Sample & Assay Technologies MGMT Pyro® Kit Handbook
Contents
1. Limited License Agreement Use of this product signifies the agreement of any purchaser or user of the MGMT Pyro Kit to the following terms 1l The MGMT Pyro Kit may be used solely in accordance with the MGMT Pyro Handbook and for use with components contained in the Kit only QIAGEN grants no license under any of its intellectual property to use or incorporate the enclosed components of this Kit with any components not included within this Kit except as described in the MGMT Pyro Handbook and additional protocols available at www qiagen com Other than expressly stated licenses QIAGEN makes no warranty that this Kit and or its use s do not infringe the rights of third parties This Kit and its components are licensed for one time use and may not be reused refurbished or resold QIAGEN specifically disclaims any other licenses expressed or implied other than those expressly stated ME CE EE The purchaser and user of the Kit agree not to take or permit anyone else to take any steps that could lead to or facilitate any acts prohibited above QIAGEN may enforce the prohibitions of this Limited License Agreement in any Court and shall recover all its investigative and Court costs including attorney fees in any action to enforce this Limited License Agreement or any of its intellectual property rights relating to the Kit and or its components 2011 QIAGEN all rights reserved sl www giagen com Australia Orders 1 800 243 800 Fax 02. Troubleshooting guide This troubleshooting guide may be helpful in solving any problems that may arise For more information see also the Frequently Asked Questions page at our Technical Support Center www qiagen com FAQ FAQList aspx The scientists in QIAGEN Technical Services are always happy to answer any questions you may have about either the information and protocols in this handbook or sample and assay technologies for contact information see back cover or visit www qiagen com Refer to the PyroMark Q24 User Manual for general troubleshooting of the instrument Comments and suggestions Signals in the no template control negative control a Cross talk between Signal from one well is detected in a wells neighboring well Avoid placing samples with high signal intensities next to no template control wells b PCR contamination Use sterile pipet tips with filters Store and extract materials such as specimens plasmid controls and amplicons separately from PCR reagents Poor or unexpected sequence a Low quality of genomic Low quality genomic DNA can cause the PCR to DNA fail Analyze PCR samples using an electrophoretic technique for example the QlAxcel System or agarose gel electrophoresis MGMT Pyro Kit Handbook 06 2011 29 Check or failed result a Low peak height b Signal in bisulfite control High background a Incorrect storage of nucleotides b Short cooling time of samples pri
3. Methylated control DNA is included in the kit as a positive control for PCR and sequencing reactions It is also recommended that a DNA sample derived from a healthy blood donor is included in every Pyrosequencing run for comparison In addition a negative control without template DNA should always be included in every PCR setup eee 6 MGMT Pyro Kit Handbook 06 2011 Materials Provided Kit contents MGMT Pyro Kit box 1 2 MGMT Pyro Kit 48 Catalog no 970061 Number of reactions A8 PCR Primer Mix MGMT 2 x 24 ul Seq Primer MGMT 2 x 24 ul PyroMark PCR Master Mix 2x 850 ul CoralLoad Concentrate 10x 1 2 ml H O 3x 1 9 ml Methylated Control DNA 10 ng ul 100 ul Pyro buffers and reagents box 2 2 Buffers and reagents PyroMark Binding Buffer 10 ml PyroMark Annealing Buffer 10 ml PyroMark Denaturation Solution 250 ml PyroMark Wash Buffer 10x 25 ml Enzyme Mixture 1 vial Substrate Mixture 1 vial dATPaS 1180 ul dCTP 1180 ul dGTP 1180 ul dTTP 1180 ul Handbook 1 Contains sodium hydroxide MGMT Pyro Kit Handbook 06 2011 7 Materials Required but Not Provided When working with chemicals always wear a suitable lab coat disposable gloves and protective goggles For more information consult the appropriate material safety data sheets MSDSs available from the product supplier E DNA isolation kit see DNA isolation and bisulfite conversion page 11 E Reagents for bisulfite conversion of DNA
4. see DNA isolation and bisulfite conversion page 11 Pipets adjustable Sterile pipet tips with filters for PCR setup Benchtop microcentrifuge Thermal cycler and appropriate PCR tubes Streptavidin Sepharose High Performance GE Healthcare cat no 17 5113 01 www gelifesciences com PyroMark Q24 cat no 9001514 PyroMark Q24 Software cat no 9019062 PyroMark Q24 Plate cat no 979201 PyroMark Q24 Cartridge cat no 979202 PyroMark Q24 Vacuum Workstation cat no varies depending on region see Ordering Information page 35 Plate mixer for immobilization to beads see Recommended plate mixers page 11 Heating block capable of attaining 80 C 24 well PCR plate or strips Strip caps High purity water Milli Q 18 2 MQ x cm or equivalent Note Sufficient water is provided in the product for PCR DNA immobilization and for dissolving the Enzyme Mixture and the Substrate Mixture additional high purity water is required to dilute PyroMark Wash Buffer 10x Ethanol 70 Do not use denatured alcohol which contains other substances such as methanol or methylethylketone COES 8 MGMT Pyro Kit Handbook 06 2011 Warnings and Precautions Safety information When working with chemicals always wear a suitable lab coat disposable gloves and protective goggles For more information please consult the appropriate material safety data sheets MSDSs These are available online in convenient and c
