Home

解説書 Vol.2 - アラクサラネットワークス株式会社

image

Contents

1. 00000 uu no debug trace wancontrol WAND OO 200000000000000 clear trace wancontrol WAND OO 2000000000000 test interfaces 0000000 no test interfaces 0000000 000000 show frame relay clear counters 0000000000000 1 free ping frame relay 0000000000000 WAN ISDN show interfaces show isdn pool show peer 00000000 000000 clear counters 0000000000000 close peer 000000 free peer 000000 show trace wanframe D h0 000000000 debug trace wanframe 00000000000 no debug trace wanframe 00000000000 clear trace wanframe 000000000 show trace wanpeer debug trace wanpeer no debug trace wanpeer clear trace wanpeer show trace wancall show isdn history ISDN B UO 0 clear isdn history ISDN 00000 0 show interfaces 000000 show atm clear counters 00000000000 close free ping atm OAM F5 1 00000000 show trace atmvc ATMO LH LH D
2. 00 00000 00 show processes timer 00000000000000000000 ipv4 unicast debug protocols ipv4 unicast lt 0000 no debug protocols 000000000000000000000 ipv4 unicast 0000 debug ip 000000000000000000000 restart ipv4 unicast dump protocols ipv4 unicast 000000000000000000000 0000000000000000 erase protocol dump 000000000000000000000 ipv4 unicast 1111111101 1811 1110100111 1 1 080 show ip mcache 1111111101 1 1 1 1 00000000000 show ip mstatic 0 0000000000000000000 show ip pim show ip mroute 5 0000000000000 show ip igmp show ip dvmrp show ip rpf RPFO OOOO restart ipv4 multicast 000000000000000000000 dump protocols ipv4 multicast IPO OOOQOOOO00000000000000 00000000000000000000000 erase protocol dump 000000000000000000000 ipv4 multicast 1111111110 111 111 111 1 01 6 show ipv6 route 00000000000 00000000000 clear ipv6 route 0000000000000000 show 1 entry
3. 00000000000000000000000000000000000000000000000 145 8 0000 82 IL 0 0000000000000000000000000000000000000000 821 0000000000 0100000 0000000 amp 0000000000000000 00000000200 000000000000000000000000 0000000 0 000000000000000000000000000 0000000 10000000000 00000000 8 0000000 8 0 000000000 200000000000000000 0000000000 Dat 00000 00000000000000000000000000000000 0 0000000000000000000000000000000000000000 0000000000000000000000 000000000000000 0 00000000000000000000 amp 000000000000000000000000 00000000000000000000000000000000000 8 0000000000 000 0000 0 00000000000008 00000000 00000000000000000000 OOO 0 00000000000000000000000 8 00000000000000 00000 020000 0 00000000000000000000000000000000000000000 Dal 00000000 00000000000000000000000000000000000000000000000 00000000000 00000000000000000000000000000000000000000000 0 8 10 00000000000000000000000 822 0000000 8 0 0000000 000000000 2000000000000 00000000000 FAULT 60 000000000008 0000000000000 0 0000000000000000082 00000000000000000 8 0 00000000 146 8 0000 8 3 DILULL IL
4. 14 2 12 3 121 3 122 IPver 00 3 123 06800 00000000000 4 1 2 4 D U 5 125 5 13 6 1000 9 21 000 10 211 0000000000 10 212 10 22 12 221 12 222 14 23 16 2 4 17 241 0000000000000 17 EE 1000 21 31 22 311 000000 22 312 0000000000000000 23 3 2 24 321 0 0888 D 24 00 030 0000000000000 10000 41 41 000000 42 411 000000000 42 4 1 2 MAC LLC LII LH 43 443 0000000 45 414 00000000000000 45 42 1 0 01 00000 46 421 000000000 46 4 2 2 MAC LLC LII LH 46 423 000000000 47 424 00000000000 47 425 00000000000000000000 48 426 000000000 49 43 Tag VLAN D 51 431 0000000 51 4 3 2 D U 21 433 000000000 53 434 i HD B 1 D U 54 4 4 PPP over Ethernet J U LH 56 441 1 U 56 442 000000000 63 44 3 64 45 0000000000000 66 451 000000 66 WAN 67 51 000000000 68 511 00000000000 68 512 0000000000000 4 513 0000000000000 72 5 2 75 524 PPP 75 522 000000000000 76 5 2 3 OO 76 524 000000000000 78 525 00000 79 5 2 6
5. IPv6 OU reve 08 0 00 00 0000000000 2 00000000000000 0000 0000000 000 E3 ran IPv6 OU 0000 100000 1111 1110 1100 6400000000000 1200000000000 0 000000000000000000000000000000000 126000000 oo O 000 Er IPX Internetwo Novell IS IS rk Packet Exchange 640000 0 6400000000000 2 0 000 00 000 000 00 000000000000000000000000000000000000 oo oon Netware 151 5000000000000000000000000000000000000000000000000000 MIB Management Information Base 00000000000000000000000 5 00000000000 246 0000 MLD Multicast Listener Discovery 000 0000000000 126 000000000000000000000 NAT Network Address Translation 000000000000000000000000000000000000000000000000000 NAPT Network Address Port Translation 0000000000000000000000000000000000000000000000000000 0000000000000 NDP Neighbor Discovery Protocol Network Interface board 0000000000000000000000000000000000000000000000 OSPF Open Shortest Path First 4 00000000 OSPFv3
6. 123 000000000 376 1231 0000000000 58 376 1232 00000000000 588 376 124 0000 548 378 125 0000 379 D 381 1 1 1 131 000000000 992 1311 00000000000 382 1312 00000000000000000 383 1313 000000000000000 383 132 0000000000000 389 1321 ad 13 2 2 IGMP 385 13 2 3 Querier 0 0 386 1324 0000000000 1325 1 1 389 13 26 1 1 389 13 27 PIM DM Querier 1 0 389 1328 IGMPOOO 389 133 00000000000 390 134 000000 25 1341 0000000000000000000 391 13 4 2 PIM DM 391 13 4 3 DVMRP 400 13 4 4 PIM SM 408 13 4 5 PIM SSM 414 135 0000000000000 7 1351 0000000000000 ate 136 000000000000 118 1361 000000000 418 13 6 2 0000 0000000000000 419 1363 0000000000 419 50 D ELE EE E IPv6 0 0 0 0 0 425 14 1 IPv6 426 142 0000000 327 xvi 14 2 1 6 427 1422 DD DD DD D 423 1423 00000000000000000 429 1424 0000000000 430 1425 00000000000 433 1426 1 6 a 1427 00000000 1260000000 436 14 28 0000000000000000 457 1429 000000 295 143 439 144 0000 340 1441 000000000000 00000 6 IPv6 440 14 4 2 ICMPv6 442 14 4 3 NDP 443 145 0000 Ms 1451 0000000000000 355 1452 00
7. 00000 000000000000000000000000120000000000000000000 0 0000000000000 0 00000000000000000000000000000000000000000000 31 1 QoSOO00 0 0000000000000000000000000 00000000000000000000000000 00000000000 o o 5 o Oo Oooo Oo ooo O o 5 9 5 5 5 0 0000000000000000000000000000000000000000 Ls 0 0000000000000000000000000000000000000000 B 0 00000000000000 1 00 20000000000000000000 EJ E E 5 9 000 1 100000 an 2 0000000 AA 00000000000000000000000000000000000000 0 00000000000000000000000000000000000000000 00000 0000 20000 0 00000000000000000000000000000000000000000 000000000000000000000000 000 000 000 0 Oooo 0 0 00000000000000000000000000000000000 0 00000000000000000000000000000 0 11 DD 0 00000000000000000000000 020 00000000000 5 6 0 00000 QoS l 0000 95 50000000000000000000000000000 000000000 8 110109 955000000000000000000000000000000000 L3 5 3 L3 ooo L3
8. JT 1430 a 00000000000000000 000000 71430 5 00000000000000 000000 JT 1431 a 000000000000 000000 71431 ISDNOOOOO0 000000 JT G703 a 000 00 00 000000 JTG783 sDHOOOOOOOOOOOOOOOOO 0000 0000 ITU T 6 703 00000000 2W 0000000000000 000000 ITU T 6 703 00000000 0000000000000 000000 ITU T 1 431 Primary rate user network interface Layer 1 specification ITU T G 707 Network node interface for the synchronous digital hierarchy SDH ITU T G 751 Digital multiplex equipments operating at the third order digital multiplex equipments operating at the bit rate of 34 368 kbit s and the fourth order bit rate of third order 139 264 kbit s and using posilive justification ITU T G 957 Optical interfaces for equipments and systems relating to the synchronous digital hierarchy ITU T G 958 Digital line systems based on the synchronous digital hierarchy for use on optical fiber cables Bellcore Synchronous Optical Network SONET Transport Systems Common Generic TR NWT 000253 Criteria ANSI EIA T1 105 Telecommunications Synchronous Optical Network SONET Basic Description Including Multiplex Structures Rates and Formats ANSI EIA T1 403 Network to Customer Installation DSI Metaric Interface ANSI T1 107 Digital Hierarchy Formats Specifications 217
9. 91 1 255 60 0000000 00000 6000 000 LMD D 00000 0000 N392 10 10 3 0000000 00000 3000 93 10100 4 0000000 00000 400 391 50 30 10 0000000 00000 10000 T392 50 800 15 0000000 00000 15000 0000 000000 0000000 000000 00000000 000000 000000 0000000000000 000 0000 00000000000 00000 z CLLM Hl B D 0000 000000 frame relay OOOO 000000 sustain OOOO 000000 00000000000 0000000000000 0000 0000000000 0000000000000 0000000 0000000000000 00000000000 0000000000 FR 0000000 195 10 000000000000000 000 00 0000 0000 00000 00000000000 00000000000 0000000 frame relay 00 cllm sustain noD D D D DLCI I 160 991 160 9910 160 9910000000 0000000000000 D 1 0000 DLCI O0 O000d00 00000000000 DLCI DLCI Okbit s 3Mbit s 00000000000 0000000000000
10. 0000000000 0 000000000000000000000000000000000000000000000 0 000000000000000000000000000000000000000000000 0 000000000000000000000 00000000 0000000000000000000000000000000000000000000000 0 000000000000000000000000000000000000000 0 0000000000000000000 0 0000000000000000000000000000000000000000000000 0 0000000000000000000000000000000000000000000000 0 0000000000000 00000000000000000000000 32 1 1 21 00000000000 5 66511 4 FH 0 00 0000000000000000000 E 0000000 0000000 OOOOO yoo woo FE EX EJ EX pj EJ goo 5 9 OO 5 9 OOO un E EJ L3 L3 OOO J Sag ET ETE oO Oooo oo L3 L3 L3 1 5 oO 000000 42 D D Ooo 0 000000 0000000000000000000 0 0 0 0 0
11. 198 10 00000000000000 00000 100000000000000 1 55 000000000000000000000000000000 10000000000000000 15 0000000 reference length t1 2 00000 100000 00 OOOO 1100 linegroup 090009 1024 00000000 0 0 00000000008 0000000000000000000 58 V 1500000 0000000000000000000000000000000000007 0000000 00000000 0000000000000000 0100000000000 0000 00000000000000000000000000000000 10 7 0000000000 000000 0 0000 00000 0000 000000 ISDN 00000 ISDN D ISDN U 2380 D OO DO00000 24B D 000 000 line 000000000 priisdn briisdn priisdn bri topology pp 000000000 phone number 00000000 000 00000 000 00 interface id 1 0000000 m isdn pool 0 00000 isdn PPP D phone n mberl 000000 000000 000000 8 channel type ho HO DDD 000000 0000 000000 0000000000000000000000000000000000 vei 4000000 0 0000000000000 Voll 11 0000000000 nel isdn pppl isdn pool 00000000000 22 0000 GO 10 8
12. A0 B00 ATMO 0000000000000000000000000000000 00 0 0000000000000000 15Mbivs 0000 15Mbit s 00000 00000000000 10 5 00000000 000000000000000000000000 00000000000 00000000 1017 00000 000000000000 0000000000000 0000000 10 5 00000000 0000000000000000000000000 7 0 5 AMSA YEA 4 EASH 65 FEE I2AHk222A gt XAYINA VP UBR L1 VPOE FRILL bk 1580511 5 7O AANEFRE IND SVCOY ERAFIAY 1017 O0 0 0 0 VETE VEA 00 00000000 32 CBR 00000 00000000000 1 32 00000000 CBR 0000 00000000000 10 000000000000000 10 32 0 0000000000000000000000000000000000 wTDODDOUDUUUO 00000000000 80000000000000000000000000000000 1018 00000000000 000000000 20000000000000000000000000 10 19 000000000000000000000 10 18 0000000000 000000000 000000 000000000 000000 00 20 5 155 52Mbit s 0 5Mbit s ONU I ITU T G 957 10 44Mbit s 1Mbit s 000 25 6Mbit s 0 5Mbit s ONU I OO TTC JT 1432 5 1Mbit s 24Mbit s 1Mbit s J
13. AUBOO 000000000000000000 080000000000000 1111110100 0 U 20Mbit s 20Mbit s 10Mbits 0000000 0000 0 20Mbit 20Mbit s 10Mbit s 300 VPOOOOOOOOOOOOOO 20Mbit s 20Mbit s 0000000000000 0 0 ATM 0000000 0000000000000000000000 108 00000000 lt 00000000000000000 00000000000 000000000 1015 00000 0000000000000000000 0000000 0 0 C 0 0000000000000000000000000000024 0000000000000 0 00000000000000000000000 ooo ep 3 9 9 ES 206 10 00000000000000 10 3 00000000 0000000000000000000 AMEE A ABRI CARH 65 RR VC 20Mbit s VC 20Mbit s VC 10Mbit s VPPAVCZ I 20Mbit s 20Mbit s 10Mbit s gt 2 8849 5 IND SVCOY ERZAFIAY 10 15 0000000000000000000 VCI 00000000 00 32 20Mbit s CBR 000000 10 32 20Mbit s CBR 0000 20 32 10Mbit s CBR 0000 0610000000000000000000000000 OO AU
14. 00000 show ipx servers QO 0000000000000 5 000000000000000000000000000000000000000000 0 0000000000000000000000000000000000000000000000 0 000000000000000000000000000000000000000000000 0 0000000000000000000000000000000000000000000000 0 000000000000000000000000 00000 000000 0 00000000000000000000000 036 00000 000000 70 3 0000000 0000000000000000000000000000 saPHOUDUUUU 0 000000000000000000 0000 1900 5 0000 0000 0000000000000000000000000 gt 000 00 000000000 Ub 00000 00000000 000000000000 0 0000000000000000000000000000000000000000000000 0 00000000000000000000000000000000000000 0 0 0 0 0 0 00000000000000000000000000 3 7 000000000000000000 Ethernet 2 7 7 ELA 0x00000010 23547 A A Ethernet802 3 2 2 7 0 Ethernetll Ethernet8023Q 00000 0000 00 0 00 00 000 0 00 0 0 0000 Ethernet 1 000000 0 0 0 0 Ethernet 00000 O30
15. OOOO Oooo O 00 00000000 00000 00 O0 0000 ng 00 Oooo 000 00000000000 1 0 0000 1MB I 0000 16 0000 00 1 8 00000 200000 10240000 1 0240 0000 1 0240 0000 1 094 00 00 00 XI 11 QoS Qos 0 0 1 1 1 QoS 2 111 2 112 0000000000000 2 1 1 3 90980000000 12 68 0 4 1 3 5 14 00 7 15 OOOO 9 16 10 17 16 1 8 18 181 0000 18 182 000000 19 183 0000000 19 184 00000000 19 185 5500 19 186 0000 00000000 20 187 00000000 2 1 9 QoS 31 191 09580 00000000 31 192 5 35 110 0080 00 0 af 1101 006 000000000000000 37 1102 00000000 38 1103 6068 0000 0000000 00000 0 38 1104 00000 39 1105 000 2000 41 111 005 D 42 1111 8 0 09800000 42 1 11 2 0000000000000000 43 1 113 000000000 43 Diff serv 45 2 1 Diff serv 2
16. sysDescr 0 00000 20000 1 3 6 1 2 1 1 1000000 800000000000000000 6 5 root iso 1 org 3 dod 6 internet 1 mgmt 2 private 4 mib2 1 enterprise 1 alaxala 21839 at 3 4 system 1 interface 2 icmp 5 tcp 6 udp 7 sysDescr 1 sysObjectID 2 transmission 10 snmp 11 ospf 14 15 rmon 16 PPP 23 32 RS232 33 622 000000 Wo0000 000 1 3 6 1 2 1 1 00000000000000000000 0 00000000000000000 0000 00000 00000 00 0 0 0 0 0000 0000000000000 0000000 3000000000000000000000 120 6 5 0000000000000 D 6 2 3 O00000 MB00000000000000 8000000000000000 800000000000000000 138000000000000000 INDEX 00000 0 00000000000000 200000000000000000000000000000 00000 OO MBOOOOOOOOOOOOOOMBOOOOOOO WO 0 0000000000000 0000000000000 80000000 20000000000000000000000 00000000000000000000 MIB ifType 1 3 6 1 2 1 2 2 1 2 0 00000000 0 000000000000000000000000000000000 2000000 0000000000000000000000 1800000000020000 20 MIBH O ifType 2 1 3 6 1 2 1 2 2 1 2 22 000000 00000000 MB80000000000RFC0O00 O
17. 00000 00000 00000000000 1 9 0000000000000000 000000000 50000000000000000000000000000000000000 0000000000000000000000 39 1 0680000 129 000000000000 0000 NIF 00000 00000000 1 2 3 4 5 2 6 7 2 8 2 100BASE TX 1 00 NEB100 4TB NEB100 1TC Line 8 4 _ 10BASE T LI 0 00000000 Line 4 4 0 100BASE TX NEB100 4TB Line 8 4 E 00 Line 64 4 0 NEB100 1TC 5 Line 64 4 _ x 4 0 8 000000 NEBIG 1B Line 4 4 0 0 000000 Line 8 4 O O O Line 64 4 00 0000000 000000000 000000 00000000 0000000000 0000000 000000000000000000 0000 000 1 AX2000R 0000000 00000000 0 2 10 0000000000000 0000000000 000000060 0000000000000000000000000000 U 3 000000000000000000000000000000000000000000 00000 0000 20000000 4 0000000000000000000000000000000000000000000000000 5 00000000000000000000 400000000 20 WAN
18. ArMOOOOOOOOO 5 Loopback 00000 0 0000000000000000000000000000000000000000000000 0 000000000000000000000000 03100000000000 0000000000000000000000000000000 0000000000000 0000000000000000 0 00 1021 00000 0000000000000 0000000 000000 1022 0000000000000000 000000000 000000000000000000 6 820000000000000 0000 0408 0 00 0 00 1 0 0000000 00000000 CLP 1000 AM 0000000 000000000000000000 10 21 00000000 0000000000000 9 25 0 0 U bit s 0000000 000 bits 00000000000000 lt 0000 0 00 per mcr priority4_pcr 95 64k 0 64k 0 64k 0 128k 128k 0 128k D 128k 0 192k 192k 0 192k 0 192k 0 256k 256k 256k 250k 00 384k 384k 384k 2508 00 0 5M 0 5M 0 5M 2508 00 211 10 000000000000000 212 00000000 0000000 OOO bts 0000000000000 gfr2s 0 D bits 1M 1M 00000000000000 8 1M 500k 0 0 2M 2M 2M 500k 0 0 D 1 prQ priority4 000000000000 000000000 D 2 0000 000000000000000 10 22 0 00000000000000000 000000000 00000 OOO bits 000 000 bit s 00000000000000 vcnnng
19. 1 7 0000000000 000 000000 00000 00 00000 00000 Echo Reply ICMP 1 0 00000 ing Echo 8 00000 ing Membership IGMP 2 _ 17 000000000 Query 1 QoS 1 D DU 000000 00000 00 00000 00000 Version1 IGMP 2 x 1g 0 00000 10000000000 Membership Report ftp 6 21 0 telnet 23 time 87 0 www go D 5 bgp 179 XD rlogin 513 0 echo UDP 17 7 0 time 87 0 bootps bootpc 67 68 0 DHCP 123 0 snmp 161 XD sysylog 514 0 520 0 E ospf 89 E 000000 u i 00000000000000000000000000000000 0x2 00000000000000 00000 0 3 U 1 8 000000000 000 0000 00000 0 00 00000 000000 POOD IPOOO 000000000 000 00000 0000 00000 0 000 000 0 000 000 00000 00000 200 300 00000000 Request 00000 0000 1 0000 16 4 ARP Response 4 4 20000 00000 0000 1 0000 16 4 WAN 4 4 00000000 v4oooo 0 000 0000 1 0000 19 4 U RIPO OSPF BGP telnet ftp uu 4 4 snmp igmp pim 00 x 000 000093 0000 16 4 0 4 4 00000000000000000 0000 1
20. 0000000000000 0 0000000000000000000000000000000000000000000000 0000000000000000000000 000000000000000000000 000000000000 Acting Drop 000000000000000000000000000 00000000 MACOOOOO 5 00000000000000000 MACI DD 000000000000000000000 0000000 00000 0310000000000000000 2 0000000000000000 0 0000000000000000000000000000000000000000000000 0000000000000000 0 0000000000000000000000000000000000000000000000 000000000 00000000000000000006 0000000000000000 0 0000000000000000000 OOO 5 0000000000000000000000000000000 200000000000 0000000000006 9000000000000000000 19500 00 00000000100 000000000000 5000 0000000000000 00000 14500 15000000000 00 4 0000 454 00000000 000000000000000000 0 0000000000000000000000000000000000000000000000 00000000 5 000000000000000000000000000000000 OM 00000000000000 0 000000000000000000000000000000000 DA 000 6000 SA 0000 66000 DSAPO 0000 e SSAPOO 000 e CTL 000000000000 9000 e 091000000 8000 e PID 000000 2200
21. LE 0 0 0 0 0 L3 L3 r3 r3 r3 0 0 0 00000 usr home share remote user 5 0000000000000 00000 00 00 0 0 00 0 000 0 0 00 0000 000000000 0 00000000000000000000000000000 0000000 000000000000000 remote 0000000 0 00000000000 0 0000000000000000000000000 amp 2000000000000000000 00000000000 141 8 1 0000000000000000000000000 0000000000000000000000000 0000000000000000000000 8 2 8 3 000 8 4 8 5 rrr 000 8 6 8 7 0000000 8 8 LED 0 FAULT CODE 8 9 8 10 8 11 0000000000000 8 12 000000 143 8 0000 81 0 00000000000000000000000000000000000000000000000 0 000000000000000000000000000000000000000000000 0000000000000 100000000000000000000000000000 8 1 0000 0000 00000000 00000000000000000000 00000000 000000000000000000000000 0000000000 00000000000000000000000000000000 0000000000060 6 PXO 0 0000000000000000000000 0000000 0000
22. E E E E EET EEE EA ERE E EET E EREN EREN L3 L3 C3 L3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 Be See Ed EI RADIUS 189 187 172 D IPX D t 68 0000 250 00000000 250 84 250 90 U 86 Li Ej CY E ERE FG 0 05 L3 L3 L3 EET T EI L3 L3 L3 L3 L3 L3 L3 L3 L3 ma 0 0 0 0 0 0 EED E 5 1 3 77 204 00000 259 00 00000000000 204 00000000000 000000000 209 00000000000 00000000 210 00000000000 ISDN 194 3 163 3 167 8 0 00000000000000000 173 173 79 0000 7 0000 00000000 20 0000000000 250 00000000000000 2 000000000000000000 250 0000000000000 250 0000000 175 00000000200000000000000 181 0000000 LrANDHUUDDDU 176 0
23. ICMP Redirect ICMPv6 Redirect O 000000 00000000 070 00 2000000 RIP l IPUHDDUU 081 00000000000 200000000000000000000000000000000 0 0 0 0 vVRRPOOOOOOOOOO 0 00000000000000000000 00000000000 000000000000000000000000 0 00000000000000000000000000000000 0 0 0 0 0 0 0 0 0 Ooo 4 0 0 0 0 0 0 0 0 Oooo Ooo 5 1 Es Ea EFL E L3 Oooo 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 Ooo E 000 000 000 000 114 5 VRRP 0000000000 0000000000000000000 9000000000000000000000000000000000 00000000000 0000000000000000000000 90000 0000000 0000000000000000000000 0 0000000000000 0000000000000 close nif lt
24. 00000000 5 0000000000 000000000000 80000000000000 0000000 0000000 e 000000000000000000 187 9 0000000 20 800000000000 000000000000000000000 0000000 00000000000000000000000000000000000 0 0000000000000000000 0 0000000000000000000000000000000000000000000000 0000000000000 12 0000000000000000000000000000000 000000 0 000000000000000000000000000000000000000000 20 0000000000000 O30 00000000000000 JPvCm2Q 0000000 0000000000000000 000000 00000 yxyyyyyy UU 00000 OxXXXXXXXXXXXXX SNMP 22 77 7222 1 0 0 0000 000000000000000 OO dPvCm20 000000000 SNMPO MIBD H 0 0000000000000000000000000000000000000000 x 0 E
25. RIP Routing Information Protocol IPv4QO000000000000000000000 RIPng Routing Information Protocol next generation 6 RM Routing Manager 0 0000000000000000000000000000000000000000000000000000 0000000000000 8 0000000 RMON Remote Network Monitoring 00000000000000000 Routing Processor 000000000000000000000000000000 9980000000000000000000 0 0000000000000000000 909 5000000000012 000000000000 SNMP Simple Network Management Protocol Tag VLAN 0 0 00090 UDP User Datagram Protocol 0000000000000000000 000000000000000000000 Virtual Leased Line 00000000000 4 2000800000000000000000000000000000000000 Virtual Router Redundancy Protocol 00000000000000000000000000000000000000000000000000000 00000000000000000000000000000000000000000000000000000 00000000000000000000000000000000000000000000000000000 0000000000000 0000 2000000000000000
26. 000000 88 o000000 o000000 O40 00000000000 00 0000000000000000000 0 0 0000000000000000000000 15 000000000000000000000 1 21 0000000000 4 000000000000000 000000000 Line 0 00000000000 10000 0 16 ong 10 2 20000 00 8 10 2 0000000010000 binef OD 900000000000000000000000 100 160 0000060010000 Lie 9000000000 20000000000000000000 000000000 10 2000000000 30 1 QoSOO00 19 QoSHUUUUUUOH 00000 95 50000000000000000000000000000 191 QoS D BB EE BE 7E DE U 00000000000000000000000000000000000000000000 0 0000 000000000000000000000 9580000000000000000 8 0000000000000 0100000000000000 0000000000000000000000000 9500 000 90800 200000000 00000000 95 5000000000000000000000 00000000 95 00000000000000 0000000000000 95 500000000000000000000000000000 00000 0 0000000000000000000000000000000000000000 000000000 0 0000000000000000000000000000000000000000 0 0000000000000000000000000000000000000000 L3 L3 L3 L3 L3 L3 L3 L3 L3 L3 L3 L3 L3 CJ L3 L3 L3 L3 000 000 0 0000000000000000000000000000000000000000000000 0 0000000000000000000000000000 00000000000000000 0000000000000 1 20 51 C 5 2
27. 000000000 4000000 320kbit s 10Mbit s 320kbit s 100Mbit 320kbit s 590Mbit 0 0 0 5 5 8000000 640kbit s 10Mbit s 640kbit s 100Mbit 640kbit s 590Mbit S S 64000000 5120kbit s 10Mbit 5120kbit s 5120kbit s S 100Mbit s 590Mbit s 00000000 000000000 80kbit s 10Mbit s 80kbit s 100Mbit s 80kbit s 590Mbit s 000000000 0 0 D 0 0000000 0 00000000 000000000 000000000 gop 0 0 0000000 0 E xO 000000000 1 63 1 00000000000000000000 80 0 8 0 0 000 0 2 00000 2000000 3 00000000000000000000000000 0x4 0000000000000000000 lt 00000000 gt 00000 FCS 8 bit 0 0 0 0 byte FCS 8bit O O O O 01 000000000000 000000000000000000000 0000 bits 00000000000 ns 10000000 16000 100000000 1600 1000000000 160 0 5 AX2001R AX2002RQ 2002 0000000000000000 20 00000000 AX2001R AX2002R 0 0 AX2002RX 0 0 00000000 00000000 200 000000000000000 00000000000000000000000000 Tag VLAN 0000000000000000000000 TagVLAND0000000000 22 1 008000 000000000000000000000000000 al 6 0000 1eVLLD 00000 NIFHnDODDUD 1674000000000 0000 Ether NEB100 4TB NEB1G 1B 0000000
28. 00 D 0 000000000000000002000000000000 000000000 000000000000000000000000000000000 000000000000000000000000000000000000000 000000000 VRRP 030 000000 VRRP Virtual Router Redundancy Protocol 000000000000 0 0000000000000000000000000000000 000000000000000000000000000000 VRRP OU 5 1 VRRP 52 5 3 UD 00000 5 4 D 5 5 VRRP 00000000000 56 O00 D 57 000 58 000 00000 59 000 000 5 10 99 5 VRRP 51 VRRP J 000000000000000000000000000000000000000 0 0000000000000000000000000000000000000000000000 0 000000000000000000000000000000000 10 000000000 00000000000000000 U 5 1 00000000 00 00 000000000 000000 VLAN IPv4 IPv6 255 000000000000000000 955 0 000000000 1200000 1 O O 00000 O 000000 Preempt Mode on off 0000 10 2550000000000 00000000 4p O000000000 0000000000 O 1 0000000000 2 000000000000 10 00000 000000000000
29. oo OOOO OOOO 0000 3000000 0000 ae 0000000000000 ardWare 0 0 Soft sr 8 oo 31 0000 0000 RPDUDDUD NIFDUIDDUDDUDD eO OOOO 100000000000 0000000000000 ardWare 0 0 SoftWare 0 0 0 0 0 100000000000 10000000000000 100000000000 10 0000000000000 000000000 00000 7000000 0000 0000000000000 BCU 000000 0000000000000 0000 10000000000000 0000000000000 000000 mn 000000 0000000000000 000000 mmn 000000 0000000000000 0000000000000 0000000000000 8 0000000000000 0000000000000 0000000000000 0000000000000 171 8 0000 8 10 2 0 0000000000000000000000000000000000000000000000 0 000000000000000000000000000000000000000000
30. 0000 0000 RFC2865 2000 60 17 VRRP 28 000 Remote Authentication Dial In User Service RADIUS 00 0000 0000 RFC2338 1998 40 000 Virtual Router Redundancy Protocol draft ietf vrrp ipv6 spec 02 txt 20020 20 226 Virtual Router Redundancy Protocol for IPv6 B Acknowledgments B Acknowledgments GateD Copyright notice C 1995 1996 1997 1998 The Regents of the University of Michigan rights reserved Gate Daemon was originated and developed through release 3 0 by Cornell University and its collaborators GateD Release 9 3 1 Copyright C 2001 by NextHop Technologies Inc and its licensors rights reserved GateD Release 9 3 3 Copyright C 2003 NextHop Technologies Inc rights reserved Copyright C 2001 by NextHop Technologies Inc and its licensors rights reserved Except as stated herein none of the software and accompanying documentation materials provided by NextHop may be copied reproduced distributed republished downloaded displayed posted or transmitted in any form or by any means including but not limited to electronic mechanical photocopying recording or otherwise without the prior written permission of NextHop All copyright and other proprietary notices contained within NextHop materials must be retained unless otherwise
