YLEX intro - Yeastern Biotech Co., Ltd
Contents
1. EXPRESSION KIT Should any pro npr a fae a Yeastern Biotech Co Lid Copyright 2013 All rights reserved Yeastern Biotech Co Ltd PIT 09 Yoe olg Wasea paniesad s YBU Iy LOZ IUSUAdOD y T D lt xt O N a D Oo O O Table of Contents Individual YLEX Expression Kit license agreement 1 Product Use and Limitation 9 Notice All rights reserved No part of this protocol may be reproduced in any form or by any means or transmitted or translated into a machine language without the permission of Yeastern Biotech Co Ltd e This product is intended to be applied for research purpose only It is not to be used for drug or diagnostic purposes nor is it intended for human and animal use Yeastern products may not be reproduced modified for resale resold or any derivative thereof to the third party INDIVIDUAL YLEX EXPRESSION KIT LICENSE AGREEMENT The YLEX Expression Kit is based on the yeast Yarrowia lipolytica Yarrowia lipolytica was developed into an expression system by scientists at the Institut National de la Recherche Agronomique INRA Paris France for high level expression of recombinant proteins which has been patented Yeastern Biotech has a non exclusive license to sell the YLEX Expression Kit to scientists for research purposes only under the terms described below A Use of YLEX Expression Kit to produce specific protein by commercial corporations requires the us2. 6736 Multiple cloning site Xba 6726 Sfi 6715 Cla 7183 Bcl 6578 XPR2 term XPR2 pre min pLEU2 p 4 dir Uas B f Promoter Ma pYLSCI1 7205 bp Sal 6045 Apa 1527 Bsm 5343 Bgl II 2233 Polylinker at previous Aat II 2378 pBR Pvu ll site Site for genomic intergration Mlu 4612 Hpa 4610 Esp 31 4542 Pst 3055 Ase 3122 The pYLSC1 secretion vector 7205 bp contains the hybrid promoter hp4d and a secretion signal XPR2 pre region The multiple cloning site and the pXPR2 transcription terminator lie immediately downstream of 3 end of XPR2 pre region They are followed by a leucine selection marker gene LEU2 The vector can be linearized by digestion with Notl in the pBR region to create a linear DNA fragment capable of inserting into the Y lipolytica genome at the pBR docking platform of Po1g strain la D lt N O N is D Q O Multiple cloning site in the pYLSC1 vector pYLSC1 contains the following restriction sites for inserting the gene of interest 6651 CACATACAAC CACACACATC CACAATGAAG CTCGCTACCG CCTTTACTAT hp4d XPR2 pre Sfil Hindill 6701 TCTCACGGCC GTTCTGGCCA AGCTTCTAGA GGTACCTCCA TGGCCTGTCC XPR2 pre Xbal Cloning of a heterologous gene into pYLSC1 Digest vector with Sfil and a selected downstream enzyme 3 Purify the digested PCR fragment by using
3. The number of yeast cells in the preparation step is critical for the transformation efficiency e Plate approximately 5x106 cells onto an YPD plate Step 1 in For cells from lawn of colonies e Mix 5x107 cells with YLOS cocktail Step 1 in YLOS One Step Transformation Yeast cell density will be preferably determined by counting using a Mallassez counting chamber according to the specification of the supplier Alternatively measurement of optical density at 600 nm ODeoo in a spectrophotometer can be used OD readings should be between 0 05 and 0 3 to ensure significance However since the relation between cell density and OD is highly variable depending not only on yeast strain and cultivation conditions but also on the sensitivity of the apparatus to light scattering the spectrophotometer should be calibrated by determining independently the cell density in a counting chamber or by performing plating experiments As a rough guide a Po1g Yarrowia strain culture of 107 cells per ml grown in YPD pH 4 broth gives an ODeoo value of approximately 0 3 in a Novaspec Il Visible Spectrophotometer Use appropriate amount 5 100 ng of linearized plasmid DNA Since circular form will not integrate efficiently check that linearization of the plasmid with the chosen enzyme i e Not restriction digestion was effective A range of 5 40 ng of DNA may show the better efficiency for our Po1g Yarrowia strain Carrier DNA should b