5. PyroMark Q24 see Protocol 5 Running the PyroMark Q24 System page 23 12 MGMT Pyro Kit Handbook 06 2011 Run parameters Run name The name of the run is given when the file is saved Renaming the file also changes the name of the run Instrument method Select the instrument method according to the reagents and cartridge that will be used for the run see the instructions supplied with the products Plate ID Optional Enter ID of the PyroMark Q24 Plate Bar code Optional Enter a bar code number for the plate or if you have a bar code reader connected to your computer place the mouse cursor in the Barcode text box by clicking the box and scan the bar code Reagent ID Optional Enter the lot number for the MGMT Pyro Kit to be used The lot number can be found on the product label Note We recommend entering the lot number so that any unexpected problems with the MGMT Pyro Kit can be traced Run note Optional Enter a note about the contents or purpose of the run Add assay files To add an assay to a well you can either M Right click the well and select Load Assay from the context menu Select the assay in the shortcut browser and click and drag the assay to the well A well is color coded according to the assay loaded to the well Enter sample IDs and notes To enter a sample ID or note select the cell and enter the text To edit a sample ID or note either select the cell the current contents
6. back beyond 90 vertical for 5 seconds to drain liquid from the filter probes Figure 3 Figure 3 Illustration of the vacuum tool raised to beyond 90 vertical 10 While the vacuum tool is held over the PyroMark Q24 Plate close the vacuum switch on the tool Off 11 Release the beads into the PyroMark Q24 Plate by lowering the filter probes into the diluted sequencing primer and moving the tool gently from side to side Do not damage the surface of the PyroMark Q24 Plate by scratching it with the filter probes 12 Transfer the vacuum tool to the trough containing high purity water Figure 2 and agitate the tool for 10 seconds 13 Wash the filter probes by lowering the probes into high purity water Figure 2 and applying vacuum Flush the probes with 70 ml high purity water 14 Raise the tool up and back beyond 90 vertical for 5 seconds to drain liquid from the filter probes Figure 3 MGMT Pyro Kit Handbook 06 2011 21 15 Close the vacuum switch on the tool Off and place the tool in the Parking P position 16 Turn off the vacuum pump At the end of a working day liquid waste and remaining solutions should be discarded and the PyroMark Q24 Vacuum Workstation should be checked for dust and spillage see Appendix B Emptying the Waste Container and Troughs page 34 17 Heat the PyroMark Q24 Plate with the samples at 80 C for 2 minutes using the prewarmed PyroMark Q24 Plate Holder 18 Remove the P
7. prior to Pyrosequencing analysis on the PyroMark Q24 19 E 5 Running the PyroMark Q24 System 23 Interpretation of Results 26 Analysis of a PyroMark Q24 run 26 Troubleshooting guide 29 Quality Control 31 Limitations 31 References 3l Symbols 32 Contact Information 32 Appendix A Setting Up MGMT Assays 33 MGMT Pyro Kit Handbook 06 2011 3 Appendix B Emptying the Waste Container and Troughs 34 Ordering Information 35 4 MGMT Pyro Kit Handbook 06 2011 Intended Use The MGMT Pyro Kit is intended for molecular biology applications This product is not intended for the diagnosis prevention or treatment of a disease or for patient management Summary and Explanation The MGMT Pyro Kit is intended for quantitative measurements of methylation in four CpG sites in exon 1 of the human MGMT gene genomic sequence on chromosome 10 from 131 265 519 to 131 265 537 CGACGCCCGCAGGTCCTCG Bisulfite converted genomic DNA is amplified by PCR and sequenced through the defined region in the forward direction Figure 1 Sequences surrounding the defined positions serve as normalization and reference peaks for quantification and quality assessment of the analysis The product consists of PCR primer mix and sequencing primer two vials of each The primers are delivered in solution Each vial contains 24 pl of primer or primer mix The kit contains primers and reagents for amplification of the genes plus buffers primers and reagents for quantitative m
8. run file in CpG mode of the PyroMark Q24 Software either by selecting Open in the File menu or by double clicking the file 9 in the shortcut browser 4 To analyze the run and get an overview of the results click one of the Analyze buttons TH Analyze all wells Analyze the selected well The analysis results methylation frequencies and quality assessment are displayed above the variable position in the Pyrogram trace For more details on how to analyze a run see the PyroMark Q24 User Manual 5 To generate a report select CpG Full Report or CpG Analysis Results in the Reports menu For reliable results we recommend single peak heights above 30 RLU Set 30 RLU as the required peak height for passed quality in assay setup see Appendix A page 33 and the PyroMark Q24 User Manual The CpG Analysis results report should be used for documentation and interpretation of methylation quantification The numbers shown in the Pyrogram are rounded and do not show the exact quantification The Pyrogram should always be compared to the histogram which can be displayed by right clicking in the Pyrogram window The measured peaks should match the height of the histogram bars Interpretation of results It is recommended that a DNA sample derived from a healthy blood donor is included in every run for comparison The samples can also be compared with each other to reveal low methylation frequencies 26 MGMT Pyro Kit Han
