency of the subtractions to determine when to stop sub tracting In many cases a problem can be easily resolved on the spot rather than being discov ered at the end of the subtractions so that it is necessary to start all over again Subtraction efficiency can be monitored in the following ways First the cumulative percentage removal of tracer counts after the phenol extractio
225. fraction on a 1 5 agarose gel made in TBE buffer 7 Precipitate the insert DNA add 0 3 ml TE buffer and 1 0 ml of 95 ethanol to each tube mix and place at 20 C for 2 hr or on dry ice for 15 min Because the sucrose gradient buffer contains 1 M NaCl there is sufficient NaCl in the fractions for precipitation of the DNA The sucrose in the gradient fractions must be diluted in order to successfully precipitate the DNA A 2 to 3 fold dilution of these low density fractions is adequate A greater dilution of the higher density fractions is necessary in order to obtain high recoveries of DNA following ethanol precipitation 8 Thaw and collect the DNA by microcentrifugation at high speed for 15 min Aspirate the supernatant and save until DNA recovery has been checked Add 0 5 ml of 70 ethanol to each tube Recentrifuge aspirate the ethanol supernatants and dry the pellets 9 Resuspend and pool the fractions containing insert DNA from the library in TE such that the final concentration is 0 2 mg ml Store the DNA at 20 C 10 Resuspend and pool the insert DNA from the library in 100 ul TE buffer and place on ice Save an aliquot of 400 ng of each and cDNA separately to be used in evaluating the final library produced Expect recoveries of gt 10 to 15 ug of insert DNA from I mg of total library DNA The aliquots of and DNA alternatively may be radiolabeled and used as probes for differential scree
226. from 10 mM dNTPs 2 0 ul 4 uM primer CP28X X A C or G 2 0 ul 4 uM primer MLI19Y Y A C G or T 9 9 ul H O 5 U ul 0 2 ul Tag DNA polymerase Again all PCR mixtures should be prepared as master mixes 3 Carry through the same program as described see Basic Protocol step 13 except for 15 rather than 25 cycles Perform first round normal concentration amplification 4 Transfer reaction tubes to ice To each tube add 20 ul of 200 UM amplification mix prepared as follows 2 0 ul 10 x PCR buffer 1 5 ul 20 mM MgCl 0 8 ul 10 mM dNTPs 4 0 ul RediLoad 11 5 ul H O 0 2 ul 5 U ul Tag DNA polymerase 5 Repeat the program cycle as described see Basic Protocol step 13 performing the Restriction remaining cycles 1 e 16 to 25 Mediated Differential Display RMDD 25B 4 8 Supplement 56 Current Protocols in Molecular Biology 6 Check products by agarose gel electrophoresis see Basic Protocol step 14 and UNIT 2 5A 7 Dilute reactions 1 100 with 0 25x TE buffer Perform second round low concentration amplification 8 Using 96 well microtiter plates set up second round 2 UM amplification reactions 192 different reactions per sample 20 ul each 2 0 ul template diluted first round PCR 2 0 ul 10x PCR buffer 1 5 ul 20 mM MgCl 0 4 ul 0 1 mM dNTPs 4 0 ul 4 uM primer CP28X X X A C G or T 4 0 ul 4 uM labeled primer ML18Y Y Y A C G or T 5 9 ul H O 5 U ul 0 2 ul Tag DNA polymerase 9 Transfer
227. from the mRNAs of the two tis sues being compared are used to screenacDNA library and clones that hybridize to one probe but not to the other are isolated and differential display UNIT 258 3 in which partially random primers are used to amplify a subset of mRNAs expressed in a given cell type these are then separated on an acrylamide gel and the bands between different samples compared Of all the procedures subtractive cloning is probably the most sensitive and itis the method of choice to isolate as complete a set of differentially expressed genes as possible The other methods allow isolation of a small number of differen tially expressed genes and may be sufficient to obtain useful markers Random sampling of a cDNA library is useful only if the two tissues to be compared contain a widely different spec trum of mRNAs A Comparison of Differential Screening Methods Disadvantages Can generally only compare two tissues at one time Procedure can be long Requires little starting material Nonisogenic tissues can be compared Differential display Requires little starting material Can compare more than two tissues or treatments at one time Procedure is relatively short Differential Procedure is relatively easy hybridization Random sampling Simple procedure only cDNA libraries are required Targets only a subset of the differentially expressed genes Generally targets medium abundant mRNAs Can yield many false po
228. g the B1 CD20 cell surface antigen of human B lymphocytes Proc Natl Acad Sci U S A 85 208 212 Contributed by Lloyd B Klickstein Brigham and Women s Hospital Boston Massachusetts Current Protocols in Molecular Biology PCR Based Subtractive cDNA Cloning Subtractive cloning is a powerful technique that allows isolation and cloning of mRNAs differentially expressed in two cell populations In the generalized subtraction scheme illustrated in Figure 25B 2 1 the cell types to be compared are the or tracer cells and the or driver cells where mRNAs expressed in the tracer and not the driver are isolated Briefly tracer nucleic acid CDNA or mRNA from one cell population is allowed to hybridize with an excess of complementary driver nucleic acid from a second cell population to ensure that a high percentage of the tracer forms hybrids Hybrids that form include sequences common to both cell populations Hybrids between the tracer and driver and all driver sequences are removed in the subtraction step The unhybridized fraction is enriched for sequences that are preferentially expressed in the tracer cell population The method described here see Basic Protocol uses double stranded cDNA ds cDNA as both tracer and driver and is modified from protocols devised by Sive and St John 1988 and Wang and Brown 1991 see Background Information and Fig 25B 2 2 Reciprocal subtractions are performed between two cell populations
229. g the flow rate to 6 ml min When the right atrium becomes dilated pierce with sharp pointed forceps to provide outflow First pump 15 to 20 ml room temperature STF through the animal to remove blood from the vasculature followed by 40 to 50 ml heated 80 C fixative Stop the pump when fixative has been depleted This procedure is not difficult but requires practice The best indicator of a successful perfusion is paling of the liver If the liver does not begin to pale rapidly try repositioning the needle in the ventricle adjusting its depth and angle Current Protocols in Molecular Biology Discovery of Differentially Expressed Genes 25A 2 3 Supplement 58 Preparation of Single Cells from Solid Tissues for Analysis by PCR 25A 2 4 Supplement 58 Perfusion fixation is effective because the fixative is distributed to tissues and cells via the macro and microvasculature Coagulation of the blood in the vessels could occur upon contact with the heated fixative thus it is important to first remove blood with room tem perature STF Dissociate tissue 6 Using a dissecting microscope if possible dissect the tissues of interest with clean dissection tools and finely mince on a nuclease free 1 e baked glass slide using scalpel blades or needles e g 25 G needles for ganglia The author uses disposable instruments e g unused 25 G needles unused scalpel blades that are discarded after use i e a singl
230. generation of microdissection techniques that is relatively quick and precise LCM was conceived and first developed as a prototype research tool at the National Insti tute of Child Health and Human Development NICHD and the National Cancer Institute NCI of the National Institutes of Health NIH Arcturus Engineering and the NIH working through a Cooperative Research and Development Agreement developed LCM into a commercial laboratory instrument that is now utilized in many research laboratories Other efficient microdissection techniques such as laser pressure catapulting have also been de scribed Bohm et al 1997 Sirivatanauksorn et al 1999 With LCM cells of interest are dissected from tissue sections or cytologic samples after microscopic identification with the aid of an ethylene vinyl acetate transfer film containing a near infrared absorbing dye The transfer film coats a flat surface of an optically clear plastic cylinder the cap with a diameter of 6 mm The LCM system places the transfer film in contact with a histologic section and then di rects an invisible infrared laser pulse onto the overlying polymer The laser pulse is absorbed by and melts the transfer film causing it to flow around the targeted cells The polymer rapidly cools and creates a bond between the transfer film and the targeted cells The targeted cells can then be lifted from the section and utilized for RNA DNA or protein analysis
231. ham Birmingham Alabama Current Protocols in Molecular Biology Preparation of Single Cells from Solid Tissues for Analysis by PCR The ability to amplify a few copies of DNA or RNA to analyzable quantities makes it technically possible to obtain detailed information regarding the DNA content and or transcriptional pattern of a single cell Mullis and Falona 1987 Although in many cases analysis at the level of the whole tissue can provide the required information there are circumstances that necessitate acquiring data on individual cells of a particular type A preparation of total DNA and RNA isolated from a tissue gives quantitative data but only an average profile masking differences among individual cells In situ analysis provides qualitative information on localization of abundant nucleic acids in specific cells but is generally not quantitative Thus it can be desirable to apply quantitative assays to individual cells The acquisition of individual cells from blood and loosely associated tissues such as spleen is straightforward since these organs are essentially cell suspensions Solid tissues however are almost universally composed of tightly linked cells of multiple types organized in a highly structured and functionally interactive manner Gilbert 1994 It is reasonable to expect that disruption of this environmental context rapidly alters the physiology of the once partnered cells Even in the case of easily dissociated tis
232. he 102 bp band with the least concentration of template A clear plateau in yield should be seen with high concentrations of template The optimal concentration of nucleotide is simply that which gives the highest yield of the 102 bp band If none of the PCR reactions give high yields of the 102 bp band repeat the protocol but run one tube for 30 cycles and one for 32 cycles The authors have found that the optimal concentration of nucleotide can vary from batch to batch and supplier to supplier so repeated optimization may be required See Basic Protocol 1 for materials 1 Prepare serial dilutions of LoTE diluted ditag reaction see Basic Protocol 1 step 27 at 1 3 1 9 1 27 1 81 and 1 243 in LoTE buffer using 10 ul reaction and 20 ul LoTE buffer 30 pl total at each step 2 Prepare the following PCR reaction mixture 5 ul 10x SAGE PCR amplification buffer 3 ul DMSO 1 ul 350 ng ul PCR primer 1 1 ul 350 ng ul PCR primer 2 28 3 ul ddH20 0 7 ul 5 U ul Platinum Tag DNA polymerase 3 Prepare six tubes each containing 1 ul of either stock see Basic Protocol 1 step 27 or diluted ditag reaction 1 3 1 9 1 27 1 81 or 1 243 In duplicate add 4 7 or 10 ul of 10 mM dNTP mix e prepare two tubes of each dilution and nucleotide concentration pair Add sufficient double distilled water to bring the total volume to 11 ul 4 Perform PCR as described see Basic Protocol 1 step 29 using 26 cycles for one of the duplicate tu
233. he approximated x7 _ However when k and A ij are small there is a large departure of TS from x 2 1 the SA algorithm calculates exact P value of observed TS based on the Poisson distribution of Xj Current Protocols in Molecular Biology Discovery of Differentially Expressed Genes 25B 6 39 Supplement 80 Representational Difference Analysis This unit provides a protocol for performing representational difference analysis RDA a technique that couples subtractive hybridization to PCR mediated kinetic enrichment for the detection of differences between two complex genomes RDA requires the generation of representations from two pools of nearly identical DNA varying only in polymorphisms deletions amplifications rearrangements or exogenous pathogens A representation or subset of the genome is used rather than the entire genome since the full complexity of genomic DNA is unfavorable for hybridization to proceed to completion In its original formulation by Lisitsyn and colleagues 1993 2 to 15 of the genome is included in the representation the percentage being dependent on the frequency of restriction endonu clease sites and the efficiency of PCR amplification of these restriction generated frag ments While RDA was first developed for genomic DNA subsequent modifications have been devised to look for differences in transcript expression RDA starts with the digestion of two comparison samples of DNA see Basic Protocol
234. he fact that mismatch extension can be significantly reduced at low dNTP levels For the second phase dNTP concentrations are raised to normal levels 1 e 200 UM each which after an additional 10 cycles allows for accumulation of the desired amount of product The choice of the restriction enzyme used for RMDD depends on the particular organism to be analyzed since average fragment size may vary due to differences in codon usage and G C content To obtain cDNA 3 fragments in a size range optimal for gel display 1 e most of the fragments having a size between 100 and 700 bp an appropriate enzyme Current Protocols in Molecular Biology has to be employed e g Mbol as described in this protocol see Basic Protocol which has proven satisfactory with RNA isolated from man rat mouse corn and Arabidopsis Should another enzyme be chosen linker and linker primer sequences will have to be modified accordingly and the same holds true if for the sake of more complete coverage of the transcriptome experiments are repeated with a second enzyme Computer analysis has demonstrated that in man and rodents roughly 80 to 85 of all transcripts contain a recognition site for Mbol unpub observ therefore 15 to 20 of transcripts would be inaccessible to analysis using this particular enzyme Accordingly if nearly complete coverage of transcripts is desired a second pass RMDD analysis might be performed with a second frequently
235. he site of the magnet Resuspend beads carefully in 20 ul Tween 20 wash buffer Transfer to a fresh 0 2 ml tube place in the magnet and remove the supernatant after complete adhesion of beads to the magnet The multiple washing steps as well as the change of the reaction tube serve to remove the LiDS containing buffer since even small traces of LiDS can inhibit reverse transcription It is very important to allow complete adhesion of the magnetic beads to the tube wall at the site of the magnet to avoid loss of cDNA Note that collection of the supernatant and storage at 20 C may be desired because it contains the genomic DNA that can be used for additional analyses at a later time 7 Resuspend beads in cDNA synthesis mix I and allow primers to anneal for 2 min on the bench at room temperature then add mix II remember to add the RT in mix II Immediately start cDNA synthesis by placing the tubes in a hybridization oven for 45 to 60 min at 44 C with rotation It is important to rotate so that the beads remain suspended The authors tape the 0 2 ml sample tubes to pre heated hybridization bottles 8 Prepare tailing mix see Table 25B 8 3 9 Place tubes in the magnet and remove supernatant Wash beads one time in 20 ul tailing wash buffer Pre heat thermal cycler to 94 C After cDNA synthesis and before starting the tailing reaction the unbound cDNA synthesis primers and unincorporated dNTPs have to be washed off Therefore meticulo
236. hed by using the CapSure Pads Arcturus Engineering which have a sticky surface If using the CapSure Pad place the pad on the microscope stage in the path of the placement arm prior to placing the cap on the unload platform Move the placement arm over the pad lower the cap and raise the pad to contact the cap Raise the placement arm and the cap while holding the pad in place with your hand A less costly alternative to the CapSure Pad is to use the sticky surface of Post It Notes 3M The Post It Notes can be used after the cap has been removed from the unload platform Peel a fresh Post It Note off the pad and lower the cap loaded into the insertion tool to contact the sticky surface of the Post It Note Repeat this 2 to 3 times 16 Using the insertion tool insert the cap into a 0 5 ml microcentrifuge tube containing an appropriate amount of lysis buffer e g DNA or protein lysis buffer usually between 50 and 100 ul Press down firmly and rotate the insertion tool to ensure an Discovery of even seal Differentially Expressed Genes 25A 1 13 Current Protocols in Molecular Biology Supplement 55 ALTERNATE PROTOCOL 2 Laser Capture Microdissection 25A 1 14 Supplement 55 The choice of lysis or digestion buffers is dependent on the analyte and the method of analysis The recipes supplied in this unit see Reagents and Solutions provide examples of lysis buffers for DNA and protein that can be used for LCM samples
237. higher cell numbers 100 to 1000 cells works quite well ZohlInhofer et al 2001a b This Current Protocols in Molecular Biology seems to result from the fact that all experimen tal steps were optimized individually and in combination that the number of steps was kept to a minimum which led to high complexity transcriptomes when the amplicons derived from single cells were hybridized onto cDNA arrays Three points seemed to be particularly important First random primers reduce the length of primary transcript and enable sub sequent amplification within the optimal range for PCR Second a poly G tail provides a much better primer binding site than a poly A or poly T tail Third a poly C containing PCR primer binding to the poly G tail should not be com bined with any other primer sequence There fore the flanking region of the cDNA synthesis primer has to be a poly C track and a single PCR primer is used A high annealing tempera ture and the addition of 3 formamide provide highly specific and optimal conditions for such sequences Reproducibility on a single cell level is very difficult to assess as two individual cells cannot be assumed to be identical and in the same functional stage To exclude intercellular vari ation the cDNA of an individual cell was di vided prior to amplification and then the vari ation of the resulting expression patterns which was presumably introduced by the different methodological step
238. however short lengths of DNA up to 200 bp can be reliably amplified after extraction from formalin fixed paraffin em bedded FFPE tissue RNA is a more labile species and formalin fixation and paraffin embedding greatly interfere with its recovery Attempts to break cross links and thereby improve recovery of nucleic acids and protein have been utilized with varying degrees of success Ikeda et al 1998 Coombs et al 1999 Masuda et al 1999 Optimization and standardization of methods to break the cross links caused by formalin fixation is a goal Current Protocols in Molecular Biology BASIC PROTOCOL 2 Discovery of Differentially Expressed Genes 25A 1 3 Supplement 55 Laser Capture Microdissection 25A 1 4 Supplement 55 of many researchers Studies have shown that among commonly used fixatives formalin has the worst effects on RNA while ethanol i e 70 or 95 ethanol or ethanol based fixatives available from suppliers of histology related materials e g Richard Allan Scientific offer the best RNA preservation Goldsworthy et al 1999 Shibutani et al 2000 In this protocol it is assumed that most researchers will procure fixed and embedded tissue from pathology laboratories or other sources and may have no control over fixation and processing of tissues however a suggested protocol for fixation and tissue processing see Support Protocol has been included in the event the researcher is prospect
239. ht ligation step The remaining set of second round amplifica tions can be done at a rate of four to six 96 well plates per day and person Alternatively em ployment of a robotic pipetting station might be considered Choosing the DBE variant two membranes per day per DBE machine can be prepared each providing space for 30 reac tions It should be noted that buffer capacity allows for using each DBE gel twice provided that the second run starts immediately after the first run without idle electrophoresis in be tween One person can then operate three to four machines per day and produce 6 to 8 membranes In such a medium scale setup gels are prepared in the evening and with edges carefully wrapped in plastic wrap with some wetted pieces of paper towel enclosed allowed to polymerize overnight In the morning gels are mounted and electrophoresis is started During electrophoresis the membranes of the day before are developed the glass plates of the previous runs cleaned and the gels for the next day are prepared Literature Cited Beck S and Pohl F M 1984 DNA sequencing with direct blotting electrophoresis EMBO J 3 2905 2909 Debouck C 1995 Differential display or differen tial dismay Curr Opin Biotechnol 6 597 599 Fischer A 1995 Verfahren zur Genexpressionsana lyse German patent application DE 195 18 505 6 other members of the same patent family are given in the introduction Fischer A Saedler
240. id mass or disintegrated into cellular debris how ever perfusion with STF followed by digestion with collagenase 1 e Worthington CLSI yielded single cell suspensions from peripheral and central nervous tissue lung liver intestine heart pancreas muscle and reproductive tract Nonetheless optimizing the balance between fixation and dissociation for the specific tissue of interest is advisable Fixation The volume of fixative perfused through the animal is critical and should be measured The procedure can be modified for larger animals such as guinea pigs by increasing the volume of fixative utilized Several different types of fixatives were tested including various formaldehyde based formulations The fixative found to give the best results was Streck tissue fixative STF This is a noncrosslinking fixative containing diazolid inyl urea 2 bromo 2 nitropropane 1 3 diol bronopol zinc sulfate and sodium citrate Why STF works in Basic Protocol 1 has not been explored however it is likely that absence of crosslinking in the fixed tissue is favorable for the subsequent enzymatic dissociation process Mincing It is critically important to finely and uni formly mince the tissue This allows greater and more uniform access of dissociating enzymes to the tissue Collagenase The collagenase preparation used contains several collagenases as well as caseinase clostipain and tryptic activities This is a rela
241. imer 360 ul total volume Add 40 ul diluted adapter ligated tester or driver DNA 40 ng to corresponding PCR tubes two for tester and twelve for driver and place tubes in a thermal cycler 1 to 2 min at 72 C Fill in 3 recessed ends of the ligated adapters by adding 3 ul of 5 U ul 15 U Tag DNA polymerase to each tube mix by pipetting and overlay with 110 ul mineral oil Incubate 5 min at 72 C If using a 96 well PCR machine double the number of tubes and halve the amount of PCR mixture for each tube such that four tubes of tester and twenty four tubes of driver amplicon are made With the 96 well PCR machine no mineral oil is required Do not let the tubes cool below 72 C in steps 9 or 10 11 Perform the following two step PCR program 20 cycles 1 min 95 C denaturation 3 min IZ C extension Final step 10min 72 C extension Quantitate amplicons and remove linkers 12 13 14 Pipet off as much mineral oil as possible Combine the contents of both tester PCR tubes into a single 1 5 ml microcentrifuge tube Combine driver tubes pairwise into single microcentrifuge tubes 1 e six driver tubes total For the 96 well PCR format combine the contents of four PCR tubes into a single 1 5 ml microcentrifuge tube Extract each tube with 1 vol phenol followed by 1 vol phenol chloroform isoamyl alcohol isopropanol precipitate with 20 ug glycogen and dry the pellets UNIT 2 1A Resuspend driver and tester am
242. in 12 Embedding paraffin 13 Embedding paraffin 14 Embedding paraffin REAGENTS AND SOLUTIONS Use deionized distilled water in all recipes and protocol steps For common stock solutions see APPENDIX 2 for suppliers see APPENDIX 4 DNA lysis buffer 10 mM Tris Cl pH 8 0 APPENDIX 2 0 2 v v Tween 20 100 ug ml proteinase K The authors use this lysis buffer for samples intended for PCR Arcturus Engineering offers DNA extraction kits that were developed specifically for LCM specimens The proteinase K should be stored at 20 C in aliquots while the Tris Cl and Tween 20 can be stored at 4 C Once the proteinase K is thawed and added the buffer should be used immediately Current Protocols in Molecular Biology 10 10 80 95 95 100 100 100 100 100 70 80 95 100 100 100 100 100 2 00 0 30 0 30 0 45 0 45 0 45 0 45 0 45 0 45 0 45 0 30 0 30 0 30 0 30 0 10 0 10 0 15 0 20 0 30 0 30 0 30 0 30 0 30 0 20 0 30 0 20 Concentration Time min Temperature C 40 40 40 40 40 40 40 40 40 40 58 58 58 58 Concentration Time min Temperature C 40 40 40 40 40 40 40 40 60 60 60 60 Discovery of Differentially Expressed Genes 25A 1 17 Supplement 55 Laser Capture Microdissection 25A 1 18 Supplement 55 Protein lysis buffer 10 mM Tris Cl pH 7 4 APPENDIX 2 0 1 Triton X 100 1 5mM EDTA 10 v v glycerol Store several months a
243. ina Petat Dutter and Nicole Wendler Ludwig Maximilians University of Munich Munich Germany Current Protocols in Molecular Biology CHAPTER 25 Discovery and Analysis of Differentially Expressed Genes in Single Cells and Cell Populations INTRODUCTION or decades molecular biologists have been discovering and analyzing genes that are differentially expressed Initially discovery and analysis were achieved one gene at a time This was followed by cDNA cloning methods to identify genes that were expressed in a given tissue However this left the investigator with a large number of genes to screen for differential expression A major advance was the development of subtractive cloning in the 1980s which greatly enriched for genes that were expressed in one cell or tissue type rather than another Since the advent of PCR using thermostable DNA polymerases in the late 1980s older methods have been refined and many new techniques have been developed that make discovery of differentially expressed genes much more facile and permit the analysis of differential gene expression at the single cell level This chapter consists of protocols some of them older some of them newer for two kinds of methods The first of these are amplification based methods for analysis of individual cells and are contained within Section 25A UNITS 25A 1 amp 25A 3 describe the use of laser capture microdissection LCM of histological specimens so that one can an
244. ination of one or more re agents with phage non E coli C60OhfIA bac terial host or failure to denature the or Current Protocols in Molecular Biology DNA prior to hybridization Too many clones may also be obtained if the S1 nuclease diges tion of DNA did not work which can be evaluated by cloning some of the DNA directly Alternatively check the S1 nuclease step by digesting some M13 DNA under the same conditions and monitoring the reaction by agarose gel electrophoresis If the subtraction did not work duplicate filters screened with and total cDNA probes as described in step 20 will have roughly equal numbers of positive clones The most likely explanation is that the S1 nuclease diges tion was incomplete Check the S1 step by cloning 100 ng of the DNA lt 10 PFU ug insert is expected Anticipated Results The number of clones obtained depends on the similarity of sources of and cDNA For a subtracted cDNA library prepared from B cell and T cell cDNA 5500 recombi nants were obtained 15 of which were im munoglobulin clones Because of the high level of similarity between B cells and T cells this result probably represents a minimum number to be expected Investigators using this protocol have reported 300 to 15 000 phage per library Twenty to fifty percent of the clones in a well constructed library will be specific most of the remainder will be abundant cDNA
245. ine phosphatase Filters Precipitated Fab fragments degraded anti digoxigenin alkaline phosphatase 25B 8 16 Supplement 61 Check concentration of added probe Concentrations gt 1 5 ug ml can result in high background Never add undiluted probe to the array Direct contact with the nylon membrane will result in dark areas spots Dilute the labeled probe in 1 ml hybridization buffer and be careful not to pour it directly onto the filter Unbound or unspecifically bound probe must be entirely washed out Check SSC concentrations and washing temperatures Alkaline phosphatase is expressed by bacteria Check autoclave buffers used for developing the filters Nylon membranes can be stripped and re hybridized up to six to eight times Repeated use however will increase background every time Spin down antibody solution prior to use and use the supernatant only Current Protocols in Molecular Biology by gene specific PCRs for housekeeping genes and one less abundant but more or less consis tently expressed gene of the investigated cells In addition it is advisable to run a gel with 5 ul of the primary PCR It should show a smear ranging from 200 to 2000 bp without bands A sample without the addition of cellular mRNA should also be checked since contamination can be detected this way If a smear originating from DNA contamination in the enzyme prepa rations is at all present in the negative control it should be sma
246. ing short and long hybridizations 6 hr to 44 hr Slot blot hybridization to check the progress 24 hr of subtraction 31 to 34 Cloning of subtracted cDNAs Amplification of subtracted cDNAs 8 hr Restriction endonuclease digestion Overnight 0 5 hr to set up Vector ligation Overnight 0 5 hr to set up Bacterial transformation and growth Overnight 0 5 hr to set up 35 to 38 Assessment of subtracted cDNA library The schedule for days 7 to 30 depends on the duration of the hybridization steps and the amount of progress Growth of library Preparation of lifts Hybridization with subtracted probes with each subtraction Current Protocols in Molecular Biology Overnight 0 5 hr to set up 8 hr 24 hr Discovery of Differentially Expressed Genes 25B 2 19 Supplement 55 PCR Based Subtractive cDNA Cloning 25B 2 20 Supplement 55 are overexpressed in senescent human diploid fibroblasts Anal Biochem 214 58 64 Patanjali S R Parimoo S and Weissman S M 1991 Construction of a uniform abundance normalized cDNA library Proc Natl Acad Sci U S A 88 1943 1947 Rosenberg M Przylbylska M and Straus D 1994 RFLP subtraction A method for making libraries of polymorphic markers Proc Natl Acad Sci U S A 91 6113 6117 Rubenstein J L R Brice A E J Ciaranello R D Denney D Porteus M H and Usdin T B 1990 Subtractive hybridization system using single stranded phagemids with dire
247. intanilla Martinez L Kumar S Beaty M W Blum L Sorbara L Jaffe E S and Raffeld M 1999a Composite low grade B cell lymphomas with two immunophenotypically distinct cell populations are true biclonal lym phomas A molecular analysis using laser cap ture microdissection Am J Pathol 154 1857 1866 Fend F Emmert Buck M R Chuaqui R Cole K Lee J Liotta L A and Raffeld M 1999b Immuno LCM Laser capture microdissection of immunostained frozen sections for mRNA analysis Am J Pathol 154 61 66 Finkelstein S D Hasegawa T Colby T and Yousem S A 1999 11q13 allelic imbalance dis criminates pulmonary carcinoids from tumor lets A microdissection based genotyping ap proach useful in clinical practice Am J Pathol 155 633 640 Garrett S H Sens M A Shukla D Flores L Somji S Todd J H and Sens D A 2000 Metallothionein isoform 1 and 2 gene expression in the human prostate Downregulation of MT 1X in advanced prostate cancer Prostate 43 125 135 Glasow A Haidan A Hilbers U Breidert M Gillespie J Scherbaum W A Chrousos G P and Bornstein S R 1998 Expression of Ob re ceptor in normal human adrenals Differential regulation of adrenocortical and adrenomedul lary function by leptin J Clin Endocrinol Metab 83 4459 4466 Goldsworthy S M Stockton P S Trempus C S Foley J F and Maronpot R R 1999 Effects of fixation on RNA extract