4. g L yeast nitrogen base w o amino acids or 1 7 g L yeast nitrogen base w o amino acids and ammonium sulfate 5 g L ammonium sulfate e 15 g L agar Note 1 Fully dried plates always give higher efficiency in YLOS transformation system 2 Suggestion uncover plates in a laminar flow for approximate 1 hour until the surface is dry Prepare the appropriate amount of either YPD agar plates or YPD pH 4 liquid broth e 20 g L glucose e 10 g L yeast extract e 20 g L bacto peptone For plates e Add 15 g L agar For pH 4 broth e Add 50 mM Citrate Buffer pH 4 add from sterile 0 5 M stock following broth autoclaving Copyign 2014 All rights YLOS Cocktail Prepare just prior to transformation For each transformation 1 Add 95 ul of YLOS buffer in a 1 5 ml sterile microcentrifuge tube 2 Add 5 pl of DTT solution stock at 20 C thaw on ice or quick thaw at room tem perature in a water bath 3 Add 2 5 ul of carrier DNA stock at 20 C thaw on ice 4 Add appropriate amount 5 100 ng of linearized plasmid DNA in a maximal volume of 5ul Preperation of Yeast Cells For cells from lawn of colonies 1 Pick up a single colony of Yarrowia and streak or spread completely ona YPD plate Note For a better result resuspend the colony in 0 5 ml of ddH20 then plate approximately 5 10 cells onto an YPD plate Incubate the plate at 28 C for 16 24 hr N 3 Scrape the lawn of cells from agar surface and wash cel
5. institution who need access thereto in order to perform the above described research or evaluation User must inform each of such officer employee and student of the provisions of this Agreement and require them to agree in writing to be bound by the provisions of this Agreement User may not distribute the YLEX KIT to another user even those within user s own institution User may transfer modified altered or original material from the YLEX KIT to a third party following a notification of YEASTERN such that the recipient can be licensed User may not assign sub license rent lease or otherwise transfer this License or any of the rights or obligation hereunder except as expressly permitted This License is effective until terminated User may terminate it at any time by destroying all Yarrowia expression products in his or her control It will also terminate automatically if user fails to comply with the terms and conditions of the Agreement User shall upon termination of the License destroy all YLEX Expression Kits in his or her control and so notify YEASTERN in writing This License Shall be governed in its interpretation and enforcement by the laws of Taiwan Product User Registration Agreement Please complete and return the enclosed Product User Registration Agreement for each YLEX Expression Kit that you purchase This will serve as a record of your purchase and registration and will allow Yeastern Biotech to provide you with tec
6. on agarose gel The size expected for YL 1 or YL 3 transformation with empty vector is 340 bp The size expected for YL 2 or YL 4 amylase encoding transformants is 1 8 kb indicated by the arrow The results show that more than 90 of the transformants contain the heterologous gene COnum SIGht 2014 All rights lt Lane M 1 kb ladder DNA marker Lane 1 YL 1 Po1g pYLEX1 Lane 2 11 YL 2 Po1g pYLEX1 Amyz1 HM gk iJ oak bh if iF sh wt J ts it lt Lane M 1 kb ladder DNA marker Lane 1 YL 3 Po1g pYLSC1 Lane 2 11 YL 4 Po1g pYLSC1 Amy14A Pe oyrign 9014 All rights REFERENCES Articles cited in this manual 1 2 Chen D C Beckerich J M and Gaillardin C 1997 One step transformation of the dimorphic yeast Yarrowia lipolytica Appl Microbiol Biotechnol 48 232 235 Madzak C Treton B and Blanchin Roland S 2000 Strong hybrid promoters and integrative expression secretion vectors for quasi constitutive expression of heterologous proteins in the yeast Yarrowia lipolytica J Mol Microbiol Biotechnol 2 207 216 Madzak C Gaillardin C and Beckerich J M 2004 Heterologous protein expression and secretion in the non conventional yeast Yarrowia lipolytica a review J Biotech 109 63 81 Other important related articles 1 Madzak C Blanchin Roland S Cordero Otero R R and Gaillardin C 1999 Functional analysis of upstream regulating r