31. 22 22 22 22 0 000000 x 0 188 9 0000000 97 RADIUS H U D 9 7 1 RADIUS I I 0000000000 0 00000000000000000000 RADIUSHHOD DO D 0000000000000000000000000000000000 RADIUSQUO D D DD 0 000000000000000 Lucent Technologies NavisRadius Windows N T Solaris 9 7 2 RADIUS I HU LI 0000 0000000000000000000000 010 00000000000 0000000 000000000000000000000 7200000000000 00000000000000000000000 200000000000000000000 e 000000000 00000000000000000000000000000000 000000 2 0000000000000 e 0000000000000000000000000000000 2200000000000 0 000000000000000000000000 000 0000 0000 00 00000 0000000000 00000000000000000000000000000000000 0 000000000000000000000000000000 20 000000000 000000 Reply MessageQ 000000000000000000000000000 RADIUSO 00000 Reply MessageQ J 000000000000000 RADIUS I D 0 000000000000000000000000000 30 000000000 RADIUSOOOOOOOOOOOOOOO 28659 18120000000000000000000 0000000 00000000 181200000000000000000000 RADIUS 0000 1812000000
32. 00000000000 00000 0 0000000000000000000000000000 73 3 3 10 0000000000000000000 ARE 2 17 RHE EK US H EX 8 0000000000000000000000 2200000000000000000000000000000000000000000000 0 000000000000000000000000000000000000000000 2 gt t1 t2Xn 61 20 00003 7 00000000000000000000000 0 0000000000000000000000000000000000000000000000 22000000000000000000000 14 72000000000000000 353 000000000000000000000 0000 D 0 pcc 0 0 0 0 000000 00000000000 NETBIOS D IPXD D D 00000 00000 0 0 0 0 3 5 4 U etWare 000000000000000 000000 0000000000000000000 0 0000000000000000000000000000000000000000 0 H 2 0 0000000000000 00 20000 000 00 20000000000000000000000 0 00000000000000000000000000000 0 0000000000000000000000000000000 000000000000000 000000000 0000000000000 Forwarding 0 0 Filteri
33. 410 4 9 2 ERE 992 5 801 92 52156 1 14 4129 2 5 4 11 00000002 18 11 1279 1 SRIET RE 129 2 10 le ld le lg Ih li ljO th o 2 6 2 UTE FA 18 BRIER CLL 129 2 la BB 2 Ube F 95 4 0000 U 4 12 0000000000 la 10427 2038 5 I jv 4 BRE gt JLU 02778063 1 0 la lb 772 2 2 462 I ll 0100000 0000 200000000000000000000000 12 00000000000000000 00000000000000000000000000000000000 3500 packet s 1 1 2500 packets 000 950000000 0 0000000000000000000000000000000000000000000000 000000000 O20 00000000000 00000000000 0 0000000000000000000 8 2 590000000000000 Blocking O 00000 000000 Forwarding 0 00000000000000000000000000000
34. snmp rgetarp 00000000000 ipNetToMediaTable IP 000000 show interfaces 000000 clear counters close D UO uu free D UO uu show vlan Tag VLAN 00000 show vlans Tag VLANQ D B D D clear counters clear vlan statistics Tag 00000000000 test interfaces 0000000 no test interfaces 0000000 000000 PPPoE show interfaces 000000 1000000 clear counters free D d uuu show trace pppoe clear trace pppoe 100000000 0000000 show interfaces 0 clear counters 0000000000000 close free 000000 show statistics WAN I OU B 0 70 execute statistics no execute statistics clear statistics show trace wanframe debug trace wanframe no debug trace wanframe clear trace wanframe show trace wancontrol WAND 2000000000000 debug trace wancontrol 200000000000000 155 8 0000
35. 000 IPv4 ICMP O O x 00 7 13 25 98 392 4 1 0680000 000000 IPQ RP IP 1 I 00000 000 00000 0000 000 00000 000 000 4 8 16 32 64 250 1000 0000000000 00 00 2 4 7 13 25 98 392 4 IPv4 D 000 00000 aen 0 000000 000000000 0000 Redirect ARPOOOOOOO DVMRP I UO U 000000000 DVMRPQ OO 00 0 5 100 2 4 15 25 98 392 4 00000 00000 100 2 4 7 18 25 98 392 4 6 00000 OOOO nog 4 8 16 32 64 250 1000 4 6 00000 0000 nnn 2 4 193 25 98 392 4 000000 1 IP flbwQOOO0000000000000000000 2 0000000000000000000000000 0 3 4 0000000000000000000000000 0000 16 0000 0 5 00000000 0000000000 0 1 6 0000 00 RP D 0000000 000 000 AX2000R RP AX2000R RP 0000000000000000000000
36. 1 non Periodic SAP 2 Periodic SAP 3 5 AYRI DA F798 3 1 2 30 850 VT F gt F 4 5 608 3 736 0000 405060000000 B000 10 0 300000000000000000000 20000 000 0 00000000000000 69 3 iIPXH OD D O10 00000 81 000000000000000 Periodic SAP Interval 000000000 0 0000 000000000000 SAPO DO O O Gon Periodic 00000000000000000 000000000 5 000000000000000000000000000000000000000000 00000000 5 00000000000000000 3 5 0000000000 000000000 000000000 00 00 SAP Periodic sap Interval SAPOOOOOO 0000000000000 Periodic SAP og 00000000000 Periodic sap Interval sAP 10 n SAP non periodic sap send off non Periodic SAP non periodic sap send ooo 000000000000 000000000000000 0000000000000 000000 e 00000000000000000000000000000000000000000 0 20
37. 8 16 0000000 251 0 00000000000000 47 62 179 00 110 D 162 00000000000 203 0000000 203 VCO OOOO 251 00000 7000 00000 201 s j L3 L3 L3 L3 L3 EE ras C3 zas L3 L3 L3 C3 C3 C3 C3 C3 4j L2 L3 00 MIB 120 251 Oo 174 92 0000000 251 VRRP 112 LAN H B B BG B C 7 CEU C U C 5 3 2 3 22 25 OOOOOOOOOO0231 MIB 120 0 MIBIJ 00000 251 L3 L3 L3 00000000 251 00000 224 00000 251 UD 82 00000000000 88 L3 L3 L3 L3 L3 L3 L3 E L3 L3 L3 41 RIP 100000000 go L3 L3 L3 L3 L3 L3 1 0 lt Ez ea OO EFE LL EST EST E ECT 21 ETE 00 L1 5
38. amp 1 0000000000000000000000000000000000000 0000000 0000000000000 Network 000000000000000000000000000 Port Network 0 0000000000000000000000000000000000 3 5 6 IPOOOO 1 0 0000 88000000 000 00 0000 0 2 0000000000 0 0000000000000000000000000000000000000000000000 0 000000000000000000000000 OOO IPX Ping IPXQ 9000000000000000000 9000000000 00000000000000 0000000000000 lt 90000000000000 0 0000000000000000000000000000000000000000000000 000 9000000000000000 2000000 200 20 1000000 75 3 0000 00000000 2000000 20 9000000000000000 2000000 200 0000 000 IPX Ping 0 000000000000 0000 1100000 20 000 2000000 20 9000000000000000000000000000000 76 36 111111 1 1 1 3 6 1 0000 0100000 000 Oooo Po ES 1 5 9 o oO 000 000 000 ood See sa Sela eS nooo 0 0 0 0 0 oS 0 00000 O20 00000000000 0000000000 0 0 0 0 0 0 Lr IPX 000 ET ooo
39. show nif 0 0 O show frame relay OOOO 0 000 000000000000000000 8 0000 00000000000000000000000000000 0000000 8 74 0 0000000000000000000000000000000000000000000000 0 0000000000000000000000000000000000000000000000 00000000000000000 0000 000000000000000000000000 00000000000 0 000000000000000000000000000000 200000000000000 0 00000000000000000000000000000000000 0 000000000000000000000000 e 000000000000000000 0000000 e 000000000000000000 0 0000000000000000000000000000000000000000000000 0000000000000 60000000000000000000000000 165 8 0000 8 8 FAULT CODE 0000000000000000 LEDOOO o 700000000000 FAULT LEDQ FAULT 0 0000000000 8 81 LED 000 0 0000000 0 0 000000000 8 7 LEbDODDU LED STATUS Ethernet 000000000000 STATUS RMP RMP Hl H B B 7 UO U POST STATUS CODE RM 000000000
40. 000000 lt 0000000000000 B000 0000 ADVERTISEMNETQ 0000000 0000 0000000000000000000 0000 A000 ADVERTISEMENT 0000000000000000 5 VRRP 58 111 111 01 LLL 5 8 1 O00 OOO 00000000000000000000000000 000000000 0 00000000000000000000000000 100 2550000000000000 100 0 00000000000000000000000000000000000000 12000000 00000 1200000000 9200000000 00000000000 255000000000 0 000000000000000000000000 5 12 0000000000000 8 0 7 IT 255 200 150 0 00000000000000000 000000000000000 000000000000 000000000 00000000000000000 0000 0000000000000 0000 lt 000000000000 982 1 1 LU 000000000000000000000000 0 0000000000000000000000000000000000000000000000 0 0000000000000000000000000000000000000000000 5 12 0 000000000000000000000000000 0000 B00000000 lt 00000000000000000000 8 0000000000 000000000 0 00000000000000 0000000000000000000000000000 L3 000000000000000000000000000000000000000 PREEMPT 0 1 00 0 8 PREEMPTQ 000 0 00000000000000000 0 00000000000000000000000000000000000000000000 0 00000000000000000 1200000000 0000 255000 20000000 000000000 0 0 0 0 0 0 0 0 oO 111 5 VRRP 59 DII ULDUUCULL I 5 9 1 VRRP
41. 010 D RIPOOOO 000 RIP 00000000000 000000000000000000000000000 RIP O O O 0 000000000000000000000 RIPOOO O O Periodic RIP Interval 0 000000000000000000000000 900000000 non Periodc 0 00000000000000000000000 00000000 8 00000000000000000000 033 0000000000 RIP L1 D 000000000 Periodic rip interval RIPOOOOOO 0 0 00000000 Periodic rip Interval n 000 RIP non periodic rip send off 000 RIP B DDD non periodic rip send HOO 0000000000000 0000000000000 000000 e 00000000000000000000000000000000000000000 67 3 0000000000000000000 0 00000000000000000000000000000000000000 0 0 000000000000000000000000000000000000 000000000000000000 0000000000 000000000 0000000000000000 1000000000000000000000000000000000000 0 0000000000000000000 0 0 Oooo 0 0 0 000 0 0 Den 00000 D 54 0000
42. mii L3 000000000000000000000000 000000000000000000 00000000000000000000000000000000000000000000000000000000 00 adOOOOOOOO 0000000 JIS 61000 32000 00000 OO 0000 0 8000 0000 00 OO 0000 0 8000 0000 DD OO 0000 0 80000 0000 000 00000 000 00000 00 00 000 00 111 Copyright 2005 ALAXALA Networks Corporation All rights reserved 0000 Ver 8 4 0000 0000000000 0000000 1 6 00000 19 64 1 000000000000000000000 00000000000 1 7 0000 0000000000 1000 NEB1001TC 0 0 000 1 81 0000 0000000000 1000 NEB1001TC 0 0 000 186 0000 00000000 000000000000000 61 000000000000000 1 104 00000 0000000000 OO 8100 176000000 00000 00000000000000000000000000 LU 1 81111111111 111 1 00000000 20008 00000000000 Ver 400 0000000000000 0 0000000000000000000000000000000000000000000000000 000000000000000000000000000000000000 000000 AxX2000RQ 000000 ROUTE OS8B mul AX2000R 000000000000000000000000000000000000000000 0 000000000000000000000000000 e 0000000000000000000 1000000000000000 00000000000 200080 000000000000000
43. 00000 178 723 178 10000000 185 81 0000000000000 186 811 187 812 000000 188 82 00000000000 191 821 191 822 0000000000000 192 83 0000000000 193 84 0000000000000000 197 O40 IPv4 DD 199 91 200 92 000 201 921 0000000000000 P 201 9 2 2 ICMP 202 9 2 3 204 9 3 OOOO 206 9 3 1 206 932 0000000000000000 206 933 211 934 0000000000000 212 94 000000 216 941 000000000 216 942 0000000000000000 217 Xii 00 218 0000000 95 218 000000000 951 219 952 220 953 222 000000000000000 954 96 223 225 97 225 971 225 972 227 973 228 974 98 0000000000 229 9 81 229 982 0000000000000000 229 9 83 00000000 229 9 84 230 985 00000000000000000 234 9 9 0 0 235 991 235 9 9 2 235 9 93 0000 ttt 237 994
44. 000000 000000 000000000000000000 0000000000000000000000000 1 16 00000000000 00000000 0000 ER VLL E 8 0 80 dac m 81 HABE 3 BARRE 00000000000000000000000000000000000000000000000 Tag VLANQ D D 1600 00000000 16 0 0000000000000 0000000 0 000000000000000000000000000000000 94 0000000000 00000000 2000000000 00000000000 0 000000000000000000000000000000000000000000000 0 00000000000000000000000 0000000000000000000000000000000000000000000 0 00000000000000000000000 0 00000000000000000000000000000000000000000000 0 000000000000000000000000000000000000000000000 0 000000000000000000000000000000000000000000000 0000000000000000000000000000000000000000000 0000000000000 16 1 0000000000000 1eVLL 00000000 Tag VLAN 000000000000000000000000000 00000000 00000000 0000000000000000000 2 6 000000 23 1 0680000 000000000 1 14 D 0000000 16
45. ESQ 00000000000000000000 58 00000000000000 0 0000000000000 00000000000000000000000000 00000000 000 000000000000000000000 000000000 0 0000000000000000000000000000 lt 000000000 000000 228 0000000000000000 8298000000000 0000000 0000000000000000 000000000 00000000000000000000 000 000000000 2 0000000000000 0000000000000002580000000000000000000000000000 0000000000000000 8 0 000000000000 0 0000000000000000000000000000000000000000000000 0 000000000000000000000 OO 00000000000000 5 00000000000000000000000000 9 0000000000000000000000000000000000000 000 ES 0 0000000000000000000000000000000000000000000000 000000000 0000000 00000000000000000000 5580000000 0 0000000000000000000000000000000000000000000000 00000000000 0 00000000000000000000000000000000000000000 WANT 9 0 0000000000000000000000000000000000000000000 ESD 0 0000000000000000000000000000000000000000000000 00000000 8 2 590000000000000000000000000000 83 4 0000 43 1 1 TIE TELE TI IEEE 1 00000 0000 0000 00 0000 00 0 00000 0 00000000000000000000000000000000000000000 0 0 0000000000000000
46. Lr L3 0000000000000000000 3 1 3 2 000000 3 3 0 3 4 000 3 5 3 6 0 0000000000 0 0 0 0 0 000000000 59 3 3 1 iIPXH OD OU D D 1 00000 NetWare 3 1170 3 1230 00 43300 OU U 1 0000000000000 10000000000000000000000000000000 NetWare 0 0000000000000000000000000000000000000 NetWare 0 000000000000000 31 1 0000000 0 000000000000000000 17 000000000 40000000000 40000 0 000000000000000000000000000000000000000000000 0 0000000000000000000 FDDIQ 0000 0000000000000000000 5510000000 NetWare 00000000 000000000000000000000 55100000000000 0 000000000000000000000000000000000 3 1 000000000000000 GQ Ethernet 802 3 802 3RAWE 6 DA SA LEN IPX Z 6 6 2 AAI LEN LEN YRD FONG FR 4 46 0 2 0181500 Ethernet II DA SA 542 IPX 5 6 6 2 84 2 0 8137 44 2 9 66 FOSJINEA6 0X2E 65141500 G Ethernet 802 2 DA SA LEN LLC IPX 2 6 6 2 3 LEN LENE U 46 0 2 181500 LLC 0xe0e003 G Ethernet SNAP DA SA LEN LLC SNAP IPX 6G 6 6 2 3 5 ALP LEN LENE YRD FONG FR 310446 0 2 81181500 LLG SNAP 0x000000
47. 00000000000000000 0 00000000000 811111 0 UBRO 0 00000000000000000000 VCHDDDU 000000000 0000000000000000000000000000000000000 104 0000000000000000000000000 00000000000 0000 10 16 0000000000000000000000000 200 00000 D D D D L3 L3 10 4 00000000 0000000000000000000000000 dco on EARHB 30Nbit s ARE s gt o v M DluTI K T VP VC CBR VC CBR VC UBR VPPAVCZR R32 2 F 30Mbit s 2 O Fa All A TERGE IND 5000 A7 UBR 207 10 000000000000000 208 10 16 vC HH 0000000000000000000000000 VPI VCI 00 00 32 00000000 10Mbit s CBR 000 00 33 00000000 20Mbit CBR 0000 AP 20000 00 34 00000000 30Mbit s UBR 000 0000000000000000000000000 0 000000000000000000 0000000000 n 0000000000000 200 00000 00000000000000000
48. 000000000000000 1200000 2 5 000000000 0 0000000000000000000000000000 1 7 000000000 COM CHES 5882 7 1 DSCPD D D l 0 0000 050000001 40000000000000000000000 1260000 0000000000000000000000000 2 0000000000000 00000000 0 0000000000000000000000000 2 0000000000000 00000000 700000000 Dsepg 6800000000 0 00000000000000000000000000000 0000000000000000000 DSCPO 900000000 0 0 0 0 0 Ooo og Oooo D 06 00 00 oOo OO EU ES 0 0210000000000 00000000 Tag VLAN 000000000000000000000000000000000 000000 0000000000000 3000000000000000000000000 000 0 00000000000000000000000 25 00000000000000000000 8 68000000000000000 700000000 1 8 00000000000 SEAEMAC E EMAC 0 IP gg ID 347 F 4 ES 122 F 1 0680000 16 00000000000000000000000000 14 00000000100 COM CHES 5882 7 0100000000000000 0 0000000000000000000000000000000000000000000000 OO 9555000000000 U 20 00000 2 000000000000000000000000000000 1 DscPq
49. 4 0 000000000000000000000000000 0000 0 0 0 0 0 0 0 010 000 2000000000000000000000000000000000 0000000000000000000000000000000000000000000000000000 0000000000000000000000000000000000 0000 253 UU 00 1000BASE SX 1000BASE LX 1000BASE LH 176 10 100 0 176 ADVERTISEMENT 0 00000 109 alarm 0000 134 8 0 245 ASOO 245 5 ATMO 00000 245 000000 180 204 219 204 B BA Classifier 52 4 00000000000 182 BGP4 0 0 00 0 245 BGP4 0 000000000 245 BGP4 0000000000 223 BGP40 00000 245 221 245 BODD 00000 245 BPDU J 00000 245 C Cisco 00000 180 D DHCP BOOTPH 0000000000000000 245 DHCP BOOTPH 000000000000000 000 220 245 DHCP DHcPOOOOOOOOOOOOO 220 DHCPOOOOOOOOOO 220 Diffserv 00000 245 Diffserv 46 Diffserv 45 Diffserv 47 Diffserv QoS 000 49 Diff servQ OO 46 Diffserv 000000 51 Diffserv 000000000 224 Diffserv 0000 50 Diffserv l 49 Diffserv nuu HD 01 0H 46 DLCIQGOOO000000000 179 0000000000 220 0
50. d D D D diei U 0000000 000 lt 0000000 000000004 00 1 0 congestion management 00000000000 0000000000000 00000 200000 0 0000000 nooo 2000000 0000000 frame relay 0 00000 1600 0 450000 Oo 9010100000 000 max packet size 00000000000 00000000000 0000 000000 u i 00000000000000000000 vali 5 100000000000000000000 0x2 00000000000000000000000000000000000000000000 frame relay 0 O provide_single_pvc_statusQ 0 000000000000000 O 3 992200 30 4000000000000000000000000000000 200000000 000000 10 2 3 ISDN I LH LU U 0000000000 ISON00000 104 0000000000 00000000000000 105 1 5 00000000000000000001 5 00000 00000000000000 106 1 595 00000000000000000000000000 D D 10 4 0000000000 ISDNDD 0000 ISDN D 00 000000000 0 Point Point 000000000 0 Point Multipomt D D D E 1000000000000 mHO nB D 196 0000 ISDN 1000000000000 mHO nBD 100000000000 BD 000000 10 00000000000000 00 OO 2 0000000000000 100000000000 10 5 ISDN 000000000000000 00000 00000
51. 0 0000000000000000000000000000 30000 9000000000000000000000000000000 000000000000000 O40 000000000 100000000000000000000000000000 000000000000000000 U 00000000000 0 00 0000000000000000 71 3 iIPXH OD D 0 3 8 Hi 6 22472 2 1 2 2 7 2 28 1 4 3 SHEETS 2 5 1 420 25 YIH SAREREA hy 7148 Y c 25471 2 1 124 05860 4 OOO 10000000 2000 Nearest 0000000 0000000000000000 0000000000000 20000 1000000000000000000000000000 0 000000000000000000000000000 3 6 000000000000000 00 0000000000 0000 Nearest 00 00000 000 BI DDD Nearest 0000 SAP Reply 000 BOOOO Nearest 000 SAP Reply on 352 0 NetWare 0000000000000000000000000000000000000 0 72 00000 0 0 0 0 Oooo Oooo EEE Oooo 0 0 0 0 0 00000000000000 00000000000000000000000 20000000 0000000000000 00 0000000000000000000 00 0 0000000000000000000000000000000000000000 0000000000000000000000000000000 00 000000 0 0000000000000000000000000000000000000000
52. Ip was a L3 L3 L3 L3 C3 C3 L3 L3 C3 E E EE E L3 L3 r3 179 194 217 WAND ATMO OO IPXOOOOOOO 79 WAND OO ATMOOOOOOOO 96 0000000 192 176 000000 216 000000 248 00 248 00000000 249 176 00000 90 0000000 249 go0000 ES EJ IQ Sm WK ass O sn TK gas SR EI EI OOo O L3 L3 L3 C3 E3 r3 C3 C3 C3 C3 L3 L3 L3 L3 C3 o 249 000 249 47 OO E ER ESI LET eel er eet Ge a ET EZ E ELE OOO L3 L3 L3 C3 C3 C3 L3 L3 L3 L3 C3 C3 aaa a m ooo Sonn a 5 000000000 249 o H E 1 3 ETE AG ET ET L3 L3 L3 L3 L3 L3
53. 0 0 0 00000000000000000000000000000000000000 SNMPOOOOO 0000000000000 127 6 128 e e 000000000000000000000000000 e 000000000 MB0000000 590000000000000000 6 1 000 GetRequest GetNextRequest 1 SetRequest 2 GetResponse GetBulkRequest 0 5 0 00000000000000000000 000000000000000000000 00000000 80000000000000000000000000 GetResponse 0000 0 0000000000000000000000000000000000000000000000 OOOO 30000000000000 180000000 0 00000000000 0 000000000000000000000000 6 2 00000000000 00000000 000 noError 0 tooBig 1 2900000000000 noSuchName 2 300000000000000000000 badValue 3 000000000 readOnly 4 00000000000000000 0 GenError 5 OOO 00 400000000000000 noAccess 6 00000000 MIBOOOO wrongType 800000000000000000000000 wrongLength 8 800000000000000000000000 wrongEcoding 9 wrongValue 10 MIB Hl 1 B BH B U noCreation 11 800000000 inconsi
54. 0 0 0 0 UD 495 15 4 4 RIPng 00 496 1545 496 1546 499 15 5 OSPFv3 901 15 5 1 OSPFv3DD 501 1552 0000000000 802 1553 00000 904 1554 0000000000 508 1555 ASOOOO 509 1556 211 1557 000000000 912 15 5 8 OSPFv390 0000000 512 156 RIPng OSPFv3 513 1561 RIPng OSPFv3 513 1562 000000 0 0 RIPngOSPFv3 513 157 0000 RIPng OSPFv3 517 BGP4 217 16 1 4 00 520 1611 520 16 1 2 BGP4 Q 0000 521 1613 000000000000 221 162 0000 BGP4 522 1621 000000000000 BGP4 522 1622 000000000000 BGP4 522 1623 00000 0000 0000 000 000 00 0 0 00 6 4 0 0000 522 1624 00000000 523 16 3 BGP4 524 16 3 1 BGP4 0000 924 1632 0000000000 1633 000000000000000 529 16 34 00000000000 990 1635 339 1636 0000000000 590 1637 0000000000 851 16 38 BGP4 0000 531 1639 00000000000000 531 16 3 10 MDS 531 16 311 000000000000 952 16 3 12 BGP4 0 0000000 532 164 BGP4 535 1641 0000000000 BGP4 299 1642 00000000000 6 4 936 165 0000 BGP4 539 IPv6 D EL 1 D D 541 171 000000 0 222 1714 1 6 942 17 1 2 600000000000000000 542 17 1 3 2
55. GetResponse a 1 21 8 1 b 2 c 3 PC WS Qi SM BA U ARE 2 2 SNMP Y F 18 GetResponse noSuchName e lL a 1 b 2 3 2 SNMPv2e 0 000000000 1 0 0 0 0 0 00 O GetResponseQ DD 00000 MIB noSuchObject 0 0 0 U 0 SNMPv2 0000 GetRequest 0 0000000000000000 GetRequest b e x sll 6 5 6 7 GetRequest 000000 SNMPv2c AEE SNMPIZ Yz GetRequest b 8 SNMP x lt 57 lt 7 FMIB GetResponse b 2 e noSuch0b ject 81 b 2 c 3 2 PC WS 6 3 2 GetNextRequest U GetNextRequest 0 0 00 0 0 0 00000000000000000 GetRequest J 0 0 0000000000 30000000000000 GetNextRequest 0 O D 00000000 MiBHOD 8000000000000000000000000000000 0 0 000000000 800000000000 GetResponse 0 00000 800000000 0 0 DU U U J GetResponse 0 0 00 0 GetResponse 0000 0000000000 6 8 GetNextRequest O U OEE L 7 NIB0022 EX 2 GetNextRequest a SNMP x 4 57 x FE GetResponse b 2 a 1 b 2 3 OEE ARE 57 GetNextReq
56. OA1 00000000000000000 00 00 00 ISO IEC 8802 3 CSMA CD Access Method and Physical Layer ANSI IEEE Std 802 3 Specifications 00 ISO 8802 2 Logical Link Control LLC ANSI IEEE Std 802 2 Ethernet IEEE 802 3u MAC Parameters Physical Layer Medium Attachment Units and Repeater for 100Mb s Operation Gigabit Ethernet IEEE 802 3z Media Access Control MAC Parameters Physical Layer Repeater and Management Parameters for 1000Mb s Operation 894 Standard for the Transmission of IP Datagrams over Ethernet Networks RFC1042 Standard for the Transmission of IP Datagrams over IEEES802 Networks RFC1398 Definitions of Managed Objects for the Ethernet like Interface Types RFC1757 Remote Network Monitoring Management Information Base Ethernet V 2 0 The Ethernet A Local Area Network Data Link Layer and Physical Layer Specifications RFC2464 Transmission of IPv6 Packets over Ethernet Networks IEEE 802 1Q O IEEE Standards for Local and Metropolitan Networks Virtual Bridged local Area Networks 2 PPP over Ethernet 000000000000 0000 0000 0000 RFC2516 1999 2 A Method for Transmitting PPP Over Ethernet PPPoE RFC1661 1994 70 The Point to Point Protocol PPP RFC1332 1992 50 The PPP Internet Protocol Control Protocol IPCP 1877 1995 120 PPP Internet Protocol Cont
57. 00000000 000000000000000000000000000 0 0000000000000000 D 10 12 00000000000 000000000 0000000 100 0500 000000000 000000 00 0 5Mbit s ONU OO 0 155 52Mbit s ITU T G 957 10 44Mbit s 1Mbit s 0 25 6Mbit s TTC JT 1432 5 0 5Mbit s 1Mbit s 24Mbit s 1Mbit s 200 soo 204 155 52Mbit s ITU T 6 957 0 5Mbit s 250000 10 135Mbit s 1Mbit s 0 10 000000000000000 OM 0 0000 0000000 001 00000000000000000000 ONUD 259000 00000 0000000000000 25Mbi s ATMO 000 8 ONUD 159000000 87 45000 021000000 0000000 00311 00000000000000000000000 10 13 0000000000 00000000 00000 000 line clock external 00 200 3800 2000000000100 000000 don t care frame format sdh_idle 000000 000000 0 0000000000000000000000000000000000000000000000 0000000 000000000000000000000000000 03100000000000 0000000 00 0 000 00 00 0 0 00 0 0 00 0 0 00 00 0000 0 00000000000000000 00000 0000000000000000000 0 0000000000000000000000000000 00000000000000000000000 1 lt 000000000000000 CBR 0000000000 100000000000000000000 0000000000000000000000000000000000000 000 000000000000 UBR 000
58. ls dir cat mkdir mv rm rmdir delete 0 11 1 1 undelete squeeze 0 1111111000 0 1110100000 chmod zmodem 0000000 diff grep egrep fgrep more less vi Sort tail hexdump 0000 show router 000000 clear counters router Ha Co 00000000 clear control counter 0000000 reload show tech support close rp 0 00000000000000 free rp show nif clear counters nif close nif 153 8 0000 00000 00 free nif 00000000 show logging 000000 clear logging 000000 show logging console 00000000000000 set logging console 00000000000000 show warning 000000000 000000 show rm cpu RM CPUD OOOO show rp cpu 0 00000000
59. 0000000000000000000000000 3000000 95100000000 20000 95500000000000 00000000 95 000000000000 D 1 26 eesaug 000000000 000 000000 0000000 Ray RPE X UNIF REKU LAN ATM 2 0098188 RP XUNIF LAN WAN Nab OO L 23 00958188 ERIS 3 LX JL OOS Inbound 3E 000000000000 9550000000000000 AMOOOOOOOOOOOOOOOOO 000000000 20000 9500 90800 C0O00000000000 gt 00000 43 Diff serv Diffserv 08 aosOOOOOOOOOOOOOOO Diffserv i O 0000000000 2 1 Diff serv 2 2 Diff serv 0000000 23 000000000000 45 2 Diff serv 2 1 Diff serv 2 1 1 Diff serv D Diff serv Differentiated Services 98 000000 000000000000000000000000000000000 2 0000 00 0000 000000000000 2 0 00000000000000000000000000000 OO 1 0000 05 0000000000 SCP Differentiated Services Code Point OOO OOOOOO0000000000000000000 0 00000000000000 25 00000
60. 1 L3 EJ CJ 000 y 69 2 2 so C3 C3 L3 L3 L3 L3 e 000000000000000 0000000000000000 000 207 000000000000000 000 208 EJ EJ EX EJ EJ E B zs LESE EST ES om 52 0 00000 252 0 9 000 11 00000 252 00000000000 252 000 252 L3 EJ E asa gt L3 C3 EJ E ES El T EI 3 L3 Fl 0000000000000 2 261 00 000000 147 21 147 00000000 210 11 0 000 17 0 00000000000000 191 0000 99500 55 000000 38 00000000 46 00000000 9 1 1111 000 252 111 10 0000000000000000000000 208 0 0 0 0 0 0 0 0 0 0 0 0 0000000 19 0 000000000000000 38 0 00000000000000000000000 173 0000000000 680 35 0 000000000000000 68 65 0 000000000000012 00
61. L 0 0000000000 check statusintervaD 0 000 0000 0000000000000000 0 00000000000000000000000000000000000000 000000000000000000 0000000000 failure detection interval 0 00 0 000 000000 0000000000 check trialtimes 0 00 000000000000000 000000000000 0000000000 faiuredetectiontime 000000000000 0 0000000000000000000000000000000000000000000000 0000000 58 00000000000 2 MBE 29 2 387 85 4 788 8 ERE ELS poll 18 xr E St T T poll 288 LE RE PELIS CEG lt Hote 021556 gt DSN LORELT 6555 critical priority RXACHGEHOBCTS poll 8 00000000000000000000 0000000000000 0 0000000000000000000000000000000000000000000000 0000000000000000000000000000 0000000000 recovery detectionintervaD 7000 0000 000000000000000000000000 00000000000 0000000000 recoverydetection times 0 0 00000000000 0 0000000000000000000000000000000000000000000000 0 107 5 VRRP 108 59 00000000000 29 2 1 Mit 2 IH 38 eT le poll poll 2 8 EE RE LE SE E n ER EI
62. 179 00000000 218 00000 252 194 0000 Oooo EET E L3 L3 L3 E E sea L3 4 OOO 5 0000000 0 000000000 T k ET 51 ERE EISE E EE ES p Ed 1 ES ES SE EI ADSLOOO 192 00 90500000 5 0 00000000000 206 0000000000000000000 LL orc Oooo J J DJ E El Se Diffserv 51 LLL 00 00000000000 5 Qos J 0 32 00000000000 000000 kbit s O O 00000 0800 34 2 0000 000000 2 E E oO L3 5 000000000000000 181 0 252 0 0 0 00000000000 252 0 0 0 Oo 0000000 252 12 ISDN 196 00000 51 0000 199 00 MIB 121