248. ion Toward this end an important step was replacing spin column chromatogra phy for removal of unincorporated linker mole cules with size selective polyethylene glycol precipitation allowing almost 100 recovery of the desired DNA species and reduction of the protocol to as few steps as possible In its current version RMDD yields highly repro ducible band patterns independent of moderate variations of the amount of input material in the range of at least down to 10 ug total RNA however it is essential that the analyzed RNA be of high purity Otherwise due to inhibition of enzymatic steps the amount of linker ligated template fragments effectively entering ampli fication might become too low to guarantee stable PCR results One should also be aware that RMDD analy sis only covers those transcripts that carry a recognition site for the restriction enzyme used in an amplifiable distance from the poly A tail For a more detailed discussion of this issue see Strategic Planning Troubleshooting For solutions to problems that may arise during these protocols see Table 25 B4 1 Anticipated Results After corresponding PCRs distinguished by identical primer extensions from different RNA samples are run side by side on the gel resulting band patterns are visually compared A typical RMDD pattern shows in each lane bands of different sizes and intensities each representing one particular cDNA Patterns ob tained fr
249. ion and amplification from laser capture microdissected tissue Mo lecular Carcinogenesis 25 86 91 Current Protocols in Molecular Biology Guan R J Fu Y Holt P R and Pardee A B 1999 Association of K ras mutations with p16 methy lation in human colon cancer Gastroenterology 116 1063 1071 Ikeda K Monden T Kanoh T Tsujie M Izawa H Haba A Ohnishi T Sekimoto M Tomita N Shiozaki H and Monden M 1998 Extrac tion and analysis of diagnostically useful pro teins from formalin fixed paraffin embedded tissue sections J Histochem Cytochem 46 397 403 Jin L Thompson C A Qian X Kuecker S J Kulig E and Lloyd R V 1999 Analysis of anterior pituitary hormone mRNA expression in immunophenotypically characterized single cells after laser capture microdissection Lab Invest 1719 511 512 Jones C Foschini M P Chaggar R Lu Y J Wells D Shipley J M Eusebi V and Lakhani S R 2000 Comparative genomic hybridization analysis of myoepithelial carcinoma of the breast Lab Invest 80 831 836 Kuecker S J Jin L Kulig E Oudraogo G L Roche P C and Lloyd R V 1999 Analysis of PRL PRL R TGFB R11 gene expression in normal and neoplastic breast tissues after laser capture microdissection Appl Immunohist Molec Morp 7 193 200 Leethanakul C Patel V Gillespie J Pallente M Ensley J F Koontongkaew S Liotta L A Emmert Buck M and
250. ion by electrophoresis Add 200 ul TE buffer and 300 ul phenol chloroform isoamyl alcohol extract and ethanol precipitate the DNA as in step 12 Resuspend the washed and dried pellet in TE buffer at 1 0 ug ul Check the 5 ul aliquot from step 13 by running a 2 agarose minigel in TBE buffer and ethidium bromide staining The DNA fragments should be between 50 and 200 bp in length Hybridize the DNA 16 17 Hybridize the insert DNA with the DNA fragments Add in the following order to a 0 4 ml microcentrifuge tube final volume 51 ul 25 ul deionized formamide 50 vol vol final 10 ul DNA fragments 10 ug 1 ul insert DNA 0 2 ug 12 5 ul 20x SSC 5x final 0 5 ul 1 M NaPO pH 7 0 10 mM final 0 5 ul 0 1 M EDTA pH 8 0 1 mM final 0 5 ul 10 SDS 0 1 final 1 0 ul 10 mg ml yeast tRNA 0 2 mg ml final Mix by vortexing briefly microcentrifuge and place tube in a bath of boiling water for 5 min Briefly microcentrifuge again and incubate 18 to 24 hr at 37 C The boiling step melts the DNA strands During the hybridization step only sequences not present in the DNA will find their complementary strands and regenerate clonable double stranded fragments with EcoRI ends A sequence also present in the DNA will hybridize with at least one of the Alul Rsal fragments forming a partially single stranded partially double stranded molecule without clonable ends Add 200 ul
251. is radiolabeled to provide tracer cDNA to monitor subtraction efficiency partis biotinylated to provide driver cDNA to facilitate removal of hybrids after annealing Tracer cDNA from cell population A is hybridized to driver cDNA from population B and vice versa Tracer driver and driver driver hybrids are removed by exposure to streptavidin and phenol extraction leaving subtracted tracer cDNAs enriched for differentially expressed genes for each population The sequences are enriched further by repeated rounds of amplification and hybridization The progress of subtraction is monitored by slot blot hybridization see Support Protocol Finally the subtracted cDNAs are ligated into vectors and used to create libraries that can be screened for individual differentially expressed genes Current Protocols in Molecular Biology Materials Double stranded cDNA ds cDNA for cell types A and B UNIT 5 5 Alul and 10x Alul buffer see recipe Rsal 10 15 and 75 mM ATP 10 U ul T4 polynucleotide kinase and 10x T4 polynucleotide kinase buffer see recipe Oligonucleotide primers 3 ug ul al 5 TAG TCC GAA TTC AAG CAA GAG CAC A 3 2 5 ug ul a2 5 CTC TTG CTT GAA TTC GGA CTA 3 3 ug ul b1 5 ATG CTG GAT ATC TTG GTA CTC TTC A 3 2 5 ug ul b2 5 GAG TAC CAA GAT ATC CAG CAT 3 10 U ul T4 DNA ligase and 10x T4 DNA ligase buffer see recipe 40 w v polyethylene glycol 8000 PEG 8000 25 24 v v phenol chloroform made with buff
252. issue type and are very well suited for transcript discovery in known genomic se quences Gene prediction from genomic se quences is still far from perfect today and the whole genome sequences of complex organ isms suggest that the transcript repertoire may be quite complicated The MPSS technology is commercialized by Lynx Therapeutics SAGE technology is described elsewhere in this book UNIT 25B 6 Differential display DD technology as first described by Liang and Pardee 1992 unir25B 3 uses one random primer and an anchored oligo d T primer for amplification of cDNA frag ments which are displayed on denaturing polyacrylamide gels i e sequencing gels The major difference between DD and the AFLP cDNA technology described in this unit is that AFLP cDNA profiling allows a system atic display of cDNA fragments with each primer combination displaying a different sub set of the cDNAs Durrant et al 2000 Van der Biezen et al 2000 Breyne and Zabeau 2001 Din et al 2001 Qin et al 2001 This and the smaller fragments generated by AFLP gener ally yield sharper and more discrete banding patterns Another alternative to DD 1s restric tion enzyme analysis of differentially ex pressed sequences This technology makes use of restriction enzyme cleavage sites in the cDNA and yields sharp discrete bands like AFLP unir 258 4 Fischer et al 1995 Prashar and Weismann 1996 The AFLP technique allows the selectiv
253. isting microbial flora is matched Lastly the infected tissue should always be used as the tester keeping in mind that the infection may be disseminated In a related cautionary when working with cell lines en sure that no mycoplasma infection is present in cultures and that transformed cell lines are not generated by viral infections i e herpes viruses papillomaviruses or adenoviruses The use of PCR in RDA necessitates imple mentation of procedures that guard against DNA contamination If RDA is performed re petitively all work areas and surfaces should be monitored regularly for occult adapter li gated products This can be done with swipe tests followed by PCR with the O and E 24 mers PCR preparation amplification and analysis should be isolated from each other if possible dedicated micropipettors should be used and reagents should aliquoted and changed frequently Amplicon preparation In both DNA and cDNA RDA the quality of the starting material is important Tissues or cells used to generate tester and driver DNA should be subjected to the same harvesting storage and DNA extraction conditions Use methods for DNA preparation which give rela tively pure DNA to ensure complete digestion Current Protocols in Molecular Biology The amount the completion of digestion as well as the integrity of DNA should be assessed by agarose gel electrophoresis to confirm that smears of tester and driver DNA in the initi
254. ith DNA prepared from already existing libraries elimi nating the potential time and expense involved in the preparation of fresh tissue or cells and 4 with slight modifications either cDNA or genomic subtracted libraries may be prepared A disadvantage of this approach is that if no or cDNA libraries are available they must first be made or cDNA must be synthe sized requiring an extra few days to a week A second disadvantage of this or any other sub traction protocol is that clones containing reit erated sequences e g an Alu repeat in the 3 untranslated region would be eliminated from the library on that basis Thus the repre sentation of a clone containing a reiterated sequence would be lower than expected with only partial length cDNAs present after sub traction A good alternative to creating a subtracted library is differential screening of a library known to contain the target clone s In one well characterized experiment duplicate lifts from a lymphoid tissue cDNA library were screened with total B cell cDNA and total T cell cDNA probes B cell specific clones were identified as plaques that hybridized with a B cell cDNA probe and not with a T cell probe Tedder et al 1988 A potential drawback to the differential screening approach is that rare sequences will have very low specific probe concentrations in the mixture and thus might not hybridize to the DNA from a target plaque in areasonable pe
255. ium acetate and 2 vol of 100 ethanol Wash two times with 70 ethanol and centrifuge again after last wash Carefully remove residual liquid with a pipet tip and air dry 5 to 10 min Resuspend pellet in 2 ul LoTE buffer Do not overdry because DNA will be lost Current Protocols in Molecular Biology Discovery of Differentially Expressed Genes 25B 6 7 Supplement 80 Ligate tags to form ditags 26 Prepare 2x ligase mix as follows 2 5 ul 3 mM Tris Cl pH 7 5 3 0 ul 5x T4 DNA ligase buffer 2 0 ul 5 U ul high concentration T4 DNA ligase Prepare a 2x ligase mix with 4 5 ul of 3 mM Tris Cl pH 7 5 and 3 0 ul of 5x T4 DNA ligase buffer Add 2 ul of appropriate mix to ligase samples and incubate in a thermal cycler overnight 8 to 12 hr at 16 C The sample may dry out in a water bath in 4 C cold room thus incubation in a PCR machine thermal cycler is preferable 27 After ligation add 98 ul LoTE buffer optimize PCR conditions see Support Proto col 2 and proceed to large scale PCR amplification Samples may be stored gt l year at 20 C Perform large scale PCR amplification of ditags 28 Prepare a reaction master mix for large scale PCR two to three 96 well PCR plates containing 50 ul reaction per well using the following recipe for one reaction as a guide 5 ul 10x SAGE PCR amplification buffer 3 ul DMSO 4 0 to 10 ul 10 mM dNTPs 1 ul 350 ng ul PCR primer 1 1 ul 350 ng ul PC
256. ively collecting human or animal tissues and has some degree of control over these processes Materials Paraffin embedded tissue block mounted on appropriate microtome chuck see Support Protocol Xylene 100 95 and 70 ethanol Microtome and microtome blades disposable preferred Richard Allan Scientific clean 43 to 44 C water bath Histologic slides plain uncoated charged or silanized 37 to 42 C oven optional Coplin jars or other solvent containers Section tissue 1 Cut 5 to 10 um sections of a paraffin embedded tissue block mounted on an appropriate chuck on a clean microtome with a clean blade IMPORTANT NOTE Careful attention should be given during sectioning and mounting of paraffin embedded tissue to prevent carryover Carryover contamination of one speci men from another or transfer of material from one region of a section to another can lead to spurious results The microtome used to cut sections should be kept clean and excess paraffin and tissue fragments should be wiped from the area with a simple gauze pad A fresh microtome blade should be used for each block and disposable blades used if possible Sections of 5 um thickness are optimal for LCM but the thickness should be dependent on the size of the cells to be microdissected 2 Float resulting paraffin ribbons on 43 to 44 C deionized water in a water bath to smooth out and eliminate folds and wrinkles The water should be changed frequently
257. ividual neurons is virus strain specific and correlates with reactiva tion J Virol 72 5343 5350 Sawtell N M Thompson R L Stanberry L R and Bernstein D I 2001 Early intervention with high dose acyclovir treatment during primary herpes simplex virus infection reduces latency and subsequent reactivation in the nervous sys tem in vivo J I D 184 964 971 Thompson R L and Sawtell N M 1997 The her pes simplex virus type latency associated tran script gene regulates the establishment of la tency J Virol 71 5432 5440 Thompson R L and Sawtell N M 2000 Replica tion of herpes simplex virus type 1 within the trigeminal ganglia is required for high frequency but not high viral genome copy number latency J Virol 74 965 974 Thompson R L and Sawtell N M 2001 Herpes simplex type latency associated transcript gene promotes neuronal survival J Virol 75 6660 6675 Virchow R 1863 Cellular pathology as based upon physiological and pathological histology 2nd ed translated by F Chance J B Lippincott Philadelphia Key References Sawtell N M 1997 See above This manuscript describes the procedure as used to quantify viral latency and includes several critical validation experiments Contributed by N M Sawtell Children s Hospital Medical Center Cincinnati Ohio Discovery of Differentially Expressed Genes 25A 2 15 Supplement 58 Laser Microdissection Mediated Isolation and
258. k solution Develop under slow rotation for 2 to 3 hr CAUTION NBT is a suspected carcinogen Moreover the DMSO in the concentrated stock solution might mediate penetrance of dissolved substances through the skin and is itself hazardous Wear gloves replace contaminated gloves immediately and carefully avoid any skin contact Dispose of according to institutional regulations also see APPENDIX 1H 13 Pour off developing solution and perform three 10 min rinses with 150 ml water each 14 Put the wet membrane between two sheets of 2 mm thick polyethylene wrap or material from a thick hybridization bag Inspect wet membranes visually for bands appearing significantly stronger or weaker in one lane as compared to adjacent corresponding lanes Polyethylene wrap is also called tubular film and must be thick as thinner material makes handling of the wrapped membranes much more difficult and might not be a sufficient barrier against water vapor allowing the membranes to dry The material from a hybridization bag should also work provided it is thick enough Current Protocols in Molecular Biology Discovery of Differentially Expressed Genes 25B 4 11 Supplement 56 It is important that after color development membrane pieces carrying DNA to be reamplified never dry as otherwise reamplification by PCR may become impossible For documentation scanning of the wrapped wet membranes has proved to yield the most satisfactory re
259. ked to beads The bead cannot enter the cell and thus the DNase is able to digest DNA in the fluid surrounding the cell but does not destroy the DNA within the cell In the next steps which include a proteinase K treatment to increase the permeability of the cell and the PCR reaction itself a two part buffer system is utilized to minimize pipetting and insure maximum uniformity in the setup of samples by eliminating the need to pipet very small volumes Materials Enriched cell sample see Basic Protocol 1 or Alternate Protocols 1 or 2 Triple 0 2 um filtered nanopure 3xF H O Ponceau S solution see recipe Immobilized DNase on PVP beads Mobitec DNase reaction buffer see recipe PCR PK solution see recipe Current Protocols in Molecular Biology DNA standards e g cloned segments of HSV genome containing the gene being amplified e g thymidine kinase PCR amplification solution see recipe Taq DNA polymerase Life Technologies 200 ul PCR tubes Dissecting microscope PCR Gene Amp 2400 Perkin Elmer Cetus Gene screen plus nylon membrane NEN Life Science Products Storage phosphor screen Molecular Dynamics Imagequant software Additional reagents and equipment for quantitating standards UNIT 15 7 Sawtell and Thomson 1992 PCR unit 15 1 nondenaturing polyacrylamide gel electrophoresis UNITS 2 5 amp 2 7 UV crosslinking DNA to filters UNIT 2 9 hybridizing blots with oligonucleotides UNITS 2 94 amp
260. king with more than eight samples at once is not recommended since it increases the duration of the procedure and consequently favors RNA degradation Clumped beads typically result from genomic DNA Refer to Table 25B 8 1 to adjust the bead volume to the cell number Perform the hot start procedure quickly since keeping a single stranded cDNA at 78 C for extended times can destroy the template Troubleshooting Global amplification There is no way to check the individual steps prior to PCR amplification Before hybridizing a sample to an array test amplification success Discovery of Differentially Expressed Genes 25B 8 15 Supplement 61 Table 25B 8 6 General Troubleshooting Guide Cause problem Possible solution Negative PCRs or no primary product Inactive reagents Gene specific PCR Because all steps are critical be sure that all reagents have been properly stored and handled Primers should be dispensed into aliquots prior to use in order to prevent repeated freeze thaw cycles do not store diluted dNTP or dGTP too long check expiration dates of enzymes check tailing buffer and TdT storage buffer for absence of cacodylate formamide must be deionized High quality enzymes and primers are most essential Most gene specific PCRs will work with the primary PCR products as template but be prepared to re test the annealing temperature for the CP2 amplified cDNA Sometimes gene specific PCR works better on 1
261. l as the restriction endonuclease DpnII is a four base recognition enzyme that is compatible with the BglII and BamHI primers listed in Table 25B 7 1 The second is the use of different ratios of tester to driver in the sequential hybridizations For cDNA RDA the ratios of 1 10 1 100 1 500 and 1 25000 may be used see Table 25B 7 2 for ranges of tester driver ratios Pastorian et al 2000 Table 25B 7 2 Tester Driver Hybridization Stringencies for cDNA RDA Subtractive kinetic enrichment Round 1 Round 2 Round 3 Round 4 REAGENTS AND SOLUTIONS Range of tester driver ratios 1 10 1 50 1 100 1 500 1 1000 1 5 000 1 10 000 1 50 000 Use deionized distilled water in all recipes and protocol steps For common stock solutions see APPENDIX 2 for suppliers see APPENDIX 4 EE x 3 hybridization buffer 30 mM 4 2 hydroxethyl 1 piperazinepropanesulfonic acid EPPS pH 8 0 at 20 C 3 mM EDTA Store up to 6 months at room temperature RDA PCR buffer 5x 335 mM Tris Cl pH 8 8 at 25 C APPENDIX 2 20 mM MgCl 80 mM NH SO 50 mM 2 mercaptoethanol 0 5 mg ml BSA Store up to 6 months at 20 C COMMENTARY Background Information Representational difference analysis RDA was first described in 1993 and has been used to detect polymorphisms between individuals positional synteny between species and ge netic lesions in neoplasms Lisitsyn etal 1993 Lisitsyn and Wigler 1995 Lowrey et al 2000
262. l 0 1 M DTT 10 mM final 1 6 ul 250 uM 4dNTP mix 20 uM final 0 2 ug total RNA or 0 1 ug poly A RNA 2 ul of one 10 uM degenerate anchored oligo dT primer set T MN 1 uM final Adjust volume to 19 ul with DEPC treated H O There will be four reactions for each RNA sample each made with one degenerate primer set 10 Incubate tube 5 min at 65 C to denature the mRNA secondary structure and incubate 10 min at 37 C to allow primer annealing 11 Add 1 ul of 200 U ul MoMUuLYV reverse transcriptase to each tube mix well and incubate 50 min at 37 C 12 Incubate 5 min at 95 C to inactivate the reverse transcriptase and microcentrifuge briefly at high speed to collect condensation Place tube on ice for immediate PCR amplification or store at 20 C for later use stable at least 6 months Perform PCR amplification 13 Prepare a 20 ul reaction mix for each primer set as follows 10 ul H O 2 ul 10x amplification buffer 1x final 1 6 ul 25 uM 4dNTP mix 2 uM final 0 2 ul a P dATP 2 ul 2 uM arbitrary decamer 0 2 UM final 2 ul 10 uM degenerate anchored oligo dT primer set T MN 1 uM final 2 ul cDNA step 12 0 2 ul 5 U ul Tag DNA polymerase To avoid pipetting errors prepare enough PCR reaction mix without the arbitrary decamer for 5 to 10 reactions and aliquot 18 ul to each tube Then add the arbitrary decamer Otherwise it is difficult to pipet accurately 0 2 ul of Tag DNA polymerase 14 Pipet up and do
263. l 1 to visualize lacZ expressing cells Materials also see Basic Protocol 1 Glutaraldehyde Discovery of 100 ug ml Xgal in Xgal buffer see recipe Differentially Expressed Genes 25A 2 7 Current Protocols in Molecular Biology Supplement 58 BASIC PROTOCOL 2 Preparation of Single Cells from Solid Tissues for Analysis by PCR 25A 2 8 Supplement 58 1 Perfusion fix the animal see Basic Protocol 1 steps 1 to 4 except add 0 2 w v glutaraldehyde to the STF and pump 20 ml of this solution through the animal at room temperature Proceed with 80 C STF only perfusion as described see Basic Protocol 1 step 5 This preserves B galactosidase activity which does not remain active in STF alone The author has utilized mice infected with a viral mutant containing a B galactosidase expres sion cassette however mice containing a B galactosidase transgene or mice in which a B galactosidase cassette has been introduced using any gene transfer approach could also be analyzed in this way 2 Remove tissue of interest and incubate in 100 ug ml Xgal in Xgal buffer at 37 C for 3 hr The time of incubation in the Xgal will depend on the strength of the promoter driving expression The minimum amount of time for development should be used 3 Inspect tissue and confirm presence of marked cells then mince and dissociate the tissue see Basic Protocol 1 steps 6 to 9 4 Enrich cell population by Percoll gradient se
264. l RNA preserva tion Samples for protein analysis are also best processed as for RNA analysis but reagents that include protease inhibitors can be used DNA is more stable and fixed or frozen tissues can be used but samples should not be over fixed in formalin as DNA yield increases with prolonged fixation times lt 6 hr is preferable for small samples Troubleshooting If LCM fails to capture the cells e they are not released from the slide the following steps are recommended 1 Refocus the beam see Basic Protocol 6 2 Make sure the sections are flat Wrinkles can be shaved off using sterile razor blades Dip the section in xylene after saving the wrinkles to make sure that no contaminating debris re mains on the section 3 Change the cap Not all caps perform equally well and the age of the caps is impor tant It is best not to use expired caps and to buy relatively small numbers of caps at a time so that the stock is relatively new 4 Ensure thorough dehydration of the specimen Place the slides in fresh xylene for 1 min or more and allow drying in a biologic safety hood for 1 to 5 min If LCM is still not successful pass the slides through 95 ethanol twice for 30 sec absolute ethanol twice for 30 sec and xylene for to 5 min 5 Process anew section and make sure that the frozen sections or cytologic specimens have not been allowed to dry on the slide prior to fixation For formalin fixed sections do not
265. l make it difficult to reamplify recovered DNA because DNA is labile at acidic pH especially at the high temperature at which the gel is normally dried The dried gel should be handled with gloves to prevent DNA contamination Always store the dried gel between two sheets of clean Whatman 3MM filter paper Use either radioactive ink or needle punches to mark X ray film and dried gel to orient them Expose the film 24 to 48 hr at room temperature APPENDIX 3A Develop the film align film with gel and indicate DNA bands of interest those differentially displayed in different lanes either by marking beneath the film with a clean pencil or by cutting through the film Typical results of differential display are shown in Figure 25B 3 2 Cut out gel slice and attached Whatman 3MM filter paper with a razor blade and place in a microcentrifuge tube Add 100 ul H O and incubate 10 min at room temperature Ifmore than one band is differentially expressed extract and reamplify each one separately Cap tube tightly and boil 15 min Place a lid lock on the tube to prevent it from opening while boiling Microcentrifuge 2 min at high speed to pellet gel slice and paper debris Decant supernatant into clean tube Add 10 ul of 3 M sodium acetate to give 0 3 M final and 5 ul of 10 mg ml glycogen as a carrier to supernatant Add 400 ul of 100 ethanol and incubate 30 min at 70 C Microcentrifuge 10 min at high speed 4 C Glycogen is solub
266. late PEG precipitated ligation products 2 0 ul 10x PCR buffer 1 5 ul 20 mM MgCl 0 4 ul 10 mM dNTPs 2 0 ul RediLoad 9 9 ul H O 0 2 ul 5 U ul Taq DNA polymerase Assemble reactions and place the tubes in the wells of a thermocycler preheated to 90 C Apply the following cycling program Initial step 1 min 94 C denaturation 25 cycles 20 sec 94 C denaturation 30 sec 65 C primer annealing 4 min 72 C primer extension Final step indefinitely 10 C hold extension Load 10 ul of each reaction onto a 1 5 agarose gel and check for successful amplification by agarose gel electrophoresis UNIT 2 54 Include a 100 bp ladder as a size marker PCR conditions are adjusted in such a way that the amount of primers limits the amount of product The long extension time ensures that differently sized products are simultane ously amplified essentially without a bias against the longer ones Agarose gel electropho resis should yield smears between 100 bp and 700 bp with very few if any discrete bands being visible Most importantly reactions obtained with the same primer combina Current Protocols in Molecular Biology tion but from different RNA samples to be compared should look essentially indistinguish able If appearance and or amount of material should visibly differ probably one of the enzymatic steps prior to amplification was performed at too low an efficiency see Troubleshooting and Table 25 B4 1 15 Dilut
267. latency This may be due in part to the very high GC content of the HSV genome in general and the specific regions being reverse transcribed Regardless the assay can detect specific transcripts in small numbers of cells REAGENTS AND SOLUTIONS Use 3xF HO in all recipes and protocol steps For common stock solutions see APPENDIX 2 for suppliers see APPENDIX 4 Cresyl violet solution Prepare the following in triple 0 2 um filtered nanopure 3xF H O 0 5 w v cresyl violet 10 v v glacial acetic acid Store up to 12 months at room temperature DNase reaction buffer Prepare the following in triple 0 2 um filtered nanopure 3xF H O 20 mM Tris Cl pH 7 5 APPENDIX 2 5 mM MgCl 5 mM CaCl Aliquot and store up to 12 months at 20 C Hanks balanced salt solution HBSS 0 4 g liter KCI 0 06 g liter KH PO 8 00 g liter NaCl 0 35 g liter NaHCO 0 048 g liter Na HPO 1 00 g liter D glucose Sterilize by passing through three 0 2 um filters Aliquot and store up to 12 months at 20 C PCR amplification solution Prepare the following in triple 0 2 um filtered nanopure 3xF H O 20 mM Tris Cl pH 8 4 APPENDIX 2 50 mM KCl 1 5 to 4 5 mM MgC 5 w v gelatin 200 UM each dNTP 25 to 50 pmols of each primer UNIT 15 7 Katz et al 1990 Store up to 1 month at 20 C While the buffer can be stored with primers and dNTPs it is better to add them just before use Buffer without primers or dNTPs can be stored up to 12 months at
268. ld These PCR cycling conditions are only guidelines that happen to work well for most SAGE tag specific primers A prolonged touchdown is pivotal for the specificity of priming Optimal annealing temperatures may vary depending upon the nucleotide makeup of the SAGE tag specific primer Therefore the touchdown annealing temperature should begin at least 10 C above the predicted oligonucleotide melting point Tm Over the 15 touchdown cycles the annealing temperature should by 1 C increments settle upon the predicted SAGE tag specific primer s annealing temperature where the rest of the 30 amplification cycles will proceed It is not advisable to go below an annealing temperature of 40 C regardless of how low the oligonucleotide T might be Despite the apparent numerous amplification cycles used in this prolonged touchdown approach the Tag polymerase remains very much active mostly attributable to the protective effects of high concentration betaine See Critical Parameters and Troubleshooting for further discussion 28 Visualize 5 ul of the PCR products on a 1 5 TBE agarose gel UNIT 2 54 The expected amplicons are usually between 100 to 400 bp sometimes larger or smaller Sometimes multiple bands may be amplified If a control rSAGE amplified library was constructed the band that is more intense in the experimental rSAGE library should be selected for further characterization Often multiple closely sized bands are ampli
269. le 5 min 70 C fill in Final step indefinite 4 C hold 25 Analyze 10 ul of each PCR product on a 4 to 20 Novex TBE acrylamide gel along with 1 kb ladder Stain with 1x SYBR Green I in TBE buffer for 30 min and visualize under UV light A smear predominantly in the 200 to 500 bp range should be observed Choose the highest rSAGE dilution that gives reliable results The authors usually use the amplified 1 50 dilution of the rSAGE product Amplified rSAGE libraries may be stored at 20 C for months Discovery of Differentially Expressed Genes 25B 6 21 Current Protocols in Molecular Biology Supplement 80 PCR amplify using SAGE tag specific primer and M13F primer 26 Prepare the following PCR mixture per reaction 1 ul amplified rSAGE library step 24 5 ul 10x SAGE PCR buffer 2 5 ul DMSO 3 ul 10 mM dNTPs 10 ul 5 M betaine 1 ul 350 ug ul M13 forward primer 1 ul 350 ug ul SAGE tag specific primer 25 5 ul H20 1 ul 5 U ul Platinum Taq See Critical Parameters and Troubleshooting for a discussion of SAGE tag specific primers 27 Amplify under the following PCR cycling conditions Initial step 2 min 93 C denaturation 1 cycle 30 sec 93 C begin touchdown 1 min 60 C 1 min 70 C 15 cycles 30 sec 93 C touchdown cycles 1 min 60 1 C cycle 1 min 70 C 30 cycles 30 sec 93 C amplification cycles 1 min 44 C 1 min 70 C 1 cycle 5 min 70 C fill in Final step indefinite 4 C ho
270. le at ethanol concentrations lt 85 Rinse pellet with 500 ul of 85 ethanol air dry and dissolve the DNA in 10 ul H O Reamplify DNA 29 26 Reamplify 4 ul of the eluted DNA in a 40 ul reaction volume using the same degenerate anchored oligo dT primer set and PCR conditions as in steps 13 through 15 except add 3 2 ul of 250 uM 4dNTP mix 20 UM final instead of 1 6 ul of 25 uM 4dNTP mix and omit isotope Save the remaining recovered DNA at 20 C for future reamplification stable indefinitely Electrophorese 30 ul of each PCR sample on a 1 5 agarose gel and stain with 0 5 ug ml ethidium bromide UNIT 2 54 Store the remaining PCR samples at 20 C stable for years Most amplified DNAs should be visible after the first reamplification Fragment molecular weights should be checked after reamplification to ensure that they are consistent with those on the denaturing polyacrylamide gel If a DNA is not visible after the first reamplification 4 ul of 1 100 dilution in water of the first reamplification sample may be used for a second 40 cycle amplification Current Protocols in Molecular Biology Discovery of Differentially Expressed Genes 25B 3 5 Supplement 56 Differential Display of mRNA by PCR 25B 3 6 Supplement 56 27 Extract the desired reamplified DNA band from the agarose gel UNIT 2 6 and use it as a probe for northern blot analysis unr 6 3 and cDNA library screening UNIT 6 3 St