7. with the plasmid by using YLOS Transformation Kit Notice L BP pyright 2014 All rights e All rights reserved No part of this protocol may be reproduced in any form or by any means or transmitted or translated into a machine language without the permission of Yeastern Biotech Co Ltd e This product is intended to be applied for research purpose only It is not to be used for drug or diagnostic purposes nor is it intended for human and animal use Yeastern Select transformants by colony formation on solid medium containing no leucine products may not be reproduced modified for resale resold or any derivative thereof to the third party Select several colonies from each sample for small scale experiment V Analyze the protein of interest Pe oyrign 9014 All rights Yarrowia Vectors Two vectors pYLEX1 and pYLSC1 are included in this kit and they can be used for either intracellular expression or secretion of proteins of interest in Y lipolytica Generally speaking if the target protein is cytosolic and non glycosylated the pYLEX1 vector is a better choice If the protein of your interest is normally glycosylated or secreted you may wish to choose the pYLSC1 vector To secrete the gene of interest we recommend that you try both pYLEX1 with native secretion signal if applicable and pYLSC1 containing XPR2 pre region to express and secrete the protein The following sections describe va
8. MY1 YL 2 Po1g pYLSC1 YL 3 Po1g pYLSC1 AMY1A YL 4 AMY1 Mouse salivary a amylase gene AMY14 AMY1 without its native secretion signal The figure below shows that filtered culture medium from batch culture of both amylase encoding transformants YL 2 and 4 could digest starch in solid medium agar and subsequently produce clear zones In contrast medium from the culture of yeast transformed with vector only YL 1 did not exhibit the same result This indicates that cloning and expression of respectively a amylase gene AMY1 into pYLEX1 and a amylase gene without its secretion signal peptide AMY1 A into pYLSC1 have been successful by using the YLEX Expression Kit In both cases active a amylase was efficiently secreted into the culture medium Copyign 2014 All rights Madum YL 1 1x Medium am bidi YL 2 c Oe Medium Madiurm i Loe Medium After yeast transformation plates were incubated at 28 C for 2 days and 10 transformants from each construction YL 2 and YL 4 were analyzed using PCR on yeast colony Transformants were resuspended in the PCR mixture described below 10X PCR buffer 2 5 pl dNTPs 0 5 pl Primer 6560F 0 5 ul Primer 6904R 0 5 pl Taq polymerase 5 U l 0 5 pl gt add water to 25 pl Perform PCR with the following parameters 94 C 94 C 5 min 45 sec 33L 2 min 45 sec 35 cycles 72 C The figure below shows the analysis of 10 ul of PCR product
9. TAAGG ATCCAACTAC 6701 GGAACTTGTG TTGATGTCTT TGCCCCCGGC TCCGATATCA TCTCTGCCTC Acc65 Xcml Kpnl 6751 TTACCAGTCC GACTCTGGTA CTTTGGTCTA CTCCGGTACC TCCATGGCCT Cloning of a heterologous gene into pYLEX1 Digest vector with Pmll and a selected downstream enzyme Kpnl as an example 4 4 Pmill pYLEX1 6670 6790 Digested PCR fragment CAC C GTG CATGG Pmll Kpnl Puni Ligation 5 CAC AATG GGTAC CTCC 5 S GIGITIAC EPO CICATGGAGG 3 Start codon Stop codon Kpnl at downstream end as an example Blunt 5 AATG GGTAC 5 Kpnl 3 TTAC Gene of interest C z Conun SIGht 2014 All rights Brief outlines for cloning a PCR fragment into pYLEX1 1 Prepare a PCR product of the gene of interest The PCR fragment must have a blunt end at its upstream end with AATG sequence and a stop codon followed by a cut site BamHI Xcml or Kpnl at its downstream end 2 Use the selected restriction enzyme BamHI Xcml or Kpnl to digest the PCR fragment 3 downstream end 3 Purify the digested PCR fragment by using a commercially available gel extraction kit 4 Use the same selected enzyme from step 2 and Pmll restriction enzyme to digest the vector pYLEX1 5 DNA ligation Mix the modified PCR fragment and the linear vector DNA with T4 DNA ligase 6 Transformation Add the ligation mixture to competent E coli cells 7 Prepare miniprep DNA from transformants Digest each with an appropriate rest
10. a commercially available gel extraction kit Kpnl as an example 4 DNA ligation Mix the modified PCR fragment and the linear vector DNA with T4 DNA ligase 5 Transformation Add the ligation mixture to competent E coli cells 6 Prepare miniprep DNA from transformants Digest each with an appropriate re corresponding to mature protein striction endonuclease to determine the presence of a cloned insert and vector size starts right after Sfil site Stop codon 7 Digest the cloning plasmid with Notl restriction enzyme for yeast transformation J Alternatively if Notl is present in the gene of interest other choices are possible see Sites for genomic integration in the map of pYLSC1 5 TGGCC GGTAC 5 3 TAAGACCGG Gene of interest C 7 6707 6790 Digested PCR fragment Kpnl at 3 site as an example GGCCGTTC C CCGGC CATGG 1st codon of the gene pYLSC1 The secretion vector pYLSC1 carries a transcriptional fusion of the hybrid promoter hp4d to the XPR2 pre region secretion signal allowing the secretion of the expressed heterologous protein In this vector the end of the XPR2 pre region has been modified Sfil Kpnl while respecting amino acid coding to create a Sfil restriction enzyme site used to a a generate a translational fusion between the XPR2 pre region and the gene The gene of Ligation interest or a PCR fragment must be ligated to Sfil site and reconstitute the end of the pre sequence up
