Home

InsectSelect BSD System with pIB/V5-His

Contents

1. The metal binding domain encoded by the polyhistidine tag allows simple easy purification of your recombinant protein by Immobilized Metal Affinity Chromatography IMAC using ProBond Resin available from Invitrogen The TM ProBond Purification System and Ni NTA Purification System are also available from Invitrogen See the table below for ordering information Product Quantity Catalog no ProBond Purification System 6 purifications K850 01 ProBond Purification Kit with Anti V5 HRP 1 kit K854 01 Antibody ProBond Purification Kit with Anti His C 1 kit K853 01 term HRP Antibody ProBond Nickel Binding Resin 50 ml R801 01 150 ml R801 15 Purification Columns 50 R640 50 10 ml polypropylene columns Ni NTA Purification System 6 purifications K950 01 Ni NTA Purification System with Anti V5 1 kit K954 01 HRP Antibody Ni NTA Purification System with Anti His C 1 kit K953 01 term HRP Antibody Ni NTA Agarose 10 ml R901 01 25 ml R901 15 Overview Introduction Description of System Description of Promoters Expression Levels Introduction TM The InsectSelect System allows you to express your protein of interest in insect cell lines either transiently or stably The system utilizes a single expression vector pIB V5 His to express your gene of interest This 3 5 kb vector has the following features e O
2. Your insert should contain a Kozak consensus sequence with an ATG initiation codon for proper initiation of translation Kozak 1987 Kozak 1990 Kozak 1991 An example of a Kozak consensus sequence is provided below Other sequences are possible but the G or A at position 3 and the G at position 4 shown in bold illustrates the most commonly occurring sequence with strong consensus Replacing one of the two bases at these positions provides moderate consensus while having neither results in weak consensus The ATG initiation codon is shown underlined G AJNNATGG If you wish to include the C terminal peptide for detection with either the V5 or His C term antibodies or purification using the 6xHis tag you must clone your gene in frame with the peptide Be sure that your gene does not contain a stop codon upstream of the C terminal peptide If you do not wish to include the C terminal peptide include the native stop codon for your gene of interest If your protein of interest is normally secreted try expressing the protein using the native secretion signal To date all mammalian secretion signals tested have functioned properly in insect cells We have successfully expressed human interleukin 6 IL6 using the native secretion signal to levels of 1 2 pg ml In addition we recommend that you create a construct to express your protein intracellularly in the event that your protein is not secreted Continued on nex
3. TM If you plan to use a metal chelating resin such as ProBond to purify your secreted protein from serum free medium note that adding serum free medium directly to the column will strip the nickel ions from the resin See the information below in Purification of 6xHis tagged Proteins from Medium for a general recommendation to address this issue Many protocols are suitable for purifying proteins from the medium The choice of protocol depends on the nature of the protein being purified Note that the culture volume needed to purify sufficient quantities of protein is dependent on the expression level of your protein and the method of detection To purify 6xHis tagged proteins from the medium see below To purify 6xHis tagged recombinant proteins from the culture medium we recommend that you perform dialysis or ion exchange chromatography prior to affinity chromatography on metal chelating resins Dialysis allows e Removal of media components that strip Ni from metal chelating resins Ion exchange chromatography allows e Removal of media components that strip Ni from metal chelating resins e Concentration of your sample for easier manipulation in subsequent purification steps Conditions for successful ion exchange chromatography will vary depending on the protein For more information refer to Current Protocols in Protein Science Coligan et al 1998 Current Protocols in Molecular Biology Unit 10 Ausubel et
4. High Five Express Five Serum Free Medium with High Five Cells The following manuals are supplied with each kit Kit Manual InsectSelect BSD System with Sf9 Cells InsectSelect BSD System manual Insect Cell Lines manual TM InsectSelect BSD System with High InsectSelect BSD System manual Five Cells Insect Cell Lines manual pIB V5 His Vector Kit InsectSelect BSD System manual Accessory Products Introduction The products listed in this section are intended for use with the InsectSelect TM BSD System and the pIB V5 His Vector Kit For more information refer to our web site at www invitrogen com or contact Technical Support page 27 Additional The following products are available separately from Invitrogen Products Product Quantity Catalog no Sf9 Cells frozen 1 ml vial 1 x 107 cells ml B825 01 Sf21 Cells frozen 1 ml vial 1 x 107 cells ml B821 01 High Five Cells frozen 1 ml vial 3 x 10 cells ml B855 02 TOP10 Electrocomp Cells 5 x 80 pl C664 55 10 x 80 ul C664 11 30 x 80 ul C664 24 One Shot TOP10 chemically competent cells 21 x 50 pl C4040 03 Electrocomp TOP10 5 x 80 ul C664 55 Grace s Insect Cell Culture Medium Unsupplemented 500 ml 11595 030 Sf 900 IT SFM 1 liter 10902 088 Express Five SFM 1 liter 10486 025 Cellfectin Reagent 1ml 10362 010 Blasticidin S 50
5. 1998 Current Protocols in Protein Science Current Protocols Chanda V B Ed John Wiley and Sons Inc New York Deutscher M P ed 1990 Guide to Protein Purification Vol 182 Methods in Enzymology Edited by Abelson J N and Simon M I Academic Press San Diego CA England B P Heberlien U and Tjian R 1990 Purified Drosophila Transcription Factor ADH Distal Factor 1 Adf 1 Binds to Sites in Several Drosophila Promoters and Activates Transcription J Biol Chem 265 5086 5094 Hegedus D D Pfeifer T A Hendry J Theilmann D A and Grigliatti T A 1998 A Series of Broad Host Range Shuttle Vectors for Constitutive and Inducible Expression of Heterologous Proteins in Insect Cell Lines Gene 207 241 249 Hegedus D D Pfeifer T A Theilmann D A Kennard M L Gabathuler R Jefferies W A and Grigliatti T A 1999 Differences in the Expression and Localization of Human Melanotransferrin in Lepidopteran and Dipteran Insect Cell Lines Protein Expression and Purification 15 296 307 Izumi M Miyazawa H Kamakura T Yamaguchi I Endo T and Hanaoka F 1991 Blasticidin S Resistance Gene bsr A Novel Selectable Marker for Mammalian Cells Exp Cell Res 197 229 233 Jarvis D L Weinkauf C and Guarino L A 1996 Immediate Early Baculovirus Vectors for Foreign Gene Expression in Transformed or Infected Insect Cells Protein Expression and Purification 8 191 203 Johnson
6. Invitrogen Corporation 5791 Van Allen Way Carlsbad California 92008 Phone 760 603 7200 Fax 760 602 6500 Blasticidin and the blasticidin resistance gene bsd are the subject of U S Patent No 5 527 701sold under patent license for research purposes only Inquiries for commercial use should be directed to Kaken Pharmaceutical Company Ltd Bunkyo Green Court Center Office Building 19 20 Fl 28 8 Honkomagome 2 chome Bunkyo ku Tokyo 113 8650 Japan Tel 81 3 5977 5008 Fax 81 3 5977 5008 The High Five cell line is patented by the Boyce Thompson Institute for Plant Research Ithaca New York and is covered under U S patent no 5 300 435 The High Five cell line is sold for research purposes only Commercial use requires a license from Boyce Thompson For more information please contact Joyce L Frank Tel 607 254 1220 Fax 607 254 1242 E mail jf51 cornell edu 29 References Ausubel F M Brent R Kingston R E Moore D D Seidman J G Smith J A and Struhl K 1994 Current Protocols in Molecular Biology Greene Publishing Associates and Wiley Interscience New York Blissard G W and Rohrmann G F 1989 Location Sequence Transcriptional Mapping and Temporal Expression of the gp64 Envelope Glycoprotein Gene of the Orgyia pseudotsugata Multicapsid Nuclear Polyhedrosis Virus Virology 170 537 555 Coligan J E Dunn B M Ploegh H L Speicher D W and Wingfield P T
7. gt e z 552555238 PR o NOQNUWXX0N PHSR Kpn BspH I 1 Features of pIB V5 His 3521 nucleotides OpIE2 promoter bases 1 548 OplE2 Forward priming site bases 511 530 Multiple cloning site bases 557 652 V5 epitope bases 659 700 6xHis tag bases 710 727 OplE2 Reverse priming site bases 737 762 OpIE2 polyadenylation sequence bases 745 874 pUC origin bases 943 1616 c OpIE1 promoter bases 1665 1956 EM7 promoter bases 1971 2029 Blasticidin resistance gene bsd bases 2048 2447 Ampicillin resistance gene bla 2566 3426 Continued on next page Features of pIB V5 His Features of The features of pIB V5 His 3521 bp are described below All features have been pIB V5 His functionally tested The multiple cloning site has been tested by restriction analysis Features Function OpIE2 promoter Provides constitutive expression of the gene of interest in lepidopteran insect cells Theilmann amp Stewart 1992 OpIE2 Forward priming site Allows sequencing of the insert from the 5 end Multiple cloning site 13 unique sites Allows insertion of the gene of interest for expression V5 epitope Gly Lys Pro Ile Pro Asn Pro Leu Leu Gly Leu Asp Ser Ihr Allows detection of your recombinant protein with the Anti V5 Antibodies Southern et al 1991 6xHis tag Allows purification of your recombinant protein on metal chelating resin such as ProBond I