63. 000000000 ERROR READY 00000000000 POWER 0000000000 PRIMARY 0 MEM CARD 01 B ACCESS 0 PRIMARY 1 MEM CARD 1000000 ACCESS 1 TOR LNK 000000000 STATUS 000000 mpg 8 82 FAULT CODE FAULT CODED 7000 00 00 0000 100 0000 0000 00 0000 0000 00 0000 0000000000000000000000000 8 POST DISP LED0000000000000 RM STATUS LEDOOOOOO 000000000000000000000000000000000000 FAULT CODED ALARM LED ERRORLEDOOOOOOOOOOOOOOOOOOOOOOOOOOOOO 166 8 0000 8 9 1 E 89 1 OOOO 0000000000 U U traceroute traceroute 1pv6 I 11 traceroute 1 0000000000000000000000000000 Livo 1000000 0000 000000000000000000000 1 00000000000000 0 00000000000000000000000000000000000000000000 0 00000000000000000000000000000000000000000000 0 000000000000000000000000 traceroute 0000000000000 u u 0 0 0 0 84 traceroute O O OD O U 37358 EL Zb Id 5650 5 BRC IPT 27356 Ih Ik 55 E SUR 5 20 traceroute ipv6 O traceroute 000000000001 600000000000000000000000000 000 Limit 0 1000000000000 126 000000000000000000000 ICMPv6 000000000000000000000000000000000000000
64. 72 00000 73 000000000 73 73 000 73 78 ss L3 L3 L3 L3 L3 L3 E CEET 3 L3 L3 L3 Oooo A A 143 000 95500000 00000000 L3 L3 C3 OOO 258 249 00000000000000000 249 00000000000 128 0 00000000000000 9 0000000000000 GOBASE T 100BASE TX 1000BASE SX 1000BASE LX 1000BASE LH 176 000000 12000000 249 169 OO 000000000000000 07 OO 000000000000000 0000 208 000000000000000 0000 208 0000 51 000 93 0000000000 93 101 NDPQ 102 0 00 0 00 0 C 0 0 E3 E3 E p D p OD yo 00000000 249 000 MACQOOdd 0000 101 000 2 QoS 35 0000000 18 0000 163 0000000 163 000000000000000 163 3 3 3 5 5 LE EI EJ EI BI L3 L3 L3 L3 EJ E ra TET 31 52 000000000000000000 53 4 00000000000 17 39 00000 95 0000000000000 19 0000000
65. 00000 0800000000 60000 1600000000 0 00000000000000 60000000000 1 4 1 0 000000000 precedence TOS 00000 000000000 0 00 31 1 4 1 32 39 2 1 400 47 2 4 48 55 2 3 560 63 2 2 2 640 71 3 1 720 79 8 4 80 0 87 8 5 88 95 8 2 3 96 103 4 1 104p 111 4 4 112 119 4 3 1200 127 4 2 4 198 135 5 1 1360 3 5 4 precedence ros 144 151 00000 1 QoS 1 DL DU 3 152 159 2 160 191 1 192 223 224 255 03100000000000000 000000000000000000000000000000 95000000000 O40 00000000000000000000 0000000000000000000000000000000000000000000000 0 0000000000000000000000000 0 00000000000000 15 000000000000000 18 000000000 16 141 00000 19 64 4 000000000000000000 000000000 1 5 000000000000 IPQ RP IP L1 00000 000 00000 00 0000 000000000000 000 00000 000 000 16 32 64 250 1000 00000000 00000 16 32 64 250 1000 4 ARP ARP Request ARP Response 0 00000 16 32 64 250 1000 4 0 20000 WAN 00000000 va 00 16 32 64 280 1000 4 0 0000 0 000 RIPO OSPF telnet ftp snmp igmp pim XU xD 00 16 32 64 250 1000 4 0 000 7 13 25 98 392 1
66. 8 2 42 2 2 2 KEE EOD O AWEFLANW PKYIFAK i a e 22375 25 2i FARA AEE JU 73 2 9 NIF i W PT7 TFILEBAT BBA gt 4 4 HE RERE 1 VIY EJL 8 94 0 000000000000000000000000 e 000000000000000000 show traceQ 169 8 00 170 00 e 000000000000000 debug trace 0 e 0000000000000000 ne debug trace 000 e 0000000000000000 U clear debug trace 0 0000000000000000000000000000000000000000000000 0 0000000000000000000000000000000000000000000000 0 0000000000000000000000000000000000000000000000 0 0000000000000000000000000000000000000000000000 0000000000000 8 8 00000000000 du 0000 0000 0000 0000 0000000 O e 0000000 0000000 0000 ATM Inverse ARP x o0000000 00000 8 0000 8 10 11 1 1 1 0 0000000000000000000000000000000000000000000000 0 00000000000000000000000000000000000000000000000 8 10 1 00000000 000000000000000000000000000000000000000000000 89 000000000 0000 00000 0000 0000 000000000 0000000000000 1 1 1 vi 3 00000000 0000 000 Jooo
67. clear ip nat statistics show ip nat log clear ip nat log show ip nat translations clear ip nat translation show ip route 00000000000 000000000 clear ip route 0000000000000000 show ip entry show ip rip clear counters ripipv4 unicast show ip ospf osPFOD000000000 clear ip ospf show ip bgp clear bgp show isis 1580000000000 clear isis 1571500 000000000 debug isis 31 00000000000000000000 000 show ip static static 000 000 clera ip static gatewayclear ip static gateway statici 0000000 show ip vpn VPN II BU B UU U D show ip interface ipv4 unicast 0000000000000000000 show processes memory ipv4 unicast show processes cpu lt ipv4 unicast show processes task ipv4 unicast 8 0000
68. gt 3 9 1 00000 bnegroupQ 0000000000 line 0000000000000 Ene groupOOOOOOOOOOOOOOOOO 1 0 00 000 00 1 100000000000 4 00000000000000 0 O 3849 08000 BO UO O 4kbit s x 6000000600000000 H10 4536kbit s 0 0 0 0 80000 64kbit s x 24000000 2400000000 HO 00000 199 10 000000000000000 200000000060000 20 12000000 1200000000 isdn pool 000000000 5 phone number2 phone number3 000000 6 1 0 20 0000 0000 0000000000000000000000000000000 000000 7 0000000000000000 D 10 8 0000 0000 000 00000 D 180 0 0 0 0 0 2380 D 0 000 200000 2480 D 0000 PRI 23B D 24B D 23B D 100000 ADDI 000000 000000 000 0 0000 oo CRSN 9 D 2 0 0 CRSU 0 2 0000000 woo IFDN 000000000 1 000000000 19000 0000000 IFDU 1 0 1 00000000 SAV On On Off 00 000000 1 00 480000000 109 000000000000000000000000 2 0000 200000 300000 00 0 000000000000000000 1000 200
69. 0000 000000080 8 000800500000000 00000000 00000000 O10 1011110011 00000000 0000 00000000 00000000000 20 1 008000 D 1 15 0000 00000000 0000 gt 3 RF BERE 5 gt 0 000000000000000000000000000 0 000000000000000000000000000 0 000000000000000000000000000 00000000 0000 000000000000000 L3 Oooo El GE Oooo Oooo Oooo Oooo El EI 000000 000000 000000 000000 000000000 0000000000000000000000000 AX2001R AX2002R AX2002RX 5 9 E E AX2001RQ AX2002R 0 0 AX2002RX 000000000000 o L3 L3 L3 L3 L3 L3 L3 L3 L3 ran oo L3 L3 L3 OO L3 L3 L3 L3 L3 L3 L3 C3 L3 ODO L3 L3 C3 L3 C3 L3 L3 C3
70. 0000000000000000000000000000000 0000000000000000000000000000000000000000000000000000 235000000 DSCP J 00 0000000 0000000000000 0000000000000000000000000000000000000000000000000000 0000000000000000000000000000000000000000 0000000 00000000 900000 0 0 0 0 0 0 0 0 0 00 000 0000000000000000000000000 000000000000000000000 0000 6 00000000000000000000000000000 0000 00000000 500000000000000000 0000000000000000000000000 00000000000000000000000000000000000000000000000000 000000000000000000000000000000000000000000000 0 Co r3 r3 O r3 00000000000000000000000000000000000000000000 252 0000 0000004 000000000000000
71. show interfaces show frame relay 0 O show isdn pool 0 0 show peer 1 O UU U show nif 00000000000 86 00000000000 0000 0000000 active 000 fault 00 disconnect 000 163 8 0000 00 0000 0000000 active 00 standby fault close disconnect configuration discord 00000000000000 software version discord 00000 active fault unused 000000000 test 000 active initialize fault close unused 000000000 active initialize fault closed unused 1 000000000 mismatch locked Line 8 7 3 OOOO active up 00000 active down 00000000000 initialize test looped by remote fault closed unused 00000000 Lir mismatch 00000000000000000000000000000000 show rm cpu O show rp U show rp buffer 000000000000000000000 show router O show interfaces 0 0 show isdn pool show peer U 00 164
72. 0000000 O 0000000000 pscPOOOOOO E pDscPOOO o000000 0000000 0000 00000000 000000000000000000 000 1 15 0000000000000000 Tag VLANQ D Tag VLAN D D 16VLLO 000 0000000 0000 102 108 0 30 16 30 16 1700 1700 0000 00 00000000000 1 15 0000000000000000 Tag VLAN 000000000000000 00 00000 800 000000 0 D x 4000 0000000000000000000000000 0000000000000 30 1600 0000000000000 LinegO 0000 0000000000000000000 Tag VLANQG 000000 16VLL 0 0000000000 00000 0000000 Line O D 000000000000000000000000 0000 00000 0 08 04 0 00 00 170000 0000000000000 0 00000000000000000000000 170000 00000000 11 0 0000000000000 16 0 000000000 0000000 0000000 0000000 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 D 1 16 NFOOOOOOOOOOO D 00 10BASE T 100BASE TX 1000BASE X 00000000 0 NEB1G 1B NEB100 4TB NIFO OOO VLLOOOOOOO0 24 1 008000 NIF 1 D 00 10BASE T 100BASE T
73. 63 000000 TEE E 1Y h C Xy 67 2 gt MPT 488 5 055645 0000 SNMPOOOOOO 126 00000000000000000000 IP 118 126 0 00000000000 0000000 MIBQOOO 0000000 0 000000000000000 64 IPv4 IPv6 D D D L LICE ZMI BEX IPv4DSNMP 7 U LIC k SMI BIE ARE IPv4 SNMP 2 22 27 SNMP 75 525 L 215 k ZMI BEX e IPV6MSNWPIL AILE gt PC WS 119 6 6 2 0000000 00000000 MB I 00000000000000000000 0000000000 200000000 RFCOOOOOO MBOOOOOOOO 300000000000000000000 0 00000000000000000000000000 380000000 0 000000000000000 1800000000 0000000000 0000 MBOOO OOOO 8000000000000000000000 8000000000000000 IP 000000 8000000000 20000000 6 2 1 00000000000000000 18000 000000000000000000000 0 000000000000000 0000000000000000000000000000 12000000000000 100 root 0
74. C3 C3 C3 C3 oo pr D n C3 C3 C3 GG Ez ESTE ES Sa a E C3 EJ E EX DC 3 roe ETE Sas ELI Ooo 0 0 0 EJ E E E 210 10 00000000000000 0 000000000000000000000000000000000000000000000 00000000 OOO 4 per 0000000000000000 Cell Loss Priority 0 0000 0 0 2000 00000000 100000 0800000 00000000000000000000000000 10000000000 3200000 MTUQO 152000000000000000000000 00000 0000000000000 250kbitsQ 000000 0000000000 10 10 0000000000000000 1021 000000000000000000 00000 000000 1022 000000000000000000 000000000 000000 00000 0000 00000000000000000000 20 5 Loopback 000 0000000000000000 F5 OAM Loopback 00 0000000000000000000000000000000 000000000000000000000000000 5 09 000000000000000 0000000000000 0000000 640 00 000000000000000 Vol 1 6 3 3 8 Loopback 0000 0000000000000000
75. Requirements for IP Version 4 Routers Transition Mechanisms for IPv6 Hosts and Routers 9 DHCP BOOTP 10 0000 0000 000 1542 1993 100 Clarifications and Extensions for the Bootstrap Protocol RFC1812 1995 60 Requirements for IP Version 4 Routers 2131 1997 0 80 Dynamic Host Configuration Protocol U 10 0000 0000 000 2131 1997 0 80 Dynamic Host Configuration Protocol RFC2132 1997 80 DHCP Options and BOOTP Vendor Extensions A 11 DHCP 10 0000 0000 000 2131 1997 0 80 Dynamic Host Configuration Protocol RFC2132 1997 80 DHCP Options and BOOTP Vendor Extensions A 12 DNS 10 0000 0000 000 RFC1034 1987 80 Domain names concepts and facilities 1035 1987 0 80 Domain names implementation and specification A 13 NAT NAPT 0000 0000 000 RFC3022 2001 0 10 Traditional IP Network Address Translator Traditional NAT RFC2663 1999 80 IP Network Address Translator NAT Terminology and Considerations 14 RIP OSPF 0000000 0000 000 1058 1988 0 60 0
76. e 0 000000000000000000000 000 000 L3 L3 L3 L3 L3 E 0 0 0 0 0 0 0 0 L3 L3 L3 L3 C3 L3 L3 L3 L3 L3 L3 L3 L3 L3 L3 C3 L3 L3 Oooo Oooo ooo Oooo Li 4 L3 Oooo Oooo Oooo Oooo Oooo L3 Oooo Oooo Oooo 00000000 000000000 00000000 00000000000000000000000000000000 00000000 00000000 00000000 2 0 00000000000 25 0000000000000000000000000 00000000 00000 00000 00000000 2000000000000000000000 5 0 0 0 0 0 0 EPI BO OO OF OO OOOO oo 1 12 0000 00000000 00000000000 HOU 00000000 00000 0000000 O x 000000 DSCPUJD D O 21 1 0680000 0000000000 00000000000000000000000000 1 13 NIF O 10BASE T 100BASE TX 1000BASE X 00000000 NEB Io 8 NEB100 TB 0000000000 40 80 640 00
77. 0000000000000 52320 00 1 0 0 0 1021000 telnet O O O 8 3 1 11 000000000000000000000000000000000 1 000000000000000000000 2 000000000000000000000000000000000000000000000 0000000000000 3 00000 6000000000000000000000 4 killuserQ 00000000000000000000000 0 0 0000000000000000000000000000000 2000000000 0 00000000000 0 0 000000000000000000000000000000000000000000 show logging 00000000000 0 0 00000 5000000 0 0 0 000000000000000 0 0 000000000 telnetQ rloging http ftp 0 0000000000000 DD DD DD 8 3 2 010000 200 000 IDD 0000000000000 rmuserg 00000000000 00000000000000000000000 00000000000000 0210000000 0 0000000000000000000000000000000000000000000000 0 0000000000000000000000000000000000000000000000 0000000000 password QO 000000000000000000000000000000 0 0000000000000 0000000000000000000000000 60000000000000000000 000000000000000 60000000000000000000000000000 O30 000000000000 00000000000000000000000000000000000000000000 0 00000000000000000 1226 00000000000000000000000000 0 0000000000000000000000000000000000000000000000 0000000000000 12600
78. 00000000000000 0 000000000000000 0000 0 8 1483 00000000 411 00000000000 0 000000000000000000000000000000 041 000000000000000000000 Q4 y h t AY KBKUFHAEY b 4 k DA SA TYPE FCS 6 6 2 4 IEEE802 1 F F DA SA jLENGTH LLC SNAP 5 FCS 6 6 4 SNAPI OUI 3 EPID 2 eFDDIZ FC DA SA LLC SNAP 5 FCS 6 6 2 4 SNAPI amp OUI 3 EPID 2 3341 o 00000000000000000000000000000000000 000000000 2510 0000000000000 00 0 0 000000 000000 5510000000000000000 412 1000000 82 0 0000000000000000000000000000 120000000 GmEthernet AUX 000 000 20000000000 120000000000000000000000000 0000000000000000000000000000000000000000000000 0 0000000000000000000000000000000000000 4 0000 4 2 000000000000000 ATMO 0 5 000000000 000000000000000000000000000000 00000000000 5510000000000000000000000000000000 0 00000000 000000 00000 000000000000000000000000 0000000 500000000 Esp 0000000000000000000000000 00000000000 0 00000000000000000000000000000000000
79. 0000000000000000000000000000000000000000000 DNS J OO DNS Domain System 000 0000000000000000000000000000000000600 000000000000000000000000000000000 245 0000 DSCP Differentiated Services Code IPOOOO IPOOOO DS Field OO 6000000 0000 Diff serv 0 000000000000000 DVMRP Distance Vector Multicast Routing Protocol IPv4 0 FDB Filteri 0000 0000 ICMPT Internet IPv4 ICMPv6 Internet IPv6 D IGMP Internet Group Management Protocol IPv4 0 IPvA Internet 890000 IPv6 Internet 128 0 D IPv6 ng Data Base 0 00 0 000000000000000000 Co 0 Control Message Protocol version 6 Protocol version 6 00000 Protocol version 41 0000000000000000000000 00000000000000000000 00000000000000000000 000 DHCP 0000 0 0000000 00000 0 00000 0000 000 000 00 000 000 0 00 0 00 0 00 000 0000 0 80000
80. 20 0000000000000000000000000000000000000000000 00000000000000000000000 0 000000000000000000000000000000000 O40 00000000 5 0000000000000000000000000000000000000000 0 0000000000000000000000 0 000000000000000000000000000000000 181 9 0000000 050 0000 00000000 10000000000 amp 000000000000000000000000000 RIP 00000000000000 000000000 0000000000000000 000 000000000000000 0000000000000000000000000000000 0000000000000 100000 000 00000000000000000000 Cisco O U ip broadeastaddress 0000008 0000000000000000 0000000 Ciseot QD D D 8 8 D D D 00 0 ip broadcast address 00000000000 0610000 00000000 000000000 00000000 0000000 10 0 1 0 00 00000 40000000000 00000 HelloInterval 0 O O Routerdeadinterval 1 UU UU U U U O70 1D BH U B D D U U UI D e HelloInterval 00000 0000 Hellemtevatt tjp aaudu 190000000000000000000000 HelloInterval DO 0 0 HelloInterval 0000 00 0000 e priority 000000 0000 1 00100000 10000000 NBMA ospf interface 000 nonbroadcast 00000000000000000 00 900000000000000000000000000 000 priority 0 000
81. 22 IPOOOOOOO 181 15 150 000 246 198 89 0 00000 196 0000 0000000000 202 197 81 0 0 1 80 L LED 166 LEDQ FAULT CODE J 166 166 M Marker 52 MC 162 162 MF Classifier 52 MIB 00000 246 1 1010100000 120 120 120 118 MIBOOOOOOOOOOOOO 187 MIBOOOOOOOOOOOO 125 MLDI 247 206 N NAPTII B 247 NAT 220 223 00000 247 NDPOU 1 1 247 79 1 3105 NetWare4 1J 0000 78 Next Hop 182 nexthopself OO 00000 BGP4 186 247 29 noinstall 00000000000 4 OSPF 0 1 UU 1 247 OSPFv39 00000 247 osPFOOOOOOOOOO 247 osPFOOOOOOOOOOOOOOO 247 osPFOOOOOOOOOOOO 182 128 81 1 B utut 247 PIM DMI 00000 247 PIM SMII 00000 247 PIM SSMI 0 0 0 0 247 ping atm 168 ping frame relay 168 pingipv6 168 pingipx 168 Ping 75 ping JU 167 247 PPPO over Ethernet 00 000000000000 217 over Ethernet 000000000000 216 PPP over Ethernet 00000
82. 9 2 D LU L 9 2 1 0000000 0 10 0000000000000 00000000000000 dlcigroup 0 0000000000000000000000000000000000000000000 DLCT 0000000000000000000000000000 0 000000000000000000000000000000000000000000 CiscoQ D D D frame relay priority dlci group I 000000000000000 021000000000000000000000 0000000000000 RFC1490 RFC2427 00000000000000000000000 0000000 amp 00000000000000000000000000000000000000 000 Ciseo OU U U U U U encapsulation frame relayQ 0 0 00 00000000000 D 30 frping O frping 1 0 0 O 1293 23900 O O 00000000000000000 Inverse ARPOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO 00000 Inverse 0000000000000000000000000000000000 0000000000000 040 00000 000000000000000000 09 000000000000000000000 0 00000000000000000000000 0 00000000000000000000000000000000000000000 0 000000000000000000000 isco 0000000000000 dle 00000 max packet size 0000 15020 0 MTUQG dial max packet size 2 0 000 0 000000000000000 Vol 1 9 3 3 9000000000000000000 179 9 0000000 9 3 ATMDTID T U D 0 0000000000000000000000000000000000000000 9 3 4 Cisco 1 EH EH UL D 0000 000000000000000000000000 Cisco 0 O 0 0000000000000000000000 D
83. SetRequest 0 0 0 0000 8 000000 0 0 00000000 20000000000 00 GetRequest GetNextRequest GetBulkRequest LH HH B 111 110101 D SetRequest 8000000000000000 GetResponse 000000 8 0000000000 0 0 0 0 0000000000000 MIB system 0 O MIBO RMON I D D SetRequest 0 000000 124 6 5 6 11 SetRequest 000000 FEE SNMPIZ Yzy SetRequest b 4 SNMP A Ux CD MIB a 1 b 2 3 GetResponse b 4 1 b 4 PC WS O10 MIBQOOOOO0UU0U00000 300000 e 0000000000 000000000000000000000000000 00000000000 00000000000000000 GetResponse 00 00 00 1 00 00 noSuchName 00 GetResponse 0 0 0 0 0 0 SNMPv2c0 000 0800000 00 D D D notWritable GetResponse 0 0 SetRequest 0 00 0000000000 SetRequest 000000 6 12 SNMP ARE 8 52 SNMP x 6 22 GetResponse noSuchName SetRequest 4 x 8 1 b 2 3 SNMPv2c ARG 2 2
84. show ipv6 rip 8 0000000000 clear counters rip ipv6 unicast RIPng 0000000000 show ipv6 ospf OSPFv80 000000000 clear ipv6 ospf OSPFv80 0000000000 show ipv6 bgp BGP4 Q 000000000 clear ipv6 bgp BGP4 0 0000000000 BGP4 QO 000000000 show isis 15 158000000000 0 clear isis 15 800000000000 show ipv6 static static 00000 clear ipv6 static gateway statici 0000000 159 8 0000 00 00000 00 show ipv6 routers RA EH D U U show ipv6 interface ipv6 unicast 000000000 show processes memory 6 ipv6 unicast show processes cpu IPv6O 00000000000 ipv6 unicast show processes task ipv6 unicast show processes timer 6 ipv6 unicast restart ipv6 unicast debug protocols ipv6 unicast 000000 debug protocols ipv6 unicast debug ipv6 packet monitor 000000000000000000 dump protocols ipv6 unicast 00000000000000000000 LI lt e
85. 0 1 0 00 0000000000000 10 2 3 ISDNO O 000000000000000 0900000 OO 0000000000000000000000 00000000000 740000000 59 0 0 00000080000 69 x 2400000000000 00000000000000000000000000000000000000000000000 0000000000000 1 5 000000000000000000000000000000 000000000000000000 10 10 0000000000 000 1 0 0 0 000 0000000 OOOO 000000 Single 0 0 384kbit s 140 H10 0 00 1536kbit s 270 Dual HOODOO 384kbit s 120 H10 0 0 536kbit s 180 202 10 00000000000000 O OOOO PPPHDOUU 000000000000 11111 1 00000000000000000000 000000000 000 1820 00000 0 0000000000000000000000 7 000000000000 0 000000000000000000000000000000000 000000000000000 000000000 0000 isdn 00000000 call direction 000000000000000000000000000000000000000 0 0000000000000000000 1100 0000000000000 0000000000000000 00000000000008 0000000000000000 00000000000 00000000000 0 0000000000000000000 7 000000000000 050 0000000000 0 000000000
86. 000 3 2000000000000000000 U 2500packet s 12 0 00000 0000000 OOO RPHDU 500000000 0 0000000000000000000000 00000000000 00000000000000000000000000000 0 0000000000000000000000000000000000000000 0 000000000000000000000000000000000000000000000 362 10 0 00000000000000000000000000000 e 0000000000000000 e 0000000000000000 e 00000000000000000000000000000000 oOo EF oo 0 0 0 0 lt gt o EI 0 0 0 0 0 0 0 2 EY ESI 0 0 0 0 0 Lar Oooo Lac 10 20 D 0000000000 0 432000 00000000000000000000 amp 00000000000000000000000 000000 RPO 100000000000000000000000000000000000 000000 8 0000000000000000000 0000 0000 amp 000000000000000000000000000 0 00000000000000000 0 0000000000000000000000000000000 0 0000000000000000 0 000000000000000 amp 0000
87. 000 Routing Information Protocol RFC2453 1998 11 RIP Version 2 RFC2328 1998 4 220 OSPF Version 2 7 0000 0000 RFC1587 1994 30 00A 0000 000 The OSPF NSSA Option RFC1519 1993 90 BGP4 Classless Inter Domain Routing CIDR an Address Assignment and Aggregation Strategy 15 0000 0000 000 RFC1771 1995 80 A Border Gateway Protocol 4 BGP 4 2796 2000 0 40 BGP Route Reflection An alternative to full mesh IBGP 1997 19960 8 BGP Communities Attribute RFC1519 1993 9 Classless Inter Domain Routing CIDR an Address Assignment and Aggregation Strategy 1965 1996 0 60 Autonomous System Confederation for BGP RFC2842 2000 50 Capabilities Advertisement with BGP 4 RFC2918 2000 90 Route Refresh Capability for BGP 4 56 1998 80 Protection of BGP Sessions via the MD5 Signature Option draft ietf idr restart 06 txt 20030 10 Graceful Restart Mechanism for BGP 0 gt Receiving O0 00000000000000 IS IS D 16 15 0000000000 ISO 9542 1988 0000 000 Information processing systems Telecommunications and information exchange between systems End system to Intermediate system routing exchange protocol for use in conjunction with the Protocol for providing the connectionless mode network service ISO 8473 ISO IEC
88. 000 0000000000000000000 00000000 000000000000 0080 0000000000000000000 0 000000000000000000000000000 000000000000000000 0 00000000000000000000000000000000000000000 Voll 10 2 00000000000000000000000 e 0000000 000000000000000000 1260000 e 0000 0000000000000000000000 12560000 00000000 00000000000000000000000000000000000000 0 00000000000000000000000000000000000000000000 0 0000000000000000000000 00000000000000000000000 0 000000000000000000000000000 0000000000000000000000000000000000000000000000000 0000000000000000 LE ty Co O20 0000 0000000000 4 6 4 00000000000000000000000000000000 0000 0 0000000000000000000000000000000000000 00000000 000000000 6 4 0000000000000000000000000000000000 e 000000000000 B amp P4 00000000 0000 00000000000000000000000000000000000000000 0 00000000000000000 0000000000000 00000000000 862 4 000000000000000000 000000000000000000000000000000 0 00000000000000000000000000 000000000000000000 4 0 000000000000000000000000 nexthopselfQ 0000000000000 nexthopselfQ I 00000000000000000 185 9 0000000 186 9 4 nexthopself 1 D DU D nexthopself FES 5 4 FLA 4 KO AILF FLA 660
89. 1 2 2 2 4 1 10 3 1000000000 10000000 95 5000000000000000 1 27 00000000 95 0 00000 OOOO 00000 IP 000 HDLCO OOOO 00000 O 0000 O 0000 DSCP 1 D O EXP UU O 00000 O 38 1 008000 0000 IPXDUOU D 0106 DL D 00 00000000 O 0000 000000 O O 0000000 O O 00000000 O O kbit s O O O 0000 00000000 O O 00000000 O O 0000000 O 0 00 O O CLPOOOOO O O O 00000000 1104 00000 0000000000 2000000000000000000000000000000000000 0000000000000000000000000000000000000 0000 00000000 0000000000000000000000000000 010000000 000000000000000000000000000000 00000000000000 000000000 1 28 000000000000 0000 NIF 000000 00000000 10BASE T 1 100BASE TX N00 9 NEB100 1TC 2 000000000000 NEB1G 1B 0000000 1 20008 00000000000000000 2 NEB100 1TCQ OO Tag
90. 1 QoSOO00 11 QoS Il ll LH LH 9 1 00000000000000000000000000000000000000000000 0 0000000000000000000000000000000000 9550000000000 0000000000000000000 1 1 1 000000 95 5000000000000000000000000 95 50000000000000000 0 0000000000000 1 1 000000000000000000 11 0000 0 000000000000000000000000000000000000 0 00000000000000000000 0 0 0 95000000000000000000000000000000000000 0 000000000000000000000000000000000000 00000000000000000000000000000000000 SRM AY 2 2 0048 OO AAOOOOOOAA QoS Hill HE BRE ig 112 0000000000000 000000000000000000000000000000000000 1 008000 D 1 1 000000000000000000 00000000 00 0000 00000000000000 VoD 0000000000 0000000000 000000 0000000 weep 00000000000 0000 00000000000 00000000 1 1 3 1 1 EH U UU 9 0000000000000000000000000 0000000 00000000 95 0000000000000000000000000000 0 00000000000000000000000000000000000000 0 000000000000000000 0000 0 00000000000000000000000000000000000000 LILE Lr CRET PP Ll 000000 0 00000000000000000
91. 2129900000 show ip dhcp binding lt clear ip dhcp binding show ip dhcp import show ip dhcp conflict clear ip dhcp conflict show ip dhcp server statistics DHCP Hl B d dau clear ip dhcp server statistics 0 U show dhcp lease show ip dhcp client statistics clear ip dhcp client statistics lt dhcp server monitor no dhcp server monitor restart dhcp 157 8 0000 158 00 00000 restart dhcp client 00 lt dump protocols dhcp DHCP HI U Du show dns relay clear counters dns relay 2 8000000000000000000 show ip sat 0000000000 clear ip sat 0000000000000000000 show filter flow OOOO 2000000000 clear filter flow OOOO show ip nat statistics
92. 30 VC17 2 8 17 425 244 VINEE L 5128 1519 LEEI PVG Trap 00000000000000000000000000000 00000000000000000000 000000000000000000000000 6 00000000000 6 25 UU OOOO 0000000 00000000000000000000 000 FEE SNMP Z Sp velo PVG Trap IV iflndex 3 VCO LER VC2 29 1 308 VC24 y VC17 2 BE PVC Trap iflndex 3 VER 2 78 1 Trap SNMPOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO VCDDUU 0 00000000000000000000 000000000000000000000000 0 0 00000000000 00000000000 6 26 OOOO 00000000 0000000000000000000 0000 SNMP 57 VC2 37 VIRF CIF R K PVC Trap iflndex 3 VCS JAR VCD 4 2 3 2 gt VC17 2 8 VC27 2 BIE PVC Trap ifIndex 3 1 3 02 781 21 133 6 6 5 RMON MIB 134 RMON Remote Network Monitoring 00 00 00000000000000000000000 0 0000000000000000000000000000000000000000000000 17570 000000000 RMON MIB statistics history alarm event 010 statistics 0 0000000000000000000000