271. levels of abundant common sequences that is the start ing cDNA population Ag or Bo otherwise these abundant sequences will never be re moved Normalization could also be achieved by subtracting the driver against itself self sub traction The reason cross subtractions are used instead is that they provide a second bene fit One of the problems with any efficient subtraction scheme is that it may remove se quences expressed only a few fold higher in one cell population than the other and therefore allow isolation of only those sequences that are not expressed at all in the driver Sequences expressed with lt 10 fold differential may be of great interest and can be isolated by cross sub tractions Suppose that sequence G is present at a ratio of 1 5 in Ao Bo the starting cDNAs If Bo is subtracted with Ao and vice versa G will be removed somewhat from the resulting B however after the reciprocal Ap Bo sub traction relatively more G will be removed from the resulting A than it was from B because the driver Bo had a higher concentra tion of G than Ap did Thus the ratio of G in A B will decrease perhaps to 1 10 This en hanced relative difference in the level of G between A and B will be enhanced even more in subsequent cross subtractions to ultimately allow isolation of G as a differentially ex pressed clone One problem here is that cross subtracting can result in false positives genes that are differe
272. licate ditags Possible Cause Too many cycles of PCR used to reamplify ditags Solution Reduce number of cycles used Increase amount of starting material when making cDNA rSAGE procedure No SAGE tag specific PCR Degraded RNA Use fersh RNA product Error in generation of Reconstruct rSAGE library rSAGE amplified library Poor tag specific primer design Low abundance transcript Multiple SAGE tag specific PCR Multiple splice variants or multiple gene identities for products Redesign primer see Critical Parameters and Troubleshooting Increase the number of amplification cycles Clone all PCR amplicons a given SAGE tag Nonspecific priming Poor sequence quality to incorporate more of the linker sequence to raise the melting temperature of the oligo In the rare case that the SAGE tag in ques tion lies immediately 5 to the polyA tail reverse SAGE may yield no additional infor mation and the PCR product may be too small to adequately visualize on a 1 5 agarose gel Additional troubleshooting guidelines are presented in Table 25B 6 1 Anticipated Results If Basic Protocol 1 is followed closely li braries containing gt 85 inserts with an aver age size of 30 to 50 tags 450 to 750 bp should be routinely generated This should enable one to obtain a SAGE data set of 50 000 tags after 2000 individual sequencing reactions If the above guidelines for rSAGE see Basic Protocol2 are f
273. ller 100 to 300 bp and less intense Note that individual bands sometimes result from concatamerization of the primers and do not necessarily indicate contamination Gene expression analysis on nylon arrays Roche Diagnostics provides an excellent manual with the digoxigenin hybridization kit All relevant information for non radioactive array analysis can be found there A general troubleshooting guide is pre sented in Table 25B 8 6 Anticipated Results After PCR amplification the DNA content of the sample should be measured by following the Support Protocol in unr 2 6 or by optical density an ethidium bromide plate compared with a standard or alternative methods like Nucleic dotMetric Genotech The anticipated amount of cDNA is between 100 and 300 ng ul Before hybridization amplification success is tested by checking the primary product and by gene specific PCR as described Running a gel with the primary PCR product a smear ranging from 100 to 2000 bp without bands should be observed Using single cells some times results in a smaller range A sample with out cellular mRNA should be included through out the whole experiment as a negative control From this sample there should be no apparent smear however sometimes smears can be ob served when the reagents especially enzyme preparations contain nucleic acids Control ling the primary amplification by gene specific PCRs for two housekeeping genes and one constantly
274. ls such as AFLP UNITS 25B 3 amp 258 4 Liang and Pardee 1992 the current unit Hybridization to microarrays of known transcript sequences is an attractive method for high throughput transcript analysis Schena et al 1995 De Risi et al 1997 The amount of data that can be obtained with this technology cannot be matched easily by any other pres ently known transcript analysis method The fast growing number of gene and whole genome sequences creates a valuable resource for probe design for microarrays One of the most attractive applications of the technology to date is the comparative analysis of gene expression between two samples for which the cDNA is differentially labeled Welsh et al 2001 Cross hybridization may pose a prob lem using microarrays primarily because gene families are quite predominant in higher or ganisms however the use of multiple oligonu cleotide probes of individual genes alleviates this problem enabling the design of highly discriminative oligonucleotide sets Wodicka et al 1997 A second category of transcript analysis technologies is represented by the SAGE tech nology Serial Analysis of Gene Expression first described by Velculescu et al 1995 UNIT 25B 6 and the Massive Parallel Signature Se quencing MPSS technology first described by Brenner et al 2000 These technologies gen erate small identifier or signature sequences specific for each transcript in a particular cell or t
275. ly Expressed Genes 25B 5 9 Supplement 57 AFLP Based Transcript Profiling 25B 5 10 Supplement 57 REAGENTS AND SOLUTIONS Use Milli Q purified or double distilled water in all recipes and protocol steps For common stock solutions see APPENDIX 2 for suppliers see APPENDIX 4 Binding buffer 2x 1x 20 mM Tris Cl pH 7 5 APPENDIX 2 150 mM LiCl 1 mM EDTA 4PPENDIX 2 Store up to 6 months at room temperature Dilute to 1x with Milli Q purified or double distilled H O Denaturing polyacrylamide gel 4 5 Prepare 4 5 v v Sequagel ready for use gel mix 19 1 acrylamide methylene bisacryl National Diagnostics in 7 5 M urea Life Technologies 0 5x TBE see recipe at a total volume of 100 ml Add 500 ul of 10 ammonium persulfate APS freshly made just before use and 100 ul of TEMED N N N N tetra methylethylenediamine immediately before casting the gel Cast the gel according to the instructions of the gel system manufacturer using either two 24 well for 48 lane gels or 48 well for 96 lane gels sharkstooth combs to create the gel slots These gels are essentially normal sequencing gels Vos and Kuiper 1998 UNIT 7 6 with the exception that a lower percentage of polyacrylamide is used Ready made solutions should also work well First strand buffer 5x 250 mM Tris Cl pH 8 3 APPENDIX 2 15 mM MgCl 375 mM KCl Store up to 6 months at 20 C Oligonucleotides and double stranded adapters Adapters
276. ly after spreading immerse the smear in 95 ethanol without allowing it to dry Incubate 10 min 3 Transfer to 70 ethanol for 30 sec 4 Proceed to hematoxylin and eosin staining see Basic Protocol 5 PREPARATION OF CYTOLOGIC SPECIMENS FOR LCM CYTOSPIN METHOD Cytospin preparations can be used for any cytologic sample but are preferred for samples of low cellularity Cytospin instrumentation allows cellular fluids to be simultaneously concentrated and placed on a glass slide Using centrifugation these instruments spin cell suspensions onto a microscope slide as the suspension medium is simultaneously ab sorbed by a blotter The result is amonolayer of well preserved well displayed cells within a 6 mm area on the slide Another alternative for samples of low cellularity is to centrifuge the sample decant the supernatant and make a direct smear see Basic Protocol 3 from the sediment Particularly bloody specimens may benefit from the protocol provided below see Alternate Protocol 1 To avoid RNA DNA or protein degradation the cytologic samples should be processed and fixed in 95 ethanol shortly after collection Microdissection after fixation is preferable particularly for RNA analysis Materials Low cellularity sample fine needle aspiration or cultured cells suspended in medium 95 and 70 ethanol Cytospin instrument and appropriate single sample chamber cytospin device e g Shandon Lipshaw Glass slides clean A
277. lymerase Mediated i ere er 75 C Differential y heating for 20 min to Display RMDD 25B 4 4 Supplement 64 Current Protocols in Molecular Biology Purify cDNA 5 Extract with 100 ul phenol equilibrated with TE buffer pH 8 0 Extract again with 100 ul chloroform UNIT 2 1A describes the procedures for phenol chloroform extraction of DNA CAUTION Phenol and chloroform are severe health hazards See UNIT 2 1A for precau tions 6 For size selective PEG precipitation carefully mix 200 ul phenol chloroform extracted ds cDNA 1 0 ul 20 mg ml glycogen 200 ul 28 PEG 8000 3 6 mM MgCl Let the reaction 401 ul total stand at room temperature for 5 min then microcen trifuge for 15 min at maximum speed 10 C Wash pellet carefully with 70 ethanol This precipitation step removes unincorporated cDNA primer as well as small 1 e below 100 nt nucleic acid molecules Since size selective PEG precipitations are susceptible to minor concentration changes it is imperative to adhere to the following guidelines 1 Make sure to pipet exactly 200 ul ds cDNA Vapor pressure of chloroform dissolved in the aqueous phase tends to displace liquid from the pipet tip making accurate pipetting difficult One way to overcome this problem is to repeatedly 5 to 10 times withdraw and expel again 50 to 100 ul of the chloroform saturated aqueous phase before pipetting the required 200 ul thus allowing the pipet to saturate with chloroform vapor
278. lysis Seth Blackshaw Brad St Croix Kornelia Polyak Jae Bum Kim and Li Cai Johns Hopkins University School of Medicine Baltimore Maryland National Cancer Institute Frederick Maryland 3Dana Farber Cancer Institute Boston Massachusetts Brigham and Women s Hospital Boston Massachusetts Rutgers University Piscataway New Jersey ABSTRACT Serial analysis of gene expression SAGE involves the generation of short fragments of DNA or tags from a defined point in the sequence of all cDNAs in the sample analyzed This short tag because of its presence in a defined point in the sequence is typically sufficient to uniquely identify every transcript in the sample SAGE allows one to generate a comprehensive profile of gene expression in any sample desired from as little as 100 000 cells or 1 ug of total RNA SAGE generates absolute rather than relative measurements of RNA abundance levels and this fact allows an investigator to readily and reliably compare data to those produced by other laboratories making the SAGE data set increasingly useful as more data is generated and shared Software tools have also been specifically adapted for SAGE tags to allow cluster analysis of both public and user generated data Curr Protoc Mol Biol 80 25B 6 1 25B 6 39 2007 by John Wiley amp Sons Inc Keywords Genomics e mRNA e expression profiling e DNA sequencing INTRODUCTION This unit provides a protocol for perfo
279. meters given in this protocol are optimized however other sequencing gel systems should also work well Using 1x TBE as the running buffer prerun gels 0 5 hr just before loading the samples under appropriate conditions to heat the gel to 55 C e g 110 W limit for the BioRad system Use a gel thermometer to monitor temperature Maintaining this temperature throughout the electrophoresis is crucial for good quality fingerprints Load either 3 ul for 48 lane gels or 1 5 ul for 96 lane gels of sample into each well and analyze at 55 C Include a molecular weight standard e g SequaMark 10 base ladder if desired After electrophoresis disassemble the gel cassette Fix the gel which will stick to the front glass plate because of the silane treatments by soaking in 10 acetic acid for 30 min Rinse thoroughly with water and dry 10 to 20 hr at room temperature in a fume hood or for a shorter time period at an elevated temperature e g using an incubator CAUTION Radioactive materials require special handling See APPENDIX IF and the institutional Radiation Safety Office for guidelines concerning proper handling and disposal Gel is dry when it is no longer sticky Visualize gel fractionated cDNA AFLP fragments by autoradiography or using a phosphorimager APPENDIX 3A Exposure times are reduced at least 2 5 fold using phosphorimaging technology Current Protocols in Molecular Biology Discovery of Differential
280. mplification 1 1 16 combinations The third step entails two selective nucleotides at each primer selective amplification 2 2 256 combinations NOTE All solutions and materials coming into contact with RNA must be RNase free and proper techniques should be used accordingly see APPENDIX 2 AFLP Based NOTE AFLP is a registered trademark of Keygene N V and is protected by patents and eae patent applications of Keygene N V 25B 5 2 Supplement 57 Current Protocols in Molecular Biology Materials Total RNA UNIT 4 2 or equivalent 5 biotinylated oligo dT 5 biotin dT 5 1x and 2x binding buffer see recipe H O Milli Q purified 1 e water deionized by passage through a five stage Milli Q Plus system Millipore or double distilled Streptavidin coated magnetic beads Dynal Wash buffer see recipe 2 mM EDTA pH 7 5 5x first strand buffer see recipe 5x second strand buffer see recipe 0 1 M DTT APPENDIX 2 5 and 10 mM each mixture of all 4 dNTPs Pharmacia or UNIT 3 4 SuperScript H Life Technologies E coli DNA ligase Life Technologies E coli DNA polymerase I Pharmacia Biotech RNase H Pharmacia Biotech 2x and 1x STEX see recipe 10 mM Tris Cl pH 8 0 0 1 mM EDTA APPENDIX 2 Taql restriction endonuclease New England Biolabs UNIT 3 1 5x RL buffer see recipe MselI restriction endonuclease New England Biolabs UNIT 3 1 50 pmol ul Taql adapter top and bottom strands see recipe for
281. n fragments of cDNAs Proc Natl Acad Sci U S A 93 659 663 Shimkets R A Lowe D G Tai J T Sehl P Jin H Yang R Predki P F Rothberg B E Mur tha M T Roth M E Shenoy S G Windemuth A Simpson J W Simons J F Daley M P Gold S A McKenna M P Hillan K Went G T and Rothberg J M 1999 Gene expression analysis by transcript profiling coupled to a gene database query Nature Biotechnol 17 798 803 Sutcliffe J G Foye P E Erlander M G Hilbush B S Bodzin L J Durham J T and Hassle K W 2000 TOGA An automated parsing tech nology for analyzing expression of nearly all genes Proc Natl Acad Sci U S A 97 1976 1981 Trentmann S M 1995 Alternatives to S as a label for the differential display of eucaryotic messen ger RNA Science 267 1186 Welsh J Chada K Dalal S S Cheng R Ralph D and McClelland M 1992 Arbitrarily primed PCR fingerprinting of RNA Nucl Acids Res 20 4965 4970 Zhao S Ooi S L and Pardee A B 1995 New primer strategy improves precision of differen tial display Biotechniques 18 842 846 848 850 Contributed by Achim Fischer F Hoffmann La Roche AG Basel Switzerland Discovery of Differentially Expressed Genes 25B 4 17 Supplement 56 AFLP Based Transcript Profiling In recent years several techniques have been developed to analyze the transcriptome 1 e the entirety of transcripts present in a cell
282. n restriction enzyme step 1 in a total volume of 200 ul Bring volume of digested product up to 400 ul with water Extract and ethanol precipitate as described step 2 Resuspend DNA pellet at 0 1 ug ul in TE buffer Take 10 ul 1 ug DNA solution and directly ligate to primer set E in a volume of 30 ul as described in steps 4 to 6 Changing primer sets between each round of RDA ensures that selective subtractive kinetic enrichment of unique tester DNA restriction fragments will occur from newly ligated primer and not from uncleaved primer carried over from the previous rounds Dilute the ligated difference product to 1 25 ng ul with TE buffer For HindIII representation dilute to 2 5 ng ul with TE buffer Always ligate I ug tester then serially dilute the ligation product to a concentration such that 40 ul will give the appropriate amount of tester for the selected tester driver hybridi zation ratio Perform subsequent subtractive kinetic enrichment steps 53 54 55 56 For a second subtractive kinetic enrichment mix 40 ul 50 ng adapter ligated difference product 100 ng for HindIII representation and 80 ul 40 ug of driver amplicon DNA digest Proceed through subtractive kinetic enrichment exactly as outlined in steps 28 to 51 except substitute E for O primers oligomers and dilute the ligated difference product to 2 5 pg ul 10 pg ul for HindIII representation The second hybridization is done at a tester driver r
283. n the preparation is associated with the bead and that no free DNase activity can be detected as any free DNase could enter the cell and destroy the intracellular DNA To test this the immobilized DNase in activation buffer is pelleted gently as detailed by the manufacturer and an aliquot of the supernatant is drawn off and placed in a 1 5 ml microcentrifuge tube The supernatant is then spiked with intact plasmid DNA of known size and incubated for hr at 37 C Agarose gel electrophoresis UNIT 2 5A is then used to evaluate integrity of DNA incubated with and without supernatant The supernatant treated DNA should show no evidence of degradation When aliquoting cells at the single cell level many of the tubes contain no cells Some of these samples as well as samples spiked with HSV DNA are utilized as controls to test the completeness of the DNase treatment see Critical Parameters and Troubleshooting The ability of the immobilized DNase to eliminate potential contamination should be deter mined by spiking a sample with the DNA sequence being amplified It is important to spike the sample with an amount of DNA that would reflect anticipated levels of contamination With proper technique these levels should be extremely low and not present in every cell eee sample The DNase step is an important safeguard but not a solution for poor technique Expressed Genes 25A 2 9 Current Protocols in Molecular Biology Supplement 66 BA
284. n the sample and upon procurement of at least the minimum number of cells required for analysis The number of cells captured depends on tissue thickness and type the size of the cells and the size of the laser spot The number of cells procured can be estimated by counting the number of cells per spot and multiplying by the number of pulses of the laser The transfer efficiency of the capture should also be consid ered and can be assessed by viewing the cap tured tissue on the cap and estimating the per centage of spots that contain tissue The number of cells required depends on the assay and whether formalin fixed alcohol fixed or frozen samples are used A single PCR reaction DNA analysis can be successfully performed with a single cell however results are more reliable with at least 10 to 20 cells from a 10 um thick formalin fixed paraffin embedded section Such small quantities of cells may not account for the significant het erogeneity that exists even within populations of the same cell type which should be consid ered when determining the number of cells to be used For RNA analysis fresh frozen tissues and cytologic specimens briefly fixed in alco hol are preferred Only a small number of cells 1 e lt 50 may be required for transcripts of high copy number per cell when utilizing RT PCR however the authors prefer using 21000 cells for RT PCR cDNA arrays require signifi cantly more RNA but how much will
285. ncentrates on the amplification procedure see Basic Protocol 1 and less on the cDNA array hybridization However a basic protocol see Basic Protocol 2 for array hybridization on nylon filters is provided because such filters are available in every laboratory without the need of additional expensive equipment As tissue samples contain many different cell types in variable amounts their analysis often requires microdissection of the tissue to isolate the specific cell types Therefore additional information on how to isolate mRNA from very small tissue samples such as biopsies and laser microdissected material from cryosections see Alternate Protocols and 2 is given Finally a simple procedure to prepare the data for statistical analysis is also provided see Basic Protocol 3 STRATEGIC PLANNING This unit deals with the handling of minute amounts of mRNA Therefore two natural foes contamination and RNA degrading enzymes RNases see UNIT 4 1 for additional details will be encountered Contamination can be reduced by working under a laminar flow clean bench that has never been exposed to PCR amplified DNA or cloned DNA and that is preferably located in a room apart from laboratories where DNA is handled It is recommended to always use filter tips for solutions and to take care not to contaminate pipets or other devices with DNA from other rooms Unfortunately contamination might still occur since many enzymes in particular rev
286. nd cDNA probes are prepared by radiolabeling some of the and cDNA saved from step 10 Most clones should hybridize with the probe and few with the probe Evaluation by screening the library with a probe for proteins such as actin or tubulin would not be appropriate since the expected result is no hybridization or only a few which may occur for a variety of reasons Discovery of Differentially Expressed Genes 25B 1 5 Current Protocols in Molecular Biology Supplement 58 Production of a Subtracted cDNA Library 25B 1 6 Supplement 58 REAGENTS AND SOLUTIONS Use deionized distilled water in all recipes and protocol steps For common stock solutions see APPENDIX 2 for suppliers see APPENDIX 4 I M NaPO pH 7 0 A 1 M Na HPO B 1 M NaH PO Add B to A until pH 7 0 COMMENTARY Background Information The practical consequence of creating a sub traction library is considerable enrichment of the target cDNA clones For example a sub tracted cDNA library was used to isolate T cell antigen receptor cDNAs By hybridizing T cell cDNA to B cell mRNA and selecting the sin gle stranded cDNA molecules by hydroxylapa tite column chromatography the T cell antigen receptor cDNAs were significantly enriched The cDNA was then hybridized back with the T cell mRNA from which it was derived and the double stranded RNA DNA hybrids were selected carried through second strand cDNA synthesis and
287. ne rinse may help While other staining protocols can be used the slides should be dehydrated with graded alcohols and the final xylene step LASER CAPTURE MICRODISSECTION The described procedure is for the PixCell I or If Laser Capture Microdissection System and assumes a general knowledge of the function of the components of the instrument and the software that accompanies the instrument The general theory underlying the use of the instrument is discussed elsewhere see Background Information The procedure can be divided into three basic steps slide positioning microdissecting with the laser and collecting the microdissected cells Additional information about the Arcturus LCM software including capturing and storing images and additional instruction for LCM can be found in the instrument users manual and at the Arcturus Engineering web site http www arctur com the National Institute of Environmental Health Sciences web site http dir niehs nith gov or from Arcturus technical support 650 962 3020 Materials Glass slide with stained specimen see Basic Protocol 5 Appropriate lysis buffer e g DNA lysis buffer protein lysis buffer see recipes PixCell I or II Laser Capture Microdissection System Arcturus Engineering Arcturus LCM software Arcturus Engineering optional CapSure transfer film Arcturus Engineering 0 5 ml microcentrifuge tubes Eppendorf NOTE Wear gloves when microdissecting to avoid contamin
288. ng 15 min at 70 C After this time add 0 25 ul of 8 pmol ul 2 pmol total reverse transcriptase primer and incubate an additional 10 min at 70 C 5 Reduce temperature to 50 C and add 3 5 ul reverse transcription reaction mix followed by an additional 0 25 ul of 40 mM PMSF and 0 25 ul of 200 U ul 50 U SuperScript II reverse transcriptase Incubate 60 min at 50 C If the transcripts are to be detected are unspliced samples are set up in multiples half of which receive no reverse transcriptase In additional controls RNase is included with the DNase step 3 6 After 60 min increase temperature to 70 C for 15 min Add 5 to 4 of the cDNA sample to 47 ul PCR reaction buffer and heat 5 min at 94 C Current Protocols in Molecular Biology Discovery of Differentially Expressed Genes 25A 2 11 Supplement 58 Preparation of Single Cells from Solid Tissues for Analysis by PCR 25A 2 12 Supplement 58 7 Reduce the temperature to 5 C above the annealing temperature UNIT 15 1 and add 1 25 U Taq DNA polymerase to each sample 50 ul total 8 Analyze amplification products as described above see Basic Protocol 2 steps 9 and 10 The usefulness of the RT PCR assay for quantification at the single cell level has not been fully explored Using primers to specific HSV genes the reverse transcription reaction lacked the sensitivity required to detect the very low levels of these transcripts anticipated during viral
289. ng sure to load the whole gel within 10 min Although 48 well combs are available as well no satisfactory results could be obtained with them in the authors laboratory Do not use the first and the last slot of a gel since the corresponding lanes easily run off the membrane due to imprecise membrane alignment prior to the run Start electrophoresis with the same parameters used for prerunning After 45 to 50 min start the conveyor belt with an initial speed of 16 cm hr linearly decreasing to 10 cm hr The continuous decrease in conveyor belt speed i e in the blotting membrane feed rate compensates for the nonlinear mobility of differently sized DNA molecules The chosen parameters yield an approximate equidistant spacing of bands of different size e g the Current Protocols in Molecular Biology distance between a 100 and a 150 bp band is roughly the same as the distance between a 400 and a 450 bp band At the end of the run the conveyor belt and membrane are wound up to the back roller The membrane can be left wound up for drying overnight Alternatively it can be removed and hung up in a dust free space Ifa size marker is desired biotinylated Sequamark 10 bp ladder Research Genetics turns out to be optimal This marker provides an accurate and easily identifiable standard for DNA fragments up to 500 bp however 5 to 10 fold concentration of the marker by precipitation is necessary to obtain sufficient sensiti
290. ning of the library see Commentary Remove EcoRI ends from DNA 11 Remove the EcoRI ends from the DNA by mixing in the following order final volume 112 ul 100 ul insert DNA 10 to 15 ug 11 ul 10x S1 nuclease buffer 1 ul 1 500 S1 nuclease 2 U Mix by vortexing briefly microcentrifuge and incubate 30 min at 37 C Discovery of Differentially Expressed Genes 25B 1 3 Current Protocols in Molecular Biology Supplement 55 Production of a Subtracted cDNA Library 25B 1 4 Supplement 55 12 Stop the reaction by adding 5 ul 0 5 M EDTA pH 8 0 200 ul TE buffer 300 ul phenol chloroform isoamy alcohol Vortex Microcentrifuge min to separate the phases and transfer the upper aqueous phase to a new tube Add 30 ul of 3 M sodium acetate pH 5 2 and 700 ul ethanol Freeze then collect the DNA by centrifugation as in steps 7 and 8 Resuspend the washed and dried pellet in 100 ul TE buffer Digest the DNA with Alul and Rsal 13 14 ies Digest the S1 nuclease treated insert DNA to small fragments with Alul and Rsal by adding in the following order final volume 121 ul 100 ul insert DNA 10 to 15 ug 12 ul 10x Alul buffer 5 ul Alul 50 U 4 ul Rsal 60 U Mix by vortexing briefly microcentrifuge and incubate 3 hr at 37 C Add 5 ul of 0 5 M EDTA pH 8 0 and incubate 10 min at 65 C to stop the reaction Remove and save 5 ul of the digest for evaluat
291. nome Res 15 603 615 Hartigan J 1975 Clustering Algorithms John Wiley amp Sons New York Hosack D A Dennis G Jr Sherman B T Lane H C and Lempicki R A 2003 Identifying bio logical themes within lists of genes with EASE Genome Biol 4 R70 Klimaschewski L Tang S Vitolo O V Weissman T A Donlin L T Shelanski M L and Greene L A 2000 Identification of di verse nerve growth factor regulated genes by serial analysis of gene expression SAGE pro filing Proc Natl Acad Sci U S A 97 10424 10429 Lepourcelet M Tou L Cai L Sawada J Lazar A J Glickman J N Williamson J A Everett A D Redston M Fox E A Nakatani Y and Shivdasani R A 2005 Insights into develop mental mechanisms and cancers in the mam malian intestine derived from serial analysis of gene expression and study of the hepatoma derived growth factor HDGF Development 132 415 427 Neilson L Andalibi A Kang D Coutifaris C Strauss J F 3rd Stanton J A and Green D P 2000 Molecular phenotype of the human oocyte by PCR SAGE Genomics 63 13 24 Polyak K Xia Y Zweier J L Kinzler K and Vogelstein B 1997 A model for p53 induced apoptosis Nature 389 300 305 St Croix B Rago C Velculescu V Traverso G Romans K E Montgomery E Lal A Riggins G J Lengauer C Vogelstein B and Kinzler K W 2000 Genes expressed in human tumor endothelium Sci
292. ns at each subtraction should be determined to pro vide an immediate and fairly accurate way of determining whether a particular subtraction has been successful and whether the subtraction should be repeated Second the degree to which A and B cross hybridize can be moni tored by slot blotting cDNAs from each step of subtraction and probing the blots with the last set of subtracted cDNAs A and B Subtractions are generally stopped when a probe made from A hybridizes to the A cDNA pool 20 fold better than it does to the B pool and vice versa Third the removal or enrichment of a known differentially ex pressed gene in Ap through A can be moni tored by slot blot hybridization If no such gene is available then the original tracer may be spiked with some DNA such as B galactosi dase which can be removed at the end Fourth if the subtractions are working common abun dant sequences should be progressively re moved with each subtraction Anticipated Results The end result of the procedure is the isola tion of fragments of differentially expressed genes The actual number of such genes ob tained depends on the tissues being compared Hence if the two starting tissues are of very similar complexity only a few genes may be obtained On the other hand if the tissues being compared contain a mixture of cell types and are very different it is easily possible to obtain hundreds of differentially expressed genes Abundant
293. nt The following tailing and PCR procedure will take place with the beads in the tube 11 Add 10 to 15 U TdT mix thoroughly and start tailing in a thermal cycler programmed for 60 min at 37 C then 22 C indefinitely Tailing is complete after I hr but can be extended overnight at 22 C whenever necessary 12 Inactivate TdT by incubating cDNA at 70 C for 5 min Amplify by PCR 13 Prepare PCR mix I and II on ice see Table 25B 8 4 14 After inactivation of TdT add PCR mix I to the aqueous phase under the mineral oil Incubate for 30 sec at 78 C 15 Add 5 5 ul mix II then carry out the amplifications in a thermal cycler with the following parameters 1 cycle 30 sec 78 C 19 cycles 15 sec 94 C 30 sec 65 C 2 min 68 C Gene Expression Analysis of continued A Single or Few Cells 25B 8 6 Supplement 63 Current Protocols in Molecular Biology 20 cycles 15 sec 94 C 30 sec 65 C 2 5 min 10 sec cycle 68 C 1 cycle 7 min 68 C indefinitely 4 C The separation of mix I and II serves for the hot start procedure Add the largest solution volume first which consists of buffer and water After 78 C has been reached add the primers nucleotides and enzymes Taq long template is one of several available mixtures ofa highly processive DNA polymerase Taq polymerase and a proof reading enzyme with 3 5 exonuclease activity Pwo polymerase The exonuclease activity would degrade the single stranded CP2 primer in
294. ntations made with most six cutters or 1 ug for HindIII representation The first hybridization is done at a tester driver ratio of 1 100 29 Extract once with 120 ul phenol chloroform isoamyl alcohol 30 Ethanol precipitate DNA with ammonium acetate as follows Add 30 ul of 10 M ammonium acetate and mix by pipetting Add 300 ul 2 vol ice cold 100 ethanol Add 1 ul 20 ug glycogen and mix by inverting Chill 10 min at 70 C Microcentrifuge 20 min at 13 000 rpm room temperature Carefully remove the supernatant Wash the pellet with 1 ml room temperature 70 ethanol ms 7 mo aoao goo Dry pellet 31 Add 4 ul EE x 3 hybridization buffer to the pellet Resuspend by pipetting incubate 5 min at 37 C vortex 2 min and then microcentrifuge at maximum speed to collect the sample at the bottom 32 Transfer resuspended DNA to a PCR tube In another PCR tube add 1 ul of 5 M NaCl Place both tubes in a thermal cycler preheated to 95 C and incubate min Centrifuge the tubes briefly to collect the contents at the bottom and immediately transfer the denatured DNA to the tube containing NaCl Mix well by pipetting and overlay with 35 ul mineral oil 33 Incubate the tube containing DNA and NaCl in the thermal cycler for an additional 4 min at 95 C to ensure that all DNA species are denatured 34 Set the thermal cycler to hold gt 20 hr at 67 C Incubate at least 18 but not more than 48 hr to allow the DNA