8. 1965 Resistance is conferred by expression of either one of two blasticidin S deaminase genes BSD from Aspergillus terreus Kimura et al 1994 or bsr from Bacillus cereus Izumi et al 1991 These deaminases convert blasticidin S to a non toxic deaminohydroxy Kimura amp Yamaguchi 1996 Yamaguchi et al 1975 The table below describes the general steps needed to clone and express your TM gene of interest using the InsectSelect BSD kit of your choice For more details refer to the manual and the pages indicated Step Action Source 1 Establish culture of Sf9 or High Five cells Refer to the Insect Cell Note Other cell lines e g Sf21 may be used Lines manual or use your own protocols 2 Develop a cloning strategy to ligate your gene of Pages 4 6 this manual interest into pIB V5 His 3 Transform your ligation reactions into a recA Page 6 this manual endA E coli strain e g TOP10 Select on LB plates containing 50 100 pg ml ampicillin 4 Isolate plasmid DNA and sequence your Page 6 this manual recombinant expression vector to confirm that your protein is in frame with the C terminal peptide Transfect Sf9 or High Five cells Pages 7 9 this manual Assay for transient expression of your protein Pages 10 11 this manual 7 Create stable cell lines expressing the protein of Pages 12 15 this interest by selecting with blasticidin manual 8 Scale up expression for purificati
9. 3 329 OpIE2 Reverse 5 GACAATACAAACTAAGATTTAGTCAG 3 250 Continued on next page Kit Contents and Storage Continued Blasticidin Cellfectin Reagent Cells and Medium Manuals TM Blasticidin is supplied with the InsectSelect BSD System kits only Blasticidin is shipped as 50 mg powder Upon receipt store Blasticidin at room temperature Blasticidin is available to order separately see page vi Cellfectin Reagent is supplied with the InsectSelect BSD System kits only Cellfectin Reagent is shipped as 1 ml composition 1 mg ml lipid in membrane filtered water Upon receipt store Cellfectin Reagent at 4 C Cellfectin Reagent is available to order separately see page vi Supplied with the InsectSelect BSD System kits only Additional cells and other cell lines are available to order separately see page vii Store the cells in liquid nitrogen Store the medium at 4 C protected from light Different cells and media are included depending on which InsectSelect BSD System kit you ordered Refer to the table below For guidelines and instructions to culture Sf9 and High Five cells refer to the Insect Cell Lines manual included with each kit Kit Cells Medium InsectSelect BSD System Sf9 e Sf 900 II SFM 1X or with Sf9 Cells e Grace s Insect Cell Culture Medium Unsupplemented contains L glutamine InsectSelect BSD System
10. BioTechniques 5 444 447 Continued on next page 30 References Continued Pfeifer T A Hegedus D D Grigliatti T A and Theilmann D A 1997 Baculovirus Immediate Early Promoter Mediated Expression of the Zeocin Resistance Gene for Use as a Dominant Selectable Marker in Dipteran and Lepidopteran Insect Cell Lines Gene 188 183 190 Sambrook J Fritsch E F and Maniatis T 1989 Molecular Cloning A Laboratory Manual Second Ed Cold Spring Harbor Laboratory Press Plainview New York Southern J A Young D F Heaney F Baumgartner W and Randall R E 1991 Identification of an Epitope on the P and V Proteins of Simian Virus 5 That Distinguishes Between Two Isolates with Different Biological Characteristics J Gen Virol 72 1551 1557 Takeuchi S Hirayama K Ueda K Sakai H and Yonehara H 1958 Blasticidin S A New Antibiotic The Journal of Antibiotics Series A 11 1 5 Theilmann D A and Stewart S 1991 Identification and Characterization of the IE 1 Gene of Orgyia pseudotsugata Multicapsid Nuclear Polyhedrosis Virus Virology 180 492 508 Theilmann D A and Stewart S 1992 Molecular Analysis of the trans Activating IE 2 Gene of Orgyia pseudotsugata Multicapsid Nuclear Polyhedrosis Virus Virology 187 84 96 Yamaguchi H Yamamoto C and Tanaka N 1965 Inhibition of Protein Synthesis by Blasticidin S I Studies with Cell free Systems from Bacterial and Mammalian Cells
11. Merck Index 12 1350 NH2 Formula and MW 458 9 Re SMURUIE Formula C17H26NsOs HCl N N HOOC O r HCl ia ae a NH NH2 O Handling Always wear gloves mask goggles and protective clothing e g a laboratory Blasticidin coat when handling blasticidin Weigh out blasticidin and prepare solutions in a hood To inactivate blasticidin for disposal add sodium bicarbonate Preparing and e Blasticidin S is soluble in water and acetic acid Water is generally used to Storing Stock prepare stock solutions of 5 to 10 mg ml Solutions e Dissolve blasticidin S in sterile water and filter sterilize the solution e Blasticidin S is unstable in solutions with a pH greater than 8 0 Be sure the pH of the solution is 7 0 e Aliquot in small volumes see below and freeze at 20 C for long term storage or store at 4 C for short term storage e Aqueous stock solutions are stable for 1 2 weeks at 4 C and 6 8 weeks at 20 C e Do not subject stock solutions to freeze thaw cycles do not store in a frost free freezer e Upon thawing use what you need and store at 4 C Discard after 1 2 weeks 21 Map of pIB V5 His Map of pIB V5 His The figure below summarizes the features of the pIB V5 His vector 3521 bp 22 For a more detailed explanation of each feature see the next page The complete sequence of pIB V5 His is available from our web site at www invitrogen com or from Technical Support page 27 Ecl136 II
12. P F and McKnight S L 1989 Eukaryotic Transcriptional Regulatory Proteins Ann Rev Biochem 58 799 839 Kimura M Takatsuki A and Yamaguchi I 1994 Blasticidin S Deaminase Gene from Aspergillus terreus BSD A New Drug Resistance Gene for Transfection of Mammalian Cells Biochim Biophys ACTA 1219 653 659 Kimura M and Yamaguchi I 1996 Recent Development in the Use of Blasticidin S a Microbial Fungicide as a Useful Reagent in Molecular Biology Pesticide Biochem Physiol 56 Kozak M 1987 An Analysis of 5 Noncoding Sequences from 699 Vertebrate Messenger RNAs Nucleic Acids Res 15 8125 8148 Kozak M 1990 Downstream Secondary Structure Facilitates Recognition of Initiator Codons by Eukaryotic Ribosomes Proc Natl Acad Sci USA 87 8301 8305 Kozak M 1991 An Analysis of Vertebrate mRNA Sequences Intimations of Translational Control J Cell Biology 115 887 903 Lindner P Bauer K Krebber A Nieba L Kremmer E Krebber C Honegger A Klinger B Mocikat R and Pluckthun A 1997 Specific Detection of His tagged Proteins With Recombinant Anti His Tag scFv Phosphatase or scFv Phage Fusions BioTechniques 22 140 149 Mann S G and King L A 1989 Efficient Transfection of Insect Cells with Baculovirus DNA Using Electroporation J Gen Virol 70 3501 3505 Neumann J R Morency C A and Russian K O 1987 A Novel Rapid Assay for Chloramphenicol Acetyltransferase Gene Expression
13. a side to side rocking platform Adjust speed to 2 side to side motions per minute Note If you do not have a rocker manually rock the dishes periodically 7 After incubation add 1 2 ml of appropriate serum free medium see previous page to each 60 mm dish 8 Place the dishes in a sealed plastic bag with moist paper towels to prevent evaporation and incubate at 27 C Note It is not necessary to remove the transfection solution as Cellfectin Reagent is not toxic to the cells If you are using a different lipid and observe loss of viability then remove the transfection solution after 4 hours rinse twice with medium and replace with 1 2 ml of fresh serum free medium 9 Harvest the cells 2 3 and 4 days post transfection and assay for expression of your gene see next page There s no need to add fresh medium if the cells are sealed in an airtight plastic bag with moist paper towels Note To create stable cell lines proceed to Stable Transfection Procedure page 12 at 48 hours post transfection Otherwise continue to harvest cells at days 3 and 4 post transfection Continued on next page Transient Expression in Insect Cells Continued Detecting To detect expression of your recombinant fusion protein by Western blot Recombinant analysis you may use the Anti V5 antibodies or the Anti His C term Proteins antibodies available from Invitrogen see page viii for ordering information or TM an antibody to your p
14. and replace with medium containing blasticidin at the appropriate concentration Incubate cells at 27 C 5 Replace selective medium every 3 to 4 days until you observe foci colonies forming At this point you may use cloning cylinders or dilution to isolate clonal cell lines next page or you can let resistant cells grow out to confluence for a polyclonal cell line 2 to 3 weeks 6 To isolate a polyclonal cell line let the resistant cells grow to confluence and split the cells 1 5 and test for expression Important Always use medium without blasticidin when splitting cells Let the cells attach before adding selective medium 7 Expand resistant cells into flasks to prepare frozen stocks Important Always use medium containing blasticidin when maintaining stable lepidopteran cell lines You may lower the concentration of blasticidin to 10 pg ml for maintenance Continued on next page 13 Selecting Stable Cell Lines Continued Isolation of Clonal Cell Lines Using Cloning Cylinders 14 If you elect to select clonal cell lines try to isolate as many foci colonies as possible for expression testing As in mammalian cell culture the location of integration may affect expression of your gene Tip Perform selections in small plates or wells When you remove the medium you must work quickly to prevent the cells from drying out Using smaller plates or wells limits the number of colonies you can choose at a time To se