11. al 2000 4 D Expression pYLEX1 noted as pINA1269 in Madzak et al 2000 5 ug lt Secretion pYLSC1 noted as pINA1296 in Madzak et al 2000 5 ug xt O N Primers for DNA sequencing purpose D 6560 F 5 GAT CCG GCA TGC ACT GAT C 3 250 ul gt a 6904R 5 AAC ACC GGT GTT GGA CTC AG 3 250 ul O YLOS Transformation Kit Chen etal 1997 A mixture of cations and 12 ml R T OS Burr polyethylene glycol TO 1 5 ml x 8 A mixture of single strand DNA E E Carrier DNA for enhancing the P Beers 20 0 3 ml transformation efficiency stored at 20 C Add 0 6 ml of dd H20 and A reducing agent for enhancing sterilized with filter DTT powder the transformation efficiency dispense into 50 ul aliquots CEES stored at 20 C Introduction General background of Yarrowia lipolytica Yarrowia lipolytica is a species of non conventional and GRAS generally regarded as safe yeast widely utilized in industrial applications such as organic acid and protein production As unicellular organism it has the advantages of E coliand Saccharomyces cerevisiae in ease of manipulation and growth capacity But it also functions as a higher eukaryotic organization able to perform post translational processing of complex proteins As compared to S cerevisiae Y lipolytica has certain advantages such as a mainly co translational secretion pathway like in mammalian cells higher secretion capacity and product yiel
12. ansformants which are comparable in terms of locus and copy number To achieve secretion of protein from yeast cells the gene of interest is cloned into pYLSC1 downstream from the XPR2 pre region secretion signal from XPR2 gene resulting in expression of a secretion signal fusion protein The XPR2 pre region directs the fusion protein to be efficiently transported through the yeast secretory pathway The secretion signal fusion protein undergoes sequential processing by signal peptidase and protease in the endoplasmic reticulum and Golgi complex respectively resulting in the secretion of the native form of the protein of interest into the culture medium For more information please read the articles cited in this user s manual INRA Institut National de la Recherche Agronomique and INAPG Institut National Agronomique Paris Grignon renamed AgroParisTech since 2007 Ltd Conum jorech CO ela 2014 All rights reserved Yeastern PIO Pe oyrign 9014 All rights Troubleshooting Low efficiency of transformation 1 Test various time lengths from 10 min to 90 min of heat shock at 39 C e Our data indicated that 60 minute heat shock treatment is the optimal condition for Po1g strain and pYLEX1 or pYLSC1 vectors Results may vary depending on the strain used and the efficiency of plasmid integration into the host chromosome depending on the length of sequence homology between the plasmid and the host genome
13. d less hyperglycosylation on products and simplicities in scaling up production These features make Y lipolytica very useful as a protein expression system Furthermore the whole genome of Yarrowia lipolytica has been sequenced please check http cbi labri fr Genolevures elt YALI for details Product Description YLEX Expression Kit based on INRA INAPG licensed patent provides an easy approach for cloning and expressing a gene of interest in the yeast Yarrowia lipolytica Using this kit heterologous protein may be expressed intracellularly or secreted from the cell into medium by selecting respectively the supplied expression vector pYLEX1 or pYLSC1 Using YLEX Expression Kit heterologous protein expression is driven by a strong hybrid promoter hp4d carrying four tandem copies of an upstream activator sequence UAS1B from pXPR2 and a minimal pLEU2 fragment To achieve expression in yeast pYLEX1 containing a cloned gene of interest is linearized by a selected restriction enzyme to produce an expression cassette that can integrate with high efficiency into the Y lipolytica genome by homologous recombination with an integrated pBR platform A leucine gene LEU2 in pYLEX1 provides for selection of yeast containing an integrated expression cassette by allowing their growth on leucine free minimal medium The integrated vector is particularly stable and targeted monocopy integration allows a direct comparison of the properties of the tr