9. 3 9840 9888 Technical 1 800 243 066 Austria Orders 0800 28 10 10 Fax 0800 28 10 19 Technical 0800 28 10 11 Belgium Orders 0800 79612 Fax 0800 79611 Technical 0800 79556 Brazil Orders 0800 557779 Fax 55 11 5079 4001 Technical 0800 557779 Canada Orders 800 572 9613 Fax 800 713 5951 Technical 800 DNA PREP 800 362 7737 China Orders 86 21 3865 3865 Fax 86 21 3865 3965 Technical 800 988 0325 Denmark Orders 80 885945 Fax 80 885944 Technical 80 885942 Finland Orders 0800 914416 Fax 0800 914415 Technical 0800 914413 France Orders 01 60 920 926 Fax 01 60 920 925 Technical 01 60 920 930 Offers 01 60 920 928 Germany Orders 02103 29 12000 Fax 02103 29 22000 Technical 02103 29 12400 Hong Kong Orders 800 933 965 Fax 800 930 439 Technical 800 930 425 Ireland Orders 1800 555 049 Fax 1800 555 048 Technical 1800 555 061 Italy Orders 800 789 544 Fax 02 334304 826 Technical 800 787980 Japan Telephone 03 6890 7300 Fax 03 5547 0818 Technical 03 6890 7300 Korea South Orders 080 000 7146 Fax 02 2626 5703 Technical 080 000 7145 Luxembourg Orders 8002 2076 Fax 8002 2073 Technical 8002 2067 Mexico Orders 01 800 7742 639 Fax 01 800 1122 330 Technical 01 800 7742 436 The Netherlands Orders 0800 0229592 Fax 0800 0229593 Technical 0800 0229602 Norway Orders 800 18859 Fax 800 18817 Technical 800 18712 Singapore Orders 1800 742 4362 Fax 65 6854 8184 Techn
10. 6 2011 Table 3 Preparation of reaction mix Component Volume reaction pl PyroMark PCR Master Mix 2x 12 5 CoralLoad Concentrate 10x 2 5 PCR Primer Mix MGMT 1 0 Water H50 supplied 4 0 Total volume 20 0 3 Mix the reaction mix thoroughly and dispense 20 pl into each PCR tube It is not necessary to keep PCR tubes on ice since HotStarTaq DNA polymerase is inactive at room temperature 4 Add 5 pl template DNA 10 50 ng of genomic DNA measured before bisulfite conversion to the individual PCR tubes see Table 4 and mix thoroughly A negative control sample without template DNA should be included in every PCR setup It is also recommended to include a control sample with DNA from a healthy blood donor in each Pyrosequencing run Table 4 Preparation of PCR Component Volume reaction pl Reaction mix 20 Sample DNA 5 Total volume 25 MGMT Pyro Kit Handbook 06 2011 15 5 Program the thermal cycler according to the manufacturer s instructions using the conditions outlined in Table 5 Table 5 Optimized cycling protocol Comments Tr rev HotStarTaq DNA Initial activation step 15 minutes polymerase is activated i by this heating step 3 step cycling Denaturation 20 seconds 95 C Annealing 30 seconds 53 C Extension 20 seconds 72 C Number of cycles 42 Final extension 5 minutes 72 C 6 Place the PCR tubes in the thermal cycler and start the cycling program 7 After amplifica
11. June 2011 MGMT Pyro Kit Handbook For quantitative measurement of methylation of four CpG sites in exon 1 of the human MGMT gene V 48 970061 1069131EN ual QIAGEN GmbH QIAGEN Strasse 1 D 40724 Hilden R1 1069131EN 0000o QIAGEN Sample amp Assay Technologies QIAGEN Sample and Assay Technologies QIAGEN is the leading provider of innovative sample and assay technologies enabling the isolation and detection of contents of any biological sample Our advanced high quality products and services ensure success from sample to result QIAGEN sets standards in Purification of DNA RNA and proteins Nucleic acid and protein assays microRNA research and RNAi Automation of sample and assay technologies Our mission is to enable you to achieve outstanding success and breakthroughs For more information visit www giagen com Contents Intended Use 5 Summary and Explanation 5 Principle of the Procedure 6 Controls 6 Materials Provided 7 Kit contents Materials Required but Not Provided 8 Warnings and Precautions 9 Safety information 9 General precautions 9 Reagent Storage and Handling 10 Specimen Handling and Storage 10 Procedures 11 DNA isolation and bisulfite conversion 11 Protocols E 1 Run setup for the PyroMark Q24 System 12 E 2 PCR using the reagents supplied with the MGMT Pyro Kit 14 E 3 Immobilization of PCR products to Streptavidin Sepharose High Performance beads 17 E 4 Preparation of samples
12. ates Eppendorf 51410 Variomag Teleshake H P 3 115 V 51410 U Labortechnik GmbH 51110 Variomag Monoshake 115V 51110 U MGMT Pyro Kit Handbook 06 2011 11 Protocol 1 Run setup for the PyroMark Q24 System Things to do before starting E Create an Assay Setup as described in Appendix A This needs to be done only once before running the MGMT assay for the first time see Appendix A Setting Up MGMT Assays page 33 Procedure 1 Click in the toolbar A new run file is created 2 Enter the run parameters see Run parameters page 13 3 Set up the plate by adding the assay to wells corresponding to the samples to analyze A negative sample without template DNA should be included in every PCR setup It is also recommended to include a control sample with DNA from a healthy blood donor in each Pyrosequencing run 4 When the run is set up and ready to run on the PyroMark Q24 System print a list of required volumes of enzyme mix substrate mix and nucleotides and the plate setup Select Pre Run Information from the Tools menu and when the report appears click i 5 Close the run file and copy it to a USB stick supplied with the system using Windows Explorer The printed Pre Run Information can be used as a template for the sample setup see Protocol 3 Immobilization of PCR products to Streptavidin Sepharose High Performance beads page 17 To run the plate on