15. in Drosophila is generally not observed Review the information on blasticidin S on page 21 Prepare a stock solution of blasticidin S as described in the protocol provided Cytopathic effects should be visible within 3 5 days depending on the concentration of blasticidin in the medium Sensitive cells will enlarge and become filled with vesicles The outer membrane will show signs of blebbing and cells will eventually detach from the plate Blasticidin resistant cells should continue to divide at regular intervals to form distinct colonies There should not be any distinct morphological changes between blasticidin resistant cells compared to cells not under selection with blasticidin In general concentrations around 10 pg ml will kill Sf9 in complete Sf 900 II SFM medium and concentrations around 20 pg ml will kill High Five cells in Express Five SFM within one week although a few cells may remain that exclude trypan blue To obtain faster and more thorough killing we recommend using 50 80 ug ml blasticidin Once blasticidin resistant clones have been obtained cells may be maintained in lower concentrations of blasticidin e g 10 20 pg ml If you are using other media or have trouble selecting cells using the concentrations above we recommend that you perform a kill curve see below If you wish to test your cell line for sensitivity to blasticidin perform a kill curve as described below Assays can be done in 2
16. mg R210 01 S N A P Miniprep Kit 100 reactions K1900 01 PureLink HiPure Plasmid Miniprep Kit 100 preps K2100 03 Positope Control Protein 5 ug R900 50 vi Continued on next page Accessory Products Continued Additional InsectSelect Kits Polyacrylamide Gel Electrophoresis Several other kits that allow you to clone and stably express your gene of interest using the InsectSelect technology are available from Invitrogen These kits include InsectSelect vectors with different antibiotic resistance genes and those that allow secreted protein expression In addition the pIZT V5 His Vector Kit enables expression of a gene of interest and a cycle 3 GFP Zeocin fusion gene This allows both visual monitoring of transfection efficiency and generation of a stable cell line For more information about the various InsectSelect vector kits available from Invitrogen visit our web site at www invitrogen com or contact Technical Support page 27 See the table below for ordering information Product Catalog no pIB V5 His TOPO TA Expression Kit K890 01 pIZ V5 His Vector Kit V8000 01 InsectSelect System with Sf9 Cells K800 01 InsectSelect System with High Five Cells K805 01 pIZT V5 His Vector Kit V8010 01 pMIB V5 His Vector Kit V8030 01 To facilitate separation of your recombinant protein by polyacrylamide gel electrophoresis a wide range of pre cast NuPA
17. this product to a scientific collaborator provided that such transfer is not for any Commercial Purpose and that such collaborator agrees in writing a to not transfer such materials to any third party and b to use such transferred materials and or information solely for research and not for Commercial Purposes Commercial Purposes means any activity by a party for consideration and may include but is not limited to 1 use of the product or its components in manufacturing 2 use of the product or its components to provide a service information or data 3 use of the product or its components for therapeutic diagnostic or prophylactic purposes or 4 resale of the product or its components whether or not such product or its components are resold for use in research Invitrogen Corporation will not assert a claim against the buyer of infringement of the above patents based upon the manufacture use or sale of a therapeutic clinical diagnostic vaccine or prophylactic product developed in research by the buyer in which this product or its components was employed provided that neither this product nor any of its components was used in the manufacture of such product If the purchaser is not willing to accept the limitations of this limited use statement Invitrogen is willing to accept return of the product with a full refund For information on purchasing a license to this product for purposes other than research contact Licensing Department
18. without blasticidin and add 100 ul of this solution to the last group of 32 wells Note Although the cells can be diluted to low numbers cell density is critical for viability If the density drops below a certain level the cells will not grow 5 Let the cells attach overnight then remove the medium and replace with medium containing blasticidin Note Removing and replacing medium may be tedious If you slough the cells gently it is possible to dilute the cells directly into selective medium 6 Wrap the plate and incubate at 27 C for 1 week It is not necessary to change the medium or place in a humid environment 7 Check the plate after a week and mark the wells that have only one colony Continue to incubate the plate until the colony fills most of the well Harvest the cells and transfer to a 24 well plate with 0 5 ml of fresh medium containing blasticidin 10 Continue to expand the clone to 12 and 6 well plates and finally toa T 25 flask Assay each of your cell lines for yield of the desired protein and select the one with the highest yield for scale up and purification of recombinant protein If your protein is secreted remember to assay the cell pellet as well as the medium You may wish to compare the yield of protein in the cells and medium In general the level of secreted protein is comparable to that obtained with viral expression systems in insect cells We have obtained stable cell lines that express
19. 0 748 0025 Continued on next page Purchaser Notification Continued Limited Use Label License No 22 Vectors and Clones Encoding Histidine Hexamer Limited Use Label License No 36 Cellfectin Transfection Reagent Limited Use Label License No 51 Blasticidin and the Blasticidin Selection Marker Limited Use Label License No 66 High Five Cells This product is licensed under U S Patent Nos 5 284 933 and 5 310 663 and foreign equivalents from Hoffmann LaRoche Inc Nutley NJ and or Hoffmann LaRoche Ltd Basel Switzerland and is provided only for use in research Information about licenses for commercial use is available from QIAGEN GmbH Max Volmer Str 4 D 40724 Hilden Germany This product is the subject of one or more of U S Patent Nos 5 674 908 5 834 439 6 110 916 and foreign equivalents owned by Invitrogen The purchase of this product conveys to the buyer the non transferable right to use the purchased amount of the product and components of the product in research conducted by the buyer whether the buyer is an academic or for profit entity The buyer cannot sell or otherwise transfer a this product b its components or c materials made using this product or its components to a third party or otherwise use this product or its components or materials made using this product or its components for Commercial Purposes The buyer may transfer information or materials made through the use of
20. 4 well tissue culture plates 1 Prepare Sf 900 II SFM medium 1X or the serum free medium of choice supplemented with concentrations ranging from 0 100 ug ml blasticidin Generally concentrations that effectively kill lepidopteran insect cells within a week are in the 50 80 pg ml range Note While 10 20 ug ml blasticidin will kill cells within a week higher concentrations will result in faster and more thorough killing In addition using higher concentrations of blasticidin may result in enrichment of clones containing multiple integrations of your gene of interest 2 Test varying concentrations of blasticidin on the cell line to determine the concentration that kills your cells within a week kill curve 3 Use the concentration of drug that kills your cells within a week Continued on next page Selecting Stable Cell Lines Continued Do not linearize the plasmid prior to transfection Linearizing the plasmid Note appears to decrease protein expression Stable For stable transfections follow the steps below Include a mock transfection and Transfection a positive control pIB V5 His CAT Procedure 1 Complete the Transfection Procedure page 9 through Step 9 until 2 days post transfection 2 At 2 days post transfection remove the transfection solution and add fresh medium without blasticidin 3 Split cells 1 5 20 confluent and let cells attach overnight before adding selective medium 4 Remove medium