295. ntially represented in the final A and B cDNA populations but not in the starting Ay and By cDNAs This is a particular problem if the efficiences of the two subtraction series A B versus B A are different but it can easily be checked after subtraction by ask ing whether a clone is differentially represented in the Ap and Bo starting cDNAs This protocol includes two modifications to the Wang and Brown 1991 method that the authors feel improve it First bio 11 dUTP is Discovery of Differentially Expressed Genes 25B 2 15 Supplement 64 PCR Based Subtractive cDNA Cloning 25B 2 16 Supplement 64 incorporated into the driver as a means of biot inylating Patel and Sive unpub observ in place of the photobiotinylation originally de scribed Sive and St John 1988 for two rea sons Incorporation of biotin during PCR am plification is extremely simple and does not require additional photobiotinylation steps Substituting 30 of the dTTP with bio 11 dUTP in the amplification of driver nucleic acid gives maximal subtraction efficiency With lower substitution subtraction efficiency de creases presumably because the density of bio tin is not great enough with greater substitu tion subtraction efficiency also decreases pre sumably because the biotin intereferes with base pairing Patel and Sive unpub observ Photobiotinylated nucleic acid is rather insol uble in aqueous solutions due to a
296. o determine transformation efficiency add 1 ul of 0 01 ng ul pUC19 control DNA to a tube labelled control Use 1 ul ofthe DNA for this transfection The remainder of the sample is stored at 20 C 73 Remove DH10B Electromax competent cells from 70 C and thaw on wet ice When cells are thawed mix cells by tapping gently 74 Add 40 ul competent cells to each chilled 1 5 ml microcentrifuge tube containing DNA Refreeze any unused cells in a dry ice methanol bath for 5 min before returning to 70 C 75 Pipet 40 ul of the cell DNA mixture into a prechilled disposable microelectropo ration cuvette step 70 Perform electroporation with the Bio Rad Gene Pulser electroporator at 100 2 25 uF 1 8 kV 76 Transfer electroporated cells into a 15 ml culture tube and immediately add 1 0 ml SOC medium at room temperature Shake 15 min at 225 rpm 37 C The incubation time is short because in theory the postelectroporation incubation period is required for expression of the antibiotic resistance gene hence increasing transforma tion efficiency However given that the doubling time of the bacteria is 20 min it is possible that the transformed bacteria may double during the incubation period po tentially skewing the library s representation of tags With 15 min incubation prior to plating the authors found the transformation efficiency to be 1 0 x 10 cfulug pUC19 respectable when compared with the l hr incubation recommende
297. oated slides work well for LCM of frozen sections in their laboratory It is best to begin with plain uncoated slides and if tissue sections do not adhere well enough to allow staining to try charged or silanized slides Adhesives such as Sta On Surgipath can be applied directly to the slides or gelatin or can be added to the water bath during histologic sectioning however these may limit the transfer efficiency of LCM It is important to mount the tissue as close to the center of the slide as possible If the tissue is too far off center the slide cannot be positioned so that the vacuum slide holder can function during microdissection If sections are particularly friable and thus difficult to cut the tissue may be too cold therefore the time allowed for the block to equilibrate to 20 C may need to be extended Sections should be without folds and lie as flat as possible on the slides Sections with gt 10 um thickness are difficult to visualize The authors prefer sections of 5 to 6 um thickness Thicker sections will require a larger spot size and therefore a higher laser energy level 9 Keep the slides in the cryostat or on dry ice if LCM is to be performed that day Alternatively store in slide boxes at 80 C until needed The duration of preservation of RNA and protein in frozen sections at 80 C is not well documented and likely depends on the tissue and the desired analyte Although storage over several weeks or ev
298. ocks or equivalent 96 well PCR plates 50 ml conical tubes Tabletop centrifuge with swinging bucket rotor Gel loading tips UV box and SYBR green or UV filter 0 5 ml microcentrifuge tubes with 0 5 mm holes in the bottom pierce from the inside out with a 21 G needle Spin X centrifuge tube filters Costar Long wavelength UV source 0 1 mm disposable microelectroporation cuvettes Bio Rad Gene Pulser electroporator Bio Rad or equivalent 15 ml culture tubes Additional reagents and equipment for determining integrity of cDNA by PCR see Support Protocol 1 optimizing ditag PCR conditions see Support Protocol 2 agarose gel electrophoresis UNIT 2 54 ethanol precipitation UNIT 2 A polyacrylamide gel electrophoresis UNIT 2 7 and direct sequencing of PCR products UNIT 15 2 NOTE Prepare Dynabeads washing solutions and 5x first strand mix before thawing and collecting cells Prepare mRNA and synthesize cDNA 1 Thoroughly resuspend Dynabeads oligo dT 25 transfer 100 ul to a 1 5 ml RNase free siliconized No stick microcentrifuge tube and place on a magnetic rack After 30 sec remove supernatant This volume of beads is much more than needed but permits easy handling When removing the supernatant always place the pipet tip at the opposite side of the tube push the pipet tip to the bottom and pipet very slowly so as not to disturb the beads Current Protocols in Molecular Biology 2 Resuspend beads in 50
299. ocol The authors have most frequently ob served problems with the Nlalll enzyme and the linkers Always store Nlalll in aliquots at 80 C do not reuse aliquots and try to have the enzyme shipped on dry ice if possible The authors order linkers prekinased but always check via self ligation to ensure that a suffi ciently large fraction of the linkers is properly phosphorylated rSAGE For the rsAGE procedure much depends on the quality of RNA used in the sample It would be best to use the same batch of RNA that was originally used to construct the SAGE library As most interesting SAGE tags are those that are expressed in abundance in one RNA sample and not in another it is advis able to make a reverse SAGE library of such a control tissue It is not uncommon to gen erate multiple PCR bands from a tag specific rSAGE amplification Identifying a PCR prod uct that is specific to the experimental rsAGE library and not present or less apparent in the control would help in the cloning and identifi cation process The most technically challenging aspect of reverse cloning SAGE tags is the PCR of a specific cDNA with the tag specific primer The rSAGE amplified library used as a tem plate for this PCR reaction consists solely of 3 cDNA ends which have the linker2 SAGE tag on the 5 end and a oligo dT M13 forward sequence on the 3 end The PCR of a specific product is difficult when the reverse primer M13 Forward anneal
300. ocol helps distinguish between driver and tester samples to avoid confusion and cross contamination of DNA 5 Place tubes in a thermal cycler at 55 C Program the thermal cycler to decrease the temperature to 4 C over 1 hr Slow annealing allows the 12 and 24 mers to form a temporary bridging complex with cohesive ends complementary to the restriction sites on the ends of the digested DNAS The Perkin Elmer Model 480 is preferred because of its larger tube capacity but any 96 well thermal cycler may also be used Current Protocols in Molecular Biology Discovery of Differentially Expressed Genes 25B 7 3 Supplement 60 Representational Difference Analysis 25B 7 4 Supplement 60 6 ke Add 1 ul of 400 U ul T4 DNA ligase mix by gentle pipetting and incubate 12 to 16 hr at 14 C This step results in ligation of the 24 mers onto the 5 ends of the DNAs The temperature used is below the T of the four base duplexes formed by the overhanging ends Transfer ligation product to 1 5 ml microcentrifuge tubes matching the colors used above step 4 Dilute adapter ligated tester and driver DNA to ng ul by adding 970 ul TE buffer PCR amplify driver and tester amplicons 8 9 10 Prepare two tubes of PCR mix for preparation of tester amplicon and twelve tubes for driver amplicon each containing 240 ul water 80 ul 5x RDA PCR buffer 32 ul dNTP Chase solution 8 ul 24 mer oligonucleotide R pr
301. ogy Isolate ditags 30 31 32 33 34 29 36 37 38 39 40 4l Pool PCR reactions into a 50 ml conical tube adjusting volume to 11 5 ml with LoTE buffer then extract with an equal volume of PC8 Precipitate with ethanol as follows 11 5 ml samples 10 ul SeeDNA 100 ul 20 mg ml glycogen 5 1 ml 7 5 M ammonium acetate 38 3 ml 100 ethanol Place in a dry ice methanol bath for 15 min Thaw 2 min at room temperature to fully melt the solution Vortex briefly and centrifuge 30 min in a tabletop centrifuge with swinging bucket rotor at 3000 x g 4000 rpm room temperature Wash with 5 ml of 70 ethanol vortex and centrifuge an additional 5 min at 3000 x g room temperature Resuspend pellet in 216 ul LoTE buffer and add 54 ul of 5x loading buffer 270 ul total Using gel loading pipet tips load 10 ul sample into each of 27 lanes on each of three prepoured 20 polyacrylamide TBE minigels Include 10 ul of a 20 bp ladder on each gel as a marker It is critical not to overload the gel wells as this can lead to linker contamination and poor separation of products Electrophorese 90 min at 160 V The optimal distance for electrophoresis is 1 cm above the bottom of the gel The idea is to obtain maximum separation of the 102 ditags and 80 bp bands linker linker dimers without allowing product to get too close to the edge of the gel Depending on the apparatus and batch of TBE buffe
302. ogy grade DNase free Agtl10 phosphatased arms and packaging extracts should be obtained com mercially unless large volume use is antici pated in which case homemade arms and extracts would be more economical Troubleshooting The initial EcoRI digestion the sucrose gra dients and the Alul and Rsal digestion of DNA are monitored by minigel electrophore sis If difficulties such as incomplete digestion or poor separation occur here see the commen taries of UNITS 3 1 amp 5 3 Poor recovery of DNA is usually not a problem since at least 10 ug of DNA is present at each precipitation Once beyond these steps there is no method for evaluation short of determining the titer and composition of the subtracted library Possible adverse outcomes include too few clones too many clones or no enrichment for clones see Anticipated Results When too few clones are obtained check the gt10 phage arms packaging extracts and host bacteria by cloning a test insert If gt 1 x 10 PFU ug test insert are obtained the problem may be that the EcoRI ends of the cDNA have been destroyed or there is an inhibitor of one of the later steps present in the DNA Evaluate these possibilities by cloning DNA after the sucrose step and measuring the effi ciency and by cloning a test insert with and without post hybridization DNA added to the test insert ligation If too many clones are obtained the problem is usually contam
303. ol 5 Dissolve RNA pellet in 20 ul DEPC treated water and quantitate the RNA concen tration accurately by measuring the A with a spectrophotometer APPENDIX 3D DNA free RNA should be stored at a concentration gt 1 ug ul It should not be diluted to the working concentration until immediately before reverse transcription Diluted RNA should not be reused for differential display as diluted RNA is very unstable during storage and repeated freezing and thawing 6 Check the integrity of the RNA to be used for differential display by performing agarose formaldehyde gel electrophoresis UNIT 4 9 on 3 Ug of cleaned RNA Store DNA free RNA at 80 C until used for differential display For undegraded total RNA the 28S and 18S ribosomal RNAs should be clearly visible by ethidium bromide staining Reverse transcribe RNA 7 For each RNA sample label four microcentrifuge tubes G A T and C one tube for each degenerate anchored oligo dT primer set 8 Dilute 1 ug DNA free RNA step 5 to 0 1 ug ul in DEPC treated water and place on ice Current Protocols in Molecular Biology Discovery of Differentially Expressed Genes 25B 3 3 Supplement 56 9 Set up reverse transcription of DNA free total RNA or poly A RNA with each of four different degenerate anchored oligo dT primer sets 5 T MN 3 T MG TMA T MT and T MC where M is G A or C as follows 4 ul 5x MoMuLYV reverse transcriptase buffer 1x final 2 u
304. old temperatures to allow for the gradual penetration of plant tissues rapid infiltration of chemical fixatives may shock plant tissues introducing structural and anatomical artifacts due to cellular disruption Infiltration and embedding media As described above for chemical fixation infiltration of plant tissues must also be carried out gradually sudden and drastic changes in chemical environments may generate extreme tissue anomalies reviewed in Ruzin 1999 Although this unit describes paraffin embed ding a number of plant LM studies have uti lized fresh frozen cryo embedded and cryo sectioned plant tissues Asano et al 2002 Nakazono et al 2003 Casson et al 2005 Schad et al 2005 Several studies have re ported improved yields of RNA extracted from cryo sectioned tissues compared to paraffin embedded samples Goldsworthy et al 1999 Gillespie et al 2002 however fast freezing can cause vacuolar ruptures and wholesale anatomical disruptions that may prohibit the accurate microdissection of fine scale plant tissue domains Thus despite the slight reduc tion in RNA yield many researchers opt for the superior histological resolution obtained in paraffin sectioned samples RNA extraction Tissue specific results A number of commercially available RNA extraction kits are suitable for the isolation of minute concentrations of total RNA from microdissected plant cells and are not indi vidually evaluated he
305. ollowed one should be able to clone the cDNA usually 75 to 400 bp from which a given SAGE tag is generated This cDNA fragment would stretch from the 3 most anchoring enzyme site Construct a control rSAGE library and select amplicons not present in control library Start the PCR touchdown cycles at a higher temperature Use of M13 forward primer Use another universal primer for cycle sequencing on the pCR vector for sequencing e g M13 reverse T3 T7 to the poly A tail The additional sequence data can be used to BLAST genome databases UNIT 19 3 or be used to generate primers for 5 RACE UNIT 15 6 The cloned fragment may also be used for northern analyses UNIT 4 9 or in situ hybridizations UNIT 14 3 Time Considerations MicroSAGE The time typically taken for RNA prepara tion through BsmFI digestion is 10 to 14 hr Blunt ending and ditag ditag ligation take 2 to 3 hr Ditag amplification and PCR optimiza tion take 2 to 3 hr and large scale ditag am plification and purification take 6 to 8 hr day for 2 days Ditag digestion and purification take 6 to 8 hr Concatemer formation purifica tion and subcloning take 6 to 8 hr Template cleanup and transformation take 4 to 6 hr PCR of library clones and gel analysis take 4 to 5 hr If a high quality SAGE library is produced it will require 2000 sequencing reactions to obtain 50 000 tags This will take anywhere Current Protocols in Molecular Biology f
306. olyacrylamide gels Also the reaction products are less prone to degradation due to autoradiolysis Only the TaqI primers should be labeled Labeling both the TaqI and Msel primers causes each of the two strands of the AFLP fragments to be visualized on the gels often causing doublets when these two strands migrate differently on the gel Perform selective AFLP amplification using labeled Taqi 2 and Msel 2 primers 25 Dilute 2 ul of each selective preamplification product 1 1 step 22 500 fold with Tris Cl pH 8 0 0 1 M EDTA Prepare selective amplification 2 2 reactions in a microtiter plate for a PE 9600 thermocycler in the following way a Dispense 2 ul of 1 500 preamplification mixture TagI A MselI C in the first two columns of the microtiter plate Dispense 0 5 ul labeled JagI AA primer into each of wells Al to D1 0 5 ul labeled Tag AC primer into each of wells E1 to H1 0 5 ul labeled TagI AG primer into each of wells A2 to D2 and 0 5 ul labeled JagI AT primer into each of wells E2 to H2 Dispense 0 6 ul unlabeled MseI CA primer into each of wells Al A2 El and E2 0 6 ul unlabeled MseI CC primer into each of wells B1 B2 F1 and F2 0 6 ul unlabeled MseI CA primer into each of wells Al A2 El and E2 0 6 ul unlabeled MseI CG primer into each of wells C1 C2 G1 and G2 and 0 6 ul unlabeled MseI CT primer into each of wells D1 D2 H1 and H2 Prepare dNTP polymerase mixture by combining 12 8 ul
307. om similar samples should very closely resemble each other with only very few if any differences Within these patterns band inten sities correlate with the original relative fre quencies of the template cDNAs This is due to the fact that in complex PCR reactions 1 e with more than one amplification product en try into plateau phase of amplification freezes the different amounts of synthesized products McClelland and Welsh 1994 therefore if a particular cDNA is present at different amounts in the two samples the resulting bands will show different intensities on the RMDD mem brane Differences in expression levels at least down to 2 fold will be detectable In one in stance a band that was shown by quantitative PCR to represent a gene down regulated 1 4 fold was isolated in the authors laboratory This is especially significant as the gold standard in transcription profiling is usually set at 2 fold up or down regulation therefore the fact that RMDD allows isolation of transcripts regulated to a lower degree which still can be of the highest biological relevance e g gradients in developmental biology clearly contributes to its usefulness Current Protocols in Molecular Biology Time Considerations When starting with up to six samples of precipitated RNA the protocol including sec ond round amplification with a subset of all primer combinations can be performed within two days including an overnig
308. ombines PCR mediated kinetic enrichment with subtractive hybridization to generate 0 2 to 2 kbp sequences that are distinct to genomic DNA or mRNA in one cell type versus another These can then be cloned and sequenced or otherwise analyzed UNIT 25B 8 describes a protocol in which both PCR and reverse transcription have been optimized to permit the detection and semi quantitative analysis of transcripts from single cells small tissue biopsies and microdissected samples These protocols extend and complement those provided in UNITS 25A 1 254 2 amp 25A 3 Donald M Coen Contributing Editor Chapter 25 Harvard Medical School Current Protocols in Molecular Biology
309. omic DNA derived from tissues or cells Modifica tions for performing cDNA RDA are discussed below see Basic Protocol 2 Materials Tester and driver DNA samples Phenol Amresco UNIT 2 1A Phenol chloroform isoamyl alcohol Amresco UNIT 2 1A 20 ug ul glycogen TE buffer pH 8 0 APPENDIX 2 Primers oligomers HPLC purified Table 25B 7 1 400 U ul T4 DNA ligase and 10x buffer New England BioLabs unir 3 14 5x RDA PCR buffer see recipe dNTP chase solution 4 mM each dGTP dATP dTTP dCTP store at 20 C 5 U ul Tag DNA polymerase Invitrogen UNIT 3 5 Mineral oil Isopropanol 10 M ammonium acetate APPENDIX 2 Contributed by Yuan Chang Current Protocols in Molecular Biology 2002 25B 7 1 25B 7 12 Copyright 2002 by John Wiley amp Sons Inc UNIT 25B 7 BASIC PROTOCOL 1 Discovery of Differentially Expressed Genes 25B 7 1 Supplement 60 Table 25B 7 1 Prototypic Primers Used in RDA Primer Type Name Sequence Representation 24 mers RBg124 5 AGCACTCTCCAGCCTCTCACCGCA 3 RBam24 5 AGCACTCTCCAGCCTCTCACCGAG 3 RAHind24 5 AGCACTCTCCAGCCTCTCACCGCA 3 RXxx24 5 AGCACTCTCCAGCCTCTCACCGxx 3 12 mers RBgl12 5 GATCTGCGGTGA 3 RBam12 5 GATCCTCGGTGA 3 RHind12 5 AGCTTGCGGTGA 3 RXxx24 5 xxxxxx CGGTGA 3 Odd cycle 24 mers OBg 24 5 ACCGACGTCGACTATCCATGAACA 3 OBam24 5 ACCGACGTCGACTATCCATGAACG 3 OHind24 5 ACCGACGTCGACTATCCATGAACA 3 OXxx24 5 AC
310. on with phenol chloroform 2 24 ZS 26 Mix 7 ul of 1 M NaCl with 140 ul HEPES buffer and warm to 68 C Add to the hybridization reaction to dilute the reaction Mix and microcentrifuge briefly at maximum speed Cool to room temperature Remove 5 ul from each tube and save total pre phenol extraction counts Add 15 ul streptavidin to each tube Vortex and incubate 5 min at room temperature Extract each tube with an equal volume 25 24 phenol chloroform Retain the aqueous phases and transfer to new tubes Current Protocols in Molecular Biology Discovery of Differentially Expressed Genes 25B 2 9 Supplement 55 27 Add 10 ul streptavidin to each tube containing aqueous phase Mix and incubate 5 min at room temperature 28 Extract twice with phenol chloroform and twice with chloroform Measure the volume of the aqueous layer for each tube The volume for each reaction should be 150 ul The aqueous phase contains A and B cDNA 29 Remove 5 ul of the aqueous layer from each tube total post phenol extraction counts Use either scintillation or Cerenkov counts of the pre and post phenol extraction samples to determine efficiency of subtraction The percent tracer cDNA removed is calculated by the following equation tracer removed 100 total post phenol counts x 100 total pre phenol counts The subtracted material can be stored at 20 C Perform further subtractions Further rounds of subtrac
311. one and the vector 31 Sequence TA cloning products using conventional methods e g UNIT 7 4A PHOSPHORYLATING AND ANNEALING LINKERS It is critical that the linkers be both annealed into double stranded products and efficiently phosphorylated prior to ligation onto NlallI digested cDNAs during SAGE library con struction Even if linkers are ordered prephosphorylated it is critical to test the efficiency of linker phosphorylation by self ligation prior to SAGE library construction so as not to lose precious time and material The following protocol details linker phosphorylation annealing and self ligation Additional Materials also see Basic Protocol 1 Linkers 1A 1B 2A and 2B see recipe 10x kinase buffer New England Biolabs 10 mM ATP 10 U ul T4 polynucleotide kinase New England Biolabs Phosphorylate linkers 1 If linkers 1B and 2B are not already phosphorylated on their 5 ends prepare the following mixture 9 ul 350 ng ul linker 1B or 2B 6 ul LoTE buffer 2 ul 10x kinase buffer 2 ul 10 mM ATP 1 ul 10 U ul T4 polynucleotide kinase Incubate 30 min at 37 C then heat inactivate 15 min at 65 C Anneal linkers 2 Add 9 ul of 350 ng ul linker 1A to 20 ul phosphorylated linker 1B 3 Add 9 ul of 350 ng ul linker 2A to 20 ul phosphorylated linker 2B 4 Perform the following incubations on each linker pair 2 min at 95 C 10 min at 65 C 10 min at 37 C 20 min at room temperature 5 Dilute to
312. ones from the subtracted library is assessed by sequencing and or gridding 40 Pick 50 to 100 differentially expressed clones from the library either randomly if the library assessment indicates most of the clones are differentially expressed or based on a differential hybridization screen using A and B as probes Prepare a miniprep of plasmid DNA UNIT 1 6 41 Sequence the inserts in each of the plasmid DNAs UNIT7 4A amp 7 4B and group together clones containing the same sequences DNA sequence analysis software such as that from DNAStar is helpful If most of the clones analyzed initially are the same they should be subtracted out to reveal rarer transcripts This is done by pooling the identified clones and using them to make driver that is then used for subtraction with A or B tracer Alternatively the library can be plated out and the lifts probed with mixed probe from the sequenced clones lt 20 sequences mixed probe Clones that do not hybridize have not yet been sequenced and should be analyzed If all the clones seem to be differentially expressed but a few are particularly prevalent then another way to reveal rare transcripts is to normalize A and B or self subtract them i e A A and B B for a short period of time These procedures greatly reduce the work involved in sorting through the library Current Protocols in Molecular Biology Discovery of Differentially Expressed Genes 25B 2 11
313. or LM as quickly as possible The authors have not attempted to perform LM of RNA on slides that were prepared more than 14 days in advance Several mm of SAM tissue can be laser microdissected in a single day although the time required for LM can vary tremendously depending upon the abundance of targeted tissues the effort required to locate the specific cells tissues of interest Optimiza tion of LM settings which must be performed for every tissue type typically requires lt 10 min Finally whereas the kit based protocols for RNA extraction of LM tissues can be com pleted in lt 1 hr IVT based RNA amplification requires an investment of two full days Literature Cited Asano T Masumura T Kusano H Kikuchi S Kurita A Shimada H and Kadowaki K 2002 Construction of a specialized cDNA li brary from plant cells isolated by laser capture microdissection toward comprehensive analy sis of the genes expressed in the rice phloem Plant J 32 401 408 Becker I Becker K F R hrl M H Minkus G Sch tze K and H fler H 1996 Single cell mutation analysis of tumors from stained histo logic slides Lab Invest 75 801 807 Cai S and Lashbrook C C 2008 Stamen abscis sion zone transcriptome profiling reveals new candidates for abscission control Enhanced re tention of floral organs in transgenic plants overexpressing Arabidopsis ZINC FINGER PROTEIN2 Plant Physiol 146 1305 1321 Casson S Spenc
314. or minimizing false positive RDA bands O Neill and Sinclair 1997 Additionally re peated thawing and freezing of primers in aque ous solution results in increased primer hy drolysis and contributes to mispriming during PCR amplification This may result in in creased false positives increased rounds re quired to isolate true difference products and excessive background smearing Primers can be stored in lyophilized aliquots to circumvent this problem Anticipated Results The RDA protocol selectively enriches for unique DNA sequences in the tester DNA sam ple Upon completion of RDA enriched popu lations of DNA can be visualized on agarose gel electrophoresis as a few or several distinct bands that range usually from between 150 to 800 bp Although a significant background smear with only poorly identifiable bands may be seen at the end of the first round of ki netic subtractive enrichment successive rounds of enrichment should result in sharper bands with clean backgrounds Even if discrete bands appear in the first or second rounds of RDA three or more rounds are typically re quired to minimize background amplimers or stochastically amplified false positives Authentic bands can then be cloned by a variety of different approaches Sequence analysis of clones should reveal authentic endonuclease restriction sites at the termini of the inserts It is not unusual to identify more than one discrete DNA fragment from each b
315. ore extracted DNA at 20 C stable for years if it is not to be used immediately 28 Characterize remaining PCR sample from step 26 by subcloning UNIT 15 4 and sequencing UNIT 7 4 A pineal clone J zal i et E x i Figure 25B 3 2 Reproducibility and multiple display of mRNAs from normal versus ras p53 mutant transformed cells A RNA samples from normal rat embryo fibroblasts REF R and its ras p53 doubly transformed derivative T101 4 cells T were reverse transcribed and amplified in duplicate with T12MA and OPA17 primers left four lanes In a separate experiment RNA samples from REF R T101 4 T and another ras p53 temperature sensitive mutant transformed cell line A1 5 grown at nonpermissive temperature A and shifted to permissive temperature for 24 hr A32 were reverse transcribed and amplified in duplicate with T12MA and OPA17 primers right eight lanes An arrowhead indicates a reproducible difference between normal and transformed cells B Northern blot analysis of this reamplified cDNA probe named as clone J 20 mg of total RNA from REF T101 4 and A1 5 cells were analyzed 36B4 was used as a probe for RNA loading control Current Protocols in Molecular Biology REAGENTS AND SOLUTIONS Use deionized distilled water in all recipes and protocol steps For common stock solutions see APPENDIX 2 for suppliers see APPENDIX 4 Formamide loading buffer 95 v v formamide 0 09 w v
316. org S mozilazine GJ mozdev org EE Genome Biology KI BioMed Central My 23 oo 23 10 Hs 148741 IBRDCe IER domain containing 2 3001504 23 53 23 10 Hs 250404 SLCZ5A3 Solute carrier family 25 mitochondrial carrier ee 50 24 11 Hs 186466 MAP3K5S Mitogen activated protein kinase kinase kinase 5 2 13 67 26 iz Hs 15155 CELF Chemokine like factor 1000502 24 55 24 Hs 15155 CELF Chemokine like factor 2000535 24 55 24 Hs 408467 SPATA6 Spermatogenesis associated 6 2000502 i 52 15 Hs 117199 Transcribed locus 1000501 c 3 3 4 SAGE Libraries SAGE Libraries Clusters 3 Clusters 4 Relative frequencies SAGE Libraries SAGE Libraries Figure 25B 6 9 Screen shot shows cluster 2 and all of its members after clicking on the graph of cluster 2 Serial Analysis of Gene Expression SAGE 25B 6 30 Supplement 80 Prioritizing data for further analysis Once particular clusters of interest have been identified genes can be prioritized for further study based on a variety of criteria Genes that match specific SAGE tags can be rapidly functionally annotated with Gene Ontology criteria using Web based programs such as EASE Hosack et al 2003 and genes that match a particular function of interest can then be selected Genes can also be prioritized based on abundance levels or by relative tissue specificity It can be very useful to include additional SAGE libraries from public repositories in the analysis to help generate
317. otal RNA that after two rounds of amplification produced between 75 and 100 ug of aRNA A Arroyo and J Rose personal communication of unpublished data Laser microdissected plant RNAs ampli fied by IVT typically range from 0 2 kb to gt 2 kb see Fig 23A 5 1 Ohtsu et al 2007 and are free of genomic contamination Thus the majority of aRNAs prepared following LM exhibit at least some degree of transcript trun cation the majority of which appears to be Current Protocols in Molecular Biology a by product of the IVT amplification proce dure rather than RNA shearing during laser harvesting of plant tissue authors unpub lished results Time Considerations A single experienced individual can hand dissect and fix at least twenty maize seedling shoots per hour Following overnight fixa tion sample infiltration and embedding takes 5 days These steps may be shortened to as little as 3 days for less dense tissues such as Ara bidopsis seedlings whereas 8 to 10 days may be required to infiltrate and embed more com pact tissues such as 20 day after pollination maize kernels Once embedded in Paraplast and kept at 4 C samples may be stored indef initely After experience is gained in micro tome sectioning of maize shoot apices four to five samples per hour can be readily pro cessed However following microtome sec tioning and fixation to slides samples should be placed under vacuum desiccation at 4 C and used f