93. 89 2 000000000000000 pingi ping ipv6 ping ipx ping frame relay ping atm ping 000 000000000000000000000000000000000000 200000000 00 1 000000000000000000000000000000000000000 000000000000000000000000000000000000000000000 ping 000000000000000000 167 8 0000 8 5 00000000 ARB JL PC WS IPF Id L Cpinga lt gt 3541 76 COMBS J 5BO0le 2 8 F2 21 E2356 6X x DT S 0 20 ping 6 IEMPven 0000000000000 12 6 0000000000000000000000000000 0000000 1260000000000 0000000000000000000000 0 00000000000000000 6 0 00000000000000000000000 0 00000000000000000000 U 30 ping ipx O00 NetWare 00000000000000000000000000000000000000000 0 00000000000000000000000 4 ping frame relay OOO 0 0000000000000000000000000000000000000000000000 507100 00000000000000 Inverse 00000000000 Inverse ARP O O l 0 000000000000000000000000000000 0000000000000 0 0000000000000000 20000000000000000000 00000000 000000000000000000000000000 200000000000000000 ping framerelay J 0 000000000000000 8 6 ping frame re
94. AX2000R HL BEL 1 DD Vol 2 Ver 8 4 AX 10 158 10 AlaxalA mill Ax2000R 000000 Ver 8 40000000000 0000000000000000000 058 000000000000000000 mioo 000000000000000000000000000000000000000000000000000000000 00000000000 00 000000000000000 mill Ethernet 0 0 0 Xerox Corp 0000000 HP OpenView O Hewlett Packard Company O 0 00 IPX Novell O 0000 1 0 0000000000000000 000000000 Microsoft 0 0000000000000000 Microsoft Corp U 00000 NetWare 0 0 NovelLlInc 00000000 PolicyXpert O Hewlett Packard Company O O B O U SNA International Business Machines Corp 0 000 00000 Solaris 00000000000 Sun Microsystems Inc 700000000000 UNIX D X Open Company Limited O0 0000000000000000000000000000000 Windows H1 000000000000000 Microsoft Corp 00000 0000000000000000000000000000000000000 EJ gt 8 11 111 1 10 ULU 000000000000000000000000000000000
95. Congestion management for the ISDN frame relaying bearer service RFC2427 5 Multiprotocol Interconnect over Frame Relay RFC2390 6 Inverse Address Resolution Protocol RFC2115 7 Management Information Base for Frame Relay DTEs Using SMIv2 ANSI T1 617a 8 ISDN signalling specification for Frame Relay Bearer Service for Digital Subscriber ANSI T1 606a Supplement Congestion Management and Frame Size Digital subscriber signalling system no 1 DSS 1 Core Aspects of Frame Relay Protocol for Use with Frame Relay Bearer Service ANSI T1 618 1 62 0000000000000 O 2 00000000000 2 993300000000000000 3 0000000000000 4 O 5 000 8 01490 0000000000000 4 00A 0000 O 6 1293 0000000000000 0x7 13150 0000000 D 8 00000000000 U 7 000000000 000 00000 000000000 0000 000 1 432 B ISDN User Network Interface Physical Layer Specification ATM Forum UNI V3 0 V3 1 1 432 5 B ISDN user network interface Physical layer specification 25600 kbit s operation 1 432 2 B ISDN user network interface Physical layer specification 155 820 kbit s and 622080 kbit s Forum PHY 622 08Mbit s Physical layer specifications af phy 0046 000 ATM 1 150 B ISDN Asynchronous Transfer Mode Functional Characteristics 1 361 B ISDN ATM Layer Specification 1 371 Traffic Con
96. DSAP SSAP 000000 0 00000 0000 2 DSAP fe ff 3 SSAP fe ff 3 Interface2 Forward 1 DA 006097c010c7 PAOD 00000 00000 0000 0000 2 OFF 5 OFF B 4 Interface2 Forward 1 DA 0000e2081390 PAOD 00000 00000 0000 0000 2 OFF 3 OFF 5 Interface2 Drop 1 TYPE 0000 0000 00000 000000 00000 0000 2 OFF 5 OFF 000000 0000000000 0000000000 0000000000 0 000000000000000000000000000000000000 Entry No 30 40 00000000000000000 Entry No 30 40 5 0 4 0000 46 1111 1 1 EL D E 461 O00000 0 0000000000000000000000000000000000000000000000 0 00000000000000000000000000000000000000 e 0000000000000 1 0 1 0000000000 e 000000000000000 1 410 0000 1000000 4 11 0000000 20000 00 00 0 0 0 0 0 0 0 0 0 0 00 0000 412
97. EF SNMP Y 57 ae FMIB GetResponse i tab le 81 b 2 623 2 PC WS SetRequest a 4 5 00000000000000 0 badValue GetResponse 0 0 0 000000 000000000000 wrongTypeQ SetRequest 0O 0000000000000000 125 6 613 0000000000000000 SetRequest 0000100 SNMP ARE SNMPI Y SetRequest a abc SNMP 57 lt lt badVa lue 778 8 1 b 2 c 3 jn SNMPv2c ARG SNMPI Y yk SetRequest a abc SNMP 52 rte GetResponse wrongType 8 1 b 2 c 3 2 0000000000000000 U O GenBrror 0000000000000000 0 0000000000000000000000000000000000000000000000 0000000000000000 5 0 0000000000000000 5 sll 6 14 00000000000000000 SetReauestD 000000 ARE SetRequest b 4 SNMP x lt 52 lt gt m ae FMIB GetResponse genError N 81 b 2 3 2 PC WS 6 3 5 126 010000000000000000000 5 0000000000000000000000000 0000000000000000000000 000000000
98. RFC2362 1998 60 Protocol Independent Multicast Sparse Mode PIM SM Specification draft ietf pim sm v2 new 03 txt 20010 7D 1 Protocol Independent Multicast Sparse Mode PIM SM Specification revised draft ietf pim sm v2 new 05 txt 20020 3p A 13 Diff serv A24 0000000000 Protocol Independent Multicast Sparse Mode PIM SM Specification revised 00000 12 60000000000000 00000 9 41010100000000 0000 0000 000 2474 1998 12 Definition of the Differentiated Services Field DS Field in the IPv4 and IPv6 Headers RFC2475 998 120 An Architecture for Differentiated Services RFC2597 1999 60 Assured Forwarding PHB Group RFC2598 1999 60 An Expedited Forwarding PHB A14 OOOO 25 00000000000000 0000 0000 000 ANSI IEEE Std 802 1D 1990 Media Access Control MAC Bridges 19910 50 IEEE 802 11 D3 1992 Supplement to Media Access Control MAC Bridges Fibre Distributed Data 19920 80 Interface FDDI IEEE P802 1H D3 Draft Recommended Practice 802 1H MEDIA ACCESS CONTROL 19920 60 BRIDGEING OF ETHERNET V2 0 IN 802 LOCAL AREA NETWORKS A 15 SNMP A26 0000 0000 1155 1990 50 000 Structure and Identification of Management Information for TCP IP based Internets RFC 1157 19900 50
99. rights reserved Redistribution and use in source and binary forms with or without modification are permitted provided that the following conditions are met 1 Redistributions of source code must retain the above copyright notice this list of conditions and the following disclaimer 2 Redistributions in binary form must reproduce the above copyright notice this list of conditions and the following disclaimer in the documentation and or other materials provided with the distribution 3 The name of the author may not be used to endorse or promote products derived from this software without specific prior written permission THIS SOFTWARE IS PROVIDED BY THE AUTHOR AS IS AND ANY EXPRESS OR IMPLIED WARRANTIES INCLUDING BUT NOT LIMITED TO THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE DISCLAIMED IN NO EVENT SHALL THE AUTHOR BE LIABLE FOR ANY DIRECT INDIRECT INCIDENTAL SPECIAL EXEMPLARY OR CONSEQUENTIAL DAMAGES INCLUDING BUT NOT LIMITED TO PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES LOSS OF USE DATA OR PROFITS OR BUSINESS INTERRUPTION HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY WHETHER IN CONTRACT STRICT LIABILITY OR TORT INCLUDING NEGLIGENCE OR OTHERWISE ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE SUN MICROSYSTEMS INC Copyright C 1984 1985 1986 1987 1988 1993 Sun Microsystems Inc Sun RPC is a product of Sun
100. 0 0000000000 240 910 0 8 00000000 242 9 10 1 000000 242 9 10 2 Ut 242 9 10 3 DHCPO JU DD 243 9104 000000000 246 911 0 00000 247 9 11 1 1 DDD 247 9 11 2 UD 247 9 11 3 0000000000000 247 9 114 248 9 12 249 9 121 000000 249 9 122 249 9 12 3 HH BH HH B HH U D 251 9 124 000000000 252 9 125 000000000 253 9126 253 xiii 00 xiv RIP OSPF 287 10 1 4 258 10 1 1 0000000000000000000000000 258 10 12 258 1043 0 00000000000000000 259 102 000000000000 269 10 2 1 260 1022 00000 0 260 1023 261 10 24 0000000000000 262 1025 0 000000000000000000 264 1026 0000000000000000 265 10 3 RIP OSPF 266 10 3 1 000000000000 288 1032 000000000000 RIP OSPF 269 1033 0000000000000000000000000 8 0000 269 103 4 1 1 270 104 RIP 2H 1041 RIP 271 1042 0000000000 ele 1043 1 0000000 lt 1044 RIP 20 00 277 1045 lt 278 1046 0000000000000 291 10 44 281 10 5 OSPF 284 10 5 1 OSPF 284 1052 0000000000 288 1053 000000000000 287 1054 00000 288 1055 0000000000 292 1056 ASO
101. 0 0000000000000000 3 0 39 000000000000000000 22 7 55 E TA RE x J F3 nl ERZA 244 00000000000000 NCP Netware Core Protocol 00 00000000000000 000000000 Netware3 00000000000000000000000000000 0 0000000000000000000000000000000000000000000 037 0 0 0 00000 00000 NetWare3 11J NetWare3 12J 4 1J 0000000000000 tw 0 50 16000 210 0000000000000 2 010 00 U 10000 10 50 00000000 100 500 1000 10 20 39 000000000000000000000000000 0100000000000000 0 0000000000000000000000000000000000000000000000 0 0000000000000000000000000000000000000000000000 0 0000000000000000000000000000000000000000000 Watchdog Spoofing TOO 0000000000000 2 0000000000000000000 0 000000000000000000000000000000 0 00000000000000000000000000000000000 000000000000000000000000 00000 e 00000000000000000000000000000000000 0 000000000000000000000000000000000000000000000 0000000000000000000 0000000000 2000000000000000 0 00000000000000000000000000 e 0000000000000000000000
102. 0000000000000 0 1201 0000000 VRRPO00000000000 00 VRRP ADVERTISEMENTQ 000000000000000 000000000000 VRRP 0 00000 1 400000000000 02 12 0000000000000000 Pv6Q 00000000000 112000000 0 1300000 00000000000 20000000000000000 3000000 000000 0 0000000000000000000000020000000000000000000000 000000 000000000000000000000000000 115 5 VRRP 0 mc 00 00 0 0000000 9 0 0 1400000 801100 0 0 000 HSRP Hot Standby Reuter Protocol 00000000000 116 040 SNMP D D D LI 000000000 0000000000000000000 0000000 6 1 SNMP 6 MIB 6 wo SNMP D D UD 64 0000 6 RMON MIB 117 6 6 1 SNMP 6 1 1 00000000 0 00000000000000000000000000000000000000000000 SNMP simple network management protocol 0 0000000000000000000000000000000000000000000000 0000000000000 000000000000000000000 0 000000000000000000000000000 Det 00000
103. 0000000000000000000000000000000000000000000000 0 00000000000000000000000000000000000000000000000 0310000000000000000 0000000000000000000000000000000 0000000000000 0 000000000000000000000000000000000000000000000 0 0000000000000000000000000000000000000000000000 0 0000000000000000000000000 e 00000000000000000 1200000 200000000000000000000 e 0000000000000000000 120000 200000000000000000000 e 000000000000000 0 00000000000000000 8 5900000000000000000000000000 0 0000000000000 040 000000000 00000000000000000000000000000000000000000000000 00000 0000000 000000000000000000000000000000000 0 0000000000000000 0 0000000000000000000000000000000000000000000000 0 0000000000000000000000000000000000000000000000 0 0000000000000000000000000000000000000000000000 000000000000000000 0000000 00000000000000000000 00000000000000000000000000000000000000 Designated Bridge 00000000000000000000000000000000000000000000000 0 0000000000000000000000000000000000000000000000 Designated 0 0 0 000000000000000000000000000000000000 Fowarding 0000000000000 00000000000000000000000000000000000000000000000 Blocking 0000000000000000000000000000000000000000 0 00000000000000000000 BlockingQ 000000000000000 Fowarding 00000000 0 000000000000000000000000 85
104. 168 20 10 24 55 00000000000000000 ADU Department1G 000000000 0000000 00 000000000000000000000000000000000 Departmenti 00000000000000000000000000000000000000 00000000000000000000 IPOD O U target address 0000 VRRPOOOOO 0 0000000000000000000000000000000000000000000000 CQ 9 0000000000000000000000 state O 0000000000000 Vol 1 10 3 1 9 00000000000000000000000 5 5 0000000000000000000 Point20 0000 0000000000000 90000000000 1200000000 10 168 30 00000000000000000000000000000000000000 400000 00000000000000000000000000000000000 00000000 0 0 0 N 0 0000000000000000 8 0000000000000000000000 0 0000000000000000000000000000000000000000000 0 0000000000000000000000000000 a Lr 5 4 2 vRRPHODBUDUU 0000000000000000000000000000000000 0 000000000000000000000 0 5 6 0 0000000000000000000 OOO 000000000000000000 88 00000000000000 00000000000000000000000000000000000000 00000000 check reply interface 0 0 00000000000000000000000000000000 0 00000000000000000000000000000000000000000000000 105 5 VRRP 0057 0000000000000000000000000000000000000000000 0 000000000000000000000000000 056 000000000000000600 Echo Reply 106 5 VRRP 5 5 1
105. 47 2 Diff serv 22 000000000000000000000 gt 28 DSCPICH gt EID gt _ gt 0 30 05000000 DSCP Diffserv 00000 1 00000 9500000000000000 DiffsevQ 0000 2 00000000000000000000 D D 2 3 5 0500000 1 05 2 4 F 7 6 5 4 3 2 1 0 KZ 5 8 9665 Diff servIzd amp 24 08 2 4 JL 7 6 5 4 3 2 1 0 Exper imental Local Use D Delay T Throughput R Reliability DSCP Differentiated Services Code Point CU Current Unused 48 2 Diff serv Diffserv 5 6 Experimental Local Use 00000000000 958 30000 Class selector O O U U 000000000 9 000000000000000000 040 Diff serv 00000 Diff servJ 00000000000000000000250000000000000000000 0000000 2000000000000 2 0000000000000000000000000 0 000000000000000 e STEP1 0 00000000000000 25000000 0000 0000 00000 DST STEP2 000 000 DU 000 0000 0 0025000000 25 000000000000000000000000 00000000000000 25 0 000000000000000000000000000 0 0000000000000000000000000000 2 1 2 Diff serv QoS Diffserv 00 0000 95 000000 000000000000000
106. 80 527 000000 PPP MP 83 5 28 86 529 92 53 0000000 ius 531 000000000 102 532 0000000000 194 533 108 534 00000000 109 535 ng 536 00000000000 iS 537 0000000000 dis 54 ISDN 19 5 4 1 ISDN I J 119 542 8 0 000000000000 120 543 80 000000000 123 5 44 15 124 55 0000000 1 551 127 552 000000000 00 128 553 00000000000 554 000000000000000 132 135 61 136 62 137 62 1 25 137 6 22 OC 3c SONET STM 1 SDH I 0 0 00 137 6 3 ATM AAL 138 6 3 1 OOOO 138 632 00000000 124 6 3 3 156 6 4 Classical IP over 161 641 ATMOO 200000000 161 6 5 0000 163 651 ATMO O 1 6 00000000 163 66 0000000000000 169 6 6 1 IPXH B B UU U D 165 662 166 67 168 671 0000000000 He 672 0000000000 xi 00 171 71 0000000 172 711 1 172 712 00000000 172 713 173 714 000000 177 72 0000000000000000 178 721 178 722
107. Dropper 0000 1 0 0 00002 _ _ gt 00003 EN E flow filter 00000 9800000 DiffservQOQOOOOOOOOOOOOOOOOOO 000000000000000000 OutboundOOOOOOOOOOOOOOO e Outbound 0 0000000000000 200000000 Gndex0 O 000 e Outbound 0 000000 955000000 2 3 2 11 11 000000000 2 00000000000000000000000000000000 0100000 10000 000000000000000000000000000002 5000000000000000 0000 25 0000000000000000000000000000000 100000 0 00000000000000000000000 55 2 Diff serv 27 000000000000 0000 1 inbound outbound hr rho on Traffic Conditioner 0210000 20000 0 00000000000000000000000000 0 5 00000000000000000 20000000000000000000000 25 00000000000000000000 0 0000000000000000000000000000 2 8 000000000000 0000 2 outbound Traffic Conditioner O30 0000 30000 0 00000000000000000000000000 02 5 00000000000000000 30000000000000000000000 2 5 00000000000000000000 0 0000000000000000000000000000 56 29 000000000000 0000 3 EREA GEBOT J 1 22 MA 2 7 inbound outbound Traffic Conditioner 2 Diff serv 57 12 0000000000 11 LI LE Novel HO 05000 NetWare 0000000000000000000000000 Lr
108. INCLUDING NEGLIGENCE OR OTHERWISE ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE Xntp Program The following copyright notice applies to all files collectively called the Network Time Protocol Version 4 Distribution Unless specifically declared otherwise in an individual file this notice applies as if the text was explicitly included in the file Copyright C David L Mills 1992 1993 1994 1995 1996 Permission to use copy modify and distribute this software and its documentation for any purpose and without fee is hereby granted provided that the above copyright notice appears in all copies and that both the copyright notice and this permission notice appear in supporting documentation and that the name University of Delaware not be used in advertising or publicity pertaining to distribution of the software without specific written prior permission The University of Delaware makes no representations about the suitability this software for any purpose It is provided as is without express or implied warranty MD5 Program Adapted from the RSA Data Security Inc MD5 Message Digest Algorithm pimdd Copyright C 1998 by the University of Oregon rights reserved Permission to use copy modify and distribute this software and its documentation in source and binary forms for lawful purposes and without fee is hereby granted provided that the above copyright notice
109. 0000 0000 0000000000000 000000000000000 10000 P P 0000000000 000000 000000 000 00000000 0000000000000000 00000000 0000000000000 Ooo 0 0 0000 0000 0 u 0000 0000000000000000 0000000 0000 00000000 0000 0000000000000000 0000000000000 10 000000 00000 0 00000 0000 0000 000000 O 2000000000000 Line Gropp 0000000000 0000000 D 00 00000 0000000 000000000000 00000000 000000 000000 O 1 00000000000 00 00000000000000 200000000 000000000000000 00000000000000000000000 10000000 10000000000000 00000000000 00000000 000000000000000000000000000000000 00000000000000000000000000000000 0000000000 0000000000000 00000000000000000 197 10 000000000000000 10 6 00000 00000 00 000
110. 0000 9 1 0 000 2 1 00 0 JOO 0000 1 0000 9 4 2 1 1 0680000 000000 POOD POOO 000000000 000 00000 0000 00000 0 000 000 0 000 000 00000 00000 200 300 0000000000 1240000 00 nog 00001 0000 8 4 00000 000000 000 2 1 000000000000 2 ae E 0000 Redirect 0 0000 00 0 a aD Dun 00001 0000 8 4 2 1 000 00000 00000 Dun 00001 0000 8 4 2 1 00000000 1260000 00000 Dun 00001 0000 19 4 4 4 00000000 1260000 00000 Dun 00001 0000 8 4 2 1 000000 1 2000000000 0 00000000000000000000000 0x2 0000000000000000000000000000000000000 400000 3 0 0000000000000 4 0000000000000000000000000 8200000 8 000000000000000 0000 re 0000 0000 000000000000000000000 1240000000000 00000000 5 0000000000 12400000000000 0 6 16710 0000000000000000000 100000000 16000000 0000186 0000 00000000 00000000000 1 9 6 000000 POOD 0000 0000 0000 0000 2 7 0000 000 00000000
111. 00A 0000 218 5 000000000 00 RFC1171 The Point to Point Protocol for the Transmission of Multi Protocol Datagrams Over Point to Point Links RFC1172 The Point To Point Protocol Initial Configuration Options RFC1220 Point to Point Protocol Extensions for Bridging RFC1331 The Point to Point Protocol PPP for the Transmission of Multi Protocol Datagrams over Point to Point Links RFC1332 PPP Internet Protocol Control Protocol RFC1334 PPP Authentication Protocols RFC1548 The Point to Point Protocol PPP RFC1552 The PPP Internetwork Packet Exchange Control Protocol IPXCP RFC1618 PPP over ISDN RFC1619 PPP over SONET SDH RFC1661 The Point To Point Protocol PPP RFC1662 PPP in HDLC like Framing RFC1717 The PPP Multilink Protocol MP RFC1990 The PPP Multilink Protocol MP RFC1994 PPP Challenge Handshake Authentication Protocol CHAP RFC2125 The PPP Bandwidth Allocation Protocol BAP The PPP Bandwidth Allocation Control Protocol BACP RFC2472 IP Version 6 over PPP 6_00000000000000000 ITU T Recommendation Q 922 1 ISDN data link layer specification for frame mode bearer services ITU T Recommendation Q 933 2 3 Digital subscriber signalling system no 1 DSS 1 signalling specifications for frame mode switched and permanent virtual connection control and status monitoring ITU T Recommendation 1 370 4
112. 2 EE ps Oro 00581882 20 8 EXEOIBISINT F 28 BEER 1515 4 5 1 25 9500000000000 RP NIF dai gt 8 8 3 2 3 3 7 OOOO 3 10 21 558528 4 OOOOO 103 4 Vr y QoS il fe A IHRE LU 9 2 1 Qi O O 3 61 5 000000000000000000000000000 0000000000000 00000000 8 00000000000 9585000000000000000000000000 42 1 008000 e e 000000000000000 e 000000000 3500 000000000000000 e 0000000000000 IPOOO 0000000000000000000000000000 e 0000000000000000000 0 00000000 0 v 3 000000000000000 1112 0 000000000000000000000000000000000000007 000000 0 0000000000000000000000000076 000000000000000000 1105 2000000000000000000000000000000 0 0000000000000000000000000000000000000000000000 0 0000 000000000000000000000000000000000000000000 0 0000000000000000000000000000000000000000000000 0 0000000000000000000000000000000000000000000000 0 00000000000000000000000000000000000 1 11 3 00000000 0 5 01000 0000000000 0000000
113. 20 1 10 7 LARPSER 192 168 20 1MC7 LATE PC JU 8 10 7 3 1 fe80 7MMACP FL AIL 2 00 00 5 00 01 07 4228 TF 0 00000000000000000000 26000000000 00 0000 00000000000000 0000000000000000000000000 000000000000000000 0000000000000 00000000000000000000000000000 0000 5 VRRP 53 DILULDUCDLDL 0 000000000000000000000000000000000000000000 0 000000000000000000000000000000000000000000 0 000000000000000000000000000000000000000000 0 0000000000000000000000000000 20000000000 00 0 00000000000000000000000000000000000000 Critical Priority O 00000000000000000000000000000000000000000 000000000000000000000 own Priority 00 0000000000000 0 00000000000000000000000000000000 0000000 0 00000000000000000000000000000000000000000000 Zes Ib 192 168 50 1 24 A tAY 1752z1 A la 192 168 20 1 24 PC PC AOU 1 0 00000 0000 00 00000 000000 00000000000000000000000000000000000 0000000000 OOO 000000000000000000000000 1 0000000
114. 4 0000 86 0 43 000000000000000 JV F 20v 2 7155 Blocking REOT y 2 JL KAR F 8 lt BlockingtR8EO 754 21 1 12 2 1 0 0000000000000000000000000000 1000000000000000 20 Blocking 0000000000000000000000000 8000000000000 0 00000000000000000000 4 0000 44 111 441 0000000000000 WAND OO 00000000000000000000000000000000 00 WANDDD 0 0000000000000000000000000000 OOOO 55100000000000000000000 55100000000000000000 0 0 00 WANG ATMQ QO FDDI 0 0000000000000000000000000000 10 OO AMOOOO 2591000 FODDIQOQ0000000000000000000000000 4 4 0 0 00 0 YR IXATM EM 588 mm CU 2001 OS 24 lt EF DITM 4 9 F 4 F 5 7 7 HE 0000000000 0000000000000000000000000000 0 00000000000000000000000000 O20 00000000000000000000000000000 00000 000000000000000000000000000000000 0 000000000000000000000000000000000000000000 0 00000000000000000000000
115. 7 4 182 O00000 00000000000000000000000000000000000000000000000 0 00000000000000000000000000000000000000000000 18 3 OOOOOOGO 0 0000000000000000000000000000000000000000000000 0 000000000000000000000000 184 ID D B B UL BI 0 0000000000000000000000000000000000000000000000 0 0000000000000000000000000000000000000000000000 0 0000000000000000000000000000000000000000000000 000 1 85 kbit s ll 0 000000000000000000000000000000000000000000 0 00000000000000000000000000 5145000000000 0 0 00000000000000000000000000000000000 000000000000000 051 500 0000000000000000 00000000 2 00000000000000000000000000000 2530 0000000000000000 051400 0000000000000000000000 D Oooo 1 0680000 1 11 000000 5 0000000000000000000 000000 0000000 O pscPOOOOOO pDscPOOO o000000 0000000 1 8 6 00000000 0 0000000000000000000000000000000000000000000000 0 0000000000000000000000000000000000000000000000 OOOO 100Mbit s ISP 000000 50Mbitis 0000000000000 5oMbits D O D 0 0000000000000000000000000000000000000000000000 0 0000000000000000 D 1 14 0000000 RBA 8 2 BEA F7 77 WARS SERVI d 8
116. 8 10 3 0 0000000000000000000000000000000000000000000000 0 0000000000000000 8 104 H H D DD 0000 0000000000000000000000000000000000 00 60000000000000000000000000 172 8 0000 8 11 0000000000000 0 000000000000000000000000000000000000 600000000 0 000000000000000000000000000000000000000 8 11 1 00000000000000000000000000000000000000000 00000000 TCPIPD UO D D 0 D CD ROM D fte D D D 0000000000 CD ROM 8112 00000000000000000000000000000000000000000 00000 PC AT D 000 88320 0 0000000 CD ROM 0 0000000000000 0 0000000000 CD ROM 8 11 3 1 0000000000000000000000000000000000000000000000 000 2 0000000 27 0 0000000000000000000000000000000000000000 173 8 0000 8 12 0 000000000000000000 0 0000000000000000000000000000000000000000000000 0 0000000000000000000000000000000000000000 0 0000000000000000000000000000000000000000000000 0 00000000000000000000000000000000 00
117. 9 L 843 1111 1 000000000000000000000 8 3 00000000000 ARE 150 TENT amp MODO SIRHSRBOESSTBERZ 7 4 2 2 iB lt OPNS 6 SHEA 5 4 0 8 8 5 5702555 7 7 1 amp 7 ILE 6 1 20000000000000000 200000000000000000000000000000000 0 6 0 D 0 0000000000000000000000000000000000000000 34 00000 1 0 0 0 0 0 00000000000000000000000000000000000000000000000 8 0000 844 1111110011 01000 000000000 30 0000000000000000000000 600000000000 0000000000000 00000000000000000 02100 0 0000000000000000000000000000000000000000000000 0 00000000000000000
118. A Simple Network Management Protocol SNMP 1213 1991 0 30 224 Management Information Base for Network Management of TCP IP based internets MIB II 0000 0000 1354 1992 00A 0000 000 IP Forwarding Table MIB 1471 1993 1473 1993 The Definitions of Managed Objects for the Link Control Protocol of the Point to Point Protocol The Definitions of Managed Objects for the IP Network Control Protocol of the Point to Point Protocol 1474 1998 The Definitions of Managed Objects for the Bridge Network Control Protocol of the Point to Point Protocol RFC 1643 1994 Definitions of Managed Objects for the Ethernet like Interface Types RFC 1657 1994 Definitions of Managed Objects for the Fourth Version of the Border Gateway Protocol BGP 4 using SMIv2 RFC 1659 1994 Definitions of Managed Objects for RS 232 like Hardware Devices using SMIv2 RFC 1757 1995 Remote Network Monitoring Management Information Base RFC 1850 19950 110 OSPF Version2 Management Information Base RFC 1901 1996 Introduction to Community based SNMPv2 RFC 1902 1996 Structure of Management Information for Version 2 of the Simple Network Management Protocol SNMPv2 RFC 1903 1996 RFC 1904 1996 Textual Conventions for Version 2 of the Simple Network Management Protocol SNMPv2 Conformance Statements for Vers
119. AND ANY EXPRESS OR IMPLIED WARRANTIES INCLUDING BUT NOT LIMITED TO THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE DISCLAIMED IN NO EVENT SHALL WASHINGTON UNIVERSITY OR CONTRIBUTORS BE LIABLE FOR ANY DIRECT INDIRECT INCIDENTAL SPECIAL EXEMPLARY OR CONSEQUENTIAL DAMAGES INCLUDING BUT NOT LIMITED TO PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES LOSS OF USE DATA OR PROFITS OR BUSINESS INTERRUPTION HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY WHETHER IN CONTRACT STRICT LIABILITY OR TORT INCLUDING NEGLIGENCE OR OTHERWISE ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE WILDBOAR Portions or all of this file are Copyright C 1994 1995 1996 Yoichi Shinoda Yoshitaka Tokugawa WIDE Project Wildboar Project and Foretune rights reserved This code has been contributed to Berkeley Software Design Inc by the Wildboar Project and its contributors The Berkeley Software Design Inc software License Agreement specifies the terms and conditions Acknowledgments for redistribution THIS SOFTWARE IS PROVIDED BY THE WILDBOAR PROJECT AND CONTRIBUTORS AS IS AND ANY EXPRESS OR IMPLIED WARRANTIES INCLUDING BUT NOT LIMITED TO THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE DISCLAIMED IN NO EVENT SHALL THE WILDBOAR PROJECT OR CONTRIBUTORS BE LIABLE FOR ANY DIRECT INDIRECT INCIDENTAL SPEC