13. be treated as potentially infectious material Specimen material is human DNA extracted from blood or formalin fixed parattin embedded samples Samples from humans undergoing heparin treatment must not be used Blood samples that have been collected in tubes containing heparin as an anticoagulant should not be used Heparin affects the PCR 10 MGMT Pyro Kit Handbook 06 2011 Procedures DNA isolation and bisulfite conversion The QIAGEN kits shown below are recommended for DNA purification from the indicated human sample types for use with the MGMT Pyro Kit Carry out the DNA purification according to the instructions in the kit handbooks For bisulfite conversion the EpiTect Bisulfite Kit cat no 59104 or EpiTect Plus FFPE Bisulfite Kit cat no 59144 from QIAGEN is recommended Table 1 DNA purification kits recommended for use with the MGMT Pyro Kit Catalog number Sample material Nucleic acid isolation kit QIAGEN QlAamp DNA FFPE Tissue Kit 56404 Parattin embedded 50 tissue EZ1 DNA Tissue Kit 48 953034 Blood QlAamp DSP DNA Blood Mini Kit 61104 Recommended plate mixers The plate mixers shown in Table 2 are recommended for use with the MGMT Pyro Kit Table 2 Plate mixers recommended for use with the MGMT Pyro Kit Manufacturer Product Catalog number Basic mixer 5355 000 01 1 Thermoblock for MTP 5363 000 012 Adapter plate tor 96 x 0 2ml PCR tubes to insert in blocks for 5363 007 009 microtiter pl
14. dbook 06 2011 The limit of blank LOB values represent methylation frequencies obtained from healthy blood donor samples with a probability of 9596 LOB values have been determined using samples from healthy blood donors Table 8 The a and errors false positive and false negative respectively were set to 596 Table 8 LOB determined for specific methylation sites using samples from healthy blood donors Position LOB 96 units CpG site 1 1 5 CpG site 2 1 8 CpG site 3 3 2 CpG site 4 3 4 Mean of CpG site 1 to 4 2 1 These values were based on runs where the signal was over 30 relative light units RLU as routinely obtained from 10 ng of DNA isolated from blood measured before bisulfite conversion We recommend that the method performance is confirmed in the laboratory Representative results Representative Pyrogram results are shown in Figures 5 6 600 400 200 0 E S G T C G A T C A G T C G T C A T G T T C G 5 10 15 20 Figure 5 Pyrogram trace obtained after analysis of unmethylated bisulfite converted DNA from a healthy blood donor sample The bar at dispensation 15 represents the control for completion of bisulfite conversion MGMT Pyro Kit Handbook 06 2011 27 600 500 400 300 200 100 0 Figure 6 Pyrogram trace obtained after analysis of a methylated bisulfite converted DNA The bar at dispensation 15 represents the control for completion of bisulfite conversion 28 MGMT Pyro Kit Handbook 06 2011
15. e PyroMark Q24 System page 12 Keep one of the PyroMark Q24 Plate Holders supplied with the PyroMark Q24 Vacuum Workstation at room temperature 15 25 C and use it as support when preparing and moving the plate 3 Place the PCR plate or strips from Protocol 3 and the PyroMark Q24 Plate on the worktable Figure 2 Ensure that the plate is in the same orientation as when samples were loaded Figure 2 Placement of PCR plate or strips and PyroMark Q24 plate on the vacuum workstation 4 Apply vacuum to the vacuum tool by opening the vacuum switch 20 MGMT Pyro Kit Handbook 06 2011 5 Carefully lower the filter probes into the PCR plate or strips to capture the beads containing immobilized template Hold the probes in place for 15 seconds Take care when picking up the vacuum tool Sepharose beads sediment quickly Capturing of the beads must take place immediately following agitation If more than 1 minute has elapsed since the plate or strips was agitated agitate again for 1 minute before capturing the beads 6 Transfer the vacuum tool to the trough containing 40 ml 70 ethanol Figure 2 Flush the filter probes for 5 seconds 7 Transfer the vacuum tool to the trough containing 40 ml Denaturation Solution Figure 2 Flush the filter probes for 5 seconds 8 Transfer the tool to the trough containing 50 ml Wash Buffer Figure 2 Flush the filter probes for 10 seconds 9 Raise the vacuum tool up and
16. est for filter probes as described in the PyroMark Q24 Handbook on a regular basis and exchange filter probes if indicated Things to do before starting E Before opening the tube with sequencing primer centrifuge briefly to collect contents at the bottom of the tubes E Place one PyroMark Q24 Plate Holder on a preheated heating block at 80 C for use in step 17 Leave a second PyroMark Q24 Plate Holder at room temperature 15 25 C for use in step 18 E PyroMark Wash Buffer is supplied as a 10x concentrate Before using for the first time add high purity water to 25 ml 10x PyroMark Wash Buffer to achieve a final volume of 250 ml and obtain a 1x working solution Note The 1x PyroMark Wash Buffer working solution is stable at 2 8 C until the marked expiration date Procedure 1 Dilute a sufficient amount of the sequencing primer Seq Primer MGMT in PyroMark Annealing Buffer as shown in Table 7 Prepare a volume of diluted sequencing primer greater than that required for the total number of samples to be sequenced for the number of samples one extra ES S MGMT Pyro Kit Handbook 06 2011 19 Table 7 Example of dilution of the sequencing primer Volume for Component Volume sample ul 9 1 reactions pl Seq Primer MGMT 0 8 8 PyroMark Annealing Buffer oa Total volume 25 2 Add 25 pl of diluted sequencing primer to each well of the PyroMark Q24 Plate according to the run setup see Protocol 1 Run setup for th