318. oting Dry slide thoroughly If more than one type of assessment is to be performed multiple slides should be prepared Current Protocols in Molecular Biology 2 Stain the slide with cresyl violet solution by overlaying the staining solution onto the slide for 5 min at room temperature rinsing in deionized water and dehydrating by dipping once in 95 ethanol and then twice in 100 ethanol Clear the dehydrated slide in xylene and mount coverslip using Permount 3 Identify neurons on the basis of morphology using a microscope Count the number of neurons in each 1 ul aliquot Determine the average number of neurons per microliter and calculate the total number of neurons by multiplying the average number per microliter by the total number of microliters cell suspension 4 Analyze an additional slide by immunohistochemistry for a neuron specific protein such as neurofilament 200 kDa peptide detailed in Sawtell 1997 The number of neurons determined by morphology should be similar to that determined on the basis of neurofilament 200 kDa peptide staining NONPERFUSION FIXATION WITH STF SOLUTION ALTERNATE In some cases perfusion fixation is not possible The following procedure is an alternative ERSO GEH to perfusion fixation for subsequent analysis of DNA Additional Materials also see Basic Protocol 1 Harvested tissue fresh HBSS see recipe 1 Finely mince freshly harvested tissue in a drop of STF on a glass slide Th
319. otocol 1 terminating cell processes and thus changes that would accompany dissociating the living tissue their numbers can then be quantitated see Support Protocol Once separated individual cells or groups of a particular cell type can then be analyzed using PCR strategies see Basic Protocols 2 and 3 Fig 25A 2 1 An alternative to fixing by perfusion see Alternate Protocol 1 and a modification of the standard Percoll gradient separation to prepare lacZ expressing cells see Alternate Protocol 2 are also provided The method has broad potential and is particularly potent when the cell type of interest represents a minor population relative to other cells types in the tissue The procedure can also be adapted to allow quantification of the number of cells within a tissue containing specific nucleic acid sequences for example a particular viral DNA or RNA sequence Contributed by N M Sawtell Current Protocols in Molecular Biology 2002 25A 2 1 25A 2 15 Copyright 2002 by John Wiley amp Sons Inc UNIT 25A 2 Discovery of Differentially Expressed Genes 25A 2 1 Supplement 58 BASIC PROTOCOL I Preparation of Single Cells from Solid Tissues for Analysis by PCR 25A 2 2 Supplement 58 Mouse terminate cell processes e fix e downstream analysis reflects cell in context of tissue E BB cell types A E tissue e mince e dissociate separation strategies E analyze frequency of e morphology capture
320. ou A 1999 Prote inchip surface enhanced laser desorption ioniza tion SELDI mass spectrometry A novel pro tein biochip technology for detection of prostate cancer biomarkers in complex protein mixtures Prostate Cancer and Prostatic Diseases 2 264 276 Key References Sheehan and Hrapchak 1987 See above This is a standard reference used by many histotech nologists for the basics of tissue processing embed ding and sectioning Suarez Quian et al 1999 See above This references provides a good overview of the mechanics and principles of LCM Internet Resources http dir niehs nih gov dirlep lcm guidelines html This website is maintained by the Laboratory of Experimental Pathology of the National Institute of Environmental Health Sciences and is another valu able source of protocols and general information for LCM http www arctur com This is the website of Arcturus Engineering It is a very useful source of all LCM related information including protocols references and resources Many of the protocols that we use including those presented here are modifications of protocols found at this website http www bioprotocol com This website contains protocols for the performance of LCM the preparation of tissues for LCM and for processing of microdissected tissue for DNA RNA and protein analysis Contributed by Andra R Frost Isam Eldin Eltoum and Gene P Siegal University of Alabama at Birming
321. paration see Basic Protocol 1 steps 10 to 17 or other suitable method Blue neurons are enriched in the bottom of the gradient presumably because of increased density from the precipitated X gal reaction product This is shown in Fig 25A 2 1E 1 to 3 ANALYSIS OF SINGLE CELLS BY PCR In the following section a protocol for analyzing the dissociated enriched neurons by PCR to detect the HSV thymidine kinase gene is presented however this protocol can be applied to other cell types and nucleic acids as well The goal in developing this assay was to provide a method for the quantitative assessment of the number of neurons containing the HSV genome Because the frequency of the latent viral genome in the author s experimental system was relatively high 20 to 30 of the total neurons in the ganglion the analysis had to be performed on single neurons however depending on the frequency of the nucleic acid of interest in the cell pool being analyzed it could be possible to perform the analysis on samples containing groups of known numbers of cells The primers and basic PCR conditions are essentially as reported by Katz and Coen 1990 and detailed in UNIT 15 7 Steps are included here for 1 aliquoting cells 2 confirming the number of cells per tube being analyzed and 3 eliminating any extracellular contaminating DNA This step is critical to ensure that the DNA being amplified is actually intracellular This is done by using DNase lin
322. pared as cytospin preparations To determine if the sample requires concentration make a direct smear as described below and examine it under the microscope If the concentration of cells is such that the desired number of cells for LCM can be located in 1 to 4 areas each with a diameter of 0 5 cm the appropriate diameter of the cap used to capture the cells of interest during LCM the specimen does not require concentration If however the concentration of cells is so low that the number of desired cells is not present or the cells are so widely spaced that it will require five or more caps to obtain them specimen concentration is recommended For specimens contaminated with undesired blood elements 1 e red blood cells or white cells that are not intended to be microdissected use the protocol for cytologic smears or cytospins containing exces sive blood as the contaminant see Alternate Protocol 1 The same basic caveats apply to cytologic specimens as histologic sections t e ethanol is the preferred fixative especially for RNA analysis the cells should never be allowed to dry on the slide prior to fixation and the fixed and stained cells should be adequately dehydrated prior to LCM Materials High cellularity sample cellular fluid e g fine needle aspiration suspended cultured cells or fresh tissue 95 ethanol Hemocytometer cover optional Glass slides clean Scalpel blade fresh tissue Current Protocols in Molecular
323. pellets might make resuspending them difficult Current Protocols in Molecular Biology Discovery of Differentially Expressed Genes 25B 4 5 Supplement 56 Perform linker ligation 10 Dissolve pellet in ligation mix 20 ul total consisting of the following components 11 1 2 ul 10x ligation buffer 2 0 ul 10 mM ATP 8 0 ul 0 5 ug ul Mbol linker ML2025 7 8 ul H O 1 0 ul 1 U ul T4 DNA ligase Ligate overnight at 16 C or over the weekend at 4 C Add 90 ul water mix and extract with 50 ul phenol buffered with TE buffer pH 8 0 then with 50 ul chloroform For removal of unligated linkers assemble a second PEG precipitation reaction 201 ul total 100 ul phenol extracted ligation products 1 0 ul glycogen 100 ul 28 PEG 3 6 mM MgCIl Let stand at room temperature 5 min then microcentrifuge 15 min at maximum speed 10 C Wash pellet carefully with 70 ethanol and resuspend in 40 ul TE buffer pH 8 0 For precautions see step 6 Perform first round amplification of 3 cDNA fragments 12 Set up first round amplification reactions by combining 1 ul of each of the three 4 13 14 Restriction Mediated Differential Display RMDD 25B 4 6 Supplement 56 uM CP28X X A C or G primers with 1 ul of each of the four 4 uM MLI9Y Y A C G or T primers in separate tubes on ice 12 reactions total Assemble a master mix with all remaining components recipe is for 1 reaction 2 0 ul temp
324. plicons in TE buffer at a concentration between 0 2 to 0 4 ug ul expecting 15 ug of DNA from each 0 5 ml PCR tube Pool driver DNA into a single tube Confirm concentrations of driver and tester DNA by agarose gel electrophoresis UNIT 2 54 against DNA standards Enough of the driver amplicon needs to be prepared to provide sufficient amounts of DNA such that all rounds of hybridization use aliquots that are identical and derived from the same source Calculate the total amount of driver DNA needed for the experiment 40 lug round and if necessary scale up driver amplicon production or perform additional driver amplicon amplifications and pool Current Protocols in Molecular Biology 15 16 17 Digest 150 ug driver DNA and 15 ug tester DNA with initially chosen restriction endonuclease step 1 in volumes of 400 ul to remove the adapters Repeat step 2 and resuspend in 125 ul TE buffer Expect the concentration of tester to be 0 1 ug ul and that of driver to be ug ul Dilute 2 ul resuspended driver amplicon digest with 18 ul water to an expected concentration of 0 1 ug ul Load 0 2 0 4 and 0 6 ug driver and tester amplicon digests and compare with DNA standards by 2 agarose gel electrophoresis UNIT2 5A Using electrophoresis results as a guide perform final dilution with TE buffer such that the driver amplicon digest concentration is 0 5 ug ul and the tester amplicon digest concentration is 50 ng ul Change adapters on
325. ponse gene expression profiles Plant Cell 12 963 977 Dynal 1995 Biomagnetic techniques in molecular biology Technical Handbook Second Edition Dynal A S Oslo Norway Fischer A Saedler H and Theissen G 1995 Restriction fragment length polymorphism cou pled domain directed differential display A highly efficient technique for expression analy sis of multigene families Proc Natl Acad Sci U S A 92 5331 5335 Liang P and Pardee A B 1992 Differential display of eukaryotic messenger RNA by means of the polymerase chain reaction Science 257 967 971 Prashar Y and Weismann S M 1996 Analysis of differential gene expression by display of 3 end restriction fragments of cDNAs Proc Natl Acad Sci 93 659 663 Qin L Prins P Jones J T Popeijus J Smant G Bakker J and Helder J 2001 GenEst a pow erful bidirectional link between cDNA sequence data and gene expression profiles generated by CDNA AFLP Nucl Acids Res 29 1616 1622 Schena M Shalon D Davis R W and Brown P O 1995 Quantitative monitoring of gene ex pression patterns with a complementary DNA microarray Science 270 467 470 Van der Biezen E A Juwana H Parker J E and Jones J D 2000 cCDNA AFLP reveals a striking overlap in race specific resistance and wound response gene expression profiles Plant Cell 12 963 977 Discovery of Differentially Expressed Genes 25B 5 15 Supplement 57
326. prepared from existing libraries which is highly recommended Complementary DNA libraries from many species and tissue sources are widely available and considerable time may be saved by obtaining preexisting and libraries to be used in this protocol Alternatively prepare 21 ug cDNA with EcoRI ends and 10 ug cDNA with blunt ends stop the cDNA synthesis before adding linkers from poly A and poly A RNA respectively UNITS 5 5 amp 5 6 If this is done proceed to step 13 The protocol assumes that the and libraries are bacteriophage libraries If the vector for either is a plasmid only 100 ug of each is needed scale down steps 2 and 3 by Yq and the inserts should be purified by agarose gel electrophoresis rather than by sucrose gradient centrifugation 2 Perform large scale 2 to 3 liters DNA preps of both the and libraries to obtain gt I mg DNA from each library Resuspend the DNA at 1 mg ml in TE buffer Digest the DNA 3 Digest 1 mg of each library DNA in a 1 5 ml microcentrifuge tube as follow final volume 1 167 ml 1 ml library DNA 1 mg 0 117 ml of 10x EcoRI buffer 0 05 ml EcoRI 1000 U Mix by shaking and incubate 5 hr at 37 C Stop the reaction by adding 40 ul of 0 5 M EDTA pH 8 0 and incubate 10 min at 65 C During the digestion prepare four 10 to 40 sucrose gradients in 38 ml SW 28 tubes UN T 5 3 Label two tubes and two tubes Internal E
327. pressed Genes 25B 4 13 Supplement 56 Restriction Mediated Differential Display RMDD 25B 4 14 Supplement 56 COMMENTARY Background Information Identification of differentially expressed genes is currently one of the most promising approaches toward understanding fundamental life processes However due to the high com plexity of mRNA composition in a living cell as well as the broad range of relative frequen cies of particular transcripts and the fact that subtle changes in the expression level of a gene can have profound biological effects perform ing asensitive reliable and relatively complete comparative expression analysis has remained a nontrivial task up to the present Probably the first methods for isolation of differentially expressed genes that found wide spread acceptance were the fingerprinting tech niques of differential display e g Liang and Pardee 1992 see also UNIT 25 83 and RNA arbitrarily primed PCR Welsh et al 1992 These methods relied on the generation of ar bitrarily primed amplification products each representing a particular transcript which were radiolabeled and separated by polyacrylamide gel electrophoresis Resulting band patterns originating from different samples were then compared An indisputable strength of display technology as opposed to subtractive hybridi zation experiments UNIT 25 B2 is the option to directly compare any desired number of differ ent
328. r varying the electrophoresis time might be necessary Stain 15 min in a foil wrapped container on a platform shaker using 2 to 5 ul of 10 000x SYBR Green I in 50 ml of 1x TBE buffer Visualize on a UV box using a SYBR green or UV filter Alternatively use long wavelength UV Amplified ditags should run at 102 bp while a background band linker linker dimers runs at 80 bp Cut out only amplified ditags from the gel and place three cut out bands in 0 5 ml microcentrifuge tubes nine tubes total which have an 0 5 mm diameter hole in the bottom Place the 0 5 ml microcentrifuge tubes in 2 0 ml siliconized microcentrifuge tubes and microcentrifuge 4 min at maximum speed This serves to break up the acrylamide gel into small fragments at the bottom of the 2 0 ml microcentrifuge tube Discard 0 5 ml microcentrifuge tubes Add 250 ul LoTE buffer and 50 ul of 7 5 M ammonium acetate to each 2 0 ml microcentrifuge tube At this point the 2 0 ml microcentrifuge tubes can remain overnight at 4 C Vortex each tube and incubate 15 min at 65 C Add 5 ul LoTE buffer to the membrane of each of 18 Spin X centrifuge tube filters Current Protocols in Molecular Biology Discovery of Differentially Expressed Genes 25B 6 9 Supplement 80 Serial Analysis of Gene Expression SAGE 25B 6 10 Supplement 80 42 43 44 45 Transfer contents of each tube to two Spin X centrifuge tube filters 1 e nine tubes transfe
329. r Biology Discovery of Differentially Expressed Genes 25B 8 13 Supplement 70 Gene Expression Analysis of A Single or Few Cells 25B 8 14 Supplement 70 dNTP mix 1 7 10 mM dCTP 10 mM dGTP 10 mM dATP 8 4 mM dTTP Store up to 12 months at 20 C Igepal wash buffer 50 mM Tris Cl pH 8 APPENDIX 2 75 mM KCl 10 mM DTT 0 25 v v Igepal CA 630 Sigma Store up to 12 months at 20 C Tailing wash buffer 50 mM potassium phosphate pH 7 APPENDIX 2 1 mM DTT 0 25 v v Igepal CA 630 Sigma Store up to 12 months at 20 C Tween 20 wash buffer 50 mM Tris Cl pH 8 APPENDIX 2 75 mM KCl 10 mM DTT 0 5 v v Tween 20 Store up to 12 months at 20 C COMMENTARY Background Information Overview of amplification methods for small amounts of mRNA With the completion of the human genome project and the introduction of technologies such as DNA microarrays and laser microdis section many fields in biology and medicine await the application of comprehensive gene expression analyses of specific cell types iso lated from defined tissues The first protocols for the amplification of single cell mRNA were introduced in the late 1980s and early 1990s Belyavsky et al 1989 Brady and Iscove 1993 and their development as well as their technical differences and application have been recently reviewed Brady 2000 All protocols are based on either of two principal ap proaches linear amplification
330. r be performed UNIT 15 1 however during the initial heating step Taq polymerase should elongate the staggered ends of the template replacing the adapter strands 19 Check the preamplification by running 10 ul of the reaction mixture on an agarose gel alongside molecular weight markers UN T2 5A which should give a visible smear of products in the size range of 50 to 500 base pairs Perform selective preamplification reactions using TagI 1 and Mse 1 primers 20 Dilute 2 ul nonselective preamplified cDNA fragments 1 e 0 0 1 500 in Tris Cl pH 8 0 0 1 mM EDTA 21 Prepare selective preamplification 1 1 reactions in a microtiter plate for a PE 9600 thermocycler in the following way a Dispense 5 ul of 1 500 nonselective preamplification cDNA fragments into each well of the first two columns 1 and 2 of the microtiter plate b Dispense 1 5 ul of 8 pmol ul ZagI A primer into each of wells Al to D1 1 5 ul of 8 pmol l Taql C primer into each of wells E1 to H1 1 5 ul of 8 pmol ul Taql G primer into each of wells A2 to D2 and 1 5 ul of 8 pmol ul TagI T primer into each of wells E2 to H2 c Dispense 1 5 ul of 8 pmol ul MseI A primer into each of wells Al A2 El and E2 1 5 ul of 8 pmol ul MseI C primer into each of wells B1 B2 F1 and F2 1 65 ul of 8 pmol ul Msel G primer into wells C1 C2 G1 and G2 and 1 4 ul of 8 pmol ul Msel T primer into each of wells D1 D2 H1 and H2 d Prepare dNTP polymerase mix by combining 32
331. r is gently pipetted off The tube is then taken off the magnet and fresh buffer wash is added to the tube and the beads are resuspended by agitation by hand or gentle vortexing It is critical that the Dynabeads are not allowed to dry between the wash steps Ethanol precipitate cDNA from step 10 as described in step 8 Resuspend cDNA pellet in 200 ul of 1x BW Remove 1x BW from Dynabeads step 11 and replace with 200 ul cDNA in BW Mix gently by pipetting the mixture up and down Incubate 15 min at room temperature with intermittent agitation by hand Wash three times with 200 ul of 1 x BW Add 200 ul of 1x T4 DNA ligase buffer Prepare the following mix 2 ul 200 ng ul linkers 2A and 2B annealed 28 ul LoTE 8 ul 5x T4 DNA ligase buffer Remove x ligase buffer from the Dynabeads by pipetting and add the above mixture Mix bead slurry bound with cDNA gently but well Heat the tube 2 min at 50 C then incubate 15 min at room temperature Add 2 ul of 5 U ul high concentration T4 DNA ligase and incubate 2 hr at 16 C Mix beads intermittently during ligation It is best to use annealed linkers 2A 2B that are lt 1 month old Release cDNA with AsclI 17 18 After ligation wash beads four times with 1x BW 1 x BSA Wash in 1 x NEBuffer 4 1 x BSA and proceed immediately to the next step Resuspend the beads by adding the following components 85 ul LoTE buffer 10 ul 10x NEBuffer 4 2 ul 100x BSA 2 ul 10 U ul Ascl
332. r patterning in Xenopus Patel et al unpub observ The method described here is very sensitive and can isolate genes that are as little as 2 to 3 fold differentially expressed In the scheme described here two cDNA populations are cross subtracted that is A tracer is subtracted with B driver and B tracer with A driver This allows isolation of genes expressed preferentially in A and genes ex pressed preferentially in B Cross subtraction has two other effects The first is to increase the concentration of rare sequences relative to the concentration of abundant common sequences in the driver because the latter rapidly hybrid ize at low Cot and are removed by subtraction This is termed normalization as it normalizes or equalizes the concentrations of what were Current Protocols in Molecular Biology initially rare and abundant common cDNAs In practice it is not possible to reach a truly equalized representation of sequences but the starting concentrations of different cDNAs can vary 10 000 fold and after normalization this can be reduced to 10 fold Patanjali et al 1991 Soares et al 1994 Normalizing the driver makes it much more efficient at remov ing rare common sequences than an unnormal ized driver Normalizing the driver is essential when starting with tissues that have high mRNA complexity It is of course also impor tant that some of the subtractions be performed with a driver that still contains high
333. ram Cancer Center Nashville Tennessee Arthur B Pardee Dana Farber Cancer Institute Boston Massachusetts Current Protocols in Molecular Biology Restriction Mediated Differential Display RMDD Restriction mediated differential display RMDD can be applied to identify differen tially expressed 1 e up or down regulated genes in many eukaryotic cells or tissues by comparison of band patterns obtained from two or more different RNA preparations As opposed to early differential display or other RNA fingerprinting protocols based on arbitrarily primed PCR RMDD provides very robust and reproducible results which are largely independent of the exact amount of input material or of the exact cycling conditions respectively Two different PCR strategies for fragment amplification de pending on the complexity of the material under investigation as well as the appropriate choice of the restriction enzyme or enzymes used are discussed see Strategic Planning The first protocol describes oligo dT primed conversion of total RNA into double stranded cDNA which is cleaved with a frequently cutting restriction enzyme ligated to linker molecules thus creating the RMDD library and amplified with labeled selective 3 elongated oligonucleotide primers to generate subpools of amplified fragments which represent the 3 ends of the cDNA molecules see Basic Protocol and Fig 25 B4 1 A protocol outlining two phase PCR is given as an alte
334. ranscript fingerprints After digestion and ligation of adapters the cDNA is stored at 20 C or immediately used for the subsequent steps Perform nonselective preamplification of the template fragments 17 Dilute a small aliquot 2 to 5 ul of the template mixture step 16 10 fold with Tris Cl pH 8 0 0 1 mM EDTA Prepare the following preamplification reactions 5 0 ul 1 10 diluted template mixture 1 5 ul 8 pmol ul each AFLP 0 nonselective primer 2 0 ul 5 mM dNTPs 0 2 mM final concentration of each dNTP 5 ul 10x PCR buffer 1 U AmpliTag DNA polymerase Adjust volume to 50 ul with H O 18 Amplify using the following temperature cycle profile on a PE 9600 thermal cycler 20 cycles 30 sec 94 C denaturation AFLP Based 60sec 56 C annealing eerie 60 sec 126 extension 25B 5 6 Supplement 57 Current Protocols in Molecular Biology The purpose of the nonselective preamplification reaction is to generate more starting material for the subsequent selective AFLP reactions This is one of the advantages of the AFLP technique Once the template DNA is made new starting material for selective amplifications can always be made by nonselective amplification of the template DNA and hence new RNA isolation will never have to be done again Note that the adapter strands are not phosphorylated and that therefore the strand which represents the primer target is not ligated to the template DNA Thus a hot start should neve
335. rayscale of the developed films in the transmission mode with a resolution of at least 600 dpi 5 Save files as MD GEL gel MCID 1m BRS img TIFF tif TIFFS tif Fujix Bas Series inf Bio Rad PA 1mg Packard tif or MD Dataset ds Other data formats cannot be imported by the array vision software Analyze with software 6 Define a template according to the grid of the cDNA arrays that were used 7 Import the scanned films as a data file into arrays vision 8 Align the grid to the corresponding spots on the cDNA array 9 Normalize the signals to the housekeeping genes present on the cDNA array The average of the signals of the housekeeping genes is set to a value of one and the background to a value of zero 10 Sample the template 11 Export the gained data to MS Excel and or SPSS for further statistical analysis REAGENTS AND SOLUTIONS Use deionized distilled water in all recipes and protocol steps For common stock solutions see APPENDIX 2 for suppliers see APPENDIX 4 Development buffer 1 100 mM maleic acid 150 mM NaCl pH 7 5 Autoclave and store up to 6 months at room temperature Development buffer 2 100 mM maleic acid 150 mM NaCl pH 7 5 1 blocking reagent DIG Luminescent Detection Kit Roche Diagnostics Store up to 12 months at 20 C Development buffer 3 100 mM Tris Cl pH 9 5 APPENDIX 2 100 mM NaCl Prepare fresh just prior to use Current Protocols in Molecula
336. re However RNA yields from LM derived samples may vary consider ably depending upon the specific plant tissue analyzed When planning LM experiments re searchers must carefully consider the targeted tissue and empirically determine the appro priate number of cells to be microdissected A single plant cell may contain lt 10 pg or as much as 100 pg of RNA depending upon the tissue type Zimmerman and Goldberg 1977 Dixon et al 2000 As a rule fully differentiated plant cells may be quite large and extremely vacuolated and contain far less RNA um than the smaller densely cytoplas mic cells found in undifferentiated and actively dividing tissues reviewed in Nelson et al 2006 authors personal observations RNA amplification procedures Typically LM procedures are performed on lt 1000 plant cells and yield between 5 and 100 ng of total RNA reviewed in Day et al 2005 Although these RNA yields are often sufficient to perform a few qRT PCR reactions most transcriptomics applications incorporate an RNA amplification procedure to generate several micrograms of amplified RNA aRNA In addition to the in house RNA amplification protocol for T7 RNA poly merase based in vitro transcription IVT de scribed in this unit a variety of RNA amplifi cation kits are commercially available and are not critically evaluated here Similar to the IVT protocol described in this unit many commer cially available kits gener
337. re 25B 6 5 7 Select the clustering algorithm from the pull down menu as indicated by the arrow in Figure 25B 6 5 8 Enter the desired value in the Specify Number of Clusters box 9 Click Submit The run time is usually lt min but will vary depending on how large the dataset is For example for a large dataset containing gt 4000 unique tags the run time could be as long as half of an hour When clustering is finished a new screen appears similar to that shown in Figure 25B 6 6 10 Select an organism for annotation then click Submit A screen with graphs appears To view members of a cluster click on the individual graphs A new window appears with all members in the clicked cluster Fig 25B 6 9 11 To save graphs right click on individual graphs Select Save Image As from Di f the menu The user then selects a directory where the graph is to be saved e E ee Differentially Expressed Genes 25B 6 29 Current Protocols in Molecular Biology Supplement 80 GS Mozilla Firefox R R m Jog File Edt Wew History Bookmarks Tools Help ARARAARAARA ARARARAARA AAABAAAAAC AAAARAAAAG AAABAAAAGA AAAAARAAAGA AAARAAAATG s i a a O Cc il oT a L ij U gt 4 ut a of 10 10 7 a J 3 6 CG G hite genome dfci harvard edu sager dat cluster_4 dat txt l o jel zco Ja mozila
338. re catapulting system LMPC in which a pulsed ultraviolet UV A laser beam cuts cells from tissue sec tions and laser pressure is used to catapult these selected tissues into collection caps Current Protocols in Molecular Biology 25A 3 1 25A 3 15 July 2009 Published online July 2009 in Wiley Interscience www interscience wiley com DOI 10 1002 0471142727 mb25a03s87 Copyright 2009 John Wiley amp Sons Inc UNIT 25A 3 Discovery of Differentially Expressed Genes 25A 3 1 Supplement 87 Laser Microdissection and Amplification of Plant RNA 25A 3 2 Supplement 87 1 dissect fix and embed plant tissues fil dissected leaf upi leaf 2 prepare thin tissue sections on microtome mount sections on microscope slide 3 laser microdissect tissue microdomains from mounted sections 4 extract nanogram quanities of RNA from microdissected tissues amplication to generate microgram quantities of amplified RNA 6 prepare cDNA from amplified RNA q amplified leaf RNA 7 perform transcript analyses of choice 1 ee a me qRT PCR microarray Figure 25A 3 1 Flowchart of the use of laser microdissection for analysis of transcript accu mulation within plant tissue microdomains In this example mesophyll cells are microdissected green arrows from transverse sections 10 um of mature rosette leaves of Arabidopsis thaliana Images of Arabidopsis leaf sections were provided by K
339. rease in background is observed upon prolonged storage due to self ligation e no insert Mix the following ligation reaction and set up a duplicate reaction without con catamer as a control 6 ul purified concatemer step 64 none in control 1 5 ul dH2O 7 5 ul in control 1 ul 25 ng ul pZErO plasmid cut with Sphl 1 ul 10x T4 DNA ligase buffer 1 0 ul 1 U ul T4 DNA ligase Current Protocols in Molecular Biology Incubate 2 hr at 16 C Consider using 3 ul concatemers and save the rest for backup The manufacturer of pZErO plasmid warns that there is increased background at incu bations gt l hr which may result in breakthrough by spontaneous mutations in the ccdB death gene 68 Bring sample volume to 200 ul with LoTE buffer Extract with an equal volume PC8 then ethanol precipitate by mixing the following 200 ul sample 133 ul 7 5 M ammonium acetate 2 ul SeeDNA 777 ul 100 ethanol 69 Wash four times with 70 ethanol Microcentrifuge briefly at maximum speed remove 70 ethanol and air dry 5 min Resuspend in 10 ul LoTE buffer Excess salt can cause arcing during electroporation and kill the cells Transfect DNA by electroporation 70 Place an appropriate number of 0 1 mm microelectroporation cuvettes and 1 5 ml microcentrifuge tubes on ice 71 Place 1 ml SOC medium in an appropriate number of 15 ml culture tubes at room temperature 72 Add 1 ul DNA from step 69 to 1 5 ml microcentrifuge tubes on ice T
340. regarding the response of the dissociating tissue and cells to the process Make estimates of the Current Protocols in Molecular Biology number of cells expected and determine if re coveries are reasonable There should be mini mal cell loss with this method Examine the integrity of the nucleic acids and proteins by carrying out routine isolation and analytical procedures on the tissue after dissociation All standard PCR and RI PCR controls should be included Additional controls will be required depending on the final application of the cells Anticipated Results Single cell suspensions of tissues will be obtained With proper attention to the quality of reagents used specifically the collagenase the nucleic acids within the cells will be intact Keep in mind that the results obtained from downstream analyses will depend on the qual ity of the cells obtained from the dissociation Step Time Considerations The time required will depend on the skill level of the individual performing the task For the skilled practitioner mouse perfusion will require 10 to 15 min dissection and mincing of tissue 5 to 15 min depending on how many tissues are being dissected tissue dissociation 30 to 45 min rinsing and post fixation 20 min neuron counts 1 hr depending on how many slides are examined separation of Percoll gra dient and rinsing 1 hr aliquoting individual cells one to several hours depending on the number of tubes
341. repare a PCR mixture for each probe 50 ul per reaction 17 5 ul H O 5 ul 10x Tag DNA polymerase buffer 3 ul 25 mM MgCl 2 ul probe dNTP mix 20 ul a P dCTP 1 ul 2 5 ug ul primer a2 primer b2 primer specific for gene expressed in both A and B or primer specific for gene expressed differentially in A or B 0 5 ul 4 ng ul subtracted A or B cDNA or appropriate gene template DNA 1 ul 5 U ul Tag DNA polymerase Add a few drops of sterile PCR grade mineral oil to cover the reaction 5 Amplify and label the probe using the following PCR program 30 cycles l min 94 C denaturation l min 50 C annealing 2min 72 C extension This reaction yields a double stranded probe the probes should be denatured before hybridization PCR Based Subtractive cDNA Cloning 25B 2 12 Supplement 55 Current Protocols in Molecular Biology 6 Purify the probe by centrifuging it through a 1 ml Sephadex G50 80 spin column 2 min at 170 x g in a Beckman Accuspin FR with a swinging bucket rotor room temperature Expect 50 ul eluate after centrifugation 7 Measure incorporation by counting a 1 ul fraction of the eluate in a scintillation counter Routinely incorporation is 10 cpm ul eluate 8 Hybridize each slot blot with one of the above probes UNIT 2 10 9 Wash the blots to high stringency UNIT 2 10 10 Expose filters to X ray film or a phosphoimaging plate APPENDIX 3A The A and B hybridizations are the most