120. CAUSED AND ON ANY THEORY OF LIABILITY WHETHER IN CONTRACT STRICT LIABILITY OR TORT INCLUDING NEGLIGENCE OR OTHERWISE ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE 0000 OOOO U ARP Address Resolution Protocol 1 AS Autonomous System 0000000000000000000000000000000000000 AS00000 0000 0 50 000 Asynchronous Transfer Model 00000000000 BGP4 Border Gateway Protocol version 41 Pv400000000000000000000000 BGP4 Multiprotocol Extensions for Border Gateway Protocol version 4 IPv6OO0O00000000000000000000 BGP4 000 00 BGP4 0000000000000 BOD Bandwidth Demand 00000 18000 00000 0000 0000 0 00000 0 00000 0000 000 Bridge Protoco Data Unit 0000000000 DHCP Dynami c Host Configuration Protocol 00000000000000000000000000000000000000000 DHCP BOOTP 0 DHCP BOOTPOOOOOO00000000000000000000000000000 uu 200000 000000 20000000000000000000000000000 Diff serv Differentiated services
121. D 0 5 13 000000000 4538 A 192 168 20 1 24 10 1 S927 IT la 192 168 20 1 24 la 192 168 20 2 24 FI 192 168 20 1 283 5 27 ELA ERES 6 4 0 0000000000000000000000000000000 2000000000000 0000000000000 20000000000000000000000000000000 1 0 00000000000000000000000000000000000000000000 0 00000000000000000000000000000000000000000000 0 00000000000000000000000000000000000000000000 0000000 7 000000000000000000 2 00000000000000000 0 0000000000000000000000000000000000000 9 9 2 DI UU UL 0 000000000000000 112 5 VRRP D 5 14 000000 ABBA 518 192 168 20 1 24 JV 9 10 1 VAR Ae 192 168 20 2 24 Jv 5 10 2 la 192 168 20 1 24 PC PC PC PC FIFAIVEW FELT FIFI 192 168 20 1 UL 2 ID 1000238 3 2 192 168 20 2 2 ID 2 R48 L FLA 35 OIPZFLA 35 0 000000000000000000000000 20000000000000000000 0 00000 1000000 00000000000000000 20 000000 2000 1 2000000 00000000000000000000000 1000 00000000 A000000 200 000000000 000000000000000 000 0000000000000 gt
122. Diffserv O O O O U 850 0000000000000 D 2 1 000000 0000 00 PHB 00000 Expedited Forwarding EF 0000 EFO 0 0 0 2598 0 000000000000000 00000000000 000000 100 0000000000000000000 Assured Forwarding AF 0000 QoS D00000 3500000000000 0000000 RFC 2597 00000000 95 00000000 950 0000000000000 49 2 Diff serv J UU QoS 0000 24 G Expedited Forwarding Aa EF Best Effort Assured Forwarding AF 2272747 11 AF12 AF13 P AF21 AF22 23 48 850 Ac bl on AF31 AF32 ras AF41 AF42 AF43 48522 IA 332 7A 2 1 3 Diff serv I 0000 000000 1 10 9580000000000000008 2475 000000 0000000000 2000 50 2 Diff serv 2 2 Diff serv E 0000 Diffserv 1 12 998000000000000000000000000000 8 0 000000000000000000000000 RFCQ DiffsevOOOOOOOOOOOOOO 000 MF Classifier Multi Field Classifier Marker BA Classifier Behavior Aggregate Classifier Meter Dropper Shaper O 0000000000000000000000 00000000000000000000 Ho
123. Internet Packet 0 O 00 0000 000000000000000000 43600000000 0000000 15000000000000000000000000 9 0 O30 12 00000000000000000000000000000000000 U 3 1 0 000 0000 0 00000000 0000000 000000 Oxfffe 0 0 0 0 O 0000 00 15000000000 O 000000000 oxof 000000 O 0000000 0 000 0x010 0x020 0x040 0 050 0 11 000000 0 000 RIP O RIPO SAPI 0 0000 0000000000 0000 000000000 RIP O 0x0455 000000 O NetBIOS D 0 0000000000000 0000000 5 0000000000 0000000 0000000 0x0455 1 000000 O NetBIOS 0 0 62 3 000000 D Netware3 12J0 0 000000 000000000000000000000000000000 00000000 0401 0000000000000000000 1 00000000000000000000 000000 0000000000000 0000 000000000 000 63 3 3 3 DIL 000000000000000000000000000000000000000000 0100000000000000 0 00000
124. O O INDEX yyyyzzzzzz 00 000 OO 0 xxxxx 0 222222 0 00000000 0000 3000000000000000000000000 8000000000 0000 o x 0 0 6 24 MIB 0 0000000000000000000000000000000000000000000000 0000000 8000000000000000000 13000 1000000 00 0 0000 0 MB0000000000000MB000000 10000 800000000000000 121 6 5 6 3 9 MIB management information 00000 0000000000000 e GetRequest 00000 1100001000 e GetNextRequest 00 0000 MIBOOOOOOOOOOO GetBulkRequest GetNextRequest O O U SetRequest 3000000000 000000000 0000000000000 6 3 1 GetRequest 0000080 122 GetRequestt 000000 0000000800 00000000 20000 9 00 0 0000000000000000000000000000000 1800000000 0000000 000 GetResponse 0000000 800000000000 D U GetResponse 0 D 000 00 noSuchNameQ 000000 GetRequest O0 00000000000000 6 6 GetRequest 000000 03 5 82 5 2156 ARE 2 2 GetRequest SNMP 57 lt FE
125. Reject 00000000 137 7 RADIUSQ 0 000 000 NAS IP Address Access Request 0000 1200000 000 9 000000000000000000000000 20000000000 NAS Identifier Access Request 000000000 000 32 0 00000000000000000000000 Reply Message Access AcceptAccess Reject 000 19 0000000000000000000000000 AecessRequest 000000000000000 02 RADIUSHDUDDUDDULD Access AcceptQ 00000000000000000 00000000000000000000000000 138 7 RADIUSO OOOO 7 3 RADIUS H U D U 91 8 0 0000 0000000000 0 1010000000 0 0 00000000000000000000000000000000000000 RADIUS O 0 0 00000000000000000000000000000000000000 0 00000000000000000000000000000000000000 0000 0 RADIUS 0000000000000000000000000000000000 D 7 2 000000000 J E KERR ARE RADIUS asswor 0 d 0000 0000 0000 0000 Telentsefz i 9yo0onZ RADIUSSEBE EA RAD I 053 IE TS 56 74 3 gt 4 177 VR 0000000
126. V 35 X 21 seriaD O O O O D timeslot 0000 00000000 vlan ITU T 9 933000 0 ITU T 00000000000 4 Q 933 T 00000000000 0 JT Q933 ANNEX ANSI TL6174ANN frame relay O O EX 0 local management 000 300 99330000 000000 000 00000 ANSI T1 617a frame relay OOOO 194 ANNEX D local management 0000 anif OOOO 10 000000000000000 0000000 000 0000 0000000 000000 000000000 0000 0000000 00000 400 FRE 1 1 local management D OOOO 2900000 00 DTE 00000000000 00000000000 0 DCE 00000000000 00 000300 0000000 0 0 0 0 0 0 frame relay LU LU 00000 poll direction O O U 6101 1 1 0 0 0 DCE frame relay OOOO 0000000000000 poll direction O O 0 0 66 0 0 0 000 frame relay OOOO 0000000000000 poll direction 0000 00000 50000000 0
127. following disclaimer in the documentation and or other materials provided with the distribution 3 The end user documentation included with the redistribution if any must include the following acknowledgment This product includes software developed by the Apache Software Foundation http www apache org Alternately this acknowledgment may appear in the software itself if and wherever such third party acknowledgments normally appear 4 The names Apache and Apache Software Foundation must not be used to endorse or promote products derived from this software without prior written permission For written permission please contact apache apache org 5 Products derived from this software may not be called Apache nor may Apache appear in their name without prior written permission of the Apache Software Foundation THIS SOFTWARE IS PROVIDED AS IS AND ANY EXPRESSED OR IMPLIED WARRANTIES INCLUDING BUT NOT LIMITED TO THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE DISCLAIMED IN NO EVENT SHALL Acknowledgments THE APACHE SOFTWARE FOUNDATION OR ITS CONTRIBUTORS BE LIABLE FOR ANY DIRECT INDIRECT INCIDENTAL SPECIAL EXEMPLARY OR CONSEQUENTIAL DAMAGES INCLUDING BUT NOT LIMITED TO PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES LOSS OF USE DATA OR PROFITS OR BUSINESS INTERRUPTION HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY WHETHER IN CONTRACT STRICT LIABILITY OR TORT
128. grAtmIntfCurrentlyFailingPVvels Q 0 0 0 ArTrMggugaggggagnggagggmmgagnmgnt 0 GfIndex9 0 30 VCO 30 VC PVC Trap 00000000000 30000000 Trap 0 000 00000 0 0000000000000000 0000000000 veood 0 00000000000000000 0 00000000000 6 5 6 19 0 0 0 000000000000000000000 EB SNNPY Sp 01 gt PVG Trap iflnde 3 gt 8 1 30 V0243 PVC Trap iflndex 3 VCO 218 2 Vo 88 2 Trap SNMPOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO VCDDUUU 09 9000089 Tapp 000000 00000000 00000000000000 00000000000 6 20 Trap 000000000000 AEB SNNPY Sp 01 gt PVC Trap iflnde 3 Vor VR VCR u i 30 VO2 2y PVC Trap iflndex 3 VCO 218 2 Vo 88 2 SNMPOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOVCOOO 0 00000000000000000000000000 1000 0000000000 U 0000000000000 6 21 PVC 00000000000000 00000000000 EB SN
129. list of conditions and the following disclaimer in the documentation and or other materials provided with the distribution THIS SOFTWARE IS PROVIDED BY THE DEVELOPERS AS IS AND ANY EXPRESS OR IMPLIED WARRANTIES INCLUDING BUT NOT LIMITED TO THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE DISCLAIMED IN NO EVENT SHALL THE DEVELOPERS BE LIABLE FOR ANY DIRECT INDIRECT INCIDENTAL SPECIAL EXEMPLARY OR CONSEQUENTIAL DAMAGES INCLUDING BUT NOT LIMITED TO PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES LOSS OF USE DATA OR PROFITS OR BUSINESS INTERRUPTION HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY WHETHER IN CONTRACT STRICT LIABILITY OR TORT INCLUDING NEGLIGENCE OR OTHERWISE ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE FRANK VAN DER LINDEN Copyright C 1995 Frank van der Linden rights reserved Redistribution and use in source and binary forms with or without modification are permitted provided that the following conditions are met 1 Redistributions of source code must retain the above copyright notice this list of conditions and the following disclaimer 2 Redistributions in binary form must reproduce the above copyright notice this list of conditions and the following disclaimer in the documentation and or other materials provided with the distribution 3 All advertising materials mentioning features or use of this softwar
130. show rp buffer clear rp buffer show processes 00000000 show memory du 00000000000 00 show trace debug trace no debug trace clear trace show registor 00000 dump rp dump nif NIFOOOOO set dump show dump status erase dumpfile 000000000 0000 show calendar 00000000 set calendar 00000000 rdate 00000000000000000 show ntp status ntp 00000000 restart ntp ntp DD 0D D MIB snmp lookup OOOO 191 0 snmp get 0000 MIBDU DU snmp getnext 000000 snmp walk OOOO MIB UD snmp getif interface Hl MIB E U snmp getroute ipRouteTableg IPPOOOOOOOOOOOOOO snmp getarp ipNetToMediaTable IPO 0000000000 000 8 0000 00 00000 00 snmp getforward ipForwardTable 0 0 0 grVpnIpForwardTable snmp rget 00000000000 8 snmp rgetnext 0000000000000 MIB snmp rwalk 00000000000 18000000 snmp rgetroute 00000000000 ipRouteTableg IPQ
131. stated Permission terminates automatically if any of these terms or conditions 18 breached Upon termination all applicable NextHop materials must be immediately destroyed Any unauthorized use of any NextHop materials may violate copyright laws trademark laws the laws of privacy and publicity and communications regulations and statutes Notice Acceptance of Terms of Use Use of NextHop material is subject to certain Terms of Use which constitute a legal agreement between you and NextHop By using this material you acknowledge that you have read understood and agree to be bound by the Terms of Use Please review the Terms of Use A copy of NextHop s Terms of Use is available upon request or on the web at http www nexthop com If you do not agree to the terms do not use these materials Restricted Rights Legend This software and any associated documentation are provided with RESTRICTED RIGHTS The Government s rights to use modify reproduce release perform display or disclose are restricted by paragraph b 3 of the Rights in Noncommercial Computer Software and Noncommercial Computer Software Documentation clause at DFAR 252 227 7014 Jun 95 and the other restrictions and terms in paragraph g 3 i of Rights in Data General clause at FAR 52 227 14 Alternative III Jun 87 and paragraph 6 2 of the Commercial Computer Software Restricted Rights clause at FAR 52 227 19 Jun 87 contained in the above identified contract Any reproductio
132. txt Results from Interoperability Tests of DHCPv6 20030 40 Implementations 20 NAT PT 00000 0000 0000 000 RFC2766 2000 20 Network Address Translation Protocol Translation NAT PT A 10 RIPng OSPFv3 21 RIPng OSPFv3 0000 0000 RFC2740 1999 120 BGP4 22 BGP4 00000000 000 8802081970 1 RIPng for IP OSPF for IPv6 10000 000 0000 0000 Border Gateway Protocol 4 BGP 4 1771 1995 0 30 RFC2545 1999 3 Use of BGP 4 Multiprotocol Extensions for IPv6 Inter Domain Routing RFC2858 2000 60 Multiprotocol Extensions for BGP 4 RFC2842 2000 50 Capabilities Advertisement with BGP 4 RFC2796 2000 40 BGP Route Reflection An alternative to full mesh IBGP Autonomous System Confederation for BGP RFC2918 2000 90 Route Refresh Capability for BGP 4 RFC1997 1996 80 BGP Communities Attribute RFC1965 1996 60 RFC2385 1998 80 Protection of BGP Sessions via the TCP MD5 Signature Option draft ietf idr restart 06 txt 20030 10 Graceful Restart Mechanism for 0 Receiving O0 00000000000000 223 00A 0000 A12 23 1 600000000000000000 0000 0000 000 RFC2710 1999 100 Multicast Listener Discovery MLD for IPv6
133. 0 26 Sry 72 570 T4928 0 10 000 000000000 100000000 600000000000 0000000 gt 0 gt 000000000000000000000000000000 B5 00000 000000 0000 0 0 00000000000000000000 100000000 6000000000000 0310000000000000000 0 00000000000000000000000000000000 82000000 300000 90000000000000000000000000000000000000000000 0000000000000 040 1 00000000000 OOOO 2 0000000000000 10000000000000000000000000000 0 0000000000000000000000000 342 0 0000000000000000000000000000000000000000000000 00000000000000000000000000000000000000000000000 0 000000000000000000000000000000000 68 35 DI ULDUDL LLL 0000000000000000000000000000000 5 00000000 0 00000000000000000000000 3 5 1 SAP UU U U Ul 0000 0000000000000 5 00000000 0000000000 0000000000000 D 3 4 5 3 0 00000000000000 5 00000000000000 00000000 00000000 0 0000000000 0000000 0000 General SAP 0000 100000000000 00000000 General SAP nmmmmmmnmnnn H 000000000000000 0 000000000 0000 000000 Nearest SAP 0000 0000000 0000000000 0 000000000 Nearest SAP
134. 0 TYPED 000000000 2000 e 0000000000000000 0000000 0000000000000000000 m 0000 00 2000000000 mJ 00 540 2010 9 0 0000000000000000000000000000000000000000000000 0 0000000000000000000000000000000000000000000000 000000 50000000000000000000000 0000000000 1000000000000000000000000000000000000 0 000000000000000000000000000000000 0210000000000000 0 0000000000000000000000000000000000000000000000 000000000 0 0000000000000000000000000000000000000000000000 00000000000 03000000000 Forward 0000000000000000 Drop 0000000000000000000 000000000000000000 200000000000000000000000000000 00000000000000000000000000000000000000000000000 0 0000000000000000000000000 O40 0000000000000 0 00000000000000000000000000000000000000000000000 1 0000000000000 0000000000000000000000000 Entry 1 0 2 interfacel 5 0 000 00000000000000000000000000000 Entry No 20 93 4 0000 94 3 interface2 00 0000000000000000000000000000 Entry 30 43 0000000000000 00000000000 00 Entry Interface Action Item Type Value 16 160 No No 1 all Drop 1 SA 400000000000 400000000000 000000 U L 1 0 000000 0000 0000 2 OFF 5 OFF 2 Interfacel Drop 1 DA 800000000000 800000000000 DAnogg 000000 000 6 1
135. 0 000 00000000000 0000000000 TOS 0 0 0 00000000000000000000 0 00000000000000000000 0 0 00000000000000000000 EJ o o Oooo L3 r3 C3 C3 C3 C3 LJ pr rn LJ r3 C3 C3 C3 C3 E EI DE 3 ESI L3 L3 L3 L3 C3 EJ 3 EI OD ano J T ooo OOO ooo Ed C3 O g 0 02 D L QoS 000 0 00000000000200000000000000000 000000000000000000000 bDSCP 0 00000000000000000000000000000 00000000000 25 lt 000000000000 0 000000000000000000000 0 000000000000000000000000000000000000000 0 00000000000000000000000000000000000000 000000000000000000 1 000000000 2000 00000000000000000000 psCPHDD 00000000 25 000000000000000 000000 000000 00000 D 33 1 QoSOO00 2000000000000000000000000000000000000000000 00000 3 000000 20 00000 00000 2 00000000000000000000000000000 0 0000000000000000000000000000000000000000000 00000
136. 0 0 000000000000000 1800000000000000000 0000 0000000000000 000000 2000000000000000000000 0 0000000000000000 6 6 15 0000000000000000 localnetwork 2774 1252274 public othernetwork 1 m 2 gt SNMPIL Y gt FR 6 SNMP 4 57 SNMP Y 57 8 1 1 E b SNMP 270 0000000 vi 000000000 00000000000000 othernetwork 0 00 0000 0000 0000 00 0000000 59000000000 Qocalnetwork 0 SNMPO OOOO 8 MBOOOOOOOOOOOOOOOOOOOOOOO othernetwors 0 8 1 OOOO 0 000000000000000000 O20 2 0000000000000000 00000000000000000000000 SNMPOOOOGOO gt 00 00000 00000 000000 80000000000000000000000000000 000000000 000000000000000000000000000 0 00000000000000000000000000000000000 0 0000000 0000000 6 3 6 5 000000000000000000000082 1157000000000000000 0000000000000000000 6 16 00000000000000 57 3 27 PDU Protocol Data Unit PDU UZIAF I2 MIBE 547 RAIE AT AA i GetRequest GetNextRequest GetBulkRequest SetRequest GetResponse E UU 00
137. 0 0000 000000000 23B DQ 0 0 248 24800000 0 000 1 126 0000000 0000000000000 OOOO 000 0000000000000 0 200000 00000000 OOO DDD 0000000000 0000000 0008 2000 100000000 2 00000 0 0000000000000 000000 0000000 0000000000 0000000000000 000000000 0000000000000 0000 Xe O 000000000000 000000000 11 0 O 0 00 0 00000000 9 0000000000000 000000000 0000 000000 O 2000000000000 Line Group D D D 0000 0000000000 x D 00 000000000000 000000 000000 0x1 00000000000 200000000000000000000000000 0x3 0 000000000000000000000000 e 10000000 10000000000000 e 00000000000000000000000000000 00000000000000000000000 e 000000000000000000000000000000000 e 00000000000000000000000000000000 00000000000000000000000000000 4 00000000000000000 0000000000000000000000 O0 5 10000000000000 line group O O dch Hine lt Line Name gt 00000 20000 00000000 0 4000000200000000000000000000000 0 0000000000002000000000000 1 5 000000000000000000000000 000000020000000000000000 8000000000000 152 000000000000 0000000000 200000000000000000000000 1000000000000000000
138. 0 0000000000000000000 0000000000000 Leaky Bucket 00000000000 1000000000000 0 0000000000000000000000000000000000000000000 0 0000000000000000000000000000000000000000000 0 0 0000000000000000000000000000000000000000 Leaky Bucket 000000000000000 00000 Leaky Bucket 00000000000000 D DD 5 9 Oooo 0 0 1 0680000 D 1 6 00000000 Leaky 000000000 AA Yy k RITI 7 M 5 4 5 F 2 ER X ei Woy gt Wry F we QU Vac TERRA Syy RETAIN erste y PREETI Weak TE gt Bay Fh BENT MAX gt SEN AB RO RRRA ST YF 8 42 00000000000 Leaky Bucket 0000000000000000000000000 16 00000000 Leaky Bucket 0 0000000000000000000000000000 0 0000000000000000000000000 20000000000000000 1000 00000000000000000000000000000000 0 0000000000000 0000000000000 0000000000000 2000000 0 0 000000000000000000 2000000000000000000000000000000 0 Oooo Oooo rcr CoE Ea san Oooo Oooo 51 54 EE Oooo Oooo Er E E EET L3 L3 oO 0 0 0 0 0 0 1 008000 15 0000 00
139. 0 00000000000000000000000000000 oOo Oo 0 0 0 L3 L3 GEN lt 00 0 gt L3 L3 0 0 0 0 lt Line 000000 0 0 0 0 0 0 0 0 0 0 0 0 E 90 DI 0000000000000000000000000000000000000 0 20000000 00000000000000 200000000000000000000 OOO 0000000000000 000000000000 000000000000000000000 2000000000000000000000 00000000000000000000000000000000 0000000000000 0000000000 check reply interface 0 00000 0 0000000000000000000000000000000000000000 0 0 0 0 0 0 0000000000000000000000000000000000000000 0 d 000000 1 000000000000000000000000000000 0 9 0 VRRP 0000 95 0000000000000000000 Ez HE EST LER CIE E 0 0 1019 800 11010 110 109100 DHCP BOOTPH 00000000000 0000000000000000000000 DHCP BOOTP O 0000 00000000000000 00000000 200 0 0000000000000000000000000000000000000000000000 00000000 7 4 6 DHCP BOOTPO VRRPOOOOOOOOOOOOO 11 1 VRRPOOOOOOOOOOOOOOOOOOOO D D UU
140. 0 0000000000000000000000000000000000 0 0 200000000000000000000000000000 2000000000000000000 0 0 0 0 ooo Ooo ood 0 0 0 D 10 14 00000000 2 00000000 00000000 2 0000000 2 0000000 0000 9 priority 0000 gfr2s 0000 gfr2m mcr pcr mcr pcr priority4 pcr mcr pcr priority4 pcr 250kbit s 250kbit s 250kbit s J 3Mbit s 2 5Mbit s 135Mbit s D 500kbit 500kbit s 500kbit s 8 135Mbit S S 250kbit s 501kbit s 500kbit s 135Mbit s 135Mbit s 135Mbit 5 205 10 000000000000000 O40 0 00 50Mbits 0 0000000 50Mbit sq VPO 10000000000 8 50 3000000000000000 0 000000000000000000000000000000000 CBROOg 00000000000000000000000 10 2 00000000 HL RAR HL BR ARE AINSFAY ER EASA 50 1 4 VPPRVCA 2 8 CBR 1
141. 0 copymeQ 0000000000000000000000000000000 copy 00000000000000000000 8 6 2 000000000 00000000000000000000000000 e U copy me OOOO MCII format mc MCOOOOO show mc OOOO set mc disable 0 0 0 e set me enale 0 0 162 8 0000 8 7 D IUD UU 87 1 1 set calendarQ QO 000000000000000000000 2 rdte 00 0000000000000000 00000000000000000000 0 00000000000000000 3 000000000000000 000000000000000000 RFC1305 0000 3000000000 872 0100000000000 00000000000000000000000000000000000000000000000 0000000000000000000000000000 1 100000000000000000 0000000000 85 000000000000000000 00000 00 00000000 show ip interface 000000000000000 00000000 show ipv6 interface 00000000000000000 0000000000000 show ip dual interface 00000000 e 00000000 show router router nif Hine 00000000 0000 show nif 00000000000000000 00 2000000 show interfaces 000 0000000000000000000 show frame relay show isdn pool Show peer show atm show version 0000000000000000 0000000000000000 00 02010000000 show router
142. 00 000000000 0 00000000 OO 95090001 0000000000 0000000000 0 0000000000000000000 000000000 000 0000000000 LINEWAN 0000000000 905019004 00000000000 T 00000 0000 000600 The originating call from this router has been refused he peer router has disconnected the ISDN call C 0000000 00000000000000000000000000000 0000 0 00000000000000000000000000 000 000 Check phone number configuration of this router and the 0 0000 L3 1 og oOo B 0000000 1 LT D GOES oo rr 5 ESN E 3 maa EET ESI El 1 o E 0 5 0000 L3 E 5 00000 0 0000000000000000000000000 3 00000000 00000 00 00 20000 0 ISDN 0 000 0000000000 Fast 0 0000 0000 00 00 00 0000 0 0000000000000000000000000000000 vai 5 2 30000000000000000000000 0 0000000000000000000000000000 11 0 isdn ppp 0 D
143. 00 200000000000000000000 00000000000000000000000000 400 2 60000000000000000 0000000 00000000000000000 100000000 00000 800000 0000 00000000000000000 200000000 00000 0000000 0000000000000000000000000 2 6 00000000000000000000 0000000 113 5 VRRP 5 10 VRRPIIUUULUULULHU 0 1Pv40 00 9 0 00000 8 000000000000000000000000000 U 20 00000000 9581 ping telnet ftp 0 00000000000000000 12000000000 12000 00 000000 20000000000000000000000000000000000000000 0 0000000000000000 30 traceroute traceroute VRRPOOOOOOOOOO 00 00000 0000 00 00 0006 2 00 000 00 00000 traceroute traceroute 1 6 000 IPOD D U 0000000000 1 4 proxy 0000000000000000000 0 proxyaRPOOOOOOOOOOOOOOOOO 0000000000000000000000000 MACOOOOOOOOOOOOO 5 proxyNDP 000000000000000000 0000000000000000 00000 000000000000000 60 ICMP Redirect ICMPv6 Redirect
144. 000 0 200 10 22 000000000000000000 000000000 00000000000 010000000 0 10 3 1 ATMO00000000 020000000000000 00000 0 5 0 000000000 0 1280000 1280000000000000 000000 0 0 0 000 DU 000 00000000 6 0 0 0 000000000000000000000000000000000 200 EE Eh Era 1 c L3 L3 L3 L3 r3 0 0 0 0 0 0 e priority pro 000000 0000000 000000 0 priority per 000000000 0 1 0000000000000000000000 CLP og D 0000000000 1 0 00000000000 0 0000000000000000000 CLP op 0 000000000000000000000000 0 0 OO Oooo 000000 0 0 00000000000000000000000 22 000000000000000000 000000000 00000000000 priority4 per 0000000000000000 Cell Loss Priority O D O O O 0000000 100000 0 00000000000000000 priority4 000000 0000000 000000000000000000000 CLP 0 priority4 pr 000000000 0000 000000000 1 90000000000000000000 0 00000 1 1000000000000000000000000000000000000 0 00000000000000 1 00000000000000000000000000 EJ GE ea ES r3 c3 3 r3
145. 000 0000000 0000 00000000000 VRRP VRRP 1 B H DDD RAUHDDDD 000000 00000000000 0000 0000000000000 00 Disable 0 HO 000000000000 Linen Subin 0 000000000000000000000001P0 00000000000 149 8 0000 842 0 000000000000000000000000000 3 3 CET Ea 1 Ooo L3 L3 L3 L3 L3 L3 r3 L3 L3 r3 L3 L3 L3 r3 0000000000000000000000 0 0 0000000000000000000000000000000000 0 0000000000000 60000000000000000 0 000000000000000000 show 000000000 0000 0 0000000000000000000000000000000 0 0 0 0 0 EE PE 1 1 C 0 00000000000000000000000000000000 0 I oL EET 121101 Go aa LJ EJ 1 Gt E HE Es ESI Ei EST SE EET 5
146. 0000 0 000000000000000000000000000 6 463 000 HDLCQOO000 000000000000000 000000000000 1 lt 0000000000000000000000 0000 5 lt 00000000000000000000 00000000000000 HDLCQoS D Bridge 000000000000000 0 000 0 000004 000000000 ridge 0000000000000000000 0 0 0 0 0 0 464 ATM I 010 Cisco 000000 PPP l Cisco 000000000 15160 000000000 Ciso 00000 900000000000 0210000000000 0000000000 0 00000000000000000000000 126610 00000000000000000 96 4 0000 0000000000000 IPH HD 0 0 0 0000000 00000000000000000000000 0 00000000000000000000 1266 1000000000000000000 0 0000 rrr 00000000000000000000000000000000000000000000 0600000000 0 000000000000000000000000000000000000000000000 00000000000000000 U 4 13 000000000000000 DLCI3 RT Xm 01011 30 4 01012 4 3 ARES DLCIA 01 11 4159 A CIE ARIZIP 2 51 CLANTZ HE 2 y 22 2 21284 EDLC 5 8 y 601012 ELANI PHS 5 2 2 TILA 6018 E G 27 2 SPTISF 50275