14. e except that the products sold will meet our specifications at the time of delivery Buyer s exclusive remedy and YEASTERN s sole liability hereunder shall be limited to at our option product credits refund of the purchase price of or the replacement of all material s that does not meet our specification By acceptance of the product the Buyer indemnifies and holds YEASTERN harmless against and assumes all liability for the consequence of its use or misuse by the Buyer its employees or others including but not limited to the cost of handling Said refunds or replacement is conditioned on Buyer notifying YEASTERN within thirty 30 days of receipt of product Failure of Buyer to give said notice within thirty 30 days shall constitute a waiver by the Buyer of all claims hereunder with respect to said material s i a D lt t O N C D OQ O U Ver M1125 Yeastern Biotech Co Lid Copyright 2013 All rights reserved Yeastern Biotech Co Ltd p 0D Yyos olg Wa ses pamasa syfu Ily L0Z ybUAdoD EXPRESSION KIT Experimental Process Select a Yarrowia expression aes OR Eien or secretion vector Table of Contents D Y Clone gene of interest into one of supplied plasmids Linearize pYLEX1 or pYLSC1 with the Notl restriction enzyme Experimental Process 2 YLOS One Step Transformation 9 One Step Transformation 9 Transform Y lipolytica strain Po 1 g
15. e thawed on ice avoid thawing it at room temperature The cultivation time of the yeast cells during the preparation step is critical for the transformation efficiency e The figure below shows the transformation efficiencies obtained with yeast cells from lawn of colonies or YPD broth cultivated at 28 C for 16 to 28 hr 40 ng of linearized plasmid DNA were used for transformation The higher transformation efficiency was achieved in both cases with yeast cells cultivated for 20 24 hr best results were obtained respectively after 24 hr for cells from lawn of colonies and 20 hr for cells from YPD broth Transformants Without Gene Expression e Test 6 to 12 transformants for the expression of the heterologous gene e Among the transformants obtained only a maximum of 10 to 20 could possibly fail to express the heterologous gene which could be due to gene conversion double crossing over event leading to the replacement by the selection marker gene of the deleted genomic version or to out of site integration to a locus unfavorable to expression Madzak et al 2004 Cells from lawm of colonies LBH Cells from YPD broth E D lt Ww gt en D o Q 16h 10H LAH rae S Time Examples To test whether recombinant a amylase could be expressed and secreted from yeast by using the YLEX Expression Kit four different Yarrowia transformants were constructed Poig pYLEX1 YL 1 Polg pYLEX1 A
16. egions from the Yarrowia lipolytica XPR2 promoter Microbiology 145 75 87 Nicaud J M Madzak C van den Broek P Gysler C Duboc P Niederberger P and Gaillardin C 2002 Protein expression and secretion in the yeast Yarrowia lipolytica FEMS Yeast Res 2 371 379 Jolivalt C Madzak C Brault A Caminade E Malosse C and Mougin C 2005 Expression of laccase IIIb from the white rot fungus Trametes versicolor in the yeast Yarrowia lipolytica for environmental applications Applied Microbiol Biotechnol 66 4 450 456 Madzak C Otterbein L Chamkha M Moukha S Asther M Gaillardin C and Beckerich J M 2005 Heterologous production of a laccase from the basidiomycete Pycnoporus cinnabarinus in the dimorphic yeast Yarrowia lipolytica FEMS Yeast Res 5 6 7 635 646 Kopecny D Pethe C Sebela M Houba H rin N Madzak C Majira A and Laloue M 2005 High level expression and characterization of Zea mays cytokinin oxidase dehydrogenase in Yarrowia lipolytica Biochimie 87 1011 1022 Product Use Limitation amp Warranty Unless otherwise indicated this product is for research use only Purchase of YEASTERN products does not grant any right to reproduce modify repackage the products or any derivative thereof nor to transfer them to third parties YEASTERN makes no warranty of any kind expressed or implied including merchantability or fitness for any particular purpos