342. repare the Taql adapter by combining 8 5 ug 1500 pmol top and 8 ug 1500 pmol bottom strands Adjust volume to 30 ul with water This results in a solution of 50 pmol ul of double stranded TaqI adapter 15 Prepare the Msel adapter by combining 8 0 ug 1500 pmol of the top strand and 8 0 ug 1500 pmol of the bottom strand Adjust volume to 30 ul with water This results in a solution of 50 pmol ul of ds Msel adapter The Taqi and Msel adapters both have double stranded parts of 14 base pairs it appears unnecessary to perform a specific denaturation renaturation procedure to anneal the two strands of the adapters Note that the base pair adjacent to the restriction site overhang is such that the recognition site is not restored upon ligation see Background Information Absence of 5 phosphates prevents self ligation of adapters 16 To the cDNA fragments digested with JagI and Msel steps 12 and 13 add 1 ul of each adapter 50 pmol each steps 14 and 15 1 ul of 10 mM ATP 2 ul of 5x RL buffer 1 U of T4 DNA ligase and 10 ul water Incubate 2 hr at 37 C The cDNA is incubated for 2 hr with restriction enzymes steps 12 and 13 followed by an additional incubation of 2 hr in the presence of DNA ligase It is not advisable to perform the restriction digestion and ligation simultaneously This may affect the efficiency of the DNA restriction Longer incubation times are also not recommended because this may affect the quality of the t
343. reported by IVT kit man ufacturers Based on these data and similar re sults from separate studies Luzzi et al 2003 more than two rounds of IVT RNA amplifi cation is usually discouraged Although typ ical PCR can result in considerable differ ences in representation of different transcripts as an alternative to IVT PCR employing 12 cycles or fewer has also been employed to amplify nanogram quantities of LM harvested RNA with less transcript truncation than IVT protocols and good correlation with quanti tative analyses of unamplified RNA samples Wilhelm et al 2006 Day et al 2007 Anticipated Results In their comparisons of RNA yield follow ing LM of 1000 vascular or epidermal cells from maize seedlings Nakazono et al 2003 harvested 35 to 43 ng of total RNA correspond ing to an average yield of 2 to 3 pg of RNA per individual cell Following two rounds of amplification by IVT these researchers gener ated from 24 ug to over 46 ug of aRNA which translates to amplification rates of over 62 000 fold to more than 100 000 fold Similar pro cedures performed on replicate samples of ten maize seedling SAMs which contain signifi cantly smaller cells than vascular or epidermal tissues yielded average harvests of gt 10 ug of aRNA per mm of microdissected SAM tis sue Zhang et al 2007 Lastly LM of 700 parenchyma collenchyma or epidermis from cryosections of tomato fruit pericarp yielded from 5 ng to 50 ng of t
344. res 4 hr but can be performed overnight Preparing run ning and drying the denaturing polyacry lamide gel takes 1 day Autoradiography can be as brief as overnight Recovery reamplification of DNA and extraction of reamplified DNA from an agarose gel can easily fit into the third day Northern blot analysis requires an addi tional 2 days Literature Cited Comes A Humbert J and Laurent F 1997 Rapid cloning of PCR derived RAPD probes BioTech niques 23 210 212 Hedrick S M Cohen D I Nielsen E A and Davis M M 1984 Isolation of cDNA clones encoding T cell specific membrane associated proteins Nature 308 149 153 Lee S W Tomasetto C and Sager R 1991 Posi tive selection of candidate tumor suppressor genes by subtractive hybridization Proc Natl Acad Sci U S A 88 2825 2829 Liang P and Pardee A B 1993 Distribution and cloning of eukaryotic mRNAs by means of dif Current Protocols in Molecular Biology ferential display Refinements and optimization Nucl Acids Res 21 3269 3275 Liang P Averboukh L and Pardee A B 1993 Distribution and cloning of eukaryotic mRNAs by means of differential display Refinements and optimization Nucl Acids Res 21 3269 3275 Liang P Zhu W Zhang X Gui Z O Connell R P Averboukh L Want F and Pardee A B 1994 Differential display using one base an chored oligo dT primers Nucleic Acids Res 22 5763 5764 Lisitsyn N A
345. res at least 6 hr when cDNA arrays are used Hybridize the labeled probe over 2 nights when few cells were used cDNA from higher cell numbers might be hybridized for 1 night Non radioactive de velopment of filters will require 3 hr The exposure time of the film has to be individually evaluated but usually two films developed at 15 and 60 min are sufficient Data analysis of hybridized cDNA arrays Scanning of the films will take 10 min per film and data analysis by array vision will take 30 to 60 min per film Literature Cited Belyavsky A Vinogradova T and Rajewsky K 1989 PCR based cDNA library construction General cDNA libraries at the level of a few cells Nucleic Acids Res 17 2919 2932 Brady G 2000 Expression profiling of single mam malian cells small is beautiful Yeast 17 211 217 Brady G and Iscove N N 1993 Construction of cDNA libraries from single cells Methods Enzy mol 225 61 1 623 Brail L H Jang A Billia F Iscove N N Kla mut H J and Hill R P 1999 Gene expression in individual cells Analysis using global single cell reverse transcription polymerase chain reac tion GSC RT PCR Mutat Res 406 45 54 Discovery of Differentially Expressed Genes 25B 8 17 Supplement 61 Gene Expression Analysis of A Single or Few Cells 25B 8 18 Supplement 61 Eberwine J Yeh H Miyashiro K Cao Y Nair S Finnell R Zettel M and Coleman P 1992
346. ridizing a probe that has been amplified by the protocol in the absence of cellular RNA negative control in which contaminating DNA from the enzymes can be expected to be present as in the cell samples Note that although some favor the opposite nomenclature for array hybridizations the authors use the term probe to refer to the labeled DNA in solution Add probe to membrane 4 Mixina 1 5 ml microcentrifuge tube 1 ml DIG Easy Hyb solution 6 ug of the labeled probe from step 1 and 100 ug of herring sperm DNA Denature 5 min at 94 C and immediately add to the prehybridization solution in the hybridization tube Incubate with slow rotation at least 36 hr at 45 C It is important that the nylon membrane be completely covered with the hybridization solution before rotating Otherwise high non specific backgrounds will result due to the drying of the membrane during hybridization Therefore adjust the amount of hybridization solution to add to the prehybridization accordingly Additionally do not pour the concentrated probe directly onto the filter This will result in high background Wash the membrane 5 Remove the hybridization solution and wash the membrane in the bottle and in the hybridization oven at 68 C using the following regimen 1 min in 2x SSC 0 1 SDS 1 min in 1x SSC 0 1 SDS 15 min in 0 5x SSC 0 1 SDS 30 min in 0 1x SSC 0 1 SDS two times Warm all solutions to 68 C prior to use in a water bath
347. riod of time e g overnight Critical Parameters Because the EcoRI ends of insert cDNA must remain intact through the sucrose gradient and hybridization steps the nuclease inhibitor and bacteriostatic agent EDTA is present in both steps In contrast S1 nuclease digestion destroys the EcoRI ends of cDNA ensuring that all clones in the final library are derived from cDNA Restriction digestion of DNA with Alul and Rsal increases the molar ratio of to DNA while not increasing the Current Protocols in Molecular Biology mass of cDNA which can inhibit sub sequent steps The boiling step prior to hybridi zation is essential to melt the cDNA to its single stranded form The hybridization condi tions favor the annealing of fragments gt 50 bp and a relatively long hybridization is required to permit reannealing of rare cDNA Hy bridization buffer must be diluted at least 10 fold in order to successfully phenol extract chloroform extract and ethanol precipitate the DNA A full 10 ug of phage vector arms must be added in the ligation reaction This repre sents only an equimolar amount of EcoRI ends with respect to the number of ends from the cDNA and is by no means an excess A major advantage of this protocol is that it may be performed with reagents enzymes and supplies routinely available in a typical mo lecular biology laboratory Sucrose for gradi ents should be molecular biol
348. rmamide Fluka IBI or American Bioanalytical 20x SSC APPENDIX 2 Discovery of 1 M NaPO pH 7 0 see recipe Differentially Expressed Genes Contributed by Lloyd B Klickstein 25B 1 1 Current Protocols in Molecular Biology 2001 25B 1 1 25B 1 8 Copyright 2001 by John Wiley amp Sons Inc Supplement 55 Production of a Subtracted cDNA Library 25B 1 2 Supplement 55 10 sodium dodecyl sulfate SDS 10 mg ml yeast tRNA 24 1 chloroform isoamyl alcohol Phosphatased Agt10 arms Stratagene 10x T4 DNA ligase buffer UNIT 3 4 T4 DNA ligase measured in cohesive end units New England Biolabs UNIT 3 14 E coli C600hfIA Table 1 4 5 phage packaging extracts Stratagene Suspension medium SM UNIT 1 11 SW 28 rotor and 38 ml centrifuge tubes Beckman or equivalent 0 4 ml microcentrifuge tube Additional reagents and equipment for construction of recombinant DNA libraries UNITS 5 5 amp 5 6 large scale DNA preps from plasmids UNIT 1 7 or phage UNIT 1 13 Sucrose gradients UNIT 5 3 agarose gel electrophoresis UNIT 2 5A production and growth maintenance of A phage libraries UNITS 5 8 25B 2 and 1 9 1 13 plating and titering libraries UNITS 6 1 amp 6 2 hybridization UNIT 6 3 and radiolabeling probes UNIT 3 4 Prepare the insert DNA 1 Prepare or obtain cDNA libraries from the and cells or tissue sources A major advantage of this protocol is that a subtracted library may be
349. rming serial analysis of gene expression SAGE SAGE involves the generation of short fragments of DNA or tags from a defined point in the sequence of all cDNAs in the sample analyzed This short tag because of its presence in a defined point in the sequence is typically sufficient to uniquely identify every transcript in the sample SAGE allows one to generate a comprehensive profile of gene expression in any sample desired from as few as 100 000 cells or as little as 1 ug total RNA SAGE also allows an investigator to readily and reliably compare data to those produced by other laboratories making the SAGE data set increasingly useful as more data are generated and shared Serial analysis of gene expression SAGE as described in the main method see Basic Protocol 1 involves the generation of an oligonucleotide library with each 14 bp SAGE tag representative of a discrete cDNA Sometimes the gene that the SAGE tag represents cannot be readily identified Thus a second method see Basic Protocol 2 describes reverse cloning the 3 end of the cognate cDNA for an unknown SAGE tag Three additional protocols for verifying cDNA by PCR see Support Protocol 1 optimizing ditag PCR see Support Protocol 2 and annealing linkers see Support Protocol 3 are also given Finally protocols for use of publicly available cluster analysis software designed for analysis of SAGE data are described in Basic Protocol 3 Current Protocols in Molecular
350. rnative to the amplification steps used in the Basic Protocol see Alternate Protocol This protocol is usually chosen if the RNA samples to be analyzed are particularly complex The final protocol describes nonradioactive fragment analysis through the use of biotinylated primers and direct blot ting electrophoresis see Support Protocol mRNA YY Aa a a AAAAAAAAAAAA TT TT Ty Js cDNA synthesis y yV o m TTT 1 digest with frequent cutter 2 linker ligation 1 PCR 3 fragments with J extended biotinylated primers 2 direct blotting electrophoresis A B _ 1 reamplification 2 sequencing Figure 25B 4 1 Schematic of RMDD Contributed by Achim Fischer Current Protocols in Molecular Biology 2001 25B 4 1 25B 4 17 Copyright 2001 by John Wiley amp Sons Inc UNIT 25B 4 Discovery of Differentially Expressed Genes 25B 4 1 Supplement 56 Restriction Mediated Differential Display RMDD 25B 4 2 Supplement 56 NOTE 5 labeled primers are indicated by an asterisk The label can be a radioactive isotope e g P or a nonradioactive label such as biotin or digoxigenin In the latter case labels should be attached via a sufficiently long spacer to the oligonucleotide e g tetraethylene glycol from Eurogentec to ensure maximum detection sensitivity NOTE The technology described in this unit is protected by certain patent rights US 5 876 932 EP 0 743 367 JP 96 3085
351. rom an additional 1 week to 3 months depending on the resources and sequencing capacity rSAGE Generating purified double stranded cDNA typically takes 4 5 hr Cleaving the cDNA with the anchoring enzyme N aIII magnetic bead purification ligating linkers to cDNA and re lease of 3 cDNA fragments from magnetic beads with AsclI typically takes 6 to 8 hr PCR generation of amplified rSAGE libraries takes 2 5 to 3 5 hr SAGE tag specific PCR takes 3 5 to 4 5 hr TOPO TA cloning and subsequent sequencing is user dependent Acknowledgement The authors are grateful to the collaborators who kindly provided the data and to the many users who provided valuable feedback sug gestions and help The authors wish to thank Feng X Zhao and members of Research Com puting at Dana Farber Cancer Institute Literature Cited Allinen M Beroukhim R Cai L Brennan C Lahti Domenici J Huang H Porter D Hu M Chin L Richardson A Schnitt S Sellers W R and Polyak K 2004 Molecular character ization of the tumor microenvironment in breast cancer Cancer Cell 6 17 32 Angelastro J M Kenzelmann M and Muhlemann K 1999 Substantially en hanced cloning efficiency of SAGE serial analysis of gene expression by adding a heating step to the original protocol Nucl Acids Res 27 917 918 Audic S and Claverie J M 1997 The significance of digital gene expression profiles Genome Res 7 986 995 Black
352. rotary evaporator and resuspend in the original volume of double distilled water or buffer Check the yield on average 2 ug and quality of the isolated poly A RNA by performing agarose gel electrophoresis alongside molecular weight markers UNIT Current Protocols in Molecular Biology 2 5A using 5 ul of the poly A RNA solution which should appear as a faint smear from 10 kb down 1 e lower molecular weight with trace rRNA bands It is not necessary to eliminate the rRNA contamination by extracting the mRNA from the eluate a second time Synthesize the ds cDNA 7 For first strand cDNA synthesis combine the following 8 9 10 11 10 ul poly A RNA 0 5 ug 0 5 ul 700 ng ul 5 biotin dT reverse transcription primer 2 ul H O 4 ul of 5x first strand buffer 2 ul 0 1 M DTT 1 ul 10 mM dNTPs 0 5 ul of 200 U ul SuperScript II add last Incubate 2 hr at 42 C For second strand synthesis combine the following 20 ul first strand cDNA synthesis mixture from step 7 16 ul 5x second strand buffer 1 5 ul 10 mM dNTPs 3 ul 0 1 M DTT 7 5 U E coli DNA ligase 25 U E coli DNA polymerase I 0 8 U RNase H H O to 80 ul Incubate 1 hr at 12 C followed by 1 hr at 22 C The quality and yield of the resulting ds cDNA can be checked by agarose gel electropho resis UNIT 2 5A Wash 25 ul streptavidin coated beads with 100 ul of 2x STEX see step 4 for technique Resuspend in 80 ul of 2x STEX
353. roy all nucleic acids by UV irradiation Expose the internal surface of the mortar to UV light in a transilluminator or hold it close to a UV light source 254 nm wavelength for 10 to 15 min For the pestle in order to expose the whole surface it will be necessary to turn it as only DNA lying in the direct path of the light will be destroyed by the UV irradiation also see APPENDIX 3F for sterile technique Thawing of the sample must be avoided under all circumstances Therefore place the mortar on dry ice and frequently pour liquid nitrogen over the sample 3 Add the powdered sample directly to 50 ul of prepared Dynal beads see Basic Protocol 1 steps 1 and 2 and rotate lysate as in Basic Protocol 1 step 4 4 Proceed with global amplification in Basic Protocol 1 steps 5 through 20 EXTRACTION OF mRNA FROM MICRODISSECTED SAMPLES Laser microdissection is the cleanest way to isolate selected morphologically defined cell groups from tissue sections However it is also possible to scratch the tissue area with a glass needle of which the tip is then broken into the lysis buffer The authors use the PALM Laser MicroBeam System PALM that first cuts the selected area by a laser beam and then catapults it into the lid of the reaction tube see Fig 25B 8 2 Other laser microdis section systems See UNIT 25A 1 Should work equally as well as long as the isolation does not change the composition of the lysis buffer The combination with Basic
354. rred to 18 Spin X centrifuge tube filters Microcentrifuge each SpinX filter for 5 min at maximum speed Consolidate sets of two eluates 300 ul total and transfer to 1 5 ml microcentrifuge tubes Sometimes purified 102 bp bands do not recut well with Nlalll which seems to be related to imperfect purification from the gel If this is a problem run 300 ul eluate through a Qiaquick gel extraction protocol Qiagen Bring the volume of the extract back up to 300 ul to proceed Ethanol precipitate eluates by adding the following 300 ul sample 0 5 ul SeeDNA 1 5 ul glycogen 133 ul 7 5 M ammonium acetate 1000 ul 100 ethanol Vortex and place in a dry ice methanol bath for 15 min Warm 2 min at room temperature until solution has melted then microcentrifuge 15 min at 4 C Microcentrifuge 15 min at maximum speed Wash two times with 75 ethanol Re suspend each DNA tube in 10 ul LoTE buffer Pool samples into one microcentrifuge tube 90 ul total The total amount of DNA at this stage should be 10 to 20 ug Digest PCR products with Nlalll by adding the following 90 ul PCR products in LoTE buffer 226 ul LoTE buffer 40 ul 10x NEBuffer 4 4 ul 100x BSA 40 ul 10 U l Nal II Incubate 1 hr at 37 C Purify the ditags 46 47 48 49 50 Extract with an equal volume of PC8 Pool aqueous phases and transfer into 1 5 ml microcentrifuge tubes Ethanol precipitate in dry ice as follows 200 ul sample 66 ul 7 5
355. ry constructed in the gt10 vector or its equivalent which allows a high cloning efficiency and permits elimination of nonrecombinants however the protocol can be used to produce subtracted cDNA libraries in any vector system cDNA with EcoRI ends and cDNA with blunt ends are prepared The cDNA is digested with Rsal and Alul to give small blunt ended fragments The cDNA inserts are mixed with a 50 fold excess of fragmented cDNA inserts the DNAs in the mixture are heated to melt the double stranded DNA and the single stranded insert DNA is allowed to hybridize After hybridization annealed cDNA inserts are ligated to Agt10 arms packaged and transfected The only cDNA likely to regenerate double stranded fragments with an EcoRI site at each end are those sequences for which no complementary fragments were present in the cDNA The subsequent cloning step allows the selection and amplification of these fragments Materials and cDNA libraries ATCC or Stratagene TE buffer APPENDIX 2 EcoRI and 10x EcoRI buffer UNIT 3 1 0 5 M EDTA pH 8 0 APPENDIX 2 10 sucrose solution UNIT 5 3 1 5 and 2 agarose gels UNIT 2 5A TBE buffer APPENDIX 2 95 and 70 ethanol S1 nuclease Sigma UNIT 3 12 and 10x S1 nuclease buffer UNIT 3 4 25 24 1 phenol chloroform isoamyl alcohol UNIT 2 1A 3 M sodium acetate pH 5 2 APPENDIX 2 Alul and 10x Alul buffer UNIT 3 1 Rsal UNIT 3 1 Deionized fo
356. s and the Poisson Current Protocols in Molecular Biology based distances were implemented into the K means procedure in clustering SAGE data It has been demonstrated that the Poisson based distances have advantages over the Pearson correlation and Euclidean distance in clus tering SAGE data Cai et al 2004 These commonly used distance measurements e g Pearson correlation and Euclidean in micro array data analysis were shown not to be suit able for SAGE data analysis The poor perfor mance of Pearson correlation and Euclidean distance in SAGE data analysis may be due to the fact that the Pearson correlation dis tance only uses the shape of the curves but neglects the magnitude of changes while the Euclidean distance takes the difference be tween data points directly and may be overly sensitive to the magnitude of changes The main drawbacks of SAGE analysis are the time and expense required to gen erate sufficient numbers of tags to examine expression of low and moderate abundance mRNAs The price of sequencing has dropped considerably in the past few years but real costs still remain around 0 25 tag For re searchers simply hoping to identify a hand ful of differentially expressed genes in their sample of interest subtractive hybridization UNIT 25B 1 differential display methodolo gies UNITS 25B 3 25B 5 or even the use of commercially available microarray technol ogy may prove more cost effective An ad
357. s considerable convenience and stained bands can be directly cut out of the blotting membrane for recovery and analysis Additional Materials also see Basic Protocol TBE electrophoresis buffer APPENDIX 2 standard and degassed 1 e stirred under vacuum 20 min Maleic buffer pH 7 5 see recipe 1 5 blocking reagent see recipe Streptavidin alkaline phosphatase conjugate Roche Molecular Biochemicals Reaction buffer pH 9 5 see recipe NBT BCIP in 67 v v DMSO Roche Molecular Biochemicals Current Protocols in Molecular Biology SUPPORT PROTOCOL Discovery of Differentially Expressed Genes 25B 4 9 Supplement 56 Restriction Mediated Differential Display RMDD 25B 4 10 Supplement 56 Primers see UNIT 2 11 for oligonucleotide synthesis CP28 5 ACC TAC GTG CAG ATT TTT TTT TTT TTT T 3 ML18 5 GCT AAG TCT CGC GAG ATC 3 GATC 1500 Direct Blotting Electrophoresis System GATC Biotech AG Direct blotting membrane GATC Biotech AG 10 ml syringe and 25 G needle 32 well sharkstooth comb GELoader tips Eppendorf with capillary like part cut away Stratalinker Stratagene Developing drum e g GATC tube GATC Biotech AG Adhesive tape Rolling incubator accepting 18 x 35 cm tubes and capable of revolving at 20 rpm 2 mm thick polyethylene wrap e g Neolab Heidelburg FRG or material from a thick hybridization bag T A cloning system e g Invitrogen optional Additional re
358. s into the tube adhesive cap see Video 1 at http www currentprotocols com Be certain that tissues are laser microdissected at the same magnification as they are marked with the sample selection software or tissue targeting will be imprecise PALM adhesive caps are coated with an RNase free tissue adhesive that prevents tissue loss due to fallback from the cap Be careful not to saturate the cap surface during prolonged laser microdissections Overfilled caps will no longer adhere to harvested tissue which may fall back to the slide surface an unfortunate phenomenon sometimes referred to as snowing and which can be easily remedied by inserting a fresh adhesive cap Collect a sufficient amount of tissue for downstream applications Tissue collected from six to ten maize SAMs typically yields between 5 and 10 ng of RNA utilizing RNA extraction kits Current Protocols in Molecular Biology 23 Perform RNA extraction from microdissected tissue using the PicoPure RNA Extraction kit or equivalent kit according to the manufacturer s instructions RNA yields can be quantified using a small volume spectrophotometer such as a NanoDrop IN VITRO TRANSCRIPTIONAL AMPLIFICATION OF RNA The following section describes the in vitro transcription IVT amplification of RNA from plant cells It uses an oligo dT T7 chimeric primer to preferentially select polyadenylated RNA species and then convert the RNA into antisense RNA through two
359. s was tested Although ran dom priming during cDNA synthesis labeling and hybridization add to the total variation overall congruence of the two halves from one cell after global PCR was remarkably high for strong and intermediate signals The weaker the signal the more likely it was lost in one of the two halves Klein et al 2002 Therefore when single cells are analyzed the lack of a signal is more difficult to interpret and the authors rec ommend using independent methods such as real time PCR or antibody staining Oligo arrays have become increasingly avail able from commercial suppliers Affymetrix Clontech Qiagen MWG Biotech Most of the sequences on these arrays are selected from the 3 end of a transcript In those cases where the 5 3 ratio is included into the bioinformatic evaluation Affymetrix one should not include the random primers as the ratio will be shifted to the 5 end Here initial results indicate that the CFISCTo4 alone results in more quantita tive results if using the Affymetrix system do not forget to include the T7 promoter into the oligo in the order 5 poly C flank T7 promoter dT 24 3 In addition if enough cells are avail able that allow division of the sample it is Current Protocols in Molecular Biology advisable to determine the number of cycles needed to reach the plateau of the PCR reaction Quantification is more precise during the linear phase of PCR i e
360. s present in both and cDNA Five to ten percent of clones not specific may have inserts that are not released by EcoRI and probably repre sent aberrant ligation of fragments into the vector Time Considerations Once and total library DNA is ob tained perform the EcoRI digestion during the day and run the sucrose gradient overnight On the second day harvest the gradients perform the S1 digestion of the cDNA and store the precipitated DNA overnight On the third day digest the DNA with Alul and Rsal and set up the hybridization overnight The fourth day ligate the cDNA to the Agt10 vector overnight and start an overnight culture of host cells Package and plate over the following night The protocol may be interrupted at any ethanol precipitation overnight or over the weekend Literature Cited Hedrick S M Cohen D I Nielsen E A and Davis M M 1984 Isolation of cDNA clones encoding T cell specific membrane associated proteins Nature Lond 308 149 153 Discovery of Differentially Expressed Genes 25B 1 7 Supplement 55 Production of a Subtracted cDNA Library 25B 1 8 Supplement 55 Lamar E E and Palmer E 1984 Y encoded spe cies specific DNA in mice Evidence that the Y chromosome exists in two polymorphic forms in inbred strains Cell 37 171 177 Tedder T F Strueli M Schlossman S F and Saito H 1988 Isolation and structure of a cDNA encodin
361. s to all templates and the forward primer SAGE tag specific shares the same sequences on the 5 end Specificity is conferred only by the last 10 bases on the for ward primer representing the unique 10 base SAGE tag One may also choose to incorporate an additional SAGE tag base information that the SAGE 2000 software can extract from the raw data The SAGE tag specific PCR is ex ecuted with a prolonged touchdown using an automatic hot start Tag polymerase 1 e Plat inum Taq Invitrogen As a 15 cycle touch down requires 46 denaturing cycles betaine is used as a Taq polymerase protectant The authors strongly advise against switching to a proofreading DNA polymerase such as Pfu or Vent in the PCR reactions Proofreading enzymes have significant 3 5 exonuclease ac tivity which may digest the 3 end of the SAGE tag specific primer Even one base differences may reduce the specificity of the PCR product Designing of SAGE tag specific primers is a matter of much debate Only the 3 most ten bases of the oligonucleotide contains tag specific sequences and the rest of the primer at the 5 end consists of linker sequences which are shared by all the cDNAs in the amplified rSAGE library As a result the authors empir ically use CACATG XXXXXXXXXX as a guideline for primer design where the Xs refer to the specific sequence in the SAGE tag of in terest Only six bases are nonspecific and the relatively low anne
362. s to hybridize to complementary strands As a result of the vast excess of driver the majority of fragments common to both the driver and tester populations will rapidly form driver driver or tester driver complexes The fragments unique or at a relatively higher quantity in the tester will require a significantly longer period of time to completely hybridize and form tester tester complexes Perform selective amplification 35 Remove as much of the mineral oil as possible without losing the hybridizing mixture Dilute the DNA stepwise to a concentration of 0 1 ug ul by first adding 8 ul of 5 ug ul glycogen in TE buffer and mixing by pipetting then adding 23 ul TE buffer and again mixing by pipetting and finally adding 364 ul TE buffer and vortexing 36 To fill in the adapter ends make two tubes of PCR mix not containing 24 mer 235 ul water 80 ul 5x RDA PCR buffer 32 ul dNTP chase solution 347 ul total volume Current Protocols in Molecular Biology 37 38 39 40 4l 42 43 44 45 46 Add 40 ul diluted hybridized DNA 4 ug to each tube Place tubes in thermal cycler set at 72 C This reforms priming sites at both ends of tester tester complexes necessary for exponential amplification of difference products Add 3 ul Taq DNA polymerase mix by pipetting and incubate an additional 5 min Add 10 ul 24 mer primer O primer set mix by pipetting and overlay with mineral oil If using a 96 well
363. samples with each other Moreover no prior knowledge about the RNA to be analyzed is required rendering these methods suitable for analysis of RNA from any source Neverthe less in some hands the application of these protocols was not always satisfactory De bouck 1995 due to insufficient reproducibil ity Malhotra et al 1998 a high rate of isolat ing false positive clones Poirier et al 1997 a biased representation favoring abundant tran scripts Ledakis et al 1998 and contamina tion of workspaces through closed tube walls by volatile sulfur compounds Trentmann 1995 The use of longer primers 1 e 20 mers Zhao et al 1995 improved reproducibility but not other problems To address these issues arbitrarily primed PCR was replaced by amplification of linker ligated restriction fragments Fischer 1995 Fischer et al 1995 Prashar and Weissman 1996 With this approach it is possible to generate and display exactly one fragment per cDNA thereby clearly increasing the sensitiv ity of the analysis Spiking experiments dem onstrated that following the RMDD protocol as described above an mRNA species at a relative concentration of 1 100 000 will usually be identifiable by a specific band This holds true for the radioactive as well as for the non radioactive version of the protocol 1 e the authors could not detect any differences in the sensitivity of RMDD regardless of whether biotin or 3P was used
364. scriptase Superscript IH Life Technologies Igepal wash buffer see recipe Tween 20 wash buffer see recipe 40 mM MgCl 2 mM dGTP 200 mM KH PO Tailing wash buffer see recipe Mineral oil Terminal deoxynucleotide transferase TdT Amersham Pharmacia Biotech Expand Long Template ELT PCR system Roche Diagnostics including 10x ELT buffer 1 17 5 mM MgCl 3 5 U ul DNA polymerase mix Current Protocols in Molecular Biology Discovery of Differentially Expressed Genes 25B 8 3 Supplement 70 Gene Expression Analysis of A Single or Few Cells 25B 8 4 Supplement 70 20 v v formamide PCR primer CP2 5 TCA GAA TTC ATG CCC CCC CCC CCC CCC 3 24 uM 1x PCR buffer Sigma Primers for B actin 5 CTA CGT CGC CCT GGA CTT CGA GC 3 and 5 GAT GGA GCC GCC GAT CCA CAC GG 3 Primers for EF 1a 5 GCA GTG CAC ACA CAG AGG TGT A 3 and 5 CTA CCG CTA GGA GGC TGA GCA A 3 0 75 U Tag DNA polymerase Sigma Magnet separation apparatus for 0 2 ml tubes Dynal 0 2 ml PCR tubes 15 to 50 ml tubes Roller bottle apparatus or other rotisserie type rotator Thermal cycler Hybridization oven or other rotator with temperature control Additional reagents and equipment for agarose gel electrophoresis UNIT 2 5A Lyse cells and isolate mRNA 1 Wash beads two times in an equal volume of washing buffer containing LiDS using the magnet Dynal beads are supplied as a solution and have to be