147. 0000 144 82 OOOO 146 821 0000000000 146 822 0000000 146 83 000000 147 83 1 000000 147 00 832 0000000000000 147 84 149 841 000000 149 842 0000000000000 150 843 150 844 000000000000 151 85 000000 152 8 6 MC 162 861 000000 162 862 162 87 0000000 163 871 000000000 163 872 163 873 0000 164 874 00000000000000 165 88 LED 0 FAULT 0 0 166 8 8 1 LED 166 8 8 2 FAULT CODE 166 89 00000000000000 167 89 1 0000 167 892 00000 167 893 00000 169 894 1101 00000000 169 8 10 0000000000000 171 8 10 1 171 8 10 2 00 172 8 10 3 DDD 172 8104 000000 172 841 0000000000000 173 8 11 1 000000000000000000000000 173 8112 000000000000000000000 173 81 3 173 812 174 4050 0000000000000 175 0000000 176 91 176 911 176 9 1 2 Tag VLAN OO LAN 00 00 vi 9 1 3 Tag VLANG 0 178 92 179 92 4 0000000 179 93 180 931 Cisco p O O O O O 180 94 181 94 4 0000000 181 942 00000
148. 0000 183 95 165 95 1 0000000 165 96 8 0 00 00000 187 961 6 187 962 80000000000000 187 97 RADIUSD 0 0000 189 971 RADIUS J D 189 972 189 1111111111 11 1111 111 O 191 101 0000000000000000000 192 1011 00000000 192 1012 000004 08 000 8000000 PPPoED ON O 192 102 0000000000000 ISDN 194 10 2 1 194 1022 0000000000000 194 1023 150000000 196 10 24 000000000 0000000000000 199 10 3 204 1031 204 1032 000000000 209 1033 00000000 210 215 00A 0000 216 000000 216 2 WAN 217 219 A4 4 1 1 1 U 219 A 5 RIP OSPF 220 BGP4 221 7 1545 221 00 8 4 222 A 9 6 222 10 RIPng OSPFv3 223 11 BGP4 223 A412 224 A 13 Diff serv 224 OOOO 224 15 SNMP 224 16 RADIUS 226 17 VRRP 226 B Acknowledgments 227 0000 245 255 vii Vol 1 DH
149. 00000 os ae Xm 1 64 11 5 188 6 E xd EL zi PEOR EE EAE SHRI KORY DIF 0 000000000000000000000000000000000000 0 00000000000000000000000000000000 400000000000000000000000 11 0 00000 0 01000 00 00 6400 0000000000000 000000000000000 MNE0000000000 00000000 009 000 0004 0 0000000000000000000 00000000000 6 1 000000 VLLOOOU 4000000000000000000000 0 0 0 0 0 0000000000000000000000000000000000000000000000 00000000000000000000000000000000000 0 0 0000 0 000000 00000000000 0000000000000000000000000000000000000000000000 000000000000000000000000 00000000000000000000000000000000000000000000 000000000000000000000000 0000000000000000000000000000000000000000000000 0000000000000000000000000000000000000000000000 0000000000000000000000000000000000000000000000 0000000000000000000000000000000000000000000000 00000000000000000000000000000000000 64 11 0000000000000 64 000000000 000000000000000000000000000 000000000 64 4 0 000000000000000000025 0000000000 00000 2 00000000000000000000 64 0 00
150. 00000 000 000 MIB 1500000000000000 pscPHuDUud 2 PVC 00000000000 MIB JDD L3 E 000 000 000 0001 Co 0000000000000000000000000000000000000 ISDN Co ooo r3 O O Ex Ez oo Co oO o UJ 0000000000 MIBOOO 000000000000000 3 0005 EX E ooo ooo ooo ooo ako L3 r3 Er 1 10 1000000000000000000000000000000000 251 0000 000000000000000000000000000000000000000 0 00000000000000000000000000000000 Co rm ooo 00g ooo 02 00000000000000000000000000000000000000000
151. 00000 0000000000000000000 D 1 19 10BASE T 100BASE TX 1000BASE X 00000000 5 NEB1G 1B NEB100 4TB 160000 4000 320kbit s 10Mbit s 320kbit s 320kbit s 0000000000000 100Mbit s 590Mbit s 0 0 0 80kbit s 808810 805530 000000000 000000 10Mbit s 0 100Mbit s 590Mbit s 0 0 0 000 000000 0 00000000 000000 000 000000 0 0 000000 10 0 00000000 Ooo 0 0 00000000 10 68 0 1 00000000000000000000 80kbits 000000 0 000 0x2 00000 2000000 29 1 0680000 00000000000000000000000000 3 D 4 0000000000000000000 gt 00000000 lt FCS O 801 00000 byte FCS O O 8bit bits 00000 s bit s 00000000000 ns 0000 16000 10000000 1600 100000000 160 1000000000 0 5 20008 00000000000000000 1 0 00 0 0 0 0000000000000000000000000000000000000000000000 0000000000000000000000 2 000000000000000 8 0 000000000000000000000000000000000000000000000 0 000000000000000000000000 1 20 0000 00000000 00000000000000000 00000000000000 0000 00000000 00000 0000000 O
152. 00000 00000000 Tag VLAN J 0 VLANID VLAN 000000 0000000000000 1 000 0000000 000000000000000 08 080 00000 0 0 0000 0 0 0 0 6000 000000 0 00000000000000000000000 3000 0000000 TCPO UDP 1 OOO 000 00000000000000000 0 0000 00000000000000000 ICMPOOO ICMPOOO 00000000 ICMPO OO 00000000 UDP 00000000000000000 000 1 0680000 0000000 00000000000000000 0 1 D IGMP OO 00000000 ICMP6 D ICMPv6 O 00000000 ICMPv6 O 0 D 00000000 000000 021000000000000000000 00000000 126 000000000000000000000 400000000000 000000 40000000000000400000000000000000000 000 DU 0000000000000000000000000 4000 CPI D 0 ICMPvOD DD 000000000000000000000000000000000000000000 0 000000000000000 958000000 4000000000 O30 IPX I IU II OOOO 12 000000525 000000000000000000 90550 00000000000 0 0000000000000000000000000000020000000000000000 0 0000000000000000000000000 1 0080000 1 4 000000000 15 m COM CHES 5882 7 0 0000000000000000000000000000000000000000000000 0 000000000000000000000000000000000000000 00000000000 e 000000000000000000000000000000000000
153. 00000 64 64 0 0000000000000 252 0 0000000000000000000 252 0 0000000000000000 252 0 000000000000000 253 000000000000000 3 00020000 41 000000000000000 3 172 262
154. 00000 1280000000000000000000 0 0000000000000000000000000000 147 8 0000 EI AES 1 111111 1 0 0000000000000000000000000000000000 e 00000 00000000000000000000 e 00000000000000000000000000000000 000000 enable GQ 000000000000000000000000000000000000 00000000000000 password 0000000000000000000000000 00000000000 148 8 0000 84 0 0000000000000000000000000000000000000000000000 0 00000000000000000000000000000 841 O00000 0000000000000000000 000000 8 3 00 0000000 000000000000000 0000000 1200000 16000000 SNMPOOOOOOOOOOOO 0000000 D 00000000000000 Line Subline 0 0 000000000000000 1000 0000000000000 000 200 0 000000 00000000000000000 2000000000 1 40 0000000000 0 0000000000 NDPO 00000000000000000 00000000000000 0 RIP OSPF BGP RIPng OSPFv3 BGP4 1515 00 00 B 000 0 D 56 00000000000 PIM DMQ 5 0 DVMRPO 160 00000000000 000000000 00000 00000000000 QoS 00000000000000000 9699000000 IPXOO 000000 0000000
155. 000000 4 000000 200000 0 0000000000000000000000000000000000000000000 0000000000 0000 0000000000000000000000000000 000000000000000000000000000000000000000000 0 0000000000000000 030 00000000000 0000 0 00 00000 00 000 1000000000 000000 00000 9 00000000000000 0 0000000000000 000000000 51500 00000 98000000000000000000000000000 000000 e 10000 00 00000000100 0 000000000000000000000 6 0000000000000 0000600 0 000000000000000000000000000000000000000000000 0000 10000000000000000000000000000000000000 050000 0 0000000000000000000000000000000000000000000000 00000 1 22 00000000000 000000 5 00 00000 1000 0 Wy 2 2 00000 0 0000000000000000000000000000000 7200000000000 0 0000000000000000000 0 00000000000000000000000000000000000000000000 0 00000000000000000000000 2 0000000000000000000 34 1 0 0000000000000000000000000000000000000000 0 0000000000000000000 5 C ooo 0 0000000000000000000000 oo o El 5 5 0 0000000000000000000000000000000 Oo 0 0 0 0 0 0 0 0 0 5 9 Ooo ooo 0 0 0 0 0 0 0 0 0 0 0 0 0 Oooo 0 0 0 0 0 000 1 100000 10420000000 AMAD 00000000000000000000000000
156. 000000 SNMP 57 FE ARS aK RR Ez URS 3 F TCP IPz F7 27 SNMP 6 1 2 SNMP UH D U 118 0000 00000000000000000000000000000000000000 0000000000000000000000000000 MBManagement Information Base 0 0 OOOO 8 000000000000000000000000000 0 00000000000000000000000000000000000000 138000000 00000000 6 2 ARE SWMPI Zrzk SNMP 57 E T C 414 xxw 0 0 6 5 80000000000000000000000 JP1 Cm2 Network Node Manager 0 5 00 5 NMPvi RFC1157 O D 0019 0000000000 SNMP O O O 0000000000000 SNMPvVIO Trap 00000000000 00000000000 00 0 000000000000000000000000000000000000060 0 00000000000000000 92 00000000000000 SNMPOOOOOO 0 0000000000000000000000000000000000000000000 0 0000000000000000000000000000 0 0 0 0 0 0 ET ESI 0 0 0 0 0 Ez EET E EG EI OO r3 0 0 0 0 0 0 0 0 0 0 0 OOo OO ooo
157. 000000 249 0000000000 9 00 000000000000000000000 21 000 146 19 000000 kbit s O 19 000000000000 250 68 000000000000 82 00000000 129 72 9 0000000000000 28 0 000000000000000000 0 00000000000 145 OOOO 167 00000012 0000000 67 8 0000000000000 205 192 192 0000 149 000000000000 55 205 0 0000000000000000 209 0 000000000000000 210 149 00000000000 150 151 000000000000000 250 0000000000000 150 00000000000 201 000000 21 0 000000000000000 127 00000 145 0 00000000000000000000 173 00000000 0000000 205 0000000000000 209 0000000000 000000000 205 0 000000000000000000000 209 18 00000 250 18 0000 202 00 146 85 85 00 111 RPOOOOOOO 77 5 78 0000000 00000000000 250 12 000000 250 000 103 109 00000 171 171 00000 201 800000 137 000000 79 0 0 0 0 0 0 4 1 EM EE EFE 0 0 0 0 0 0 0 0
158. 00000000 U 8 e NextHop 0 0000000 ASOO BGPOOOOOOOOOOOOOOO NEXT OOOO 6 0 000000000000000000000000000000000000000000000 000 NEXT_HOPQOO 19 0000000000000000000 NEXT HOPOOOOOO 0 00000000000000000000000 1620000 NEXT 0 000000000000000 Next D U B bgp U J J resolve nexthop al 00000000000 Next Hop 0 000000000 Net 000000000 500000000 000 00000 9 2 Next _ tE IGPIz amp 2T lan lachta LTLI 182 9 0000000 U 90 0000000000 0000000000000000000 580 0000000000000 82615880 000000 0 0000000000000000000000000 0000 4 50000000000000000000000 000000000 1247 0 00 D 15830 0000000000000 00000000000000000000000000000 158300 000000 00000000000000000000000000000000000 00000000000 000000000000000000000000000000000000000000000 0 0000000000000000000000000000000000000000000 1583 0000000000000000000000000000000000000000 0 00000000000000000000000000 8 1588000000000000000 0 0000000000000 RFC12470 00 94 2 0000000 81 10000000000
159. 00000000 e Cisco UU U 0 000000000000000000000000000000000000000 00000000000000000000000000000000000000000000000 00000000 00000000000 00000000000000000000000000 000000000 000000 000000000000 00 81 100000000000000 00000000000000000000000000000 0000000000000000 0000000000000 000000000000000000 Voll 10 4 3 3 IP 0 D 00000000000 8 00000000000000000 1860 00000 10000000000000000000000000000000000 00000000000000000000000000000000000000000000000 00000000000000000000000000000000000000000000000 000000000000000000000000000000000 00000000000000000000000000000000000000000000000 0000000 aggregate OOO noinstall 00 00000000000 noinstal 0 00000 0000000000000000 183 9 0000000 9 3 noinstall O 00000000000 192 168 11 64 28 X24 Hg 192 168 10 0 24 1 192 168 11 28 192 168 11 0 24 TRESS 1 A Tuy gt 192 168 11 0 9 2 192 168 10 0 RIPE U RATA ITER CHE 7 TOEIC 8192 168 11 0 24 A 8 192 168 11 64 2858 COD P F 655 5 TL 12192 168 11 64 28 lt TITI FREE CEMEG tt 5425518 184 9 0000000 9 5 D DU U EH 9 9 5 1 0000000
160. 00000000 0 0 0 0 00000000000000000000000000 0000000 2000000000000 0 0000000000000000000000000000000000000000000000 Periodic O D 00000000000000000000000 78 3 00000000000000000000 Forward 00000000000000000000000000000 0 0000000000000000000000000000000000000000000000 0 0000000000000000000000000000000000000000000000 0 0000000000000000000000000000000000000000000 cO NETBIOS OOO 0000012 000000000 8 0 0000000000000000000000000 0000000 3 6 3 01000000000000 00000000000 000000000000000000000000000000000 0000000000000000000 0000000000 e 0000000000000000000 e 000000000000000000000000 000000000 12 0000000000000000000000000 2176100000000 0 0000000000000000000000000000000000000000000000 0000000000 2 lt 1000000000000000000002 00000000000 000000000 00000000000000000000000000000000 3 11 0000000000000 2vL 4AUv f lt DLCI a 2247L2Fk 8 AA EE 29427 FLA 8 2 Oxbbbbbbbbbbbb DLCI b 22 X X Oxbbbbbbb
161. 00000000 247 218 247 Trap 130 96810 00000 248 950000 2 9550000 1 0000000000000 000000 38 681111111 1 01 1 0 0 37 000000000 87 9981 0 31 9050000 4 9550000000000 42 000000 2 9980000000 3 95000000000 31 85000000000 35 R RADIUS 136 RADIUS 136 RADIUSO 0000000000 140 RADIUSO 0000000000 189 00 0000 189 189 189 0000000 189 RADIUSG OOOO 135 141 0 00000 137 RADIUSOOOOOOOOOOOO 226 137 0 00000 139 248 1588 0 0000000000 8 1 1 0000000 183 000000000 220 RIPO 00000 248 RIPng OSPFv30 000000000 223 RIPng 00000 248 8 00 77 67 67 75 67 RM0 00000 8 RMON 248 RMON MIB 134 00000 248 95500000 42 71 SAP 78 71 70 0 000000000000000000 72 71 69 70 74 Set
162. 00000000 245 3 8 U UU 6 DSCPO OOO 9 pscPOOOOOOOOOOOOO 54 180000 46 80000000000 6 08000000 DSCP 48 DVMRP UU 246 E event 134 F FAULT CODE 166 08 00000 246 frping 000 179 G GetBulkRequest 000000 124 GetNextRequest O OU UU 123 GetRequest O00000 122 Groupp 0000000000 80 H 96 history 0 0 00 134 ICMP 0000 246 ICMPv60 0 00 0 246 1 3 4 000 00 246 MIB I 0000 00 119 4 00000 246 IPvej OO UU D 246 255 00 IPv6 0000000000 246 6 223 0 0 00 0000 0 6 000000000000000 246 IPV6QN0000U00000000000 222 224 1 6 0 0000000000000 000 246 185 0 0 246 62 62 59 68 60 61 127 1 40000000000 219 POOOOO 5 5
163. 000000000 000000000000000000000 10000000000000000000000 000000000000000000 00000000000000000000 48 MACOOOOOOOOOOOGO DA SA z On DA6 34 F 5 6 4 KONA FTEIC Ey 5 89 4 0000 45 IU D D D LI 451 00000000000000000000000000000000000000000000000 300 00000000000000000000000000000000000000000000 000000 SPT 000000000000000000000000000000000000 Bridge 0 00000000000000000000000000000000000000 Not Bridge 0 0000000000000000000000 0 0000000000000000000000000000000000000000000000 0 00000000000000000 49 00000000000000000000 pIJ VIULFFORIAIL 0 00000000000000000000000000000000000000000 0000000 00000000000000000000000000000000 0 00000000000000000 0 0000000000000000000000000000000000000000 00000000000 Not Bridge 000000 Not Bridge 0000000000000 E Oooo Oooo 452 0100000000000000000 0 0000000000000000000000000000000000000000000000 90 4 0000 000000 0 0000 00000000 000000000000000000000 0 00000000000000000000000000000 0 00000000000000000000000000000000000 0 0000000000000 1 00000000000000000000
164. 000000000 0 00000000000000000000000000 00000000 13000000000000000000 lt 5 9000000000000 174 050 00000000000000 1111 1 0000000000000000000000000000000000 000 91 0000000000000 92 93 94 9 5 6 111 1 1 U 96 SNMPOOOOOOOOO 9 7 RADIUS 1 B DB 1 D 175 9 0000000 9 1 111 CEU EE EE D D 911 000000000600 000000000000000000000000000000000000 10 10BASE T 100BASE TX 0 0000000000000000000000000000000000000000000000 00000000000 e 1 100 0000000000000000 e 1 000 00000 0000 00 0 0 00 00 00 00 0000 20 1000BASE SX 1000BASE LX 1000BASE LH 0 00000000000000000000000000000 O30 1 11 U 10BASE T 100BASE TX 1000 1000BASE LX 1000BASE LH 0 000000000000000000000000000000000000000 IEEE802 3u 0 0000000000000000000000000000000000000000000000 0 0000000000000000000000000000000000000000000000 0 0000000000000000000000000000000000 0 00000000000000000000000000000000000000000000000 0 0000000000000000000000000000000000000000000000 0 000000000000000000000000000 E4 LINELAN LINE X 41000201 1350 XXXXXXXXXXXX The interface faild in aut
165. 000000000 0 0000000000000000000000000000000000000000000000 000000000000000000000000000000 00000000000 0 000000000000000000000000000000000 RMON JP1 Cm2 HP 0 0 0 RMON 0 000000000000000 8 9 0 00000000000 8 9 000000000000 0 000000000000000000000000000000000000 RADIUS LU 00000 00000 7 1 RADIUS 72 5 0000000000 73 RADIUSOOOO000 74 0000000000000 135 7 000 7 1 RADIUS RADIUS Remote Authentication Dial In User Service 0 NAS Network Access Server 0 OOOO 000000000000000000 NASO 00 0000 00 0000 0 0 00000 0000000000000000000 00000000 00000 000 0000 00000000000000000000000000 0 000000000000000000000000 RADIUS 00000000 00000000 000000000000000000 0 000000000000000000000000000000 8459 0 00000000000 000000 85 000 000000000000 7 1 RADIUS 00000 5 7 2 2 FIER HINGE 1 J E FE
166. 000000000 FEO 00000 0 0000000 00000 0808 200000000000 0000000000 5 0000 0000000000000000000000000 06000000000 00000000000 0 000000000000000 call reference length 0 0 0000000000 200000000000000000000 00 00000 call reference length 0000000000000000000000000000000000000 0 00000000000000000 000000000000 7 00000000000000000000000000000000000000 00000 call reference length 00000000000000000000000000000 0x4 OOOO lne D OOO interfaceid QOO0000 Donon 107 00000000000 200 10 00000000000000 10 9 0000000000000 0000 0000 000 00000 BMOD ModeA ModeB ModeA 0000000 Single Dual Single 0000000 SLOW Fast Slow Fast 0000 DISC Off On Off 0000000000 000 000010000 000000000000000000000000000000 00000 0000000000 000000000000000000000000000000000000 0 isdn ppp O 0 OO 000 channel 0 0 hig 1536kbit 9 0 0000000 2400 000000000000000000000000000000000000 ISDN 00000000000000
167. 000000000 122 000000 0 9800000 00000000 200000000000000000 123 0000000 Qos 00000 000000 0000000 1 22 9500000 00000000 1000 0000 6680 0000000 0000000 000 9800 00000 00000 0000 0000 00000000000 0000 9800 00000 nooo 0000 DscPOO OOD 1 23 99500000 000000 OOOO QoS O 00000000 000000 10000 0 0 9500 00000 00000 1000 0000 00000000000 0000 8 00000 pscPgo gogo 0 00000 000000000 so 00000 0 00000 00000 000000000 nooo 0000 9080 D 00000000000 0 0000000000 000000000 so 0000 00000000 1 008000 1 10 DD D D E U U L 1 10 1 0000000 95 00000000000000000000000000000000000000 1 24 0000000 00000600 000000 WAN ATM in out in out in out 0003 00000 O O O soo d Onno Ono no m oo ood Q nog L3 L3 L3 OO m OO m 0000 un Q OOOO 1 1 1 1 1 1 1 O O O O 0000 0 0 00000 0000 CE L3 L3 LAILIIID LJITLIT ad EE J
168. 000000000 temeti 00 00 00000000000 RADIUSD 00 00 0000 00 0 0 00000 0 0000000000000000000000000000000000000000000000 0000000 U 20 000000 RADIUS 00000000000000000000000000000000000000000 0 0000000000000000000000 005000000000000000000000000000000000000 500000 5 000000000000000000000000000000000000000 00000 2000000000000000000 8459 0 000000000000000 0000000 0 0 0 00000000000 RADIUSQ OOOO 0 0000000000000 0 0 0 0 139 7 000 140 D 73 RADUSOOOOOOOOOOO J ARE RADIUSS 1 RAD USH 7 2 Telent m 4 RAD K 8 LT Roa e n4 RAD IUSEZEIE 8 38 0000000000000000000 telnet 0 0 00000 RADIUSQOO 100000000 RADIUS 0 0000000 RADIUSQOO 0000000000000000 RADIUSIJ DU 20 000 00 00000 00000 0000 00 0 0 00 00 0 0 00 00 00 00 0000 7 RADIUST OOOO 0000000000000 74 00000 00000 5 0000000000000000000000 0000000 200000000 0000000000000 0 0000000000000000 RADIUS RADIUS dduser 0 oo oOo 23 000 000 r emote user D D D D D D 0000000000000 CE Es L3
169. 0000000000 77 3 00000 50000000 100000 1000 0 0 0 200000000000 U 20 SAP 00000 12 000000000000000000 000000 000000 000000 0 00 00000000000000000000 5 00000000000000000000 000000 SAPO 100000000000000000000000000000 OOO 5 000000000000000000 0000 0000000 000000000 000 o oo gt 3 pin Enn oo UU ULL oo 1 Ea E EE Ea 0 0 0 0 L3 000000 000000000 0 0000000000000000000000000000000000 OO 19000000000000000000 0 000000000000000000 5 00000000000 0000 0000 0000 0000 0000 0000 0000 SO T E NEE aoe pjE EL 0000000000 0 10000 480000 n 000000 saed 0000 00000 7000000 100000 1000 00 0 1430000000000 NetWare4 1J 00000 e 0000000000000000000000000000000000000000 0000000000000000000000 e 000000000000000000000000000000015 000000000 0000000000000 031 00000000000 000000000000000000000000 00000000000 e 00000000000000 e 00000000000000 e NETBIOS 0 0 000000000000000000000000000000 000
170. 0000000000 0 00000000000000000000000000 0 0000000000000000 0 00000000000000000000000000 2 11000000000000000000000000 0000000000000 000000 000000 000000 000000 ETE Ey Eel L 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 Lr Ooo 0 0 0 0 0 0 Ea ESEIE EI ESI AA 18 16 2 x X 01000000000000000000 000000 10000000 200000000000 0000 100000 200000000 00000000 10 100000000 20 20000000000000000000000 0000 1 ES1 000000000 s2000000000000000000 100000 20000000 00000000 5810 200000000000000000000000000000000 00000000000000 58900 1000 2000000000000000000 00000 2 100000 10000000 10000 0000000000 000000000 FDBDD 1000000 1200000000 200000000 000000000000000 200 OOOO 0000000 3 2 51 000000000000000000000000 0210000000000 0000000000 000000000000000000000000000000000000 0 00000000000000 100000 20000000000000000000 10000 0 0000000000000000600000 2000000000000000 20000000 84 4 0000 000000000 1 0000000 20000000000000 100000 20000000000000000000000000 10000000 200 00000000000 58 00000000000000000000 2800000000000 000000000000 10000000000000000000000000 000000 0
171. 0000000000 LAND 0000 VLAN 0000000000000 200000000000000000000 0 00000000000000000000 17 9 0000000 D 9 1 000 1 00000000000000 So SS Seb Lu UM M MM MR MR CR 0 28 LANA F FEE 1 4 272 3P LANA 4 PERES VLAN 10 1 VLAN 10 1 AY 8 VLAN2 LANA YF ER VLAN 10 2 VLAN 10 2 t aH Ru uL LE LEE Tag U 188 0 91 000 VLANG OOO LANDO00000 gt 0000000000 1200000 0 0000000000000000000 2000000000000000 Static 0 1 0 0 0 0 0 VLAN D0 ARP Static 000 VLAN 2000000000000000 00000000 0000000 000000 0000000000000000000000000000000000000 ooo 000000000000000 OO Lr 3 9 1 3 Tag VLAN PC 0000 Tag VLAN 000000000000000000000 e Tag VLAN I O PCO Tag 00000 e Layer2 OOOO Tag VLANQ 8 0000000000000 VEAN D D OOOO 2 178 9 0000000
172. 00000000000 26 1 008000 6 D 1 17 6 0000000 6 000000000 0000000 gt 0000000000 O DscPOOOOdO 000000 8 0000000 6411 000000000 1 18 D NIF 0 00 10BASE T 100BASE TX NEB100 1TC 640000 00000000000 4000 100000000000 320kbit s 10Mbit s 320kbit s 100Mbit s 1111111101 11 1 0000000000000 6 1 0000000000000 2 80kbit s 10Mbit s 80kbit s 100Mbit s 3 1 5 3 AE 0000000000 T 00000 0 1 000000000000000000000000 00000 6000000000000000 000 0 200000 0 0 0000060 1 000000000000000000000000000 1000000000000000000 U D 2 00000 2000000 000000000000000000000000 11 00000000000000 1 4 650000 Tag VLAN 000000000000000000000000000 65000 TagVLAN 000000000 11 000000000000000 0x5 000
173. 00000000000 00000 000x30 10000000000 00000000000000000000000000000000000 00000000 100 5 VRRP 0 0000000000000 Macppuunpnpauauapnnauudd 0000 0000 00 00 5 00 01 00000 000000000000000 200 0 0000000000000000000000 000000000000000000000 0 000000000000000000000000000000000000000 00000000000000 0000000000000 0 00000000000000000000000000000000 200000000000000000000000 0 0000000000000000000 5 1 0000000 KIDP IF JV 2 10 7 ORES 6 XHEL iR 00 00 5E 00 01 070 2 LL A 00000000000000000000000000000000000 00000000000000000 0 51 0000000000000000000000 00000 00000000000 2 000000000000000000000000000 1200000 000000 000000000000000000000 0 00 OO ARPOOOOO 2 00000000 ARPOOOOO NDPHODUD 000000 101 5 VRRP 102 D 92 DD NDP O O OARA A927 192 168
174. 00000000000 251 000000000 183 0000 146 0000000000 146 1 4 96 77 0000 177 000000000 0000000000 202 e 164 9 163 129 0000 260 00000 251 129 119 129 5 L3 L3 L3 L3 L3 0000000 251 00 251 00000 3 2 83 251 0000000 L3 L3 000 000 000 000 000 000 A LJ L3 L3 L3 L3 L3 L3 L3 L3 L3 L3 L3 L3 87 sani as Ip ELT Ea ELT aq ETT ETE E ELE Oa ELT EST 3 E23 ET ng 000000000 139 000 61 118 VRRP 112 000000 167 00000 0000000 77 0000000000 95 OOO 46 m 2 CJ E E3 malun 05 2 CJ E Eb EIE iE CJ C E3 cai ooo 00000000 7 0000000 60 0000000000000 251 000000000 251 00000000000 0 5 9
175. 00000000000 m 146 000000 1461 000000000 440 1462 000000 14 7 0000000 449 1471 000000000 55 1472 000000 439 1473 430 14 7 4 Hash U U 43 1475 000000000000000 391 148 452 149 IPv6 DHCP 0 0 0 0 1491 000000 285 1492 0000 14 14 9 3 0000000000000 436 14 94 457 14 10 158 14 101 458 14102 460 14 10 3 NAPT PT 460 14 104 NAPT PT 461 14 10 5 ALG 463 14106 466 1411 0000 T 14 11 1 IPv6 over IPv4 000 472 14 11 2 IPv4 over IPv6 O00 472 xvii 00 xviii 14 11 3 6to4 1 lI 473 14114 00000000000000 474 14 12 RA 481 14121 81 14122 8 000000 484 14 13 0000000 RIPng OSPFv3 487 151 IPv6 0000 488 1511 0000000000000000000000000 488 15 1 2 D 488 1543 000000000000000000 488 152 000000000000 489 1521 000000 ae 1522 000000000 T 1523 0000000000000000 490 15 3 0 RIPng OSPFv3 491 1531 000000000000 491 1532 00000000000 RIPng OSPFv3 492 1533 00000000000000000000000 000 0 0 D RIPngOSPFv3 492 1534 00000000 de 154 RIPng 494 15 4 1 RIPng OO 494 1542 0000000000 1543
176. 000000000000 16450000000000000000000 00000000000 auth 00000 16450 000000000 port 000000 10 655350 0000000000000 000 0000 00 000 0 0000 00 0 0000 000000 U auth pot 000000000000000000000000000000 Vol 2 9 0 0000000000 189 11 11 1 1 11 111 1 11 1 1 LE 1 111 111111 00000000000 101 0000000000000000000 102 00000000000 ISDN 103 191 10 000000000000000 TOT 1111111111111411101114111111111114111 0 000000000000000000000000000 10 1 1 00000000 SES EI ES 0000000000000000000000 0 000000000000000000000 0 000000000000000000000 0 000000000000000000000 0 000000000000000000000 0 10 12 ADSL I 11 000000 PPPoE I J 010000000 000000000 0000000000000 D 10 1 000000000 D D 000000 00000000000000 1 ADSL 1 5M 00 ADSL OO 8 1 00 ADSL DD 00 0000000 100 ONU 00000000 ONU 00000000 ONU ONU 000000000000 ADSLOOOO 9 90000000000000000000000000 0 0000000000000000 192 10 00000000000000 0210000000000 00
177. 0000000000000 0 0000000000000000000000000000000000000000000 0 0000000000000000000000000000000000000000000 00000000 1 9 2 5111111 00 9981 101 0 950000000 95000000000000 85000 30 0000000000000 e100 0 00000000000000000000000000 95 0000000000000000 0 0000000000000000000000000000000 9950 0000000000 0000000000000000 0 00000000000000000000000 telnet http 0 0000000000000 0 00000000000000 95 000000000000000000000000000 0000000000000 9555000000000 95 00000000000000000000 0 0000000000000000000000000000000000000000000 oesnt 0 000000000000000 95 000000000000000000000000000 0000000 0 000000000000000000000000 8 0000 Qos 0 00000000000 95 0000000000000000000000000000 9500 0 0000000000000000000000 0000000000000 2 5 00000000000000 9500000600 0000000000 2 000000000000000000000000000000000 0 00000000000000000000000000 95 0000000000000000 pscenpn g 950 000000000 000000000000 95500000000 0000000 95 00000000000000 35 1 36 9050000 U 1 23 0000000 95 0000 B EI ARE KEE 592 8 9 1 0 9 gt lt gt SLA ILS If gt FI Eidos Hi 6 5 5 5 5 5 0 0000000000000000 9550000000000