21. GE and Novex Tris Glycine polyacrylamide gels are available from Invitrogen In addition Invitrogen also carries a large selection of molecular weight protein standards and staining kits For more information about the appropriate gels standards and stains to use to visualize your recombinant protein refer to our web site at www invitrogen com or contact Technical Support page 27 Continued on next page vii Accessory Products Continued Detecting Recombinant Proteins Purifying Recombinant Protein viii Expression of your recombinant fusion protein can be detected using an antibody to the appropriate epitope The table below describes the antibodies available for detection of C terminal fusion proteins expressed using pIB V5 His Horseradish peroxidase HRP or alkaline phosphatase AP conjugated antibodies allow one step detection using colorimetric or chemiluminescent detection methods The amount of antibody supplied is sufficient for 25 Westerns Product Epitope Catalog no Anti V5 Antibody Detects 14 amino acid epitope R960 25 Anti V5 HRP Antibody derived from the P and V R961 25 Anti V5 AP Antibody ae N ES GKPIPNPLLGLDST Anti His C term Antibody Detects the C terminal R930 25 Anti His C term HRP polyhistidine 6xHis tag R931 25 Antibody requires the free carboxyl group Ani HiG TAP for detection Lindner et al 1997 R932 25 Antibody HHHHHH COOH
22. J Biochem Tokyo 57 667 677 Yamaguchi I Shibata H Seto H and Misato T 1975 Isolation and Purification of Blasticidin S Deaminase from Aspergillus terreus J Antibiotics 28 7 14 1999 2008 Invitrogen Corporation All rights reserved For research use only Not intended for any animal or human therapeutic or diagnostic use 31 Notes Notes Notes invitrogen Corporate Headquarters 5791 Van Allen Way Carlsbad CA 92008 T 1 760 603 7200 F 1 760 602 6500 E tech_support invitrogen com For country specific contact information visit our web site at www invitrogen com
23. Product User Registration Card and return it to Invitrogen Invitrogen grants you a non exclusive license to use the enclosed Expression Kit for academic research or for commercial evaluation purposes only The Expression Kit is being transferred to you in furtherance of and reliance on such license You may not use the Expression Kit or the materials contained therein for any Commercial Purpose without a license for such purpose from Research Corporation Technologies RCT If you are a commercial entity your right to use the Expression Kit expires after one year Any commercial entity that wishes to use the Expression Kit beyond this one year period must obtain a commercial license from RCT Commercial entities will be contacted by RCT during this one year period regarding their desire to obtain a commercial license You may terminate your use of the Expression Kit at any time by destroying all InsectSelect expression products in your control Your right to use the Expression Kit will also terminate automatically if you fail to comply with the terms and conditions set forth herein You shall upon such termination of your rights destroy all Expression Kits in your control and notify Invitrogen of such in writing Commercial Purpose include any use of Expression Products in a Commercial Product any use of Expression Products in the manufacture of a Commercial Product any sale of Expression Products any use other than evaluation of Exp
24. RGO a de te sade as Seok Mae o edea E SPERRER NSRS na 27 Purchaser Notifica aaa 28 AS O NN ke 30 Kit Contents and Storage Types of Kits Shipping Storage Vectors and Primer This manual is supplied with the products listed below Product Catalog no InsectSelect BSD System with Sf9 Cells K820 01 InsectSelect BSD System with High Five Cells K825 01 pIB V5 His Vector Kit V8020 01 See the table below for shipping and storage information Product Shipping Storage InsectSelect BSD System Dry ice Vectors primers blasticidin 20 C with Sf9 Cells Cellfectin Reagent 4 C InsectSelect BSD System Cells Liquid nitrogen with High Five Cells Medium 4 C protected from light pIB V5 His Vector Kit Wet ice 20 C The vectors and primers are supplied with all of the kits listed above Store at 20 C Product Amount Composition Supplied pIB V5 His 20 ug 40 ul of 0 5 ug ul pIB V5 His in 10 mM Tris HCI 1 mM EDTA pH 8 0 pIB V5 His CAT 20 ug 40 ul of 0 5 ug ul pIB V5 His CAT control vector in 10 mM Tris HCI 1 mM EDTA pH 8 0 OpIE2 Forward 2 ug Lyophilized in TE pH 8 0 Sequencing Primer OpIE2 Reverse 2 ug Lyophilized in TE pH 8 0 Sequencing Primer Primer Sequences The sequence of each primer is provided below Primer Sequence pMoles Supplied OpIE2 Forward 5 CGCAACGATCTGGTAAACAC
25. TGACTAAAT CTTAGTTTGT ATTGTCATGT TTTAATACAA TATGTTATGT His His His OpIE2 polyadenylation signal TTAAATATGT TTTTAATAAA TTTTATAAAA TAATTTCAAC TTTTATTGTA ACAACATTGT CCATTTACAC 3 untranslated region of OplE2 ACTCCTTTCA AGCGCGTGGG ATCGATGCTC ACTCAAAGGC GGTAATACGG TTATCCACAG AATCAGGGGA Transforming E coli Introduction E coli Host Transformation Method Long Term Storage Once you have completed your ligation reactions you are ready to transform into E coli Many strains and transformation protocols are suitable General recommendations are provided below Many E coli strains are suitable for transformation of pIB V5 His including TOP10 or DH5 We recommend that you propagate vectors containing inserts in E coli strains that are recombination deficient recA and endonuclease A deficient endA For your convenience TOP10 is available as electrocompetent or chemically competent cells from Invitrogen see page vi You may use your method of choice to transform E coli To select transformants use LB plates containing 50 100 ug ml ampicillin Note It is possible to select E coli transformants on 100 150 pg ml blasticidin You will need to prepare Low Salt LB 5 g NaCl per liter and adjust the pH to below 7 before autoclaving After autoclaving and cooling add blasticidin Plates are stable for 1 2 weeks Since blasticidin is sensitive to salt and pH we recommend that you use ampicillin for sel
26. al 1994 or the Guide to Protein Purification Deutscher 1990 Continued on next page Scale Up and Purification Continued Metal chelating Resin Note Purification of Intracellularly Expressed Proteins Scale Up TM You may use the ProBond Purification System or Ni NTA Purification System page viii or a similar product to purify your 6xHis tagged protein Both purification systems contain a metal chelating resin specifically designed to purify 6xHis tagged proteins Before starting be sure to consult the ProBond Purification System manual or Ni NTA Purification System manual to familiarize yourself with the buffers and the binding and elution conditions If you are using another resin consult the manufacturer s instructions TM Many insect cell proteins are naturally rich in histidines with some containing stretches of six histidines When using the ProBond Purification System or other similar products to purify 6xHis tagged proteins these histidine rich proteins may co purify with your protein of interest The contamination can be significant if your protein is expressed at low levels We recommend that you add 5 mM imidazole to the binding buffer prior to addition of the protein mixture to the column Addition of imidazole may help to reduce background contamination by preventing proteins with low specificity from binding to the metal chelating resin If you are expressing your 6xHis tagged protei
27. and secrete human interleukin 6 to levels of 1 2 ug ml Human melanotransferrin has been expressed to levels of 8 10 pg ml Hegedus et al 1999 Remember to prepare master stocks and working stocks of your stable cell lines prior to scale up and purification Refer to the Insect Cell Lines manual for information on freezing your cells and scaling up for purification 15 Scale Up and Purification Introduction Important Serum Free Medium Adapting Cells to Different Medium Purifying Proteins from Medium Purification of 6xHis tagged Proteins from Medium 16 Once you have obtained stable cell lines expressing the protein of interest and prepared frozen stocks of your cell lines you are ready to purify your protein General information for protein purification is provided below Eventually you may expand your stable cell line into larger flasks spinners shake flasks or bioreactors to obtain the desired yield of protein If your protein is secreted you may culture cells in serum free medium to simplify purification As you expand your stable cell line you can maintain the concentration of blasticidin at 10 pg ml If your protein is secreted use serum free medium to facilitate expression and purification see page 8 Cells can be switched from complete medium to serum free medium during passage Refer to the Insect Cell Lines manual for more information on how to adapt cells to different medium
28. ar plates 1 Prepare LB medium as above but add 15 g L agar before autoclaving 2 Autoclave on liquid cycle for 20 minutes 3 After autoclaving cool to 55 C add antibiotic and pour into 10 cm plates 4 Let harden then invert and store at 4 C in the dark 1 Prepare a 0 4 stock solution of trypan blue in phosphate buffered saline pH 7 4 2 Mix 0 1 ml of trypan blue solution with 1 ml of cells and examine under a microscope at low magnification 3 Dead cells will take up trypan blue while live cells will exclude it Count live cells versus dead cells Cell viability should be at least 95 99 for healthy log phase cultures Continued on next page 19 Recipes Continued Cell Lysis Buffer 4X SDS PAGE Sample Buffer 20 50 mM Tris pH 7 8 150 mM NaCl 1 Nonidet P 40 1 This solution can be prepared from the following common stock solutions For 100 ml combine 1 M Tris base 5 ml 5 M NaCl 3 ml Nonidet P 40 1 ml 2 Bring the volume up to 90 ml with deionized water and adjust the pH to 7 8 with HCl 3 Bring the volume up to 100 ml Store at room temperature Add 1 mM PMSF 1 M leupeptin and 0 1 uM aprotinin to prevent proteolysis before use Combine the following reagents to obtain 10 ml 0 5 M Tris HCI pH 6 8 5 ml Glycerol 100 4 ml P mercaptoethanol 0 8 ml Bromophenol Blue 0 04 g SDS 0 8 g Aliquot and freeze at 20 C until needed Blasticidin S Molecular Weight