365. se Carry out the amplifications in a thermal cycler with the following parameters 1 cycle 2 min 94 C 30 sec 58 C 2 min 72 C 14 cycles 40 sec 94 C 30 sec 58 C 20 sec I2Z 15 45 cycles 40 sec 94 C 30 sec 58 C 30 sec 72 C 1 cycle 40 sec 94 C 30 sec 58 C 2 min 72 C indefinitely 4 C The number of cycles in the main part of the amplification can be 15 to 45 depending on the transcript abundance 20 Run PCR products on a 2 agarose gel containing 0 5 ug ml ethidium bromide Current Protocols in Molecular Biology Discovery of Differentially Expressed Genes 25B 8 7 Supplement 61 ALTERNATE PROTOCOL 1 ALTERNATE PROTOCOL 2 Gene Expression Analysis of A Single or Few Cells 25B 8 8 Supplement 61 EXTRACTION OF mRNA FROM SMALL TISSUE BIOPSIES This protocol is used to isolate and amplify mRNA from small biopsies that are obtained during diagnostic clinical procedures and do not undergo laser microdissection UNIT 25A 1 The fresh biopsy is immediately snap frozen in liquid nitrogen and stored in liquid nitrogen or at 80 C until lysis and mRNA preparation is performed Additional Materials also see Basic Protocol 1 Biopsy sample Liquid nitrogen Dry ice Mortar and pestle 1 Use only a small piece of the biopsy sample with a size of 1 to 1 5 mm in diameter 2 Using a mortar and pestle crush the frozen tissue sample in liquid nitrogen Prior to using the mortar and pestle dest
366. se chain reaction PCR to amplify cDNAs after each subtraction to prepare tracer and driver for the next subtraction This makes it possible to begin with very small quantities of cells and by performing repeated subtractions achieve maximal enrichment of differentially ex pressed genes in both cell populations The progress of subtraction is monitored by slot blot hybridization see Support Protocol Differentially expressed cDNA sequences are used to construct a subtracted cDNA library STRATEGIC CONSIDERATIONS For this method ds cDNA full length if possible and prepared from cell types A and B using oligo dT as first strand primer is the starting material The ds cDNA is digested by restriction endonucleases to obtain short cDNA fragments This prevents preferential PCR amplification of naturally small cDNAs Next each of the two cDNA samples is ligated to different adapters and amplified by PCR to obtain a large amount of material In the first and subsequent PCR amplification step both tracer and driver cDNAs are made for each cell type to allow subtractions in both directions The first subtractions are Ao tracer By driver and B tracer Ay driver Tracer cDNA is made partially radioactive so the success of subtractions can be monitored Driver cDNA 1s biotinylated during PCR by incorporating bio 11 dUTP to provide a basis for separation of hybrids and driver Tracer and driver are mixed denatured and allowed to reanneal
367. shaw S Harpavat S Trimarchi J Cai L Huang H Kuo W P Weber G Lee K Fraioli R E Cho S H Yung R Asch E Wong W H and Cepko C L 2004 Genomic analysis of mouse retinal development PLoS Biol 2 E247 Boon K Osorio E C Greenhut S F Schaefer C F Shoemaker J Polyak K Morin P J Beutow K H Strausberg R L De Souza S J Riggins G J 2002 An anatomy of normal and malignant gene expression Proc Natl Acad Sci U S A 99 11287 11292 Cai L Huang H Blackshaw S Liu J S Cepko C and Wong W H 2004 Clustering analysis of SAGE data using a Poisson approach Genome Biol 5 7 R51 Datson N A van der Perk de Jong J van den Berg M P de Kloet E R and Vreugdenhil E 1999 MicroSAGE A modified procedure for serial analysis of gene expression in limited amounts of tissue Nucl Acids Res 27 1300 1307 Current Protocols in Molecular Biology Gorski S M Chittaranjan S Pleasance E D Freedman J D Anderson C L Varhol R J Coughlin S M Zuyderduyn S D Jones S J and Marra M A 2003 A SAGE approach to discovery of genes involved in autophagic cell death Curr Biol 13 358 363 Halascheck Wiener J Khattra J S McKay S Pouzyrev A Stott J M Yang G S Holt R A Jones S J Marra M A Brooks Wilson A R and Riddle D L 2005 Analysis of long lived C elegans daf 2 mutants using serial analysis of gene expression Ge
368. sic Protocol 1 and PCR optimization UNIT 15 7 1 Obtain cells dissociated from perfusion fixed tissues as detailed above see Basic Protocol 1 using solutions tested to be free of RNase activity At this point immobilized RNase could be utilized to remove any contaminating RNA from the aliquoted cells as detailed above see Basic Protocol 2 step 3 however the author has tested extensively for specific RNAs in the supernatant of washed dissociated cells and has not detected extracellular RNA contamination This could reflect the inability of the reverse transcription reaction to detect one or just a few template molecules In contrast HSV DNA could occasionally be detected in the supernatant therefore eliminating it was imperative 2 Aliquot cells to be analyzed in a 1 ul volume into PCR tubes Add 4 ul proteinase K solution and incubate 60 min at 50 C After digestion add 0 25 ul freshly prepared 40 mM PMSF Preliminary analysis demonstrated the need for protease digestion of cellular proteins in isolated cells for complete DNase I digestion of genomic DNA however the high tempera tures required for heat inactivation of this enzyme led to degradation of RNA most likely through metal iton catalyzed hydrolysis Thus following digestion with proteinase K activity of this enzyme is selectively inhibited by adding freshly prepared PMSF 3 Add 0 75 ul RNase free DNase I Incubate 45 min at 37 C 4 Inactivate DNase by incubati
369. sitives Targets relatively abundant mRNAs 0 1 Only useful for comparing very different tissues Current Protocols in Molecular Biology Critical Parameters and Troubleshooting Some of the more common problems that arise with this procedure and their solutions are listed in Table 25B 2 2 RNA preparation It is essential to start with a clean preparation of RNA that is free of any salts or other sub stances that may inhibit reverse transcription The RNA should not be contaminated with even trace amounts of genomic DNA In fact all RNA preparations should be treated with RNase free DNase then checked for contami nating genomic DNA by PCR using primers for specific genes Contaminating DNA alters the representation of the various mRNAs during the subtractions to create false positives Purity of oligonucleotides The quality of the primers is crucial to the success of the procedure It is worth purifying Table 25B 2 2 Troubleshooting Guide for Subtractive cDNA Cloning Problem No amplified cDNAs visible on agarose gel Median size range of amplified cDNAs gt 500 bp in Ag and or Bo Low subtraction efficiency No or few colonies after cloning into vector No or few differentially expressed genes Probable cause s Failure of adapters to ligate to cDNA due to Kinasing of wrong primer Inactive ligation buffers and or enzymes Inhibitors in CDNA Failure of PCR amplification due to inactive ampli
370. specific genes Figure 25B 2 3 Sequence of subtractions The order of subtractions performed is outlined here for the first five subtractions The approximate timescale and the hybridization length for each subtraction is indicated along with the primary purpose for each subtraction Subtractions alternate between a short 2 hr subtraction with Ap or Bo as driver and a long subtraction 30 to 40 hr with A Or B as driver Ag and By are not normalized that is they contain an excess of abundant mRNAs or CDNAs and are therefore used to ensure that abundant common sequences are removed Conversely A A and B B are enriched for rarer sequences and therefore remove rare common sequences more efficiently than does Ap or B The progress of the subtractions is monitored by slot blot hybridization after every three to four subtractions When the degree of enrichment is satisfactory gt 20 fold differential that is when A hybridizes to itself better than to Bp gt 20 fold then the subtracted cDNAs A and B are cloned into appropriate vectors for clonal analysis CONSTRUCTION OF SUBTRACTED cDNA LIBRARIES This protocol describes preparation of libraries of subtracted cDNA clones that represent differentially expressed genes prepared from two cell populations Each cDNA 1s ligated to a specific adapter and then the two sets of cDNAs are amplified by PCR to provide large amounts of starting material Part of the starting material
371. specimens and stabilize them for long term storage and sectioning also see UNIT 14 2 Tissue 1s embedded in a viscous compound such as optimal cutting temperature OCT Tissue Tek medium and rapidly frozen on dry ice For long term storage 1 e months to years liquid nitrogen offers the best preservation of protein and RNA Storage at 80 C is adequate for shorter time periods 1 e a few days to several weeks Contributed by Andra R Frost Isam Eldin Eltoum and Gene P Siegal Current Protocols in Molecular Biology 2001 25A 1 1 25A 1 24 Copyright 2001 by John Wiley amp Sons Inc SECTION A UNIT 25A 1 BASIC PROTOCOL 1 Discovery of Differentially Expressed Genes 25A 1 1 Supplement 55 Laser Capture Microdissection 25A 1 2 Supplement 55 Materials Embedding medium e g OCT Tissue Tek cm maximum dimension tissue samples Cryomolds Tissue Tek Dry ice container with lid Aluminum foil Microm cryostat refrigerated to 20 C with tissue platform chuck and appropriate blades Richard Allan Scientific Glass slides e g Gold Seal plain uncoated slides Becton Dickinson No 2 pencil or slide marker Slide boxes optional Embed tissue l Place a labeled empty cryomold on dry ice in a container for 1 min Keep on dry ice during the entire embedding procedure Cover the bottom of the cryomold with 2 to 3 mm embedding medium Place the tissue to be frozen against th
372. ssemble and load cytospin devices 1 Assemble the sample chamber cytospin device with clean glass slides according to the manufacturer s instructions Plain uncoated charged or silanized glass slides can be used Current Protocols in Molecular Biology 2 Load the assembled collection chamber devices into the support plate of the cytospin instrument They must be secure freely tiltable and symmetrically distributed Add samples and spin 3 Pipet low cellularity sample into sample chambers The optimal amount of specimen will vary with its cellularity Samples of low cellularity will require 300 to 400 ul per chamber highly cellular samples will require only 100 to 200 ul per chamber 4 Press closure cap on each sample chamber 5 Lock the lid of sealed head and close the cytospin cover 6 Program cytospin for 3 min at 1500 rpm on high acceleration and press start Rapidly fix cytospins 7 When the alarm signaling the end of the spin sounds quickly remove the assembled collection chambers Open the chambers and remove the slides by lifting the blotter away from the slide This method avoids damage of cell membranes and thus smearing 8 Quickly transfer slide into 95 ethanol without allowing the specimen to dry Fix 10 min Transfer slide to 70 ethanol for 30 sec 9 Proceed to H amp E staining see Basic Protocol 5 or other stain of choice REMOVING BLOOD FROM SAMPLES FOR CYTOLOGIC SMEARS OR ALTERNATE CYTOSPINS PRO
373. stain is the most commonly used stain for examination of histologic sections and diagnostic histopathologic criteria are based on its use in veterinary and human pa thology practice therefore it is frequently used for LCM even though hematoxylin may bind to nucleic acids causing adverse effects during PCR Other stains such as methyl green and nuclear fast red have been recommended as alternatives and literally hundreds of others exist in clinical practice and for research appli cations Ohyama et al 2000 however H amp E stained LCM samples have recently been shown to amplify equally as well as samples stained with methyl green toluidine blue O or azure B Ehrig et al 2001 This is likely due to the relatively small size of LCM samples Discovery of Differentially Expressed Genes 25A 1 19 Supplement 55 Laser Capture Microdissection 25A 1 20 Supplement 55 which thus contributes only a small amount of hematoxylin to the PCR reaction mix It is also recommended that the duration of staining with hematoxylin be minimized to decrease the con centration present Eosin has been reported to interfere with PCR analysis utilizing the TaqMan instrument and can appear on electro phoretic gels when relatively large numbers of cells are captured for protein analysis Banks et al 1999 Ehrig et al 2001 Consideration should be given to minimizing or eliminating its use when samples will be utilized for either o
374. sue sec tion or sample If multiple sections or samples are required to procure an adequate number of cells the time required for staining additional sections should be added This also assumes that the samples are well prepared and mi crodissected efficiently and that the cells of interest are easy to identify and locate Some skill is also required in operating the joystick in combination with laser firing and in being able to identify the tissue and cell type of interest The time required for lysis of the cells from the cap depends on the buffer and the method of sample preparation We have found frozen tissue will be completely removed from the cap by Stat 60 after 5 min Formalin fixed paraf fin embedded tissue in buffers containing pro teinase K requires significantly more time and may require an overnight incubation at 37 C Literature Cited Arnold M M Srivastava S Fredenburgh J Stockard C R Myers R B and Grizzle W E 1996 Effects of fixation and tissue processing on immunohistochemical demonstration of spe cific antigens Biotechnic Histochem 71 224 230 Banks R E Dunn M J Forbes M A Stanley A Pappin D Naven T Gough M Harnden P and Selby P J 1999 The potential use of laser capture microdissection to selectively obtain dis tinct populations of cells for proteomic analy sis preliminary findings Electrophoresis 20 689 700 Bohm M Wieland I Schutze K and Rubben
375. sues the impact of manipulating the living tissue on the process under study must be considered In addition some adult cell types most notably neurons can be recovered only at low efficiency with the majority bursting during the process Pretlow and Pretlow 1982 This unit details a protocol for the separation of solid tissues into single cell suspensions for subsequent analysis of nucleic acids and protein This protocol was developed using mice with the major focus being the analysis of the interaction of herpes simplex virus HSV with the neurons of the trigeminal ganglia Sawtell 1997 The balance between fixation and dissociation should be determined for the particular tissue of interest It has been determined however that the dissociation protocol is directly useful for several other mouse tissues including liver heart skeletal muscle lung pancreas brain intestine and reproductive organs Kidney yields a combination of single cells and multicellular tubular structures The adaptation of the method to other laboratory animals has not been fully explored Again the appropriate balance between fixation and dissociation would need to be determined for other species of interest Using the approach of adjusting the volume of the fixative perfused through the animal to achieve this balance the author s laboratory has determined that the method is directly useful for guinea pigs Tissues are fixed in situ by perfusion see Basic Pr
376. sults Isolate and reamplify sample band 15 Cut out differential bands with a scalpel and transfer to microcentrifuge tubes each containing 20 ul TE buffer pH 8 0 Make sure that membrane pieces do not become dry during this procedure Using the scalpel tip immediately submerge bands in the buffer Rinse scalpel carefully before excising the next band If excision is not intended to occur immediately wet membranes can be stored I to 2 days at 4 C however during prolonged storage wet membranes tend to become blotched It is therefore advisable to dry membranes after at most one week To avoid fading after drying membranes should be kept dark indefinitely at room temperature 16 For band reamplification transfer half of the respective piece of membrane into a PCR tube containing 30 ul of the following mixture 4 0 ul buffer from the tube in which the band was stored 3 0 ul 10x PCR buffer 2 25 ul 20 mM MgCl 0 6 ul 10 mM dNTPs 13 85 ul H O 3 0 ul 4 uM CP28 3 0 ul 4 uM ML18 0 3 ul 5 U ul Tag DNA polymerase 17 Amplify under the following conditions Initial step 1 min 94 C denaturation 20 or 25 cycles 20 sec 94 C denaturation 20 sec 65 C annealing 2 min 72 C extension Final step indefinitely 10 C hold Amplification takes place for 20 cycles strong bands or 25 cycles weak bands respec tively Do not use biotinylated primers for band reamplification 5 modification of oligonu cleoti
377. t 4 C This lysis buffer has been found to be useful for analysis of membrane bound proteins Simone et al 2000 For cytoplasmic proteins T Per tissue protein extraction liquid reagent Pierce Chemical has been recommended Simone et al 2000 It has also been suggested that the addition of protease inhibitors such as 4 2 aminoethyl benzenesulfonyl fluoride Boehringer Mannheim to the buffer increases the yield of protein Banks et al 1999 Ornstein et al 2000a COMMENTARY Background Information Technologic advances in gene sequencing and amplification techniques are allowing the identification of alterations in genes proteins and biochemicals that can explain the etiology and pathogenesis of many disease processes however the efficacy of these technologies de pends on the identity and the purity of the cells being analyzed Physical homogenization of tissues results in a mixture of many cell types 1 e Some are normal or minimally altered com ponents while others may be significantly dis eased Alterations detected in such homogen ates cannot be localized to a particular cell type Multiple mechanical methods for separating cells of interest from tissues have been de scribed especially as related to histologic sec tions Sirivatanauksorn et al 1999 but their methodology is time consuming extremely la bor intensive and often imprecise Laser Cap ture Microdissection LCM is one of the new
378. t discovery particularly in organisms for which little or no sequence information is available The technology is complementary to microarray based transcript imaging techniques that rely on prior charac terization of the gene sequences Critical Parameters and Troubleshooting AFLP analysis of genomic DNA is a very robust technology that has been used by numer ous laboratories around the world for the past five years Very few technical problems are generally encountered Vos etal 1995 Vos and Kuiper 1998 however the quality of the poly A RNA and resulting ds cDNA is critical to its success The authors advise that the pro tocols for poly A RNA isolation from total RNA and the synthesis of ds cDNA be strictly followed Despite the robustness of AFLP there are several theoretical and technical reasons why specific transcripts might not be displayed These include 1 low transcript abundance 2 the absence of relevant restriction enzyme sites in the transcript and 3 features of the tran script that prevent efficient reverse transcrip Discovery of Differentially Expressed Genes 25B 5 13 Supplement 57 1 2 2 2 A C G T A1A2A3B1B2B3 AB AB AB AB Figure 25B 5 4 cDNA fingerprint of Aspergillus niger that displays a very typical result for AFLP technology Samples A1 to A3 represent three different samples which have been taken inde pendently through the procedure of RNA isolation cDNA synthesis
379. te out the subtracted library UNIT 6 1 It is worth titrating the library first UNIT 1 3 to obtain individual colonies It is also important to determine the percentage of colonies that have inserts and the sizes of the inserts UNIT 5 8 The insert size should be 250 bp If the insert size is gt 500 bp consider the possibility that the inserts may be double inserts 37 Prepare four replica lifts from each primary filter UNIT 6 2 38 Denature neutralize and cross link the lifts according to the manufacturer s instruc tions also see UNIT 6 2 39 Use subtracted probes see Support Protocol step 5 to hybridize the replica filters Comparison of filters probed with A versus B identifies those clones that are probably differentially expressed in the starting A and B cDNAs and also indicates what proportion of the library contains differentially expressed genes Further rounds of subtraction may be desirable if only a small number of the clones seem to be differentially expressed The filter probed with a common abundant gene should give very few or no positive signals if the subtractions were done to completion Finally probing with a known differentially expressed gene s gives another indication of how well the subtractions have worked If the library evaluation suggests that no further subtractions are needed analyze individual clones in the library Sort through the library The number of differentially represented cl
380. temers Separate concatemers on a 10 to 12 polyacrylamide TBE gel uniT 2 7 Load 1 kb DNA marker in first lane leave one empty lane and then load the entire concatenated sample into the third well Run samples 45 min at 200 V Stain and visualize as described in step 37 Isolate regions of interest Concatemers will form a smear on the gel with a range from 100 bp to several kilobases The authors usually isolate regions 600 to 1200 bp and 1200 to 2500 bp These size ranges clone efficiently and yield ample sequencing information Place each gel piece into 0 5 ml microcentrifuge tubes which have an 0 5 mm diameter hole in the bottom Microcentrifuge as described in step 39 Current Protocols in Molecular Biology Discovery of Differentially Expressed Genes 25B 6 11 Supplement 80 Serial Analysis of Gene Expression SAGE 25B 6 12 Supplement 80 61 62 63 64 Discard the 0 5 ml microcentrifuge tubes Add 300 ul LoTE buffer to the gel pieces in the 2 0 ml microcentrifuge tubes Vortex each tube and incubate 15 min at 65 C If desired this incubation can be extended to overnight but yields are not significantly increased Note that ammonium acetate is not required for high molecular weight molecules Add 5 ul LoTE to the membrane of each of four Spin X microcentrifuge tube filters Transfer contents of each tube to two Spin X microcentrifuge tube filters four total Microcentrifuge each
381. ter ligation Msel primer 0 Msel 5 GACGATGAGTCCTGAG TAA Internal sequence Tagl adapter 3 5 GACGATGAGTCCTGAG TAA 3 Msel primer 1 1 T 5 GACGATGAGTCCTGAG TAA T 3 Msel primer 2 2 C 5 GACGATGAGTCCTGAG TAA TC 3 Adapter top strand and primer sequences for Taql Adapter End 5 CTCGTAGACTGCGTACA CGA Internal sequence Msel adapter 3 5 CTCGTAGACTGCGTACA CGA 3 Taql primer 1 1 A 5 CTCGTAGACTGCGTACA CGA A 3 Taq primer 2 2 G 5 CTCGTAGACTGCGTACA CGA AG 3 After adapter ligation Tagl primer 0 Figure 25B 5 3 Schematic of primer design compete with primer annealing during AFLP amplification This hypothesis is supported by the observation that amplification of Msel Msel fragments is efficient when two different Msel adapters are used for template preparation and two corresponding Msel primers are used for amplification P Vos unpub observ In the protocol outlined in this chapter dou ble stranded cDNA is restriction digested with Taql and Msel and adapters for these two restriction endonucleases are ligated to the re sulting restriction fragments Adapters create a target site for the AFLP primers in the sub sequent amplification reactions The adapter ligation is performed in a way that the original Taql and Msel sites are not restored After adapter ligation the TagI MselI restriction frag ments have from 5 to 3 a universal sequence at the JagI end Taq I
382. terol O acyltre GGGGGGGTCC T 9 10 3 6 0 553663 Hs 421257 RPL Ribosomal proteii TTTTTTTCcT 10 11 10 10 46 0 00042344 Hs 195471 PFKFB3 6 phosphofructc TTITTITTAA 10 11 10 435 0 000314162 Hs 136900 NARCH I Nemorane assoac TTTTTTT TAA 10 11 3 10 435 000314162 Hs 33642 ARCNI Archain 1 20002 TTTTTTTTAA 10 11 9 10 45 000314162 Hs 366160 FCDHGC3 Protocadherin TTTTTTTTTC 10 10 9 10 48 8 94093e 05 Hs 371903 GYPE Glycophorin E TTTTTTTTTC 10 10 9 10 45 8 94093e 05 Hs 424788 TTC13 Tetratricopeptic TTTTTTTTT 10 10 9 10 47 0 00013 6754 Hs 511311 ATP amp EB4 ATPase Class TTTTTTTTTT 10 11 11 9 46 0 000369744 Hs 467634 OaCT2 O acyltransfera TTITTITTITT 10 11 il J 48 0 000369744 Hs 224947 CDC20 CDC20 cell divi Figure 25B 6 8 Annotated results after tag matching with SAGEmap Column 1 is the SAGE tag columns 2 to 6 are five different SAGE libraries column 7 is calculated P value column 8 is organism Hs homo sapiens column 9 is unigene ID column 10 is gene symbol and gene description number of clusters k We have found that Poisson based clustering is generally most robust algorithm for analyzing SAGE data Cai et al 2004 The number of clusters can not be more than the number of tags genes contained in the data file It is recommended that users test a range of values for k A more detailed discussion of how to set the value for k is found in Hartigan 1975 To start cluster analysis users begin with Step 3b as shown in Figu
383. ters Whatman Dialysis tubing 6 000 to 8 000 MWCO Spectra Pore Flat blunt forceps 18 G needle Representational Difference Analysis 25B 7 2 Supplement 60 Current Protocols in Molecular Biology Additional reagents and equipment for restriction digestion UNIT 3 1 agarose gel electrophoresis UNIT 2 5A ethanol and isopropanol precipitation UNIT 2 1A and quantifying DNA by absorbance spectroscopy APPENDIX 3D gel isolation UNIT 2 6 and sequencing UNIT 7 1 NOTE Use de ionized distilled water in all recipes and protocol steps and ensure that the water is RNase DNase free Since minute amounts of contaminating DNA may be detected by RDA use barrier pipet tips throughout the protocol Prepare amplicons and representation Enzyme restriction of tester and driver DNA 1 Using 10 U enzyme per microgram DNA and a total volume of 200 ul each separately digest 5 ug tester and driver DNA samples with the restriction enzyme chosen for representation UNIT 3 1 Analyze 40 ul 1 ug of each reaction by electrophoresis on a 1 agarose gel UNIT 2 54 to confirm complete digestion Bring volume of remaining digest to 400 ul each with water This step provides three to four times the DNA needed for the preparation of amplicons therefore if the amount of starting DNA is a limiting factor as little as I to 2 ug DNA can be used Bell BamHI and HindIII are the enzymes which were used in the original RDA publica tion by Lisits
384. that the unknown gene is cloned using 3 cDNA fragments Current Protocols in Molecular Biology mRNA priming and AAAAA cDNA synthesis TTT TTT M13 Ascl KB tag sequence Nialll digestion and capture on CATGNNNNNNNNNN AAAAA streptavidin magnetic beads NNNNNNNNNN _ TTTTT O0 F gt tag sequence primer 2 site mati CATGNNNNNNNNNN____AAAAA ligation of annealed linkers i linker 2A 2B STACNNNNNNNNNN _TTTTT M13 Asc OD D primer 2 site tag sequence release of cDNA with Asc linker 2A 2B CATGNNNNNNNNNN__AAAAA GTACNNNNNNNNNN gt TTTTT M13 tag sequence i l CATGNNNNNNNNNN AAAAA generation of amplified rSAGE library linker 2A 2B ale GTACNNNNNNNNNN TTTTT M13 PCR with primer 2 and M13F ie CATGNNNNNNNNNN AAAAA generation of rsAGE cDNA product GTACNNNNNNNNNN TTTTT M13 PCR with SAGE tag specific primer and M13F agarose gel purification of PCR product TA cloning into pCR4 vector sequencing Figure 25B 6 2 Steps of an rSAGE experiment that are the most 3 sequences containing the anchoring enzyme recognition sequence This approach provides increased specificity of cloning the appropriate cognate cDNA from an anonymous SAGE tag Figure 25B 6 2 summarizes this procedure The starting material is total RNA that ex presses the target gene and as a result the anonymous SAGE tag Double stranded cDNA is synthesized by mRNA priming with a biotinylated poly dT oligonucleotide
385. the implementation of which have resulted in enhanced fidelity and overall utility of this evolving technique Isolation of RNAs that are undegraded and that are free of contaminating DNA is necessary to select optimally for expressed genes see Quality of RNA below A considerable num ber of articles propose modifications in choice of primers for both reverse transcriptase and PCR steps Single base oligo dT anchored primers reduce the number of reactions and redundancy Liang et al 1994 A recent study proposes primer sequences based on frequen cies of gene sequences Pesole et al 1998 Longer arbitrary primers seem to enhance the reproducibility of the differential display pat terns Liang et al 1994 Zhao et al 1995 Labelling the PCR products with S or gt P deoxynucleotides has safety advantages over 7P Trentmann 1995 Bands may be visualized nonradioactively with silver staining or fluorescence Improved methods for cloning differential display products have also been proposed Comes et al 1997 Wybranietz and Laurer 1998 One band on a sequencing gel often contains more than one cDNA and the contaminating band can generate a false northern signal if its mRNA is very plentiful For avoiding false positives cloning strategies Zhao et al 1996 restriction cutting Prasher and Weissman 1996 nested PCR reamplification Zhang et al 1996 Martin et al 1998 and single strand conformation pol
386. the resulting cDNA was cloned Hedrick et al 1984 Thus a large percentage of the clones in the subtracted library were T cell specific All clones in the subtracted li brary would have been present in a library constructed from the T cell line without the subtraction step the objective was to obtain a library so enriched that clones derived from it could be screened by random selection Two major disadvantages to the approach outlined above are that poly A RNA from both and source is required and the hybridizations hydroxylapatite columns and library production with a very small amount of cDNA are technically difficult A conceptually different approach termed deletion enrich ment has been undertaken in the construction of a genomic library enriched for Y chromo some specific sequences Lamar and Palmer 1984 In this case DNA male and an excess of DNA female fragments were mixed denatured hybridized and DNA that did not hybridize to was selected by a cloning step Production and selection of a library were accomplished simultaneously The subtracted cDNA library protocol de scribed here is an adaptation of the deletion enrichment method to cDNA libraries and is recommended over the other because 1 it is conceptually and practically simple involving only standard laboratory techniques 2 it does not involve the handling of RNA which can be problematic 3 it may be performed w
387. the view that disturbances in structure and function of individual cells form the basis of disease Current understanding of the interac tive nature of the cells comprising an organism have substantiated this view Itis now clear that cells differentiate and function according to the summation of the molecular cues arising from many other cells in the organism Gilbert 1994 It follows that certain important aspects of the molecular behavior of individual cellular components can only be observed in the context of the organism Current Protocols in Molecular Biology Reported here is a strategy contextual ex pression analysis CXA that combines the cell specific information of in situ approaches with the analytical and quantitative potential of solution PCR Sawtell 1997 Cells are chemi cally stabilized in the context of the organism and subsequently isolated PCR can then be utilized to gain insight into the molecular proc esses of a single cell among billions The enzymatic dissociation of living tissues has been widely used and refined for many specific tissue types Pretlow and Pretlow 1982 Inherent in this process are cellular mo lecular changes induced by disruption of con text In order to prevent these changes tissues Discovery of Differentially Expressed Genes 25A 2 13 Supplement 58 Preparation of Single Cells from Solid Tissues for Analysis by PCR 25A 2 14 Supplement 58 are stabilized by
388. three tubes 200 ul each with the following 200 ul sample 66 ul 7 5 M ammonium acetate 2 ul SeeDNA 3 ul glycogen 825 ul 100 ethanol Incubate 10 min in a dry ice methanol bath then microcentrifuge 15 min at 4 C Wash two times with cold 75 ethanol each Resuspend each DNA sample on ice in 2 5 ul cold LoTE buffer and pool 7 5 ul total It is critical to keep the purified ditags on ice until the ligation buffer is added Ditags with a high A and T content can denature at room temperature even in LoTE buffer Ligate ditags to form concatemers 59 56 57 58 29 60 Mix the following 7 ul pooled purified ditags 2 ul 5x T4 DNA ligase buffer 1 ul 5 U ul high concentration T4 DNA ligase Incubate 1 to 3 hr at 16 C Do not ligate overnight as this will result in long concatemers that are difficult to clone The authors usually ligate for 2 hr with good results The length of ligation time depends on the quantity and purity of the ditags Typically several hundred nanograms of ditags are isolated and produce large concatemers when the ligation reaction is performed for I to 3 hr at 16 C lower quantities or less pure ditags will require longer ligations After completing ligation add 2 5 ul of 5x loading buffer to the ligation reaction Heat samples 5 min at 65 C and immediately place on ice The heating step melts annealed sticky ends and is critical for obtaining a good yield of clonable conca