178. 000000000000000 0 0000000000000000000 0 0000000000000000000000000000000000 0000 0 000000000000000000000000000000000000 00000000 O20 000000000000000000000000000000 0 0000000000000000000000000000000000000000000000 00000000000 0000000000000000000000000000000000 0000000000 0000000000000 0000000000000 show spanningtree 0000000000000000000000000000000000 0 0000000000000000000000000000000000000000000000 0 0000000000000000000000000000000000000000000000 000000000000000000000000000000000000000 00000 000000000 O40 0000000000000 restart bridge JO 0000000000000000000000000000000000000 0 0000000000000000000000000000000000000000000000 0 0000000000000000000000000000000000000000000000 0 0000000000000000000000000000000000000000000000 0000000000000000000000 050 0000 L3 L3 L3 L3 L3 L3 L3 L3 L3 EST EST ESI L3 L3 L3 L3 L3 CJ L3 L3 L3 L3 L3 oD L3 L3 L3 L3 L3 L3 L3 L3 L3 L3 L3 L3 L3 L3 L3 L3 L3 L3 L3 L3 L3 L3 L3 L3 L3 00000000000000000000000000000000000000000000000 000 EEE802 0000000000000000000000000000000000000 0 0000000000000
179. 000000000000000 0 4 5 00000000000000000000000000000 Wan Translation Yes gt BE d 6 532 551 87 4 0000 0000000000000000000000000000000000000 55100000 0 00000000000000000000000000000 200000000000 0 00000000000000000 FDDI 000000000000000000000000000000000000 ES2D0 000 442 HTH 000 Hui HH 88 00000000000000000000000000 000000000 20 0 0 00 0 FDDI gt 0000000000000000000 e 000000000 200 0 FDDI gt IEEE802300 00000000000 4 7 000000000 FDDI 802 3 0 0000 46 000000000 FDDI 00000 din ik FDDIOFCHRILADNS 47 000000000 FDDI gt IEEE802 3 SNAP m SNAP FDDIOFC 351216 8 32 3 DAE RE 6 41 U OO FDDILI DSAP SSAP OUI PID 0x000000 Ox80f3 802 3 0 0x80f3 0 0000000 0x0000f8 Ox80f3 0000000 0x80f3 0 0000000 ooo 802 3 000 802 3 4 0000 000000 443 FbbIiDuunuugnuunuuanuaunugapnuanudapnguanadnpadn utdbl tgDDIr pu 0 0000000000000000000000000000000000000000000000 000000000 2510
180. 0000000000000000 lt 00000000 gt 00000 FCS 8 10 0 00000 FCS O 8bit O D bit s 000000000000 s 27 1 0680000 0000 bit s 00000000000 ns 10000000 16000 100000000 1600 1000000000 160 0 000000000000000000 000000 000000 6 O 7 000000000000000 0000000000000000000000000 200000000 000000000 1 8 7 0 0000000000000000000000000000000000000000000000 0 0000000000000000000000000000000000000000000000 0 000000000000000000000000000000000000000000000 0 0000000000000000000 00000000000 1 18 584 RY XB 2310 3C 212 27 7 27982 ENENOT IL FIA CT ESI ET EXEADOI 975 22 2 OSHA Jv Fat MIT 5 0 00 00 00 AB EAR 8 IPE 5 88 8 01000000000000 0 00000000000000000000 28 1 008000 D 1 9 00000000000 v IP ELA 7 28 Fa 110 BREED F Z C ia eis n Ex Es 0 000000000000000000000000000000000000000000000 0 00000000001000000000000000000000000000020000 0 0000000000000000000000000000000000000000000000 00000000 O20 00000000000 0 00000000
181. 00000000000000000 0 5 1 OOO 1 1 1 1 Co Co Co OSPFI OOO 1 0000 00000000000 0 00000000000000000000 Per Hop Behavior 00000 PIM DM Protoco DVMRP 0000 sPviOOOOOOOOOOOOOOOOOOOOOOOOOOOA Independent Multicast Dense Mode 0000000000000000000000 PIM SM Protoco DVMRP 0000 Independent Multicast Sparse 000000000000000 12 40000000000000000000000000000 00000000000000000000 Shortest path 0 000000 PIM SSM Protocol Independent Multicast Source Specific Multicast 5 0000000000000000000000000000000000000000000 Point to Point Protocol 00000000000000000000000000000 0 BOUND PPP over Ethernet 0 0000 PPPoE PVC Permanent Virtual Channel Connection Permanent Virtual Circuit 0000000000000 247 0000 QoS Quality of Service 0000000000000000000000000000000000000000000000000 RFC Request For Comments
182. 000000000000000000 0000000000000000000000000000000000 000000000 0 000000000000000000000000000000000 203 10 000000000000000 10 3 000000000 00000000000000 D 10 11 00000 000 00 000000 EJ O 0 5Mbit s 00000000 0000 11000000000 135Mbit s 0 0000000 00000000 2 02 5 5 5 3 5 5 T o 3 2 5 5 oooos ET 0000000 CR CBR gt J 3 wo 9 Do 6kbit s 10Mbit uo 5 x C VBR SCR 16kbit s 6Mbit s x0 x0 PCR 16kbit s 48Mbit s 0 PCR 1680168 10Mbit 0 D 0 00000000 000 000000 000 880 00 00 000 38kbit s 149760kbit s 16kbit s O 0000000 00000000 1 0000000000 0 2 0000000000000000000000000000000000000000000000000 0000000000000000 0 30000000000000000000000 0 3 00000000000 00 10 3 1 1 000000000000 000000000000000000000000 000000
183. 000000000000000000 8200000 00000000000000 0000 1 6 000 5 00000000 1240000000000 17 0000000000 12 400000000000 0x6 980 00000000000000000000000000000 4000000 00 O 7 0000000000000 6410000000 000186 0000 00000000 000000000060 0500000000000 0 00000000000000000000000000000000000000000000000 17 DO LI LU 0 0000000000000000000000000000000000000000000000 0 0000000000000000000000000000000000000000000000 0 00000000000000 95800000000 0 0000000000000000000000000000000000000000000000 119 0000000000000000000000000000000000000 0 0000000000000000000000000000000000000000000000 00000 COR CHARS 588282 D BRE ERA 7 3 0 0000000000000000000000000000000000000000000000 000000000000000000000000000 00000000000000000 OOO 00000000000000000000000000000000000 0 00000000000000000000000000 0 0 000000000000000000000000000000000000000000 80 0 0000000000000 e 000000000 1000 8 e 000000000 2000 9 8 e 000000000 3000 8 000000000 4000 8 0 000000000000000000000000 6 8000000000000000000 300000000000002000000000000000000000000 00000000 1 0
184. 0000000000000000000 0 0 000009000000 4 20008 000000000000000000 00000000000 DBCU J O00 90000000 440000000000000000 000000000000000000 100BASE FX 0000000000 J26 3Mbit s Q T30 El E30 OC 3q OC 12c 00 486 O subline O O 0 0 0 0 0 000 8000 0 80 0000 00000000000 0 AUXOOOOOOC000000 70000000 20008 0000000000000000000 ClLigdd 1000000000000000 CLIQOO 100000000000000000 1111 111111 1111 11 U 00000000000000000000 0000000000000 0 000000000000000000000000000000 11111 11111 AX2000R 0 0000000000 00000 91190 8 1 2000000000 2000 0 0000000000 000 1 20000000000000000000000000 010 QoS 2000 i 0 0000 955000 0000 020 0000000000 00000000000000000000000 000000000 0000000000 0000000000000000000000000000000000 000 Acknowledgments Acknowledgments 00000000 000 0000 0 000000000000000000000000000 0000 mI ll 000000000000000000000000000000 Ano zv n
185. 0000000000000000000000 0000000000000000000000000 0000 000000000000000000000001000000 1000000000000000000000 00000000000000000000000000 25 lt 00000000000000000 000000000000000 249 0000 000000 000 0000 e ETE 0000000000000000000000000000 1 1 02 oOo oOo O 00g oo oo ooo oo oOo oOo oOo oOo oOo oOo oOo oo oo 000000000000000000000000000000 00000000000 000000000000000000000 000000000000000000000000000000000 0 3 3 63 53 3 E tz ee Seg OOO OOOO a p go o0 OOO OOOO OOO OOOO OOO OOOO 51 geo L3 oo L3 L3 L3 pu L3 0000000000000000000000000000000000000 000 000 000 0 ooo 000 000 000 000 L3 m 1 IPv6 D 0 0 0 000000000000000000000000000000000000000000000000000 000000 0 0000000000000000000000000
186. 00000000000000000000000 0000000000000 0000 2400 0000000000000 000 000000000000000 000000000 Tap 18 0000000000000 000 00000000000000 0000000000000000000 0000000000 17010006 00000000000 The connection has been terminated via peer s request Make the peer router open the connection if you need it PPP O U O D ugggggggggggguggudgpeagggagagagagagagagagagaggau 00000 00000000000000000000000 000000000 0000 0000 2400 0000000000000 080 000000000000000 0000000000000 000000000000000000000 0 0000000000000000000000000000000000000 Slow 0000000 0 00 0000000000000000000000 000000000000000000000 0000 0000000000000000 5 000000000000000000000000000000000000000000 000000000000000 0000000000000 0 0 00000000M 0000000000 000000000 Sow0 00000000 TATSDNOOOO 000000000000000 0 0 0 000000000000000000000000000 0000 20000000000 00000 1 5 0000000000000000000000000000000 000000 155940 000000000000000000000000000000 0000000000000000000000 9 5 000000000000 0000 0000000000000000000000000000000000 000 2000000 201 10 000000000000000 000000000 0000 000000000
187. 00000000000000000000000 0 000000000000000000000000000000015 000000000000 0 00000000000000000000000000000000000000000 U 10 0000000000 Diffserv 0000000000000 2500 00000 00000 250000000000000 2 0 0000000000000000000000000000000000000000000000 0000000000000 00000000000000000000000000000 0 00000000000000000000 000000000000000000000000000000000 DSCPD 0 0000000000000000000000000000000000000000000000 0000000000000000000000000000 25 000000000000000 0 0000000000000000000000000000000000000000000000 0 0000000000000000000000 000000000000000000000000000000 02 56 0000000000000 0000000000000 PHB Per Hop Behavior 0 O J O O Diffserv 00000000000000 46 2 Diff serv 0 2 1 Diff serv 0 0 00 91 58 822959888 EEL EAN EELS DAR 25 DIR 22A 80 0 021 0000000000000000000000 0 000000000000000000 Diffserv 0000000000000 00000000000 0000000000000000000000000 25 00000000000 00000 0000 25000000 25 00000000000000000000 DSCP 9 0000000000000000000000 0000000000 0000000000000000 25 lt 00000000000000000 00000000000000000000000000000000 4 1 Ooo
188. 000000000000000000000000 0 00000000000000000000000000000000000 86000000000 0 00000000000000 statistics 0 00000000000000000000000000 0 0000000000000000000000000000000000000000000000 000000000 20 history O O 00 statistics 00000000000000000000000000000000000000000 history 0000 O historyControlTable 0000000000 etherHistoryTable 00000000 00000000 historyControlTable 0000000000000000000000 MBOOO etherHistoryTable Ql 00 000000000000000 l history 00000000 O 30 alarm 000000 800000000000000000000 8000000000000000 0 00000000000000000000000 8 1 0000000000000000000000 500000000000000000 0000 1900000000000000000000 00000000000000000 0000 0 event event 00000 alarmQ 00000000 O eventTable 000 80000000000000000 000 eventTableQ 0 00 0 00000000000000000000000000000 logTable 00 0 MIB eventTableQ 0 00 0000000000000
189. 00000000000000000000000000 0000000000 0 000000000000000000000000000000000000000000000000000 00000000 000000000000000000000000000000 00000000000000000000000000000 1260000000000000000000 00 0000000 000000000000000000000000000000000000000000000000 000000000000000000000000000000000 000000000 0000 000 000 000 250 E 00000000000000000000000000000000000000000000000000 00000000 000000000000000000000000000000000000000000000000000 000 0 0000000000000000 0000 10000000000000000000000000000000 0000 0000000 SNMPOOOOOOOOOOOOOOOOOOOOOOOO 0000000000000000000000000000000000000000000000000000 0 0000000000000000 CBR VBR ABR UBRO 2 0000 000 00000000000000000000000000000000000000000000000000000 00000000000000000000000000000000000000000000000000000 0000000000000000 0000000 000 100000000000000000000000000
190. 0000000000000000000000000000 0 0000000000000000000000000000000000000000000000 00000000000000000 955000000000000000000000 1 0680000 1 2 QoS ll LI LH LH 0000 95 0000000000000000 D 1 3 000000000 0 00000000000000000000000 1 2 000000000 000000 0000 00000 00000000 2000000000000000000000000000000 0000 1 00 080 0 000000000000000000000000 00000 000000000000000000000000000000000000000000 0000 000000000000000000000000000000000000000000 0000 000000000000000000000000000000000000000000 0 000000000000000000000000 1 9080000 13 00100 00000000000000000000000 120000 000000000000000 0000000 0 00000000000000000000000000 1 4 0000000000 ABD Coca eiie n O10 PDmDmau 0000 955000000 IP 0 00000000000000000000000000012000000000000000000 000000 1 3 00 00 00 00 00
191. 0000000000000000000000000000 Critical Interface 0 0 0 00000000000000000 Critical Priority 00000000000 Down Priority 0 0 0 000000000000000000000000000000000 0000000000000000000 600000000000000000000000 9000000000000000 00000000000000000 00000 0000 00000 103 5 VRRP 5 4 VRRP I I 0 0000000000000000000000000000000000000000000000 0 0000000000000000000000000000000000000000000000 U 0 000000000000000000000000000000 88 0000000000000 0 000000000000000000000 5 4 0000000000000000000000 05586184 YI 2 VRRP F 17 VIER 20 20 ARE KEE 22 2 Y A4 ud gt 4252r AR 2 T BE RE EHET gt 5 PC PC EchoRequest EchoReply 5 4 1 VRRP 1 U 1 U 00000000000000000 120000000 000000000 0000000000000000 U ICMP 00000 0000000000 1 0 0000 0 0000000000000 0000000000000 2 000000000000000000000000000000000 0 00000000000000000000000000000000 0000000000 0000 104 5 VRRP 55 Pointi 192 168 80 1 24 Point2 192 168 50 1 24 192 168 20 1 Department 192
192. 00000000000000000000000000000 IPQ 1 6 000000000000000000000000000 151 8 0000 85 DI LLUL IL 0 0000000000000000000000000000000000000000000000 00000000000 1 100000000000000000 Vol2 00 0 8 4 00000000000 00000 00000 cli 00000000 enable disable quit exit 000000000 logout configure configure terminal end adduser rmuser password clear password show sessions show whoami killuser 00000 set terminal warning level set exec timeout set terminal command literal 0000 set terminal help set terminal pager show history stty 000000 telnet 000 rlogin 000 ftp 00000000 show version ppupdate 00000000 ftpbackup 000000000 ftprestore 0000000000 synchronize MCN U copy mc format mc show mc set mc disable 1 0 set mc enable 00 000000 00000 show running config show configuration 8 0000 00 show startup config copy running config erase startup config cd 0000000 pwd
193. 00000000000000000000000000000 LED 0 0 0 FAULT CODED 0 D LEDQOO 70000000000000000000 MIB 000 000000000000000000000 000000 00000000000000000000000000000000 00000000000000000000000000000000 000 MCUUUD MCOO00000000000000000 511111 11 11 0 000000000000000000000000000000000000000000000 0 000000000000000000 RS232c0 0000000000000000 200000 0 00000000000000000 telnet 0000000000000000000000 000000000 00000000000000000000000000000000 00000 81 000000000000000000000000000000000000 82 0000000000000 8 1 000000000 RM J 852320 SNMP Ye 144 8 0000 0 8 2 1 0000 0000 0000 0000 9 889200 RS232C U D D 0 0 192000 96000 48000 24000 1200 ZMODEM CD ROM ISO 9660 000 6523260000 D D 9600 00000000 00000000 TCP IP telnet rlogin ftp CD ROM ISO 9660 11 00000 000000 882320 000 0000008 000000 852320 8 0000000000000000 2559 000000000000000000000 0 0000000000000000002 000000000000000002 00000000 0000000000 20 5590 00000000000000000000000000000000 00000000 82 000000000000 2 F 7 Z W Z 000 20000000000 PO000000000000 3784000000
194. 000000000000000000000000000000000 40 Traffic Conditioner Traffic Conditioner Meter Marker Shaper Dropper H HH BB B 00000000000000000000000000000000000000000000000 000000 Meter 0000000 0000 Marker shaper DropperQ n D 0000 Marker Dropper Meter 00000000000000000000000000000000000000000 00000000000000 Shaper 0 00000000000000000000 1 8 000000000000000 0 00000000000000000000000 0000000000 0 00000000000000 2 5 lt 0000000 e 00000000000000000000 Traffic Conditioner 0 00000000000000000000000000000000000 0 0000000000000000000000000000000000000000000000 00014 000000000000000 222 0000 017 000000000000000 2 2 3 00 0 018 000000000000000 224 0000 0000000000 09800 8 95 500000000000000 0 00000000000000000000000000000000000000000 52 23 Diff sev 0 2 Diff serv 0000000000000 MFClassifier 00000 flow filter Marker pscPngnnug 000000 protocol ip protocol No tep icmp igmp icmp6 upper lower dscp ip source ip destination port source port destination icmp type icmp code igmp type replace dscp BA Classifier 00000 flow qos M
195. 000000000000000000000000000000000 0 0000000000000000000000000000000000000000000000 000 spanningtreeQ 000000000 0 42 00000000000000000 000000 0000000000 000000000 Max age time 18 20 Forward delay time 10 15 91 4 0000 45 3 92 042 000000000000000000000000000000000000 000000000000000000000000000000000000000 0 00 0 00000000000000000 5800000000000000000000000000 0 00000000000000000000000000000000000000000000000 0 0000000000000000000000000000000000000000000000 0 000000000000000000000000000 00000 3000 0000000 MAC 00000000000000000000000 8101 000 0 2000000000000 5000000000000000000000000 0 00000000000000000000000000000000000 5800000000 0 000000000000000000000000000000 0 0000000000000000000000000000000000 580000000000 000000000000000000000000000000000000000000 0000000000000000000 0100000000 Action Forward OOO OO 00000000000000000000000000000000 000000000000000000000000000000000 Action Forward 0 000000000000000000000000000000000000000000000 0 000000000000000000000000000000000000000000000 0 000000000000000000000000000000 0000000000000 0 000000000000000000000000000 O20 0000000 Acting Drop D l Oooo 0 000000000000000000000
196. 0000000000000000000000000000000000 00 00000000 50000000000000000 62 0000000000000000000000000 120000 0000000000000000000000000000000000 248 0000 OOOO 00000000000000 0 000000000000000000000000000000000000000000 80000000000000 00000000 25 000000000000000000 15000000 0000000000 0000 0000000000000000000000000000000000000000 000000000 OOO 450000 000000000000000000000000 1 000000000000000 0000000000000000000000000000000000000000000000000000 0000000000000000000000000000000000000000000000000000 000000000 0 000000000000000000000000000000000000000000000 ID 000000 10080 00000000000000000000000 1300000000 200 0000 00000 0 000000000000000000000000000000000000000000000000 00000000 000000000000000000000000000000
197. 0000000000000000000000000000000000000 000000000000024 00000000000000046 000000000000000 0 0000000000000000000000000000 0 0000000000000000000000000000000000000000000000 0 0000000000000000000000000000000000000000000000 0 000000000000000000000 5 000000000000000000000 MRU 5 500000000000000000000000000000000000000000 00000000000 75 30 00000000000 7 5 37 000000 0000000000 193 10 000000000000000 10 2 U ISDN 10 2 1 WANTI LH U 0 0000000000000000 0 000 10 2 0000 00 000 000000000 00000000000 000000000 000 0000000 300 0 000 0000000 200 ISDN 145000 00000000 000000000000000 00000 0000000 FR 000000000000000000000 00 1022 0000000000000 0 0000000000000000000000000000000000000000000000 0 0000000000000000000000000000000000000000000000 0000000000000000000 10 3 000000000000000000000000 000 00 0000 0000000 000000 0000 00000000 64kbit s 6Mbit s 6Mbit s 0 00000000000 000 0 V24
198. 000000000000000000000000000000000000000000 0000000000000000 show ipx route 00000000000 Dest Net 0000000000000 e Next Net 0 0000000000000000 e Next HostOOOOOOOOOOOOOOOO IF Name 000000000000 Hops 00000 Ticks 000000 00000000000000000000000000000 00000000000000000 Flags 00000000000000000000000000000000000000 0000000000000 020000000000000 0 0000000000000000 64 3 033 0000000 227 0 7 FL Z 0x10000000 EI 2 21 lb 0x00001000 14 210 3 S Ky 2 27 ELZ 3 0 00000020 M RYbI DPELA 0x00000010 RY EIT 0x00003000 ty 7 00 YaF Ty 7 27FUvA 0x20000000 3 32 F2 27 S E3 5 89 9 2 PELACHS SHR COT y HFU 27T 22 2 18 la 00 00 87 40 0A EO Ib 00 00 87 40 0B EO lc 00 00 87 40 0C EO Id 00 00 87 40 0D EO le 00 00 87 40 0E EO f 00 00 87 40 0F EO 9 510 7 4 727 2W Dest Net Next Net Next Hop Host IF Name Flags 00000010 00000010 00 00 87 40 0 0 la static 00001000 00001000 00 00 87 40 0B EO Ib static 00002000 0 7 0 static 00000020 00001000 00 00 87 40 0D EO Ib rip 00000030
199. 0000000000000000000000000000000000000000000 000000000000000000000 kI TORRE EAI UY UA Vol 1 Vol 2 AX 10 157 AX 10 158 FUL TORRE 1255 gt 5 2 AX 10 141 150125 SAVVY ITA 9 A REM FUERA F 10 159 y Voll AX 10 162 y Vol 2 AX 10 163 OER ESSE gt IIA 52 8 avy Vol l AX 10 161 AX 10 167 Vol 2 gt AX 10 168 xi Ayk Uy7nZV7yvuvwA AX 10 169 8 5 8 MIBL Z y AX 10 170 VI AAL ABR AC ACK ADSL AIS ALG ANSI APS ARP AS AT BGP4 BGP 4 bit s BOD BPDU BRI BSR CBR CIDR CIR CLLM CLNP CLNS CLP CNTL CONS CRC CSMA CD CSNP DA DCE DHCP Diff serv DIS DLCI DNS DR DSAP DSCP DSU DTE DVMRP E Mail ES FCS H H H H H H H H H md UO QQ lt 0000 1111111 1 1 1 ATM Adaptation Layer Available Bit Rate Access Concentrator ACKnowledge Asymmetric Digital Subscriber Line Alarm Indication Signal Application Level Gateway American National Standards Institute Automatic
200. 00002000 00 00 87 40 0E EO lc rip 00003000 00001000 00 00 87 40 0D EO Ib rip 10000000 00001000 00 00 87 40 0D EO Ib rip 20000000 00002000 00 00 87 40 0E EO lc rip NetWare Q 0000000000000 00000 00000000000000 33 000 0 00000000000000000000000 30000000000000000000000 10000000 100000 100000000000 12000 2000000000000000 000000000 12000 32000 20000000000000000000000 00000 000 0 00000 000 00000000 12 0000000000000000000000000000000000000 0 000000000000000000000000000000000000000000000 0 0000000000000000000000000000000000000000000000 000 e 0000000000000000000000 0 0000000000000000 0 0000000000000000000000000000000 e 000000000000000000000000 0 000000000000000000000000000 000000000000000 65 3 0 000000000000000000000000000000000000000000000 000000000 66 34 DILULL I 3 3 4 1 00000 RIP Routing Information Protocol 000000000000000000000000 00000000000 2 00000000000 RPOOIPPOOOOOOOOOOO U 3 2 0000000 0000000 00000000 0000000 000000000 amp 0 00000000 000000 000000000 0000000 000000000 00000000000 0 0 00000000 00000000000 0 1 non Periodic RIP 2 Periodic RIP D 3
201. 08000 0 1 11 11011111111111117 1811 a R 8 8 7 8 6 8 5 8 4 8 3 8 2 8 1 8 0 8 Fat 5 4 44 4 2 52 4 04 5 6 AB F O 4 VF BRBONT F NEB1001TC 64 0 0000000000000000000000000000000000 4 000000 64 1 0 000000000186 0000 00000000 00000000000 0 0000000000000000000000000000000000000000000000 000000000 1 10 00000000000000000000000000000 NEB100 1TC 000000 0000000 000000000 0 1 4 1 2 2 3 4 3 5 6 4 7 0x 00000000000000000000 1 6005 000 18 OOOO 0 0000000000000000000000000000000000000000000000 0000000000 D 1 12 000000000 kawsashun E0 Ka COM CHS SHARD 22 0 000000000000000000000000000000000000000000000 kbit s O O 110000 00000000 0000000000000000000000000 0 0000000000000010000000 1 81 0000 0 0000000000000000000000000000000000000000000000 0 0000000000000000000000000000000000000000000000 0000000000000 0 00000 0 0 1 0000000000000000000000000000000000000000000 1 008000 D 1 13 0000000 ARE CHRAOT 4 ERIBEIC AEE THRADFT ERC 8 Fiz I lt OB EUR 28 gt 38 0 gt 38 8 OBIIT 2 FE 2 3 6 5 0 4 9 557 5 825 67 42 U 6
202. 1 1 Diff serv 0 0 46 2 1 2 Dif serv QoS I D 49 00 2 4 3 Diff serv 0 0000 50 2 2 Diff serv 000000 51 221 00000 51 222 0000 52 223 00 0 52 224 52 23 1000000000 55 2 3 1 0000000000 55 232 000 55 020 0000000000 59 3 4 60 3 1 1 0000000 60 312 60 313 61 314 61 315 61 32 000000 62 33 OOOO 64 34 000000 67 341 67 342 68 35 000000000000 69 351 69 352 72 353 74 354 74 355 75 3 5 6 Ping O 0 75 36 000000000000 77 36 1 0000 77 362 0000000000000 77 363 79 10 81 41 000000 82 411 00000000000 82 00 82 0000000 412 83 00000000000000 42 84 000000000000000 43 87 44 441 0000000000000 87 442 88 443 89 45 000000 90 90 451 452 90 453 0000000 92 454 000000000 93 46 000000000000 95 461 000000 95 462 0000 96 463 HOLCOO0000000000 6 464 WAND 0 0 9
203. 1 30 0000000000 20000 00000 0000 i 1 2 3 4 5 6 7 8 WAN 6M PPP Line 8 4 0 16 4 32 4 0 0 200 4 _ 0 1000 2 0 6M DLCI 8 4 0 16 4 O e O 40 1 008000 0000000000 20000 00000 0000 d 1 2 3 4 5 6 7 8 32 4 0 ISDN peer 8 4 0000000 000000000 0000000000 00000000 5100 0000000 000000000000000000 0000 000 0 4900000000000000000000000 0000 000000 000 00000 12 000000000000000000000000000000000000000000000 0000 0000000000000000000000000000000000000000 80000000 ATM CBR VBR ABR IJ 000000 vei 6 1105 HOU 20000 00000000000 95 5000000000000000000 2 0000000000000 0 20 0000 00000000000 980 00000000000000000 CLP 0 00000000000000 20000000000000 41 1 0680000 1 11 QoSD 000000000 1111 D LU LU 000000000000000 124 000000 00000000000000000 0000 000 00000000000 000000000000000000000 820000 0000000200 125 00000000000000 95500000000000000000 0000000000000000 9550000000000000000000 1 24 000000 00000000000000000 10 21 7
204. 10589 1992 Information technology Telecommunications and information exchange between system Intermediate system to Intermediate system intra domain routing information exchange protocol for use in conjunction with the protocol for providing the connectionless mode Network Service ISO 8473 RFC1195 Use of OSI IS IS for Routing in TCP IP and Dual 19900 120 Environments RFC2763 Dynamic Hostname Exchange Mechanism for IS IS 20000 20 RFC2966 Domain wide Prefix Distribution with Two Level IS IS 20000 100 RFC3373 Three Way Handshake for IS IS Point to Point 20020 90 Adjacencies 221 00A 0000 8 A 9 222 draft ietf isis 1pv6 03 20010 40 0000 txt u Routing IPv6 with IS IS draft ietf isis hmac 03 txt 20010 IS IS Cryptographic Authentication draft ietf isis traffic 04 txt 20010 80 IS IS extensions for Traffic Engineering 17 POOOO 111 11 0000 0000 RFC2236 000000 000 Internet Group Management Protocol Version2 Internet Draft draft ietf idmr dvmrp v3 06 txt 19980 580 Distance Vector Multicast Routing Protocol Internet Draft draft ietf pim v2 dm 03 txt 19990 60 Protocol Independent Multicast Version2 Dense Mode Specification RFC2362 Protocol Independent Multicast Sparse Mode PIM SM Specification I
205. 2 0 0000000000000000000000000000000000000000000000 0000000 9610 1000000000000000 106610000000000000000 0 0000000000000000000000000000000000 00000000 0 00000000000000000000 O30 0000000000000 ATMO 0000000000000000000 148380 0000000 0 0000 0 00000000000000000000000 8 5900000000000000000000 4 14 0000000000000 BPDU as defined by 802 1 d or 802 1 2 LLC 0xaaaa03 OUI 0x0080c2 PID 0x000e 00000000000 0 0000000000000000000000000000000000000000000000 00000000 0000000000 0 00 01 0800070000 20000 000000 00000000000000000000000000000000000000 000000000 97 4 0000 98 040 Group 0000000000 0 0 0 0 0 0 VCO Group 00000000000000000000000000000 825900000 0000 0000 0 000000000000000000000000000 0 00000000000000000000000000 00 0000000 Group l 0 000000000000000000000000000000010000000000000 00000000000 00000000000000000 Grup 0000000 0 000000000000000000 200000000 00000 0 50 ISDN 00 000000000000000000000 0 0 0
206. 2 128 88249 6 0 1 128 35 00 00 0 00000000000000000000000000000000 9 0000000 96 SNMP IDII HL D DO D D 9 6 1 SNMP LI 0000000000 000000000000000000000 0 0000000000000000000000 e SNMPO OOOO HP OpenView Network Node Manager Ver4 0x HP UX HP OpenView Network Node Manager Ver5 01 HP UX HITACHI JP1 Cm2 Network Node Manager e e NetScout Systems NetScout Manager Plus 5 2 3Com Transcend LANsentry Manager ver3 0 962 MBOOOOOOOOOOOOO 0000000000000000000 800000000000000000 MIB 0 0000000000000000000000000000000000000000000000 0000000000000 800000000000000000000000000000000 0 00000000000000000000000000 O10 000000000000000 5 80000000000000000000000500000000000 0 0000000000000000000000000000000000000000000000 0 0000000000000000000000000000000 e 00000000000000000 0 000000000000000000000000000000000000 000000000 e 00000000000000000000000 0 000000000000000000000172000 800000000000000000 e 00000000000000000000 00000000 00000000000000000000000000 800000000 0000000000000000000 MB0000000 900000000000 MIB