29. ection of E coli transformants We recommend that you sequence your construct to confirm that your gene is fused in frame with the V5 epitope and the polyhistidine tag Use the OpIE2 Forward and Reverse sequencing primers included in your kit or a primer to your gene of interest to sequence your insert Note Resuspend each primer in 20 ul sterile water to prepare a 0 1 pg pl stock solution Once you have confirmed that you have the correct clone prepare a glycerol stock for long term storage It is also a good idea to keep a stock of plasmid DNA at 20 C To prepare a glycerol stock 1 Grow the E coli strain containing the plasmid overnight 2 Combine 0 85 ml of the overnight culture with 0 15 ml of sterile glycerol 3 Vortex and transfer to a labeled cryovial 4 Freeze the tube in liquid nitrogen or dry ice ethanol bath and store at 80 C Transient Expression in Insect Cells Introduction Plasmid Preparation Method of Transfection Control of Plasmid Quality Materials Needed Once you have cloned your gene of interest into pIB V5 His you are ready to transfect your construct into Sf9 or High Five cells using lipid mediated transfection and test for expression of your protein Plasmid DNA for transfection into insect cells must be very clean and free from phenol and sodium chloride Contaminants will kill the cells and salt will interfere with lipid complexing decreasing transfection eff
30. edure medium see Serum Free Media previous page and incubated with freshly seeded insect cells The amount of cells liposomes and plasmid DNA has been optimized for 60 mm culture plates It is important that you optimize transfection conditions if you use plates or flasks other than 60 mm plates 1 To prepare each transfection mixture add the following reagents to a 1 5 ml microcentrifuge tube a 1ml Appropriate serum free medium see previous page b 1 10 pl pIB V5 His plasmid or construct 1 ug pl in TE pH 8 0 c 6hl Cellfectin Reagent mix well before use and always add last 2 Gently mix the transfection mixture for 10 seconds Incubate the transfection mixture at room temperature for 15 minutes While the transfection mixture is incubating proceed to Step 4 4 Carefully remove the medium from the cells without disrupting the monolayer If the medium contained serum wash the cells by carefully adding 2 ml of fresh serum free medium see previous page for appropriate media to use Note This will remove trace amounts of serum that will decrease the efficiency of liposome transfection 5 Again carefully remove all of the medium from the monolayer and add the entire transfection mix drop wise into the 60 mm dish Repeat for all transfections Note Distribute the drops evenly over the monolayer This method reduces the chances of disturbing the monolayer 6 Incubate the dishes at room temperature for 4 hours on
31. ellet Be sure to assay the pellet see below 5 Assay the lysate for protein concentration You may use the Bradford Lowry or BCA assays 6 To assay your samples mix them with SDS PAGE sample buffer as follows e Lysate 30 ul lysate with 10 ul 4X SDS PAGE sample buffer e Pellet Resuspend pellet in 100 pl 1X SDS PAGE sample buffer e Medium 30 pl medium with 10 ul 4X SDS PAGE sample buffer Note Because of the volume of medium it is difficult to normalize the amount loaded on an SDS PAGE gel If you are concerned about normalization concentrate the medium Boil the samples for 5 minutes Centrifuge briefly 8 Load approximately 3 30 ug protein per lane For the cell pellet sample load the same volume as the lysate Amount to load depends on the amount of your protein produced 9 Electrophorese your samples blot and probe with a suitable antibody see above 10 Visualize proteins using your desired method The C terminal tag containing the V5 epitope and 6xHis tag will increase the Note size of your protein by 3 kDa Note that any additional amino acids between your protein and the tags are not included in this molecular weight calculation Continued on next page 10 Transient Expression in Insect Cells Continued Polyacrylamide To facilitate separation of your recombinant protein by polyacrylamide gel Gel electrophoresis a wide range of pre cast NuPAGE and Novex Tris Glycine Electrophoresis po
32. he cells and medium and transfer to a microtiter plate and let the cells attach Remove medium and replace with selective medium for culturing Expand the cell line and test for expression of your gene of interest Important Always use medium without blasticidin when splitting cells Let the cells attach before adding selective medium Continued on next page Selecting Stable Cell Lines Continued Isolation of Clonal Cell Lines Using a Dilution Method Assay for Expression Yield of Expressed Protein Important You may also select clonal cell lines using a quick dilution method The objective of this method is to dilute the cells so that under selective pressure only one stable viable cell per well is achieved Note The higher your transfection efficiency the more you should dilute out your cells The protocol below works well with cells transfected at 5 10 efficiency 1 Forty eight hours after transfection dilute the cells to 1 x 10 cells ml in medium without blasticidin Note Other dilutions of the culture should also be used as transfection efficiency will determine how many transformed cells there will be per well 2 Add 100 ul of the cell solution from Step 1 to 32 wells of a 96 well microtiter plate 8 rows by 4 columns 3 Dilute the remaining cells 1 1 with medium without blasticidin and add 100 pl of this solution to the next group of 32 wells 8 x 4 4 Once again dilute the remaining cells 1 1 with medium
33. iciency We recommend isolating plasmid DNA using the S N A P Miniprep Kit or the PureLink HiPure Plasmid Miniprep Kit page vi The purified plasmid can be used directly for transfection of insect cells We recommend lipid mediated transfection with Cellfectin Reagent Note that other lipids may be substituted although transfection conditions may have to be optimized Expected Transfection Efficiency using Cellfectin Reagent e 40 60 for Sf9 cells e 40 60 for High Five cells Note Other transfection methods e g calcium phosphate and electroporation Mann amp King 1989 have also been tested with High Five cells To test the quality of a plasmid DNA preparation include a mock transfection using DNA only in all transfection experiments At about 24 48 hours post transfection compare the DNA only mock transfection with cells transfected with plasmid If the plasmid preparation contains contaminants then the cells will appear unhealthy and start to lyse You will need the following for each transfection experiment e 1 10 ug of highly purified plasmid DNA 1 pg ul in TE buffer e Either log phase Sf9 cells 1 6 2 5 x 10 cells ml gt 95 viability or log phase High Five cells 1 8 2 3 x 10 cells ml gt 95 viability growing in serum free medium Note You may transfect Sf9 cells in Grace s Medium without supplements or FBS The proteins in the FBS and supplements will interfere with the l
34. invitrogen InsectSelect BSD System For Stable Expression of Heterologous Proteins in Lepidopteran Insect Cell Lines using pIB V5 His Catalog nos K820 01 K825 01 V8020 01 Version I 07 October 2008 25 0330 Table of Contents Kit Contents nd Storage un ekegren iv Accessory Products ii AAA AS A NR vi L Balana a Lie aTa a A E EE AET E E A E E 1 OVERVIEW Je aS 1 Methods remesererersrsrsrnrnenenensrsrsenenenenensssrsenenenensnnensssssenenenenenesessenenenensnensnsesssenenenenenessssenenenensssssenenenenennsssssssenenenenesessesee 3 Culture Insect Cells nn tae faster dolo Beas casio Ir iodo Loa 3 Cloning to pl VIS ctv seta nennen hi hee AE es es 4 Tr nsforming E cola ea e E E EEE E aa gassen Ion AE A EE E 6 Transient Expression in Insect Cells ssmnvrvrvrvrvrorenevrrsrrrrrrereveverenrrnrsnnrnenensvsvsnsavavevevenensrsnsennnenenenevsnsssanenevenen 7 selecting Staple Cell lime cacao lali flag einigen RE 12 Scale Up and Purification seisis e eterin epe an e yiee E a E T E eTa E E E a ERE E Ea EE en In 16 Troubleshooting nassen antiken ASSE ario 18 O NN 18 Appendiks e Ee EEEE EE E EEE EE E AE OEE EA EE EE EEE EEES EE 19 RECIPES E E E nesen 19 Blasticidin Su 8222 en ersehnte 21 Map Of PIB Vo Hisk ainia latin ic 22 Features Of PIB VS His en ee akten 23 Map of pIB V5 His CAT 2 2 at iD Ni 24 OpIE2 Prom otet iea A AA A TADA AS EE 25 OplEd Promotes savne rita dt lia Runen 26 Technical Support vasen traia ls A