17. er to obtain a commercial license as detailed below hence it is advised that the license agreement be read before any use In any case user does not agree with the license terms he or she should contact Yeastern Biotech within 10 days for an authorization to return the unused YLEX Expression Kit before receiving a full credit User agreeing to the terms of this Agreement should complete and return the Product User Registration Agreement to Yeastern Biotech before using the kit INDIVIDUAL YLEX EXPRESSION KIT LICENSE AGREEMENT Yeastern Biotech YEASTERN grants user a non exclusive license to use the enclosed YLEX Expression Kit YLEX KIT for academic research or for evaluation purposes only The YLEX KIT is being transferred to user in furtherance of and reliance on such license User may not use the YLEX KIT or the materials contained therein for any commercial purpose without a license for such purpose from YEASTERN Commercial purposes include the use of or sale of expressed proteins as a commercial product or their use to facilitate research or development of a commercial product Commercial entities may conduct their evaluation for one year at which time this license automatically terminates Commercial entities will be contacted by YEASTERN during the evaluation period regarding the purchase of a commercial license An access to the YLEX KIT must be limited solely to officers employees or students of the granted or licensed
18. hnical support and manual updates It will also allow Yeastern Biotech to update you on future developments of and improvements to the YLEX Expression Kit The agreement outlined above becomes effective upon our receipt of your User Registration Card or 10 days following the sale of the YLEX Expression Kit to you A use of the kit at any time results in immediate obligation to the terms and conditions stated in this Agreement Technical Services Yeastern Biotech provides Technical Services to all of our registered YLEX Expression Kit users Please contact us if you need assistance with the YLEX Expression Kit Pres Con iotech CO eOYright 2014 Al rights reserved Yeaste ii Kit Components Yeast Strain Po1g The strain Po1g of Yarrowia lipolytica is a derivative of the wild type strain W29 ATCC 20460 by a series of genetic modifications Briefly the original URA3 gene in the W29 strain was disrupted with the SUC2 gene from Saccharomyces cerevisiae followed by the introduction of a deletion in the LEU2 gene Furthermore the deletion of the XPR2 and AXP genes ensures that Po1g is unable to produce any extracellular protease In order to allow easy integration of pBR based expression secretion vectors a pBR322 docking platform was integrated at the URA3 locus Madzak et al 2000 MatA leu2 270 ura3 302 URA3 2 xpr2 332 axp 2 Leu AAEP AAXP Suct pBR platform Polg Vectors Madzak et
19. ls with 1 ml of sterile ddH20 twice resuspend softly centrifuge at 3000 rpm at room temperature for 5 min discard supernatant Note For a better result cells should be collected at 5x10 per tube after the second washing 4 Save the pellets and proceed to transformation For cells from YPD broth 1 Inoculate a single colony of your Yarrowia strain in a 250 ml flask containing 10 ml of YPD pH 4 liquid broth Grow at 28 C until saturated 20 22 hr in a shaking incubator 250 300 rpm 2 Harvest the cells at a cell density of 5x10 ml 3 Centrifuge the cells at 3000 rpm at room temperature for 5 min Discard the supernatant Wash the cell pellet with sterile dd H20 twice to deplete all residues of YPD broth 4 5 Resuspend softly the cells with 1 ml of 0 1 M LiOAc pH 6 0 6 Transfer 0 1 ml of the cells to a new sterile microcentrifuge tube Note This corresponds to 5 10 cells per tube 7 Centrifuge the cells at 3000 rpm at room temperature for 5 min and discard the supernatant 8 Save the pellets and proceed to transformation One Step Transformation For each transformation 1 Resuspend the cells with freshly prepared YLOS cocktail corresponds to 5x107 cells tube 2 Incubate the tubes at 39 C for 60 min 3 Plate the entire transformation cocktail on appropriate dried selection plates YNB Note It is highly suggested to spread the transformation cocktail by using preferably a s