17. ethylation detection in real time using Pyrosequencing technology on the PyroMark Q24 System FP Seq pem gt IlvalAvg rrvclrAcorrTTTYGI Figure 1 Illustration of the MGMT assay The sequence indicated is the analyzed sequence after bisulfite conversion Y indicates the potentially methylated sites and boxes indicate the analyzed CpG sites The asterisk indicates the site for bisulfite conversion control FP Forward PCR primers RPB Reverse PCR primers B indicates biotinylation Seq Sequencing primers Note The workflow has been slightly modified compared to the PyroMark Q24 User Manual see Protocol 4 Preparation of samples prior to Pyrosequencing analysis on the PyroMark Q24 page 19 MGMT Pyro Kit Handbook 06 2011 5 Principle of the Procedure The workflow illustrates the assay procedure After PCR using primers targeting the defined region of exon 1 the amplicons are immobilized on Streptavidin Sepharose High Performance beads Single stranded DNA is prepared and the sequencing primers anneal to the DNA The samples are then analyzed on the PyroMark Q24 System using a run setup file and a run file Workflow of MGMT Pyro procedure Assay and run setup Sample preparation Assay file setup Appendix A PCR Protocol 2 M 4 Immobilization Protocol 3 M Run file setup Protocol 1 Preparation of samples Protocol 4 o PyroMark Q24 run Protocol 5 M Analysis of PyroMark Q24 run M Report Controls
18. ical 1800 742 4368 Spain Orders 91 630 7050 Fax 91 630 5145 Technical 91 630 7050 Sweden Orders 020 790282 Fax 020 790582 Technical 020 798328 Switzerland Orders 055 254 22 11 Fax 055 254 22 13 Technical 055 254 22 12 C3 Q Q C gt UK Orders 01293 422 911 Fax 01293 422 922 m Technical 01293 422 999 o o eo o o USA Orders 800 426 8157 Fax 800 718 2056 Technical 800 DNA PREP 800 362 7737 QIAGEN Sample amp Assay Technologies
19. iner and Troughs WARNING Hazardous chemicals The Denaturation Solution used with the vacuum workstation contains sodium hydroxide which is irritating to eyes and skin Always wear safety glasses gloves and a lab coat The responsible body e g laboratory manager must take the necessary precautions to ensure that the surrounding workplace is safe and that the instrument operators are not exposed to hazardous levels of toxic substances chemical or biological as defined in the applicable Material Safety Data Sheets MSDSs or OSHA ACGIH or COSHH documents Venting for fumes and disposal of wastes must be in accordance with all national state and local health and safety regulations and laws OSHA Occupational Safety and Health Administration United States of America t ACGIH American Conference of Government Industrial Hygienists United States of America COSHH Control of Substances Hazardous to Health United Kingdom Be sure to observe federal state and local environmental regulations for the disposal of laboratory waste Procedure 1 Ensure that no vacuum is applied to the vacuum tool Make sure that the vacuum is closed Off and the vacuum pump is switched off 2 Discard any solutions left in the troughs 3 Rinse the troughs with high purity water or replace them if necessary 4 Empty the waste container 5 The cap can be removed without disconnecting the tubing 6 If the vacuum wor
20. kstation must be cleaned for example due to dust or spillage follow the instructions in the PyroMark Q24 User Manual 34 MGMT Pyro Kit Handbook 06 2011 Ordering Information Product Contents Cat no MGMT Pyro Kit 48 For 48 reactions on PyroMark 970061 Q24 Systems Seq Primers PCR Primers Methylated Control DNA PyroMark PCR Master Mix CoralLoad Concentrate PyroMark Binding Buffer PyroMark Annealing Buffer PyroMark Denaturation Solution PyroMark Wash Buffer Enzyme Mixture Substrate Mixture dATPaS dCTP dGTP dTTP and HO Accessories PyroMark Q24 Plate 24 well sequencing reaction 979201 100 plate PyroMark Q24 Cartridges for dispensing 979202 Cartridge 3 nucleotides and reagents PyroMark Vacuum Reusable filter probes for 979010 Prep Filter Probe PyroMark Vacuum Workstation 100 Q96 and Q24 PyroMark Control For installation check of system 979203 Oligo PyroMark Q24 For performance confirmation ot 979204 Validation Oligo system Related products PyroMark Q24 Sequence based detection 9001514 platform tor Pyrosequencing of 24 samples in parallel PyroMark Q24 Vacuum Workstation for 9001518 Vacuum Workstation preparing 24 samples in parallel 220 V from PCR product to 9001516 single stranded template 110 V 9001519 100 V MGMT Pyro Kit Handbook 06 2011 35 Product Contents Cat no PyroMark Q24 Analysis software 9019062 Software QlAamp DNA FFPE For 50 DNA preps 50 QlAamp 56404 Tissue Ki