35. iposomes causing the transfection efficiency to decrease e Serum free medium see next page e 60mm tissue culture dishes e 1 5 ml sterile microcentrifuge tubes e Rocking platform only NOT orbital e 27 C incubator e Inverted Microscope e Paper towels and air tight bags or containers e 5mM EDTA pH 8 0 Continued on next page Transient Expression in Insect Cells Continued Serum Free Media Several serum free media are available from Invitrogen for use in transfection experiments with pIB V5 His Express Five SFM page vi is recommended for use with High Five cells while Sf 900 II SFM 1X page vi is optimized for use with Sf9 cells and Sf21 cells Other serum free media may be used although you may have to optimize conditions for transfection and selection You will need to adapt the cells to serum free medium before transfection see the Insect Cell Lines manual for a protocol Note You may transfect Sf9 cells in Grace s Medium without supplements or FBS The proteins in the FBS and supplements will interfere with the liposomes causing the transfection efficiency to decrease Preparing Cells For each transfection use log phase cells with greater than 95 viability We recommend that you set up enough plates to perform a time course for expression of your gene of interest Test for expression 2 3 and 4 days post transfection You will need at least one 60 mm plate for each time point 1 For Sf9 cells
36. lect more colonies increase the number of plates or wells not the size To select colonies 1 Examine the closed plate under a microscope and mark the location of each colony on the top of the plate Transfer the markings to the bottom of the plate Be sure to include orientation marks Note Each colony will contain 50 to 200 cells Sf9 cells tend to spread more than High Five cells Move the culture dish to the sterile cabinet and remove the lid Apply a thin layer of sterile silicon grease to the bottom of the cloning cylinder Scienceware Catalog no 378747 00 or Belco Catalog no 2090 00608 using a sterile cotton tipped wooden applicator The layer should be thick enough to retard the flow of liquid from the cylinder without obscuring the opening on the inside Tip Cloning cylinders and silicon grease can be sterilized together by placing a small amount of grease in a glass petri dish and placing the cloning cylinders upright in the grease After autoclaving the grease will have spread out in a thin layer to coat the bottom of the cylinders Aspirate the culture medium and place the cylinder firmly and directly over the marked area Use a microscope if it is available to help you direct placement of the cylinder Use 20 100 pl of medium without blasticidin to slough the cells Try to hold the pipette tip away from the sides of the cloning cylinder to avoid the grease this will take a little practice Remove t
37. locations and partially at six other locations These are marked in the figure below Elimination of the three major 18 bp elements reduces expression to basal levels Theilmann amp Stewart 1992 The function of these elements is not known Primer extension experiments revealed that transcription initiates equally from either the C or the A indicated These two transcriptional start sites are adjacent to a CAGT sequence motif that has been shown to be conserved in a number of early genes Blissard amp Rohrmann 1989 GGATCATGAT GATAAACAAT GTATGGTGCT AATGTTGCTT CAACAACAAT TCTGTTGAAC TGTGTTTTCA TGTTTGCCAA CAAGCACCTT TATACTCGGT GGCCTCCCCA CCACCAACTT TTTTGCACTG CAAAAAAACA CGCTTTTGCA CGCGGGCCCA TACATAGTAC AAACTCTACG TTTCGTAGAC TATTTTACAT AAATAGTCTA CACCGTTGTA TACGCTCCAA ATACACTACC ACACATTGAA CCTTTTTGCA GTGCAAAAAA GTACGTGTCG GCAGTCACGT AGGCCGGCCT 1 I 1 1 TATCGGGTCG CGTCCTGTCA CGTACGAATC ACATTATCGG ACCGGACGAG TGTTGTCTTA HR AACAGGACGC GCCTCCATAT CAGCCGCGCG TTATCTCATG CGCGTGACCG GACACGAGGC 1 I 1 TCGTGACAGG ACGCCAGCTT CCTGTGTTGC TAACCGCAGC CGGACGCAAC TCCTTATCGG PP a TATA Start of Transcription GCCCGTCCCG CTTATCGCGC CTATAAATAC AGCCCGCAAC GATCTGGTAA ACACAGTTGA ACAGCATCTG TTCGAATTTA 25 OpIE1 Promoter Description The OpIE1 promoter has been analyzed by deletion analysis using a CAT reporter in both Lymantria dispar LD652Y and Spodoptera frugiperda Sf9 cells Deletion ana
38. lyacrylamide gels are available from Invitrogen In addition Invitrogen also carries a large selection of molecular weight protein standards and staining kits For more information about the appropriate gels standards and stains to use to visualize your recombinant protein refer to our web site at www invitrogen com or contact Technical Support page 27 Assay for CAT If you use pIB V5 His CAT as a positive control vector you may assay for CAT expression using your method of choice Commercial kits to assay for CAT protein are available There is also a novel rapid radioactive assay Neumann et al 1987 CAT can be detected by Western blot using antibodies against the C terminal fusion tag page viii or an antibody against CAT The CAT V5 His protein fusion migrates around 34 kDa on an SDS PAGE gel 11 Selecting Stable Cell Lines Introduction Nature of Stable Cell Lines Before Starting Effect of Blasticidin on Sensitive and Resistant Cells Suggested Blasticidin Concentrations Blasticidin Selection Guidelines 12 Once you have demonstrated that your protein is expressed in Sf9 or High Five cells you may wish to create stable expression cell lines for long term storage and large scale production of the desired protein Note that stable cell lines are created by multiple copy integration of the vector Amplification as in the case with calcium phosphate transfection and hygromycin resistance
39. lysis revealed that sequence between 186 and 106 is important for maximum transcription in Sf9 cells Theilmann amp Stewart 1991 This region contains a canonical CCAAT site underlined Johnson amp McKnight 1989 and an element R4 that is homologous to the proposed binding site of the Drosophila transcription factor Adf 1 England et al 1990 Three other Adf 1 like elements are found at three other distal locations These elements are referred to as R1 R2 R3 and R4 R3 and R4 are marked in the figure below R1 and R2 are not present in pIB V5 His but do not appear to be important for expression in Sf9 cells The function of these elements has not been determined Primer extension experiments revealed that transcription initiates from the A in the CAGT sequence This CAGT sequence motif has been shown to be conserved in a number of early genes Blissard amp Rohrmann 1989 R3 26 1661 1721 1781 1841 1901 1961 TTGGTCATGC GCGCCCACCG R4 GAAACACGCA CGGCGCGCGC ACGCAGCTTA GCACAAACGC GTCGTTGCAC CTAACCGCAG GCCAATCGGT CGGCCGGCCT CATATCCGCT CACCAGCCGC GTCCTATCGG GCGTGAGGCA ACGTTCATGT CGGGATCTGC l GCGCGGCTTC CGCGCCCATT TTGAATAAAT AAACGATAAC GCCGTTGGTG TATA AA TGTAAAAGGT TACATCATTA TCTTGTTCGC CATCCGGTTG GTATAAATAG Start of transcription m TGGTTTTTGT TTCAGTTGCA AGTTGGCTGC GGCGCGCGCA GCACCTTTGC CGGGCTGCAG CACGTGTTGA CAATTAATCA TCGGCATAGT Technical Support Web Resou
40. more information You will need log phase cells with gt 95 viability to perform a successful transfection Review pages 7 10 to determine how many cells you will need for transfection Cloning into pIB V5 His Introduction General Molecular Biology Techniques Propagation and Maintenance of pIB V5 His Translation Initiation Fusion to the C terminal Peptide Secretion of Recombinant Protein This chapter provides information to help you clone your gene of interest into pIB V5 His A diagram is provided on page 5 to help you ligate your gene of interest in frame with the C terminal peptide sequence e For information on transformation into E coli see page 6 e For information on transfection into Sf9 or High Five cells see pages 7 9 For help with DNA ligations E coli transformations restriction enzyme analysis DNA sequencing and DNA biochemistry refer to Molecular Cloning A Laboratory Manual Sambrook et al 1989 or Current Protocols in Molecular Biology Ausubel et al 1994 20 ug of pIB V5 His vector is supplied in suspension at a concentration of 40 ul of 0 5 ug ul pIB V5 His in 10 mM Tris HCl 1 mM EDTA pH 8 0 If you wish to propagate and maintain the pIB V5 His we recommend using 10 ng of the vector to transform a recA endA E coli strain like TOP10 DH5 or equivalent using your method of choice Select transformants on LB plates containing 50 100 ug ml ampicillin see page 6
41. n addition the C terminal 6xHis tag is the epitope for Anti His C term Antibodies Lindner et al 1997 OpIE2 Reverse priming site Allows sequencing of the insert from the 3 end OpIE2 polyadenylation sequence Efficient transcription termination and polyadenylation of mRNA Theilmann amp Stewart 1992 pUC origin Replication maintenance and high copy number in E coli OpIE1 promoter Provides constitutive expression of the blasticidin resistance gene in lepidopteran insect cells Theilmann amp Stewart 1991 EM7 promoter Allows efficient expression of the blasticidin and ampicillin resistance genes in E coli Blasticidin resistance gene bsd Allows generation of stable insect cell lines Kimura et al 1994 Ampicillin resistance gene bla Selection of transformants in E coli Note The native promoter has been removed Transcription is assumed to start from the EM7 promoter 23 Map of pIB V5 His CAT Description pIB V5 His CAT is a 4257 bp control vector expressing chloramphenicol acetyl transferase CAT The CAT gene was amplified using PCR and TOPO Cloned into pIB V5 His TOPO CAT is expressed as a fusion to the V5 epitope and 6xHis tag The molecular weight of the protein is 34 kDa Map of pIB V5 The figure below summarizes the features of the pIB V5 His CAT vector The His CAT 24 complete nucleotide sequence for pIB V5 His CAT i