389. times Incompletely infiltrated tissues cannot be properly sectioned and may tear or break free of Paraplast blocks Embedded tissue samples must not settle to the very bottom or edge of the base mold To avoid tissue breakage during sectioning samples should be completely surrounded by Paraplast at least 2 mm thick Perform microtome sectioning 15 Trim Paraplast blocks into a trapezoidal shape ensuring that the top and bottom edges of the block are parallel to each other and to the edge of the microtome knife blade Section the blocks on a rotary microtome typically 10 um sections are used The individual tissue sections will remain attached to both the preceding and the sub sequent sections to form a serial ribbon of tissue sections that can be handled using fine pointed paintbrushes Do not handle tissue ribbons with the fingers the heat generated by the human hand is sufficient to partially melt the paraffin sections which will adhere to the fingers if handled Microtome sectioning causes considerable tissue compression Allow for 25 ribbon expansion in all dimensions when cutting ribbons to place on slides in order to pre vent overcrowding of sections For helpful hints on tissue sectioning techniques and troubleshooting consult Plant Microtechnique and Microscopy by S Ruzin 1999 16 Use a razor blade to trim ribbons containing sectioned samples of interest to fit onto microscope slides Using a fine pointed
390. tion P A L M Mikrolaser Technologie http www palm mikrolaser com however currently Arcturus Engineering is the only manufacturer of instrumentation for LCM Arcturus Engineering hittp www arctur com can be contacted for details about the various LCM systems available and the current prices of instrumentation and consumables In this unit protocols for the preparation of mammalian frozen tissues see Basic Protocol 1 fixed tissues see Basic Protocol 2 and cytologic specimens see Basic Protocols 3 and 4 for LCM including hematoxylin and eosin staining H amp E see Basic Protocol 5 and UNIT 14 5 are presented as well as a protocol for the performance of LCM utilizing the PixCell I or IJ Laser Capture Microdissection System manufactured by Arcturus Engineering see Basic Protocol 6 Also provided is a protocol for tissue processing and paraffin embedding see Support Protocol and recipes for lysis buffers for the recovery of nucleic acids and proteins see Reagents and Solutions The Commentary section addresses the types of specimens that can be utilized for LCM and approaches to staining of specimens for cell visualization see Critical Parameters Emphasis is placed on the preparation of tissue or cytologic specimens as this is critical to effective LCM Resources available on line are given at the end of the unit see Internet Resources PREPARATION OF FROZEN SECTIONS FOR LCM Embedding and freezing is a way to preserve
391. tion are performed using subtracted cDNAs from the previous round as template for PCR synthesis of tracer and driver cDNAs Additional rounds of subtraction with alternating short and long hybridization steps continue enriching for the differentially expressed genes 30 Repeat the subtractions steps 15 to 29 using A or B tracer cDNA and the appropriate driver cDNA as determined by the subtraction strategy see Fig 25B 2 3 Use Ag or Bo drivers for short 2 hr hybridizations and A or B drivers for long 30 to 40 hr hybridizations Monitor the progress of subtraction by slot blot hybridiza tion see Support Protocol Between five and twenty rounds of subtraction are usually sufficient to isolate cDNAs for differentially expressed genes Clone subtracted cDNAs Subtracted cDNAs are ligated into a vector and cloned to permit screening of individual clones 31 Amplify 5 ul of the subtracted cDNAs A and B using the program described in step 13 Purify PCR products with a commercial anion exchange PCR spin column e g Qiagen UNIT 2 1B 32 Digest the cDNAs with the appropriate restriction endonucleases that cut within the adapters e g EcoRI and EcoRV for the adapters used here Taq DNA polymerase may survive phenol chloroform extraction so it may help to purify the cDNAs by treating the amplified reaction with proteinase K extracting with phe nol chloroform and precipitating with ethanol before digestion Digestion
392. tissue or organ These procedures include methods based on hybridization to microarrays of known expressed sequence tag EST sequences Schena et al 1995 De Risi et al 1997 sequence based approaches like SAGE Velculescu et al 1995 UNIT 258 6 and random EST sequencing Adams et al 1991 and protocols based on display of cDNA fragment patterns on high resolution gels Liang and Pardee 1992 UNITS 25B 3 amp 25B 4 In the last category is transcript profiling based on amplified fragment length polymorphism AFLP fingerprinting of double stranded cDNA Zabeau and Vos 1993 Vos et al 1995 Bachem et al 1996 The protocol illustrated in Figures 25B 5 1 and 25B 5 2 includes the following steps 1 the isolation of poly A RNA from total RNA unT4 2 2 the synthesis of a double stranded ds cDNA library 3 the preparation of template fragments by digestion of the cDNA library with a combination of two restriction enzymes and the ligation of adapters to the fragment ends 4 the selective amplification of specific subsets of fragments and 5 the electrophoretic analysis of these amplification products on standard denaturing polyacrylamide gels The protocol given in this unit describes all steps in the procedure except the isolation of total RNA however any of the presently used methods is acceptable e g UNIT 4 2 The restriction enzyme combination EC used in this protocol is Taql Msel This EC will target the majorit
393. to form ditags These are then amplified via the PCR primer sites incorporated into the linkers and then recleaved with N alll These cleaved ditags are purified and ligated together to form concatemers of tags which are then subcloned into plasmid vectors to create a SAGE library Individual clones are then sequenced and analyzed via SAGE analysis software SAGE software identifies and discards any sets of duplicate ditags 1 e a given combination of any two individual tags to control for PCR amplification bias It can also be used to prepare a tag report listing all tags and their abundance in a given library or a tag comparison file listing the tag abundances in a number of different libraries An overview of the microSAGE protocol is shown in Figure 25B 6 1 mRNA capture and AAAAA cDNA synthesis rt ttt OD Nialll digestion o j TT OD linker 1 ligation Fa S linker 2 ligation ME AAS cA AMAMA FD BsmF digestion __ CATGN CATGNNNNNNNNNN and blunt ending primer 1 BsmF GTACN GTACNNNNNNNNNN ditag ligation he ata EAA CATG colnet hd GTAC NNNNNNNNNNNNNNNNNNNN lt lt amplification ditag cleavage concatenation and subcloning CATGNNNNNNNNNN CATGNNNNNNNNNNNNNNNNNNNNCATG GTACNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNGTAC Figure 25B 6 1 The steps of a SAGE experiment Serial Analysis of Gene Expression SAGE 25B 6 2 Supplement 80 Current Protocols in Molecular Biology M
394. to group tags 1 e genes with significant changes in expression levels that behave similarly under different conditions It has been applied in a number of genomics studies in mouse retinal development Blackshaw et al 2004 fetal gut development Lepourcelet et al 2005 and diseases such as cancer Allinen et al 2004 Lepourcelet et al 2005 There are two user platforms for the SAGE Data Analysis Application one is an online Web based application and the other is a Microsoft Windows desktop based application stand alone version can be downloaded from http genome dfci harvard edul sager Both platforms perform the same set of analyses the difference being that the Web based application does not require users to download and install the application onto a local computer All data analyses are performed interactively The potential drawback of the Web based application is that users need to submit their SAGE data onto the online application Web server which may risk the exposure of data to the public If data security is a concern the authors recommend that users use the Windows desktop based application The instructions in this protocol describe use of the online version Materials Hardware Computer with Internet access Software An up to date Internet browser such as Internet Explorer http www microsoft com ie Netscape http browser netscape com Firefox hittp www mozilla org firefox or Safari http www
395. tracking beam 12 Once LCM is achieved successfully with the test pulses proceed to microdissect the remainder of the desired cells Collect microdissected cells 13 After completing the intended microdissection lift the placement arm Assess the completeness of the capture by inspecting the microdissected tissue and the cap as described above Laser Capture Microdissection 25A 1 12 Supplement 55 Current Protocols in Molecular Biology i i r ri j a j za Pier i oF FG r re i re ot pi i l Pil 1 fd Ta E ag HAY ti es EH ti pats Ja AN Phos Figure 25A 1 3 LCM of ductal carcinoma in situ A The area of ductal carcinoma in situ prior to LCM B The same focus after LCM C The microdissected focus on the transfer film Cap 14 Swing the placement arm with the cap towards the right to the unload platform and place the cap in the designated slot Move the placement arm without lifting it to the left and place in a resting position 15 Using the cap insertion tool pick up the cap from the unload platform by sliding the insertion tool along the guide rail until the cap is engaged in the tool Remove the cap from the unload platform by lifting the insertion tool The open end of the insertion tool should face the cap Because tissue and cells that were not selected for capture may nonspecifically stick to the surface of the cap it is important to remove this unwanted tissue This can be accomplis
396. tral buffered formalin NBF Richard Allan Scientific 70 80 95 and 100 ethanol Xylene Embedding paraffin Tissue cassettes Automated tissue processor Embedding mold Tissue Tek Embedding center optional Leica Fix tissue l Place fresh tissue in a volume of fixative that is 210x the tissue volume so that the fixative surrounds the tissue on all sides Unfixed tissue that floats should be covered by a layer of gauze or paper towel to ensure the tissue is under the fixative Fixation can be carried out at room temperature or 4 C Fixation at 4 C slows down the autolytic process and can be useful for larger specimens Fix the tissue for an appropriate amount of time The time required for fixation is dependent on the size of the tissue and the speed with which the fixative penetrates the tissue Formalin and 95 ethanol penetrate at a rate of 1 mm hr Fixation time and tissue size should be adjusted as necessary For any fixative used a fixing period of 16 to 24 hr is recommended to provide complete tissue fixation however a fixation period of lt 6 hr provides better recovery of DNA than longer fixation times http www arctur com Optional Trim tissue sections from larger fresh or fixed tissue specimens so that they are no more than 3 mm in thickness and no larger than the dimensions of the cassette used for tissue processing Place one section in each cassette Again 1 cm maximum dimension is ideal
397. transcripts will be represented more frequently than rare transcripts Additionally each original transcript may be represented by multiple clones because the original cDNA was digested into fragments before subtraction In theory because the restriction endonucleases Alul and RsaI have 4 bp recognition se quences digestion should produce approxi mately four 250 bp fragments per kilobase Current Protocols in Molecular Biology original mRNA In practice digestion yields one to two fragments per gene If the subtrac tions have been performed exhaustively then theoretically every clone in the subtracted li brary should be differentially expressed Fur thermore it should be possible to isolate genes that are 2 to 3 fold differentially expressed between two given tissues and whose abun dance is as little as 5 copies mRNA cell how ever the isolation of rare differentially ex pressed genes is dependent on the complexity of the starting tissues Time Considerations A time schedule for this procedure is pre sented in Table 25B 2 3 This schedule is ap proximate and assumes that the procedure starts with double stranded cDNA see Fig 25B 2 3 Literature Cited Buckbinder L and Brown D D 1992 Thyroid hormone induced gene expression changes in the developing frog limb J Biol Chem 267 25786 25791 Davidson E H 1986 Complexity of maternal RNA In Gene Activity in Early Development 3rd ed pp 50 55 Academic
398. tually identical to those obtained with total RNA On the other hand mRNA isolation is a potential source of variation and should therefore be avoided DEPC treatment will not usually be required for RNase free water 2 Assemble components for first strand synthesis on ice 29 1 ul total 17 0 ul freshly denatured RNA with cDNA primer 3 0 ul 100 mM RNase free DTT 6 0 ul 5x SuperScript buffer 1 5 ul 10 mM RNase free dNTPs 0 6 ul 40 U ul RNase inhibitor e g RNasin 1 0 ul 200 U ul SuperScript II reverse transcriptase Mix well and incubate 1 hr at 42 C Stop reaction by placing on ice Incubation is best done in a water bath or thermal cycler Hot air ovens do not guarantee sufficiently quick heating of samples To check for possible RNA degradation in the course of first strand synthesis due to RNase contamination 0 5 to I ul of the first strand synthesis reaction can be analyzed on a 1 standard agarose gel UNIT 2 5A no special RNA gel is required watching for undegraded ribosomal RNA bands Synthesize second strand cDNA 3 Assemble on ice the following components 207 2 ul total for second strand synthe SIS 48 ul 5x second strand buffer II 3 6 ul 10 mM dNTPs 148 4 ul H O 1 2 ul 1 5 U ul RNase H 6 0 ul 10 U ul E coli DNA polymerase I 4 Combine first strand and second strand synthesis reactions Mix and incubate for 2 Restriction hr at 22 C After completion of second strand synthesis inactivate DNA po
399. tweezers A C D e cell type e density gradient centriguation J A B e mutation D B e marker e nucleic acid sequence e histochemical e protein e enrich Separate analyze groups or individual cells e PCR amplification strategies e DNA e mutation frequency e viral other foreign seqences e RNA e specific or general transcription chip technology Figure 25A 2 1 Schematic representation of the preparation of single cells from solid tissue Tissue is represented by the box in the center and letters A to E represent different cell types within that tissue PERFUSION FIXATION AND ENRICHMENT OF SINGLE CELLS In this protocol the animal here a mouse is perfused with Streck tissue fixative STF a noncrosslinking fixative This fixative and the fixation conditions presented were determined empirically so that intracellular nucleic acids and proteins are preserved without interfering significantly with the ability of the dissociating enzymes to free the cells from the extracellular matrix The fixed tissues of interest are dissected out finely minced and enzymatically separated using collagenase The cell types of interest are then enriched using a suitable strategy At this point any of a number of methods can be used to harvest the desired cell populations from the cell suspension Percoll gradient separation is given here however the end application will strongly influence the procedure selected Materials Streck tissu
400. ug ul oligonucleotide a2 or oligonucleotide b2 5 ul 0 2 ng ul ligated A cDNA or B cDNA 0 5 ul 5 U ul Tag DNA polymerase Add a few drops of sterile PCR grade mineral oil to cover the reaction 13 Amplify the cDNA using the following PCR program 30 cycles l min 94 C denaturation min 50 C annealing 2min 72 C extension 25 sec 72 C autoextension If available use the autoextension function of the thermal cycler e g Perkin Elmer 480 Alternatively for thermal cyclers without autoextension increase the extension time from 2 to 4 min This amplification should yield 10 ug A and B cDNAs The reaction product can be stored overnight at 4 C or longer at 80 C Current Protocols in Molecular Biology Discovery of Differentially Expressed Genes 25B 2 7 Supplement 55 PCR Based Subtractive cDNA Cloning 25B 2 8 Supplement 55 14 Analyze 5 to 10 ul of the amplified cDNAs by agarose gel electrophoresis UNIT 2 5A to determine the size ranges of amplified cDNAs The size of amplified cDNAs should be between 150 bp and 1 5 kb with most 250 bp Prepare labeled tracer and driver DNAs Radioactive tracer DNA is required for monitoring subtraction efficiency biotinylated driver DNA is required for removing hybrids by streptavidin binding and phenol extrac tion 15 For both sets of amplified cDNAs set up the following tracer synthesis PCR 100 ul per reaction 77 ul H O 10 ul 10x T
401. ul 5 mM dNTPs 80 ul of 10x PCR buffer 16 U AmpliTaq Gold polymerase and adjust the volume to 672 ul with water e Dispense 42 ul dNTP polymerase mix into each well of the first two columns The procedure above can be adjusted when more samples are processed at the same time i e 3 samples occupy 48 wells of the microtiter plate and three times more TaqI 1 primers MselI 1 primers and dNTP polymerase mix will be needed An individual reaction can be prepared by combining 5 ul of 1 500 nonselective preampli fication product 1 5 ul of 8 pmol ul TagI 1 primer 12 pmol 1 5 ul of 8 pmol ul Msel 1 primer 12 pmol 2 ul of 5 mM dNTP 5 ul 10x PCR buffer and I U AmpliTaq Gold polymerase The volume is adjusted to 50 ul with water 22 Perform AFLP amplification with the following touch down temperature cycle program 13 cycles 30 sec 94 C denaturation 30 sec 65 0 7 C cycle annealing 60 sec T2 C extension 23 cycles 30 sec 94 C denaturation 30 sec 56 C annealing 60 sec T2 G extension The initial annealing step is performed at 65 C decreasing by 0 7 C each cycle Current Protocols in Molecular Biology Discovery of Differentially Expressed Genes 25B 5 7 Supplement 57 AFLP Based Transcript Profiling 25B 5 8 Supplement 57 A stepwise amplification procedure is used to minimize mismatch amplification A single additional selective nucleotide one on each primer is added per sele
402. up to 3 month at 20 C EcoRI buffer 10x 1 M Tris Cl pH 7 5 APPENDIX 2 500 mM NaCl APPENDIX 2 100 mM MgCl APPENDIX 2 0 25 v v Triton X 100 Store at 20 C EcoRV buffer 10x 100 mM Tris Cl pH 7 9 APPENDIX 2 500 mM NaCl APPENDIX 2 100 mM MgCl APPENDIX 2 10 mM dithiothreitol DTT APPENDIX 2 Store up to 6 months at 20 C Current Protocols in Molecular Biology Discovery of Differentially Expressed Genes 25B 2 13 Supplement 55 PCR Based Subtractive cDNA Cloning 25B 2 14 Supplement 55 HEPES buffer 100 mM HEPES N 2 hydroxyethylpiperazine N 2 ethanesulfonic acid pH 7 3 1 mM EDTA 4PPENDIX 2 Store at 20 C Hybridization buffer for subtractions 2x 50 mM HEPES pH 7 3 10 mM EDTA APPENDIX 2 0 2 w v SDS 1 5 M NaCl APPENDIX 2 Store up to 3 months at 20 C To avoid cloudiness add NaCl last and warm to 68 C Probe dNTP mix 0 5 mM each dATP dGTP and dTTP 0 1 mM dCTP Store up to 3 months at 20 C Streptavidin solution 2 Ug ul streptavidin 0 15 M NaCl APPENDIX 2 HEPES buffer see recipe Store up to 6 months at 20 C T4 DNA ligase buffer 10x 500 mM Tris Cl pH 7 8 APPENDIX 2 100 mM MgCl APPENDIX 2 100 mM dithiothreitol DTT APPENDIX 2 10 mM ATP 250 ug ml BSA Store up to 6 months at 20 C T4 polynucleotide kinase buffer 10x 700 mM Tris Cl pH 7 6 APPENDIX 2 100 mM MgCl APPENDIX 2 50 mM dithiothreitol DTT APPENDIX 2
403. usly remove all of the cDNA synthesis solutions by carefully pipetting because dNTPs and primers will interfere with the tailing reaction Discovery of Differentially Expressed Genes 25B 8 5 Current Protocols in Molecular Biology Supplement 63 Table 25B 8 3 Tailing Mix No of samples 1 2 3 4 5 6 7 8 9 10 40 mM MgC 1 2 3 4 5 6 7 8 9 10 1 mM DTT 1 2 3 4 5 6 7 8 9 10 2 mM dGTP 1 2 3 4 5 6 7 8 9 10 200 mM KH PO 0 5 1 1 5 2 ZS 3 3 5 4 4 5 5 HO 6 5 13 19 5 26 329 39 45 5 52 58 5 65 All solution volumes are indicated in microliters Table 25B 8 4 PCR Mixes for Global Amplification No of samples 1 2 3 4 5 6 i 8 9 10 PCR mix I Roche buffer 1 4 8 12 16 20 24 28 32 36 40 20 formamide 7 5 15 229 30 INI 45 529 60 67 5 75 H O 24 48 J2 96 120 144 168 192 216 240 PCR mix II 24 uM CP2 primer 29 5 TS 10 12 5 15 17 5 20 225 25 10 mM dNTP 1 75 3 5 5 25 7 8 75 10 5 12 25 14 15 75 We Taq long template 1 5 3 4 5 6 Ta 9 10 5 12 13 5 15 All solution volumes are indicated in microliters Tail cDNA 10 Resuspend beads in tailing mix and add 40 ul mineral oil on the surface Place the 0 2 ml tubes in the preheated thermal cycler and denature RNA DNA hybrids for 5 min at 94 C Immediately chill on ice This step serves to generate single stranded cDNA which is tailed with high efficiency in contrast to RNA DNA hybrids After denaturation the cDNA is no longer bound to the magnetic beads but is now found in the supernata
404. ut tissue Adjust the laser spot size to 7 5 um Lower the light from the microscope until there 1s a black monitor screen except for the tracking beam Turn the laser focusing wheel until the tracking beam is a bright spot with a well defined edge There should be no bright rings surrounding the central spot Fig 25A 1 1 Always focus the laser with the 7 5 um spot Each tissue section and slide will need to be refocused Once the 7 5 um spot is focused for a particular slide there is no need to refocus the 15 um or 30 um spots as they are automatically calibrated Adjust the laser power and pulse duration settings for the particular spot size to be used as provided below Current Protocols in Molecular Biology Figure 25A 1 1 Focusing the Laser Beam A Unfocused beam the spot of light has concentric halos of light B Focused beam the spot of light has a sharp border without halos of light C Unfocused beam the spot of light has a blurred border A 20x objective and 7 5 um spot size is used in all three pictures Spot size Power Duration 7 5 um 40 mW 450 usec 15 um 25 mW 1 5 msec 30 um 20 mW 5 msec Laser power and duration determine the spot size The power and duration settings given above should provide a melted area that is similar in size to the tracking beam at each of the three settings but may require adjustment See the user s manual for more information 10 While the tracking beam is still located in an
405. vity 5 Air dry the membrane overnight and fix by gentle UV irradiation in a Stratalinker with a UV dosage of 10 000 J cm i e o the auto cross link dosage For later recovery of bands of interest it is important not to overfix membranes Rinse membrane and block nonspecific binding 6 Insert membrane into a suitable developing drum e g GATC tube fix with some adhesive tape and rinse with 100 ml water while rotating 5 min on a suitable rolling incubator Any roller that accepts a tube 18 cm in diameter X 35 cm long and is able to revolve at 20 rpm will do 7 Replace water with 150 ml maleic buffer pH 7 5 and equilibrate membrane by rotating another 5 min Pour buffer into a beaker and store for later use 8 Incubate 40 to 50 min in a rolling incubator with 80 ml of 1 5 blocking reagent Label bands with streptavidin alkaline phosphatase 9 Discard buffer and add 20 ml of 1 5 blocking reagent and 2 to 4 ul streptavidin al kaline phosphatase conjugate Incubate membrane 30 min in a rolling incubator 10 Pour off buffer completely and wash 5 min using the 150 ml maleic buffer set aside in step 7 Replace with 150 ml fresh maleic buffer and wash 10 min Replace with another 150 ml maleic buffer and wash 15 min 11 Replace with 150 ml reaction buffer pH 9 5 and equilibrate membrane 5 min Develop color 12 For color development pour off buffer and add 20 ml reaction buffer containing 400 ul NBT BCIP stoc
406. volume of 240 ul with LoTE buffer IMPORTANT NOTE From this point on do not use siliconized tubes Extract with 240 ul PC8 and ethanol precipitate with SeeDNA using the following procedure a Add 4 ul SeeDNA Alternatively use 4 ul of a 3 1 solution of 20 mg ml glyco gen SeeDNA mix Add 0 1 vol of 3 M sodium acetate 24 ul and mix briefly Add 2 vol of 100 ethanol 480 ul and vortex briefly Incubate 2 min at room temperature Microcentrifuge 5 min at maximum speed PO Gs Oo So Wash two times with 70 ethanol and microcentrifuge again after last wash Carefully remove residual liquid with a pipet tip and resuspend pellet in 10 ul LoTE buffer SeeDNA is a brightly colored carrier molecule that allows easy visualization and maximal recovery of alcohol precipitated DNA or RNA The glycogen SeeDNA mixture may be used to reduce cost One may pause the protocol here and store the pellet overnight at 20 C Perform blunt end digestion on released tags 2 24 29 Add the following mix to tags 30 5 ul ddH2O 5 ul 10x Klenow buffer or Roche Buffer H 2 5 ul 10 mM dNTPs 1 ul 100x BSA 1 ul Klenow fragment of DNA polymerase I Incubate 30 min at 37 C then add 190 ul LoTE buffer 240 ul final volume Extract with an equal volume of PC8 240 ul Transfer 200 ul into a ligase tube and the remaining 40 ul into a ligase tube Ethanol precipitate with 2 ul SeeDNA 0 1 vol of 3 M sod
407. ween the tissue and the underlying glass slide therefore proper sample preparation is critical It is im portant that the sample be well dehydrated so that the melted polymer can infiltrate intercel lular spaces and create a tight bond The final dehydration and xylene steps have been found to be absolutely crucial for successful LCM Any moisture present in the sample during LCM will give less than optimal results Ideally samples should be microdissected shortly after dehydration however samples can be stored with desiccant after staining and dehydrated for later microdissection although this is not rec ommended for recovery of RNA because of its lability Additionally the humidity in the labo ratory will also affect the results and protocols may need to be modified accordingly Other factors that will affect this bond are presented below see Troubleshooting Specimens reagents and materials for pro cessing must be handled in a manner that will allow optimal preservation of the molecule to be analyzed therefore samples for RNA and DNA should be handled to minimize contami nation from other tissues Samples for RNA analysis should be processed rapidly either as fresh frozen material or briefly fixed in 95 ethanol RNase free reagents and materials should be utilized whenever possible Also the duration of the actual microdissection session on each stained frozen section should be limited to less than 30 min for optima
408. wn to mix well and overlay with 25 ul mineral oil 15 Carry out PCR in a thermal cycler using the following amplification cycles 40 cycles 30 sec 94 C denaturation 2 min 40 C annealing 30 sec 72 C extension 1 cycle 5 min 72 C extension Final step indefinitely 4 C hold The 2 min incubation at 40 C is to allow sufficient time for the short primers to anneal and start extension The short extension period at 72 C is intended to amplify only short lt 600 bp DNA products to be separated on a denaturing polyacrylamide gel PCR products may be stored at 4 C until used 16 Mix 3 5 ul PCR product with 2 ul formamide loading buffer and incubate 2 min at gestae 80 C Load sample onto a 6 denaturing polyacrylamide gel UNT 7 6 Run the gel mRNA by PCR 3 hr at 60 W until xylene cyanol runs to within 10 cm of the bottom 25B 3 4 Supplement 56 Current Protocols in Molecular Biology Flush out the urea from the gel wells with a syringe and needle just before loading samples to obtain high resolution differential display cDNA patterns Recover differentially displayed amplified DNAs 17 18 19 20 21 22 Zi 24 Carefully remove one of the glass gel plates Place a piece of Whatman 3MM filter paper over the gel without trapping air bubbles between filter paper and gel Dry the gel 1 hr at room temperature without fixing it in methanol acetic acid Fixing the gel with methanol acetic acid wil
409. y of the mRNAs and both Msel and Taql are reliable and inexpensive Other combinations of two 4 base cutters may also work well AAA AAA 3 AAA AAA 3 ds cDNA amp ey D 5 Taql digest ooo Taql Msel Msel Msel Msel digest 1 a a a a rt Ff fF 4 4 Tagl Tagl Msel Msel Taql Tag Msel Msel Msel coer JE JE Jk Tk IE O S Ff fF fy Tagl Msel Msel Taqi Taql Msel amplification xE PE 1E 7T x x Figure 25B 5 1 Principle of the AFLP based transcript profiling technique The poly A RNA is indicated at the top with the poly A tail at the 3 end The ds cDNA is shown as a double line restriction enzyme sites with 5 overhangs are indicated The ds Taql and Msel adapters are depicted as small black and gray boxes respectively attached to the protruding ends of the restriction fragments At the bottom the X s illustrate the poor amplification of the Msel Msel fragments Contributed by Pieter Vos and Patrick Stanssens Current Protocols in Molecular Biology 2002 25B 5 1 25B 5 16 Copyright 2002 by John Wiley amp Sons Inc UNIT 25B 5 BASIC PROTOCOL Discovery of Differentially Expressed Genes 25B 5 1 Supplement 57 A E GUT T aa AC AG AT oA colo ca cc ac er ra ro ra rr scl Peet te tt vc Pe Tt tT SRR See OA co ca lor ca jac lac ar E ie T ety ft ft ff re ttt te ty et tf CEE EE Figure 25B 5 2 Illustr
410. ymorphism gels Miele et al 1998 can help to avoid this problem Direct sequencing of differentially ex pressed cDNAs has been reported Wang and Feurstein 1995 Dot blot grids are being de veloped to evaluate the differential display products Martin et al 1998 Recently other methods have been devel oped for studying expression genetics These include representational difference analysis Lisitsyn 1995 serial analysis of gene expres sion SAGE Zhang et al 1997 and dot blot analysis Wodicka 1997 by which differential mRNA expression is examined with high throughput mass cDNA library screening on dot blots placed on chips together with power ful computational analysis of sequences This technique will in time provide massive amounts of information although it is relatively labori ous and requires special facilities Quality of RNA The quality of RNA is determined by two criteria First is the integrity of the RNA second is the degree of chromosomal DNA contami nation The integrity of total RNA can be easily verified by agarose formaldehyde gel electro phoresis whereas the integrity of poly A RNA must be checked by northern blot hybridi zation using a cDNA probe for an mRNA with known molecular weight Contamination by chromosomal DNA can be checked by per forming differential display omitting the re verse transcription step Under the PCR condi tions used for differential display 1 e low dNTP
411. yn and colleagues 1993 Oligomer primers compatible with each of these enzymes are listed in Table 25B 7 1 These enzymes with corresponding oligomers have been extensively and successfully used in RDA applications however other enzymes may be used by adapting the restriction sites adjacent to the core sequences In particular four base cutters may be more appropriate for less complex genomes 2 Extract digested tester and driver with 1 vol phenol 400 ul each followed by 1 vol phenol chloroform isoamyl alcohol 400 ul each Ethanol precipitate DNA UNIT 2 1A adding 20 ug glycogen and microcentrifuging at 4 C to increase recovery Dry pellets and resuspend at 0 1 ug ul in TE buffer pH 8 0 instead of water in the final step Confirm DNA concentration by comparison to dilution of known standards by agarose gel electrophoresis UNIT 2 5A 3 Resuspend HPLC purified primers oligomers in water at 62 pmol ul an OD of 6 or 12 AU ml for 12 and 24 mers respectively APPENDIX 3D HPLC purification of oligomers is critical for minimizing false positive RDA bands O Neill and Sinclair 1997 Ligate adapters onto driver and tester DNA 4 Mix the following in thermal cycler tubes colored differently for tester and driver DNA 2 ul water 3 ul 10x ligase buffer 7 5 ul 12 mer R primer 7 5 ul 24 mer R primer 10 0 ul 1 ug driver or tester DNA digest 30 ul total volume The use of tubes of different colors throughout the prot

side

Contents

Download Pdf Manuals

Related Search

Related Contents