21. mber Components Contains Number Temperature limitation Manufacturer Consult instructions for use E Bgg ss Contact Information For technical assistance and more information please see our Technical Support Center at www giagen com Support or call one of the QIAGEN Technical Service Departments or local distributors see back cover or visit www qiagen com 32 MGMT Pyro Kit Handbook 06 2011 Appendix A Setting Up MGMT Assays Before running the MGMT assay for the first time the assay file needs to be set up as described below Procedure 1 Set up the assay for MGMT by using the PyroMark Q24 Software 2 Click in the toolbar and select New CpG Assay 3 Type the sequence YGAYGTTYGTAGGTTTTYGT in Sequence to Analyze 4 Manually enter the following Dispensation Order GTCGTATCAGTCGTCATGTTCG 5 Click the Analysis Parameters tab and increase Peak Height Threshold Required peak height for Passed quality to 30 6 Inthe Analysis Parameters tab set the Allowed percentage for passed quality and Allowed percentage for check quality to 7 0 and 10 0 respectively 7 Click amp in the toolbar and save the assay as MGMT Ul m O m U1 N O Figure 7 Histogram for the MGMT Pyro Kit assay The bar at dispensation 15 indicates the control for completion of bisulfite conversion eee MGMT Pyro Kit Handbook 06 2011 33 Appendix B Emptying the Waste Conta
22. ment Do not remove the USB stick before the run is finished Select Run in the main menu using the and screen buttons and press OK Select the run file using the 4 and screen buttons To view the contents of a folder select the folder and press Select To go back to the previous view press Back When the run file is selected press Select to start the run When the run is finished and the instrument confirms that the run file has been saved to the USB stick press Close Remove the USB stick Open the instrument lid Open the cartridge gate and remove the reagent cartridge by lifting it up and pulling it out Close the gate Open the plate holding frame and remove the plate from the heating block Close the plate holding frame and the instrument lid MGMT Pyro Kit Handbook 06 2011 21 Discard the plate and clean the cartridge as per the instructions in the product sheet supplied with the cartridge 22 Analyze the run according to Analysis of a PyroMark Q24 run page 26 MGMT Pyro Kit Handbook 06 2011 25 Interpretation of Results Analysis of a PyroMark Q24 run This protocol describes the methylation analysis of a completed MGMT run using PyroMark Q24 Software Procedure 1 Insert the USB stick containing the processed run file into the computer s USB port 2 Move the run file from the USB stick to the desired location on the computer using Windows Explorer 3 Open the
23. of the master mix and PCR product 5 Seal the PCR plate or strips using strip caps Ensure that no leakage is possible between the wells MGMT Pyro Kit Handbook 06 2011 17 6 Agitate the PCR plate at room temperature 15 25 C for 5 10 minutes at 1400 rpm During this step prepare the PyroMark Q24 Vacuum Workstation for sample preparation as described in the PyroMark Q24 User Manual 7 Proceed immediately with Protocol 4 Preparation of samples prior to Pyrosequencing analysis on the PyroMark Q24 page 19 Sepharose beads sediment quickly Capturing of the beads must take place immediately following agitation If more than 1 minute has elapsed since the plate or strips was agitated agitate again for 1 minute before capturing the beads EEE 18 MGMT Pyro Kit Handbook 06 2011 Protocol 4 Preparation of samples prior to Pyrosequencing analysis on the PyroMark Q24 This protocol is for preparation of single stranded DNA and annealing of the sequencing primer to the template prior to Pyrosequencing analysis on the PyroMark Q24 Important points before starting E Add the sequencing primer in the same pattern as predefined for the plate in the run setup see Protocol 1 Run setup for the PyroMark Q24 System page 12 E Note that the workflow has been slightly modified compared to the PyroMark Q24 User Manual step 18 Do not shorten the time for cooling down the samples after heating to 80 C E Perform the function t
24. ompact PDF format at www giagen com Support MSDS aspx where you can find view and print the MSDS for each QIAGEN kit and kit component The following risk and safety phrases apply to components of the MGMT Pyro Kit PyroMark Denaturation Solution Contains sodium hydroxide Irritant Risk and safety phrases R36 38 9526 36 37 39 45 24 hour emergency information Emergency medical information in English French and German can be obtained 24 hours a day from Poison Information Center Mainz Germany Tel 49 6131 19240 General precautions The user should always pay attention to the following E Note that the workflow has been slightly modified compared to the PyroMark Q24 User Manual see Protocol 4 Preparation of samples prior to Pyrosequencing analysis on the PyroMark Q24 page 19 E The components of this product are sufficient to perform the 48 reactions in up to 5 independent runs E Use sterile pipet tips with filters for PCR setup E Store and extract positive materials specimens positive controls and amplicons separately from all other reagents and add them to the reaction mix in a spatially separated facility R36 38 Irritating to eyes and skin S26 In case of contact with eyes rinse immediately with plenty of water and seek medical advice S36 Wear suitable protective clothing S37 Wear suitable gloves 539 Wear eye face protection 45 In case of accident or if you feel unwell seek medical ad