42. n intracellularly you may lyse the cells and add the lysate directly to the ProBond column You will need 5 x 10 to 1 x 107 cells for purification of your protein on a 2 ml ProBond column see TM ProBond Purification System manual Seed 2 x 10 cells in two or three 25 cm flasks Grow the cells in selective medium until they reach confluence 4 x 106 cells Wash cells once with PBS Harvest the cells by sloughing Transfer the cells to a sterile centrifuge tube Dy Pl E Ne Centrifuge the cells at 1000 x g for 5 minutes You may lyse the cells immediately or freeze in liquid nitrogen and store at 80 C until needed To scale up insect cell culture refer to the Insect Cell Lines manual 17 Troubleshooting 18 Problem Cause Solution Cells Growing Too Refer to the Insect Cell Lines For troubleshooting guidelines regarding cell Slowly Or not at all manual culture refer to the Insect Cell Lines manual included with the InsectSelect BSD kits Low Transfection Efficiency Impure DNA Transfected cells will appear unhealthy when compared to the negative control DNA only Use clean pure DNA isolated by resin based DNA isolation kits e g S N A P Midiprep Kit Poor Cell Viability Be sure to test cells for viability and make sure you use log phase cells Refer to the Insect Cell Lines manual to troubleshoot cell culture Method of Transfection Optimize transfec
43. ng our customers with high quality goods and services Our goal is to ensure that every customer is 100 satisfied with our products and our service If you should have any questions or concerns about an Invitrogen product or service contact our Technical Support Representatives Invitrogen warrants that all of its products will perform according to specifications stated on the certificate of analysis The company will replace free of charge any product that does not meet those specifications This warranty limits Invitrogen Corporation s liability only to the cost of the product No warranty is granted for products beyond their listed expiration date No warranty is applicable unless all product components are stored in accordance with instructions Invitrogen reserves the right to select the method s used to analyze a product unless Invitrogen agrees to a specified method in writing prior to acceptance of the order Invitrogen makes every effort to ensure the accuracy of its publications but realizes that the occasional typographical or other error is inevitable Therefore Invitrogen makes no warranty of any kind regarding the contents of any publications or documentation If you discover an error in any of our publications please report it to our Technical Support Representatives Invitrogen assumes no responsibility or liability for any special incidental indirect or consequential loss or damage whatsoever The above limited warran
44. on Page 16 this manual Insect Cell Lines manual 9 Purify your recombinant protein by Pages 16 17 this chromatography on metal chelating resin manual e g ProBond Methods Culturing Insect Cells Introduction Culturing Sf9 and High Five Cells Note Sf21 Cells Cells for Transfection Before you start your cloning experiments be sure to have cell cultures of either Sf9 or High Five cells growing and have frozen master stocks available If you purchased one of the InsectSelect BSD System kits you will receive either Sf9 cells or High Five cells along with the Insect Cell Lines manual Use this manual as a guide to initiate cell culture This manual is available for downloading from our web site at www invitrogen com or by contacting Technical Support page 27 To culture Sf9 or High Five cells refer to the Insect Cell Lines manual This manual covers the following topics e Thawing frozen cells e Maintaining and passaging cells e Freezing cells e Using serum free medium e Growing cells in suspension e Scaling up cell culture For the best recovery and viability thaw High Five cells into Express Five Serum Free medium and thaw Sf9 cells into Sf 900 II SFM 1X see page 8 You may also use Sf21 cells as a host for pIB V5 His Sf21 cells are larger and we have found that they may produce more protein than Sf9 cells Refer to the Insect Cell Lines manual for
45. or High Five cells seed 1 x 10 cells in appropriate serum free medium in a 60 mm dish Note You may transfect Sf9 cells in Grace s Medium without supplements or FBS The proteins in the FBS and supplements will interfere with the liposomes causing the transfection efficiency to decrease 2 Rock gently from side to side for 2 3 minutes to evenly distribute the cells Cells should be 50 60 confluent 3 Incubate the cells for at least 15 minutes without rocking to allow the cells to fully attach to the bottom of the dish to form a monolayer of cells 4 Verify that the cells have attached by inspecting them under an inverted microscope Positive and We recommend that you include the following controls Negative Controls pIB V5 His CAT vector as a positive control for transfection and expression e Lipid only as a negative control e DNA only to check for DNA contamination e If you use another lipid besides Cellfectin Reagent review the protocol on Note the next page and consult the manufacturer s instructions to adapt the protocol for your use You may have to empirically determine the optimal conditions for transfection e Do not linearize the plasmid prior to transfection Linearizing the plasmid appears to decrease protein expression Continued on next page Transient Expression in Insect Cells Continued Transfection Plasmid DNA and Cellfectin Reagent are mixed together in the appropriate Proc
46. pIE2 promoter for constitutive expression of the gene of interest Theilmann amp Stewart 1992 e OpIE1 promoter for expression of the blasticidin resistance gene see next bullet Theilmann amp Stewart 1991 e Blasticidin resistance gene for selection of stable cell lines Takeuchi et al 1958 Yamaguchi et al 1965 e EM7 promoter for expression of ampicillin or blasticidin resistance in E coli e Ampicillin resistance gene for selection of transformants in E coli e Optional C terminal peptide containing the V5 epitope and 6xHis tag for detection and purification of your protein of interest For more information and a map of the vector see pages 22 23 The gene of interest is cloned into pIB V5 His and transfected into Sf9 or High Five cells using lipid mediated transfection After transfection cells can be assayed for expression of the gene of interest Once you have confirmed that your gene expresses you can select for a stable polyclonal population or stable clonal cell lines using blasticidin as a selection agent Stable cell lines can be used to express the protein of interest in either adherent culture or suspension culture Baculovirus immediate early promoters utilize the host cell transcription machinery and do not require viral factors for activation Both the OpIE2 and OpIE1 promoters are from the baculovirus Orgyia pseudotsugata multicapsid nuclear polyhedrosis virus Op MNPV The virus natural host is
47. rces Visit the Invitrogen web site at www invitrogen com for e Technical resources including manuals vector maps and sequences application notes MSDSs FAQs formulations citations handbooks etc e Complete technical support contact information e Access to the Invitrogen Online Catalog e Additional product information and special offers Contact Us For more information or technical assistance call write fax or email Additional international offices are listed on our web site www invitrogen com Corporate Headquarters Japanese Headquarters European Headquarters Invitrogen Corporation Invitrogen Japan Invitrogen Ltd 5791 Van Allen Way LOOP X Bldg 6F Inchinnan Business Park Carlsbad CA 92008 USA 3 9 15 Kaigan 3 Fountain Drive Tel 1 760 603 7200 Minato ku Tokyo 108 0022 Paisley PA4 9RF UK Tel Toll Free 1 800 955 6288 Tel 81 3 5730 6509 Tel 44 0 141 814 6100 Fax 1 760 602 6500 Fax 81 3 5730 6519 Tech Fax 44 0 141 814 6117 E mail tech_support invitrogen com E mail jpinfo invitrogen com E mail eurotech invitrogen com MSDS Certificate of Analysis Limited Warranty MSDSs Material Safety Data Sheets are available on our web site at www invitrogen com msds Product qualification is described in the Certificate of Analysis CofA available on our website by product lot number at www invitrogen com cofa Invitrogen is committed to providi
48. ression products or the Expression Kit to facilitate or advance research or development of a Commercial Product and any use other than evaluation of Expression Products or the Expression Kit to facilitate or advance any research or development program the results of which will be applied to the development of Commercial Products Expression Products means products expressed with the Expression Kit or with the use of any vectors or host strains in the Expression Kit Commercial Product means any product intended for commercial use Access to the Expression Kit must be limited solely to those officers employees and students of your entity who need access to perform the aforementioned research or evaluation Each such officer employee and student must be informed of these terms and conditions and agree in writing to be bound by same You may not distribute the Expression Kit or the vectors or host strains contained in it to others You may not transfer modified altered or original material from the Expression Kit to a third party without written notification to and written approval from Invitrogen You may not assign sub license rent lease or otherwise transfer any of the rights or obligations set forth herein except as expressly permitted by Invitrogen and RCT Inquiries for commercial use should be directed to Research Corporation Technologies 101 North Wilmot Road Suite 600 Tucson AZ 85711 3335 Tel 1 520 748 4400 Fax 1 52