20. riction endonuclease to determine the presence of a cloned insert and vector size 8 Digest the cloning plasmid with Notl restriction enzyme for yeast transformation Alternatively if Notl is present in the gene of interest other choices are possible see Sites for genomic integration in the map of pYLEX1 To construct the vector pYLEX1 the original ATG of the hybrid promoter hp4d in the parent vector was replaced by a Pmll blunt cloning site The Pmll site can be used to obtain a perfect fusion between the hybrid promoter and the heterologous gene 5 ATCCACAATGGAACCC Modified sequence in pYLEX1 5 ATCCA GTGGGAACCC Pmll blunt site Native promoter sequence Pe yiight 2014 Al rights Therefore the end of the promoter the sequence AATG must be reconstituted at the same spot in order to express the heterologous gene properly as in the graph shown below The gene of interest or a PCR fragment with AATG sequence must be inserted into the Pmll blunt site of pYLEX1 using its blunt upstream end The downstream end of the gene can be ligated to BamHI or Kpnl unique sites 6668 In pYLEX1 nF Pmlil ATACAACCACACACATCCAC GTGGGAACCCGAAA no ATG present 6668 In a low construct lh ATACAACCACACACATCCACAATG Gene of Interest Genuine hp4d sequence Selecting a Yarrowia Secretion Vector pYLSC1 The map of pYLSC1 for insertion of the gene HinD Ill 6721 Kpn
21. rious factors that affect how genes should be cloned into pYLEX1 or pYLSC1 to achieve the desired method of expression Selecting a Yarrowia Expression Vector pYLEX1 The map of pYLEX1 Kpn 6790 Multiple cloning site Xcm 6762 for insertion of the gene Bam HI 6990 Pml 6671 Cla 7237 Bcl 6575 XPR2 term min pLEU2 4 dir UAS1B Sal 6042 romoter a LEU2 Apa 1527 pYLEX1 7259 bp Bsm 5340 Polylinker at previous Bgl Il 2233 pBR Pvu Il site Aat II 2378 Site f Not 4618 Sca 2816 ite for genomic Sfi 4617 Pvu 2928 intergration Pst 3055 Spe 4604 Esp 3I 4542 Ase 3122 The pYLEX1 expression vector 7259 bp contains the strong hybrid promoter hp4d carrying four tandem copies of upstream activator sequences UAS1B fragment from pXPR2 and a minimal pLEU2 fragment The multiple cloning site and the XPR2 transcription terminator lie immediately downstream from hp4d promoter They are ollowed by a leucine selection marker gene LEU2 The vector can be linearized by digestion with Notl in the pBR region to create a linear DNA fragment capable of inserting into the Y lipolytica genome at the pBR docking platform of Po1g strain Multiple cloning site in pYLEX1 pYLEX1 vector contains the following restriction sites for inserting the gene of interest Pmll BamHI 6651 ATACAACCAC ACACATCCAC GTGGGAACCC GAAAC
22. terile glass rod or alternatively sterile glass beads 4mm 4 Incubate the plates at 28 C for 2 4 days Lc Harvest Scrape and colonies MIX wash cells gt Plating on dried plate la D lt t O N D Q O 10 60 mins YLOS buffer DTT Carrier DNA Plasmid
23. to the cleavage site The downstream end of the gene of interest can be ligated to one of three available restriction enzyme sites Hindlll Xbal and Kpnl In pYLSC1 Sfil M _Xbal_ Hindlll Kpnl Pe yiight 2014 Al rights In a new construct mature protein 5 ATT CTC ACG GCC GTT CIG GCC 1st codon of the gene of interest 3 5 GGCCGTTC TGGCC EPE E PETERR GGTACICTCC 5 3 CCGGC AAGACCGG C CATGGAGG 3 Vector D Digested PCR Fragment Brief outlines for cloning a PCR fragment into the pYLSC1 vector 1 Prepare a PCR product of the gene of interest The PCR fragment must contain the sequence of the Sfil site from XPR2 pre region at its upstream end and a stop codon followed by a cut site Hindlll Xbal or Kpnl at its downstream end 2 Use Sfil and the selected restriction enzyme Hindlll Xbal or KpnI to digest both the PCR fragment and the vector pYLSC1 YLOS One Step Transformation Introduction YLOS One Step Transformation system provides a simple way to transform Yarrowia cells cultured in either solid agar or liquid broth They were designed for various strains of Yarrowia lipolytica and vectors including Po1g strain and pYLEX1 or pYLSC1 vectors in this kit Transformation efficiency may vary with each strain and vector used Before Beginning Prepare the appropriate selection media and pour the required number of agar plates We suggest the use of YNB medium N5000 e 20 g L glucose e 6 7
Download Pdf Manuals
Related Search