25. or to Pyrosequencing analysis c Contamination of cartridge Handling errors in PCR setup or sample preparation prior to Pyrosequencing can result in low peaks Perform the function test for filter probes as described in the PyroMark Q24 Handbook on a regular basis and exchange filter probes when indicated In case of a Check warning carefully compare the Pyrogram to the histogram which can be displayed by right clicking in the Pyrogram window It the measured peaks match the height of the histogram bars the result is valid Otherwise it is recommended to rerun the sample The bisulfite conversion was not complete It is recommended to use the EpiTect Bisulfite Kit cat no 59104 or EpiTect Plus FFPE Bisulfite Kit cat no 59144 from QIAGEN and to strictly follow the protocol for conversion Store nucleotides at 2 8 C Storage at 20 C can cause an increase in the background Keep the samples on a PyroMark Q24 Plate Holder at room temperature for 10 15 minutes Do not shorten the cooling time Carefully clean the cartridge as described in the product sheet Store the cartridge protected from light and dust No signals in positive controls a Insufficient enzyme or substrate mix for all wells b Reagents incorrectly stored or diluted 30 Make sure to fill the PyroMark Q24 Cartridge according to the Pre Run Information in the Tools menu Prepare the PyroMark Q24 Gold Reagents according to the inst
26. reagents and the PyroMark Q24 Cartridge to reach ambient temperature 20 25 C 4 Place the PyroMark Q24 Cartridge with the label facing you 5 Load the PyroMark Q24 Cartridge with the appropriate volumes of nucleotides enzyme and substrate mixes according to Figure 4 Make sure that no air bubbles are transferred from the pipet to the cartridge When working with chemicals always wear a suitable lab coat disposable gloves and protective goggles For more information consult the appropriate material safety data sheets MSDSs available from the product supplier MGMT Pyro Kit Handbook 06 2011 23 11 12 13 14 15 16 17 18 19 20 24 Label Figure 4 Illustration of the PyroMark Q24 Cartridge as seen from above The annotations correspond to the label on the reagent vials Add enzyme mixture E substrate mixture S and nucleotides A T C G according to the volume information given in the Pre Run information report found in the Tools menu at run setup Open the cartridge gate and insert the filled reagent cartridge with the label facing out Push the cartridge in fully and then push it down Ensure the line is visible in front of the cartridge and close the gate Open the plate holding frame and place the plate on the heating block Close the plate holding frame and the instrument lid Insert the USB stick containing the run file into the USB port at the front of the instru
27. ructions MGMT Pyro Kit Handbook 06 2011 c PCR or sample Handling errors in PCR setup programming of preparation failure the PCR cycler or sample preparation prior to Pyrosequencing analysis can result in no signal Perform the function test for filter probes as described in the PyroMark Q24 Handbook and exchange filter probes when needed Repeat the PCR and Pyrosequencing analysis Quality Control In accordance with QIAGEN s ISO certified Quality Management System each lot of the MGMT Pyro Kit is tested against predetermined specifications to ensure consistent product quality Limitations The purchaser and user of the MGMT Pyro Kit should refer to the Limited License Agreement on the inside back cover of the MGMT Pyro Kit Handbook for additional information concerning the use of this product References QIAGEN maintains a large up to date online database of scientific publications utilizing QIAGEN products Comprehensive search options allow you to find the articles you need either by a simple keyword search or by specifying the application research area title etc For a complete list of references visit the QIAGEN Reference Database online at www qiagen com RefDB search asp or contact QIAGEN Technical Services or your local distributor ES S MGMT Pyro Kit Handbook 06 2011 31 Symbols EU Contains reagents sufficient for lt N gt reactions Use by ro lt Catalog number Lot number A Material nu
28. t 50 MinElute Columns Proteinase K Buffers Collection Tubes 2 ml EZ1 DNA Tissue Kit For 48 preps Reagent Cartridges 953034 48 Tissue Disposable Filter Tips Disposable Tip Holders Sample Tubes 2 ml Elution Tubes 1 5 ml Buffer C2 Proteinase K QlAamp DSP DNA For 50 preps QlAamp Mini Spin 61104 Blood Mini Kit Columns Buffers Reagents Tubes VacConnectors EpiTect Bisulfite Kit For 48 preps EpiTect Bisulfite 59104 Spin Columns Reaction Mix DNA Protect Buffer Carrier RNA Buffers EpiTect Plus FFPE For 48 preps MinElute DNA spin 59144 Bisulfite Kit columns Bisulfite mix DNA Protect Buffer Carrier RNA Buffers Deparaffinization Solution Lysis Buffer FTB For up to date licensing information and product specific disclaimers see the respective QIAGEN kit handbook or user manual QIAGEN kit handbooks and user manuals are available at www giagen com or can be requested from QIAGEN Technical Services or your local distributor CES 36 MGMT Pyro Kit Handbook 06 2011 This page intentionally left blank MGMT Pyro Kit Handbook 06 2011 37 This page intentionally left blank 38 MGMT Pyro Kit Handbook 06 2011 Trademarks QIAGEN QlAamp QlAxcel CoralLoad EpiTect EZ1 HotStarTaq MinElute Pyro Pyrogram PyroMark Pyrosequencing QIAGEN Group Milli Q Millipore Corporation Sepharose GE Healthcare Variomag Thermo Fisher Scientific Windows Microsoft Corporation