49. rotein of interest In addition the Positope Control Protein page vi is available from Invitrogen for use as a positive control for detection of fusion proteins containing a V5 epitope or a 6xHis tag WesternBreeze Chromogenic Kits and WesternBreeze Chemiluminescent Kits are available from Invitrogen to facilitate detection of antibodies by colorimetric or chemiluminescent methods For more information refer to our Web site www invitrogen com or contact Technical Support see page 27 Testing for Use the cells from one 60 mm plate for each expression experiment Expression Before starting prepare Cell Lysis Buffer and SDS PAGE sample buffer Recipes are provided on page 19 for your convenience but other recipes are suitable If you are using pre cast polyacrylamide gels see below refer to the manufacturer s instructions to prepare the appropriate sample buffer 1 Prepare an SDS PAGE gel that will resolve your expected recombinant protein 2 Remove the medium from the cells If your protein is predicted to be secreted be sure to save and assay both the medium and the cell pellet 3 Add 100 ul Cell Lysis Buffer to the plate and slough or scrape the cells into a microcentrifuge tube Vortex the cells to ensure they are completely lysed 4 Centrifuge at maximum speed for 1 2 minutes to pellet nuclei and cell membranes Transfer the supernatant to a new tube Note If you are expressing a membrane protein it may be located in the p
50. s available for downloading from our web site at www invitrogen com or by contacting Technical Support see page 27 gt o Or ODO 555 MON gt sE Acc65 Kpn I Ecl136 II BspH I 1 Features of pIB V5 His CAT 4257 nucleotides OplE2 promoter bases 1 548 OpIE2 Forward priming site bases 511 530 CAT ORF bases 666 1322 V5 epitope bases 1395 1436 6xHis tag bases 1446 1463 OpIE2 Reverse priming site 1473 1498 OpIE2 polyadenylation sequence bases 1481 1610 pUC origin bases 1679 2352 c OpIE1 promoter bases 2401 2692 EM7 promoter bases 2707 2765 Blasticidin resistance gene bsd bases 2784 3183 Ampicillin resistance gene bla bases 3302 4162 OpIE2 Promoter Description 61 121 181 241 301 361 421 481 541 The OpIE2 promoter has been analyzed by deletion analysis using a CAT reporter in both Lymantria dispar LD652Y and Spodoptera frugiperda Sf9 cells Expression in Sf9 cells was much higher than in LD652Y cells Deletion analysis revealed that sequence up to 275 base pairs from the start of transcription is necessary for maximal expression Theilmann amp Stewart 1992 Additional sequence beyond 275 may broaden the host range expression of this plasmid to other insect cell lines Tom Pfeifer personal communication In addition an 18 bp element appears to be required for expression This 18 bp element is repeated almost completely in three different
51. t page Cloning into pIB V5 His Continued MCS of pIB V5 His The TATA box start of transcription and the polyadenylation signal are marked 487 557 611 665 719 787 857 as described in Theilmann and Stewart 1992 Restriction sites are labeled to indicate the actual cleavage site Potential stop codons are shown underlined The multiple cloning site has been confirmed by sequencing and functional testing The complete sequence of pIB V5 His is available for downloading from our web site at www invitrogen com or from Technical Support page 27 For a map and a description of the features of pIB V5 His refer to pages 22 23 Start of transcription gt TATA Box i OpIE2 Forward priming site Fa CTTATCGCGC CTATAAATAC AGCCCGCAAC GATCTGGTAA ACACAGTTGA ACAGCATCTG TTCGAATTTA Sac Hind III Acc65 I Kpn I Ecl136 I BamH I Spe I EcoR I EcoR V AAG CTT GGT ACC GAG CTC GGA TCC ACT AGT CCA GTG TGG TGG AAT TCT GCA GAT Lys Leu Gly Thr Glu Leu Gly Ser Thr Ser Pro Val Trp Trp Asn Ser Ala Asp Not Xho Xba Sac ll I ATC CAG CAC AGT GGC GGC CGC TCG AGT CTA GAG GGC CCG CGG TTC GAA GGT AAG Ile Gln His Ser Gly Gly Arg Ser Ser Leu Glu Gly Pro Arg Phe Glu Gly Lys V5 epitope 6xHis tag 1 CCT ATC CCT_AAC CCT CTC CTC GGT CTC GAT TCT ACG CGT ACC GGT CAT CAT CAC Pro Ile Pro Asn Pro Leu Leu Gly Leu Asp Ser Thr Arg Thr Gly His His His OpIE2 Reverse priming site aes al l CAT CAC CAT TGA GTTTAT C
52. the Douglas fir tussock moth however the promoters allow protein expression in Lymantria dispar LD652Y Spodoptera frugiperda cells Sf9 Hegedus et al 1998 Pfeifer et al 1997 S 21 Invitrogen Trichoplusia ni High Five Invitrogen Drosophila Kc1 52 Hegedus et al 1998 Pfeifer et al 1997 and mosquito cell lines unpublished data The OpIE2 promoter has been shown to be about 5 to 10 fold stronger than the OpIE1 promoter Pfeifer et al 1997 Both promoters have been sequenced and analyzed For more detailed information on the OpIE2 and OpIE1 promoters see page 25 and page 26 respectively The OpIE2 promoter provides relatively high levels of constitutive expression although not all proteins will express as high as might be expected from baculovirus late promoters such as polyhedrin or very late promoters such as p10 Jarvis et al 1996 However some researchers have found that the InsectSelect System expresses some proteins better than baculovirus systems To date reported expression levels range from 1 2 ug ml human IL 6 Invitrogen to 8 10 pg ml human melanotransferrin Hegedus et al 1999 Continued on next page Overview Continued Blasticidin Resistance Experimental Outline Blasticidin S HCl is a nucleoside antibiotic isolated from Streptomyces griseochromo genes which inhibits protein synthesis in both prokaryotic and eukaryotic cells Takeuchi et al 1958 Yamaguchi et al
53. tion Low or No Protein Expression Gene not cloned in frame with the C terminal sequence If it is not in frame with the C terminal peptide sequence expression will not be detected using the antibody to the V5 epitope or the C terminal histidine tag No Kozak sequence for proper initiation of translation Translation will be inefficient and the protein will not be expressed at its optimal level Optimize expression If you ve tried a time course to optimize expression try switching cell lines Proteins may express better in a different cell line Proteins are degraded Include protease inhibitors in the Cell Lysis buffer to prevent degradation of recombinant protein Poor secretion Check the cell pellet as well as the medium when analyzing secreted expression Protein may be trapped in the cell and not secreted To improve secretion try a different cell line e g High Five Recipes LB Luria Bertani Medium and Plates Trypan Blue Exclusion Assay Appendix Composition 1 0 Tryptone 0 5 Yeast Extract 1 0 NaCl pH 7 0 1 For 1 liter dissolve 10 g tryptone 5 g yeast extract and 10 g NaCl in 950 ml deionized water 2 Adjust the pH of the solution to 7 0 with NaOH and bring the volume up to 1 liter 3 Autoclave on liquid cycle for 20 minutes Allow solution to cool to 55 C and add antibiotic if needed 4 Store at room temperature or at 4 C LB ag
54. ty is sole and exclusive No other warranty is made whether expressed or implied including any warranty of merchantability or fitness for a particular purpose 27 Purchaser Notification Limited Use Label License No 68 InsectSelect Technology 28 The InsectSelect System the Expression Kit was developed into an expression system by scientists at the University of British Columbia UBC for high level expression of recombinant proteins Components of the InsectSelect System are covered by one or more U S patents NUMBERS or patent applications and corresponding foreign patents or patent applications owned and or licensed by UBC and others Invitrogen Corporation Invitrogen has an exclusive license to sell the Expression Kit to scientists for academic research or one year commercial evaluation only under the terms described below Use of the Expression Kit for any Commercial Purpose as defined below other than evaluation requires the user to obtain a commercial license as detailed below Before using the Expression Kit please read the terms and conditions set forth below Your use of the Expression Kit shall constitute acknowledgment and acceptance of these terms and conditions If you do not wish to use the Expression Kit pursuant to these terms and conditions please contact Invitrogen s Technical Supports to return the unused and unopened Expression Kit for a full refund Otherwise please complete the

Download Pdf Manuals

Related Search

Related Contents

Mode d`emploi  Lenovo 9156 User's Manual  Blanco Platinum Series Sink 510-887 User's Manual  ZG116 CO2 and Temperature Monitor Operating Instructions  

Copyright © All rights reserved. Failed to retrieve file