29. tion proceed with Protocol 3 Immobilization of PCR products to Streptavidin Sepharose High Performance beads page 17 16 MGMT Pyro Kit Handbook 06 2011 Protocol 3 Immobilization of PCR products to Streptavidin Sepharose High Performance beads This protocol is for immobilization of template DNA to Streptavidin Sepharose High Performance GE Healthcare prior to analysis on the PyroMark Q24 System Important points before starting E Allow all required reagents and solutions to reach room temperature 15 25 C before starting Procedure 1 Gently shake the bottle containing Streptavidin Sepharose High Performance until it is a homogeneous solution 2 Prepare a master mix for DNA immobilization according to Table 6 Prepare a volume 10 greater than that required for the total number of reactions to be performed Table 6 Master mix for DNA immobilization Component Volume sample wl Streptavidin Sepharose High Performance 2 PyroMark Binding Buffer 40 Water H50 supplied 28 Total volume 70 3 Add 70 pl of the master mix to wells of a 24 well PCR plate or strips as predefined in the run setup see Protocol 1 Run setup for the PyroMark Q24 System page 12 4 Add 10 ul of biotinylated PCR product from Protocol 2 to each well containing master mix as predefined in the run setup see Protocol 1 Run setup for the PyroMark Q24 System page 12 The total volume per well should be 80 pl after addition
30. vice immediately show the label where possible MGMT Pyro Kit Handbook 06 2011 9 E Thaw all components thoroughly at room temperature 15 25 C before starting an assay E When thawed mix the components by pipetting repeatedly up and down or by pulse vortexing and centrifuge briefly E Failed results are not a basis for judgment of methylational status Reagent Storage and Handling The MGMT Pyro Kit is shipped in two boxes The MGMT Pyro Kit box 1 2 is shipped on dry ice PyroMark PCR Master Mix CoralLoad Concentrate methylated control DNA and all primers should be stored at 15 to 25 C upon arrival The Pyro Buffers and Reagents box 2 2 containing buffers Enzyme Mixture Substrate Mixture dATPa S dCTP dGTP and dTTP the reagents for Pyrosequencing analysis is shipped on cool packs These components should be stored at 2 8 C upon arrival To minimize loss of activity it is advisable to keep both the enzyme mixture and the substrate mixture in the vials supplied Reconstituted enzyme and substrate mixtures are stable for at least 5 days at 2 8 C Reconstituted enzyme and substrate mixtures can be frozen and stored in their vials at 15 to 25 C Frozen reagents should not be subjected to more than 3 freeze thaw cycles Important Nucleotides should not be frozen The MGMT Pyro Kit is stable until the kit expiration date when stored under these conditions Specimen Handling and Storage All samples must
31. will be selected or double click the cell MGMT Pyro Kit Handbook 06 2011 13 Protocol 2 PCR using the reagents supplied with the MGMT Pyro Kit This protocol is for PCR amplification of a region of bisulfite converted DNA using the MGMT Pyro Kit Important points before starting E The HotStarTaq DNA polymerase in the PyroMark PCR Master Mix requires an activation step of 15 minutes at 95 C E Set up all reaction mixtures in an area separate from that used for DNA purification adding template DNA to the PCR PCR product analysis or preparation of samples prior to Pyrosequencing analysis E Use disposable tips containing hydrophobic filters to minimize cross contamination E Bisulfite converted DNA must be used as template DNA The EpiTect Bisulfite Kit cat no 59104 or EpiTect Plus FFPE Bisultite Kit cat no 59144 from QIAGEN are recommended Things to do before starting E Before opening the tube with PCR primer centrifuge briefly to collect contents at the bottom of the tubes E Adjust the concentration of the sample and control DNA if necessary to 2 10 ng ul Procedure 1 Thaw all necessary components Mix well before use 2 Prepare a reaction mix according to Table 3 The reaction mix typically contains all of the components needed for PCR except the sample Prepare a volume of reaction mix greater than that required for the total number of PCR assays to be performed 14 MGMT Pyro Kit Handbook 0
32. yroMark Q24 Plate from the hot plate holder and place it on a second PyroMark Q24 Plate Holder that was kept at room temperature 15 25 C to let the samples cool to room temperature 15 25 C for 10 15 minutes 19 Proceed with Protocol 5 Running the PyroMark Q24 System page 23 22 MGMT Pyro Kit Handbook 06 2011 Protocol 5 Running the PyroMark Q24 System This protocol describes the preparation and loading of PyroMark Gold Q24 Reagents into the PyroMark Q24 Cartridge and starting and finishing a run on the PyroMark Q24 System For a detailed description on how to set up a run see the PyroMark Q24 User Manual Important point before starting E Switch on the PyroMark Q24 The power switch is located at the rear of the instrument E The Pre Run information report found in the Tools menu at run setup see Protocol 1 Run setup for the PyroMark Q24 System page 12 provides information about the volume of nucleotides enzyme and substrate buffer needed for a specific assay Procedure 1 Dissolve each of the freeze dried enzyme and substrate mixtures in 620 pl water supplied 2 Mix by swirling the vial gently Do not vortex To ensure the mixture is fully dissolved leave it at room temperature 15 25 C for 5 10 minutes Make sure that the solution is not turbid before filling the PyroMark Q24 Cartridge If the reagents are not to be used immediately place the reagent vials on ice or in a refrigerator 3 Allow the
Download Pdf Manuals
Related Search