207. 20 5800 155 52Mbit s 0 5Mbit s psug dg ITU T G 957 10 185Mbit s 1Mbit s J 155 52Mbit s 45Mbit s E ITU T G 957 135Mbit s 000000 1019 00000000000000 CBR PVC 6 SVC x VBR PVC 000000000 000000000 UBR PVC z 40000 00000000 000000 010000000 0 10 3 1 02000000000000000000 020 00000000000 0 0000000000000000000000 2 00000000 0000000000000 0 000000000000000000000000000000 e 10981 0300000000000000000000000 e 0 0000000000000000000000000000000000000000000 e 00000000 00000000 0000000 00000000 000 9 6000000000000000000 0 000000000000000000000000000000000 e 0000000000000000000000 65000 MBSQ 500 0000000 30 209 10 000000000000000 10 33 0000000 00000000000000000000000000 0000000 0 00000000000000000000000000000000000000000000000 10 20 00000000000 00000000 000000000 0000 000000 000000 0000 0000 0000 000000 0000 000000 000 000 000 000 155 52Mbit sITU T 3Mbit s 42Mbit x0 G 957 s 3Mbit s 000 25 6Mbit sTTC 3Mbit s 24Mbit JT 1432 5 S 3Mbit s O 100 1021 000000000000000000 0000000 00000000
208. 4 0000 per Mer 00000 priority4 pcr D 00000 00 00 00000 0 0000 0000 00000 CLP 0 0 5M 0 1M 500k 500k 250k 0 500k 00000 0 5 0 3 500k 500k 2508 5008 8008 1M 0 1M 1000k 1000k 500k 0 1000k 00000 1M 0 5M 1000k 1000k 5008 1000k 500k 2M 0 2 2000k 2000k 500k 0 0 2000k 00000 2M 1 0M 2000k 2000k 5008 20008 10008 3M 0 3M 3000k 3000k 500k 0 3000k 00000 3M 1 5M 3000k 3000k 500k 0 0 3000k 1500k 4M 0 4M 4000k 4000k 500k 0 4000k 00000 4M 2 0M 4000k 4000k 500k 0 0 4000k 2000k 5M 0 5M 5000k 5000k 500k 0 0 5000k 500k 5M 2 5M 5000k 5000k 5008 0 J 50008 2500k 6M 0 6M 6000k 6000k 500k 60008 6008 6M 3 0M 6000k 6000k 5008 60008 3000k M 0 7M 70008 70008 5008 70008 700k M 3 5M 70008 70008 5008 70008 3500k 8M 0 8M 8000k 8000k 500k 8000k 800k 8M 4 0M 8000k 8000k 500k 0 0 8000k 4000k 9M 0 9M 9000k 9000k 500k 0 0 9000k 900k 9M 4 5M 9000k 9000k 500k 0 0 9000k 4500k 10M 1 0M 10000k 10000k 500k 0 0 10000k 1000k 10M 5 0M 10000k 10000k 500k 10000k 5000k 10 00000000000000 D 1 prp 100000 0 0 mer U priority4 perg 0000000000000 000000000 0x2 00000000000000000000 00 1000000000000000000 213 Acknowledgments 215 00A 0000 0000 1 216 D Butt
209. 46 000000000000000 543 17 2 0000000000000 gt 44 17 2 1 544 17 2 2 MLD OO 544 17 2 3 Querier OQ 945 1724 6 0000000000 549 17 2 5 OOO 547 173 0000000000 00 17 3 1 00000000 548 17 3 2 6 0000000000000 548 17 4 1 6 1 00 550 17 4 1 IPv6 PIM SM 00 550 1742 DOOD 554 17 4 3 Forwarder 0 555 1744 DR ID U d EB D U U 555 1745 556 17 46 IPv6 PIM SM O 0 0 556 17 4 7 IPv6 0 0000000 557 17 4 6 IPv6 PIM SSM 558 560 000000000000 175 560 6 175 1 17 5 2 IPv6 PIM SM 560 17 5 3 0000000000000 560 754 0000000000 561 565 0000 566 1 000000 566 2 WAN 567 A 3 569 4 569 5 RIP OSPF 570 4 571 7 Isls 571 8 572 9 6 00000 572 10 RIPng OSPFv3 573 A11 BGP4 573 A12 260000000 574 13 Diffserv 574 OOOO 574 15 SNMP 574 A 16 RADIUS 576 A 17 VRRP 576 Acknowledgments 577 0000 595 605 010 Qos QoS 1 U LL 11 008000 0 12 005 13 00000 14 0000 15 0000 16 00000 17 0000 18 0000 19 110 50 00000000 1 11
210. 6 030 000000 VRRP 99 51 VRRP j 100 52 000000 00000 101 5 3 00000000000 103 54 104 541 1 DDD 104 542 105 55 107 56 00000000 109 57 0000000 110 5 8 00000000000 111 5 8 1 Ul 111 582 000000 TH 59 000000000 Me 5 9 1 112 592 000000 112 5 10 88 0 000000 114 00 040 117 6 1 SNMP O 118 6 1 1 00000000 118 6 12 5 118 6 2 MIB D 120 6 2 1 MIB C 120 622 120 62 3 000000 121 624 00000000 MB 121 63 8 0 000 122 6 3 1 GetRequest O O O O 122 6 3 2 GetNextRequest O O 123 6 3 3 GetBulkRequest O 124 6 3 4 SetRequest O O O O O D 124 63 5 126 63 6 000000000000000000 127 64 0000 129 64 1 000000 129 642 0000000000 129 643 00000000 129 6 4 4 PVC Trap 130 6 5 RMON MIB 134 RADIUSO D 000 135 71 RADIUS 136 72 137 73 RADIUSOOOOD 139 74 50 0000000000000 141 143 81 OOOO 144 8 1 4
211. 8137 312 0000000 60 6000 16000 120 00000000000000000000000000000 000000000 12 00000000000 WANQ OO 0000000000000000 0 000000000000000000000000000000000000000 1000 900 0000000000000 3 3 13 000000006060 4000 32000 20000000000000000000000000000000000000 00000000000 1000 9000000000000000000 1550000000000 0 0000000000000000000000000000000 314 DDDBDDDUD 9 mEthernet AUXD 000 0 0 000000000000000000001000 lt 315 000000 IPXOOO 000000000 2000000000000000000 0000 0 0000000000000 900 e 000000 0 0000000000000000000000000000000000000 e 0000000000000 0000000000000000000000000000000000 61 3 32 IPX Internetwork Packet Exchange 0000000000000 O10 12 00000000000000 000000000000000000000000 3 2 00000000000000 299 5 TC PT 2 2 0 1 FEES 2 HM 02100000 150000000000000000000000000 Netware3 12J0 00000 LIPQLarge
212. 9 1 0000000000000 Cisco 000000 000 000000 000 ve OOO mtu 4470 mtu 4470000000 ip mtu 4470000000 0000000000 MTV0O00000000000000000000000000000000 0 00000000000000000000000000000000000000000000 0 00000000000000000000000000000000000000000000 180 9 0000000 94 IPDTIILE BLU D DI 94 1 HOUUUUO 00000000 200000000000000000000000 0100000 0000000000000000000 00000000 0000000 000000000000000 00000000000 WAND 00000 0000 0000000000000000000000000000000 0000000000000000 000000000000000000000000000000 0 00000000000000000000000 0000 000000000000000000000000000000000000000000 Vol 1 19 200000000000000000000000 e 0000000 00000000000000000000000000000 120000 e 0000 00000000000000000000000000000000 120000 0000000000000000000000000000000000000000000000000 O20 00000000 10000000000 0 0000000000000000000000000 0 0000000000000 00000 0 0000000000000000000000000000000000000000000000 0000000000000000000 000000000000 00000000000000000000000 00000 0 00000000000000000000000000000 0000000000000000 0 000000000000000000000000000000000 00000000 20000000000
213. ARP ARP Request ARP 00000 VLL64 4 4 Response 0 0 0 00000000000 20000 wan 00000 VLL64 4 4 00000000 0000 00 000 L06414 4 RIP OSPF telnet ftp snmp igmp LL pim 0 0 3 5 4 6 000 VLL64 4 4 4 0000000000000000000 IPv4 ooo VLL25 1 1 3 4 6 000 VLL25 1 4 1 0080000 000000 000000 0 0 0 0000 00000 0000 7 Hun ooo 0000000000 4000000000 VLL25 1 4 000 EU n 4 ET 0 Redirect 0 VLL25 1 4 00000 1240000 00000 a3 4 6 000 VLL25 1 4 00000000 1260000 0000 3 4 6 000 VLL64 4 4 00000000 1260000 00000 3 4 6 000 VLL25 1 4 00 000000 1 2000000000 0 00000000000000000000000 2 000000000000000000000000000 11 000000 400000 D 3 000000000000000000000000000000000000 1 10 00000 000000000000000000000000 WNEB 1001TOD 000000 0x4 0000000
214. E 1241 1 4 eT LILILIC fC L3 L3 jas p L 31 14 1 L3 L3 L3 L3 L3 L3 L3 L1 02 0 gt E d 0 0000 ATMO OO GFR 000000000 0 L3 lt inf Inbound Outbound 000000 D i 000000000000000000000 O 2 ATM0000000000 00 CBR VBR ABR UBRO lt 37 1 0680000 00000000000 00 000000000000000000000000000 Vei 6 1102 0000000 1 25 000000 RMm0000000000000000000 RMOO RPOO 0000 000000 00000 n 00000 00000 AX2001R 198 1000 1000 1000 AX2002R AX9002RX 256MB 2000 2000 2000 000000 O 1 0000000 00000 698 00 D 2 0000 fowOOOO000000000U000000000000 1000000000000000000 00000000 1 26 10000000000000000 00000 0000 00 1 0000 1 1 1 11 908 1
215. E 55 G t poll 3E 58 C DERE reply BEL CUTE AER priority 4 SE E RE HIS RA BUTS poll 5 VRRP 56 0000000000000000 00000 10 00000000000 0 0000000000000000000000000000000000000000000000 0 000000000000000000000 000000000000000 00 000 0000000000000 000 5 10 000000 A27 ADVERTISEMENT 7 F 0 0 O D 0 0000000000000000000000000000000000000000000 0 000000000000000000000000000000000000000000000 0000000000000000 0 000000000000000000 0 000000000000000000000000000000000000000000000 0 Ooo 109 5 VRRP 57 110 ADVERTISEMENT III 00 00 00 00 0000 00 00 0 0 00 000 224 0 0 180 IPve 02 10 0 000000000 VRRPOOOO 1 0 0 0 0 TTLO O O HopLimit 2550000000000000000 00000000 000000000000000000 00000000000000000000 VRRP 0000000000000 000800000000000000000000000000000000 ADVERTISEMENT 00000000000000000000000000000 U 5 1 000000000 FREA 8 YAS YAR 2142 40 1 Password ABCDEFG Password Password ABCDEFG 0000000000
216. EITHER THE AUTHOR NOR AT amp T MAKES ANY REPRESENTATION OR WARRANTY OF ANY KIND CONCERNING THE MERCHANTABILITY OF THIS SOFTWARE OR ITS FITNESS FOR ANY PARTICULAR PURPOSE INFO ZIP GROUP This product includes Info ZIP s software which is used for a part of the boot program Info ZIP s software ZIP UnZip and related utilities is free and can be obtained as source code or executables from various bulletin board services and anonymous ftp sites including CompuServe s IBMPRO forum and ftp uu net pub archiving zip INTERNET SOFTWARE CONSORTIUM Copyright C 1996 by Internet Software Consortium Permission to use copy modify and distribute this software for any purpose with or without fee is hereby granted provided that the above copyright notice and this permission notice appear in all copies THE SOFTWARE IS PROVIDED AS IS AND INTERNET SOFTWARE CONSORTIUM DISCLAIMS ALL WARRANTIES WITH REGARD TO THIS SOFTWARE INCLUDING ALL IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS IN NO EVENT SHALL INTERNET SOFTWARE CONSORTIUM BE LIABLE FOR ANY SPECIAL DIRECT INDIRECT OR CONSEQUENTIAL DAMAGES OR ANY DAMAGES WHATSOEVER RESULTING FROM LOSS OF USE DATA OR PROFITS WHETHER IN AN ACTION OF CONTRACT NEGLIGENCE OR OTHER TORTIOUS ACTION ARISING OUT OF OR IN CONNECTION WITH THE USE OR PERFORMANCE OF THIS SOFTWARE SIGMASOFT TH LOCKERT Acknowledgments Copyright C 1994 SigmaSoft Th Lockert lt tholo sigmasoft com gt
217. FOR ANY DAMAGES WHATSOEVER RESULTING FROM THE USE OF THIS SOFTWARE The author requests users of this software to send back any improvements or extensions that they make and grant him and or the Invenia Innovation the rights to redistribute these changes without restrictions Todd C Miller Copyright C 1998 Todd C Miller lt Todd Miller courtesan com gt All rights reserved Redistribution and use in source and binary forms with or without modification are permitted provided that the following conditions are met 1 Redistributions of source code must retain the above copyright notice this list of conditions and the following disclaimer 2 Redistributions in binary form must reproduce the above copyright notice this list of conditions and the following disclaimer in the documentation and or other materials provided with the distribution 3 The name of the author may not be used to endorse or promote products derived from this software without specific prior written permission THIS SOFTWARE IS PROVIDED AS IS AND ANY EXPRESS OR IMPLIED WARRANTIES INCLUDING BUT NOT LIMITED TO THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE DISCLAIMED IN NO EVENT SHALL THE AUTHOR BE LIABLE FOR ANY DIRECT INDIRECT INCIDENTAL SPECIAL EXEMPLARY OR CONSEQUENTIAL DAMAGES INCLUDING BUT NOT LIMITED TO PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES LOSS OF USE DATA OR PROFITS OR BUSINESS INTERRUPTION HOWEVER
218. FeV i 7517 ANY fev An Z VA i I I 1 1 1 NZ I DO4 8 F WAN EE 2 2 2 25 gt Pra Big vy 7 7 I Sr y RIP OSPF 4 4 BGP4 15 15 4 JF 4 2 V7 RIPng OSPFv3 BGP4 IPv6 JF F 5 IPv6 L 7T 4 V 8 K 1 1 3 IPUUL 7T 4 77 2 8 VIF IO 32 6 4 29 92 I I 6 SNMP LER YY 7 7 EH 7 RADIUSI CF 2 8 8 FARE V V 58 V 9 VAT LEBBZOLOORT Vb 10 E Z 8 WB maj MACE URL 0000000000000 8000000800 0000 http www alaxala com 0000 AX2000R 10 157 Vol 2 AX 10 158 SED F y Vol 1 AX 10 159 AX 10 162 FL Z y Vol 2 AX 10 163 y Vol 1 AX 10 161 AX 10 167 Vol 2 10 168 AX 10 169 MIBL Z AX 10 170 0000 2000 0000000
219. HANTIBILITY AND FITNESS FOR A PARTICULAR PURPOSE This implementation has been influenced by the CMU SNMP release by Steve Waldbusser However this shares no code with that system Additional ASN 1 insight gained from Marshall T Rose s The Open Book Earlier forms of this implementation were derived and or inspired by an awk script originally written by C Philip Wood of LANL but later heavily modified by John Robert LoVerso The copyright notice for that work is preserved below even though it may not rightly apply to this file This started out as a very simple program but the incremental decoding into the BE structure complicated things Los Alamos National Laboratory Copyright 1990 The Regents of the University of California This software was produced under a U S Government contract W 7405 ENG 36 by Los Alamos National Laboratory which is operated by the University of California for the U S Department of Energy The U S Government is licensed to use reproduce and distribute this software Permission is granted to the public to copy and use this software without charge provided that this Notice and any statement of authorship are reproduced on all copies Neither the Government nor the University makes any warranty express or implied or assumes any liability or responsibility for the use of this software traceroute Copyright C 1988 1989 1991 1994 1995 1996 The Regents of the University of California All rig
220. IAL EXEMPLARY OR CONSEQUENTIAL DAMAGES INCLUDING BUT NOT LIMITED TO PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES LOSS OF USE DATA OR PROFITS OR BUSINESS INTERRUPTION HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY WHETHER IN CONTRACT STRICT LIABILITY OR TORT INCLUDING NEGLIGENCE OR OTHERWISE ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE MARTIN BIRGMEIER Copyright C 1993 Martin Birgmeier rights reserved You may redistribute unmodified or modified versions of this source code provided that the above copyright notice and this and the following conditions are retained This software is provided as 15 and comes with no warranties of any kind I shall in no event be liable for anything that happens to anyone anything when using this software CHRISTOPHER G DEMETRIOU Copyright C 1993 1994 Christopher G Demetriou rights reserved Redistribution and use in source and binary forms with or without modification are permitted provided that the following conditions are met 1 Redistributions of source code must retain the above copyright notice this list of conditions and the following disclaimer 2 Redistributions in binary form must reproduce the above copyright notice this list of conditions and the following disclaimer in the documentation and or other materials provided with the distribution 3 All advertising materials mentioning features or use of thi
221. Microsystems Inc and is provided for unrestricted use provided that this legend is included on all tape media and as a part of the software program in whole or part Users may copy or modify Sun RPC without charge but are not authorized to license or distribute it to anyone else except as part of a product or program developed by the user SUN RPC 15 PROVIDED AS IS WITH NO WARRANTIES OF ANY KIND INCLUDING THE WARRANTIES OF DESIGN MERCHANTIBILITY AND FITNESS FOR A PARTICULAR PURPOSE OR ARISING FROM A COURSE OF DEALING USAGE OR TRADE PRACTICE Sun RPC is provided with no support and without any obligation on the part of Sun Microsystems Inc to assist in its use correction modification or enhancement SUN MICROSYSTEMS INC SHALL HAVE NO LIABILITY WITH RESPECT TO THE INFRINGEMENT OF COPYRIGHTS TRADE SECRETS OR ANY PATENTS BY SUN RPC OR ANY PART THEREOF In no event will Sun Microsystems Inc be liable for any lost revenue or profits or other special indirect and consequential damages even if Sun has been advised of the possibility of such damages Sun Microsystems Inc 2550 Garcia Avenue Mountain View California 94043 231 B Acknowledgments 232 UNIVERSITY OF TORONTO Copyright C 1986 by University of Toronto Written by Henry Spencer Not derived from licensed software Permission is granted to anyone to use this software for any purpose on any computer system and to redistribute it freely subject t
222. OOO 800000 234 10 5 7 297 1058 1059 10 5 10 300 106 RIP OSPF 302 10 6 1 RIPOSPF 302 1062 00000000000 RIPIOSPF 303 107 0000 RIP OSPF 306 108 00000000000000000 308 108 1 OSPFOOO RIP 20 100000 308 1082 000000000000000000000000000 310 10 8 3 0000 310 BGP4 313 11 1 86 4 314 11 1 1 DDD D 314 11 12 BGPA4 0000 315 11 13 000000000000 315 112 0000 BGP4 316 1121 000000000000 316 4 22 0 000 00 00 0 BGP4 316 1123 0000000000000000000000000 6 400000 316 1 24 317 11 3 BGP4 319 11 3 1 BGPATI 319 1 32 0000000000 320 1 33 000000 920 1134 00000000000000 Pen 1135 00000000000 ae 11 36 0000000000 942 11 3 7 BGPA4 0000 335 11 38 000000000000000 337 11 39 0000000000 339 11 3 10 MD50 0 339 1 311 000000000000 939 11 3 12 8 4 1 1 11 340 114 000000000 343 1141 0000000000 BGP4 oe 1142 00000000000 BGPA 948 11 5 0000 BGP4 349 5 5 eo 124 13 800 352 122 5 18 ane 1221 986 1222 299 1223 0000000000 368 1224 0000 12 2 5 IS IS 365 12 2 6 15 15 368 XV 00
223. P Z 2 x 01 7 2 PVC Trap 453 7901 iflnde 3 Vor S 1 VCR d 30 2 2 gt VBL PVC Trap iflndex 3 627 JAAS 00 88 3 Trap 0000000000000000000000000000 VCDDUUU 0000 U 131 6 132 6 22 PVC Trap 0 0 00000000000000000000 SNMP Z 22 VIR I PVC Trap iflnde 3 VOX VR VCR E 30 VC17 7 0148 Trapi amp Bl amp WRITES SNL Trap 0000000000000000000000000000 000 00000000000000000000000000 000000000000000000 000000 0000000000000 0000000000000 6 23 0 0 0 00000000000000000000000000 SNP Z Sp 01 gt 4 PVC Trap 409 lt iflnde 3 VCO VME Vo 30 V024 0027 7 BE 4 gt 4 A b IS ABE PVC amp nigu Trap 00000000000000000000000000000 00000000000000000000 000000000000000000000000 Trap 0000000000000 000000000000 6 24 0000 00000000000000000000000000 ARE SMIP Y 4 7 001 PVC Trap iflndex 3 VE VCZ 8 1
224. Protection Switching Address Resolution Protocol Autonomous System Asynchronous Transfer Mode Auxiliary Bandwidth Allocation Protocol Broadband Access Server Backward Explicit Congestion Notification Border Gateway Protocol Border Gateway Protocol version 4 Multiprotocol Extensions for Border Gateway Protocol version 4 bits per second bps 000000000000 Bandwidth On Demand Bridge Protocol Data Unit Basic Rate Interface BootStrap Router Constant Bit Rate Classless Inter Domain Routing Committed Information Rate Consolidated Link Layer Management Connectionless Network Protocol ConnectionLess Network System Cell Loss Priority CoNTroL Connection Oriented Network System Cyclic Redundancy Check Carrier Sense Multiple Access with Collision Detection Complete Sequence Numbers PDU Destination Address Data Circuit terminating Equipment Dynamic Host Configuration Protocol Differentiated Services Draft International Standard Designated Intermediat Data Link Connection Identifier Domain Name System Designated Router Destination Service Access Point Differentiated Services Code Point Digital Service Unit Data Terminal Equipment Distance Vector Multicast Routing Protocol Electronic Mail End System Frame Check Sequenc Filtering DataBase Fiber Distributed Data Interface Forward Explicit Congestion Notification Far End Receive Failure Fully Qualified Domain Name Frame Relay Fiber To The Home GigaBit Inter
225. R 9 455 2 RTS 5 2 CHE L RADIUSF NICH LTA 5 5 3 RADIUSH 141 157 6 AIZE OU HELE 88 4 OD UV C U x R Dtelnet 35 136 7 2 RADIUS 000000000 7 0 800000 8 8 1 0 0 000000000900000 000 8 RADIUS O 0 000000000000000000000000 8 3 00000000000000000 10 8 0 8 0 0 0 0 0 9 08000000000000000000 0 0 0 telnet IPvA IPvo 0 0 0 O rogin IPvAIPvo 00000 ftp IPv4 IPv6 0000000 e RS222C0 000000 0000000000000 000000000000000000 enable admin U 20 RADIUST LLL D 000 RADIUSO 0000000000000000 71 RADIUSO000000 00 0000 810000000000000 0000000 Access Request Access Accept Access Reject 00 User Name e User Password Service Type NAS IP Address NAS Identifier Reply Message 0300000 RADUSOOOOO 0000 00000 00000 00000 7 2 0000 00000 000 User Name Access Request 00000000000 000 gt User Password Access Request 100000000000 000 2 Service Type Access Request Login 1 0 000 Access Accept Aecess
226. R ANY SPECIAL INDIRECT OR CONSEQUENTIAL DAMAGES OR ANY DAMAGES WHATSOEVER RESULTING FROM LOSS OF USE DATA OR PROFITS WHETHER IN AN ACTION OF CONTRACT NEGLIGENCE OR OTHER TORTIOUS ACTION ARISING OUT OF OR IN CONNECTION WITH THE USE OR PERFORMANCE OF THIS SOFTWARE RADIUS Copyright 1992 Livingston Enterprises Inc Livingston Enterprises Inc 6920 Koll Center Parkway Pleasanton CA 94566 Permission to use copy modify and distribute this software for any purpose and without fee is hereby granted provided that this copyright B Acknowledgments and permission notice appear on all copies and supporting documentation the name of Livingston Enterprises Inc not be used in advertising or publicity pertaining to distribution of the program without specific prior permission and notice be given in supporting documentation that copying and distribution is by permission of Livingston Enterprises Inc Livingston Enterprises Inc makes no representations about the suitability of this software for any purpose It is provided as is without express or implied warranty totd WIDE Copyright C 1998 WIDE Project All rights reserved Redistribution and use in source and binary forms with or without modification are permitted provided that the following conditions are met 1 Redistributions of source code must retain the above copyright notice this list of conditions and the following disclaimer 2 Redis
227. RANTIES INCLUDING BUT NOT LIMITED TO THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE DISCLAIMED IN NO EVENT SHALL THE PROJECT OR CONTRIBUTORS BE LIABLE FOR ANY DIRECT INDIRECT INCIDENTAL SPECIAL EXEMPLARY OR CONSEQUENTIAL DAMAGES INCLUDING BUT NOT LIMITED TO PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES LOSS OF USE DATA OR PROFITS OR BUSINESS INTERRUPTION HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY WHETHER IN CONTRACT STRICT LIABILITY OR TORT INCLUDING NEGLIGENCE OR OTHERWISE ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE CRUNCH Copyright C 1994 University of Maryland Rights Reserved Permission to use copy modify distribute and sell this software and its documentation for any purpose is hereby granted without fee provided that the above copyright notice appear in all copies and that both that copyright notice and this permission notice appear in supporting documentation and that the name of U M not be used in advertising or publicity pertaining to distribution of the software without specific written prior permission U M makes no representations about the suitability of this software for any purpose It is provided as is without express or implied warranty U M DISCLAIMS ALL WARRANTIES WITH REGARD TO THIS SOFTWARE INCLUDING ALL IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS IN NO EVENT SHALL U M BE LIABLE FO
228. Request 124 248 SNMPOOOOOOO 122 SNMPOOOOOOOOOOOO 126 sNMPOOOOOOOOOOOOOOOOOOO 127 118 SNMPOOOOOOOOOO 224 187 SNMPOOOOOOOOO 187 188 0 0 0 0 0 0 0 117 1 statistics OOO 134 T Tag VLAN 0 0 0 ut 248 Tag VLAN UU 177 Tag VLAN OU 176 178 9 203 200 200 43 2800000 48 traceroute6 167 traceroute J 7 Traffic Conditioner 52 Trap 129 U 248 V 248 VLANID 177 176 VLLO D O 0 8 vPOOOOOOOOOOOO 206 VRRP 99 248 257 00 VRRP 100 0000000 114 VRRPOOOOOOOOOOO 100 112 226 VRRP J 104 000000000 105 0000000 104 vRRPOOOGOOOOOOOOOOO 107 0 000000 36 9550000 36 152 0000 152 Oooo 4 249 145 144 00000000 165
229. U debug trace atmvc ATMO no debug trace atmvc clear trace atmvc ATM 1 LH LU U test interfaces 0000000 no test interfaces 0000000 show ip dual interface 156 00 00000 show ip interface 8 0000 00 4 000 show ipv6 interface 6 000 clear counters null interface 0 0 000009000000000 ping ping ipv6 ICMP6 00000 traceroute 00000 traceroute ipv6 show arp ARP I 1 clear ARP f show ipv6 neighbors NDP clear ipv6 neighbors 000000 show netstat 0 0000000000000 netstat clear netstat 0 0000000000000000 clear show vrrpstat VRRP U clear vrrpstat 000000000 show ip policy Fiter0 ODO t 000 show ip local policy 0 0000000000000000000 show ip cache policy 0000000000000 show dhcp traffic lt clear dhcp traffic 0 U show dhcp giaddr
230. X 1000BASE X 00000000 n NEB100 4TB 1 000000000 320kbit s 10Mbit s 320kbit s 100Mbit 320kbit s 590Mbit S S 00000000 000000000 80kbit s 10Mbit s 80kbit s 100Mbit s 80kbit s 590Mbit s 000000000 0 0 0000000 0 00000000 000000000 000000000 0 0 0000000 0 000000000 10 63 1 00000000000000000000 80kbits 0000000000 0 2 00000 2000000 0 3 000000000000000 0 4 0000000000000000000 lt 00000000 gt 00000 byte FCS 8 bit byte FCS J O 8bit O 0 D its 000000000000 000000000000000000000 0000 bits 00000000000 ns 10000000 16000 100000000 1600 1000000000 160 0 5 AX2001R AX2002RQ 000000000000000 bg 64VLL 0000 64 000000 164 0000000000000 000000 000000000 0000 6 00000000000000000000000 000000 000000 U 4000000000000000000000000 000 64 e NEB100 1TC B B Hl B 00000 00 00 0 0 00 000 4000 0000000000000 409 e 000000000000000000000000000 e NEB100 1TC 0 00000000000000000000000000000000 show 10000000000000 25 1 0680000 e Taa 000000 Ethernet 20000000000000000000000000000000 000000 ViL0O00000000 000 2000000000 D 1 17 641000
231. al and Electronics Engineers Inc In the event of any discrepancy between these versions and the original IEEE Standard the original IEEE Standard is the referee document In the following statement the phrase This material refers to portions of the system documentation This material is reproduced with permission from American National Standards Committee X3 on Information Processing Systems Computer and Business Equipment Manufacturers Association 229 B Acknowledgments 230 CBEMA 311 First St NW Suite 500 Washington DC 20001 2178 The developmental work of Programming Language C was completed by the X3J11 Technical Committee The views and conclusions contained in the software and documentation are those of the authors and should not be interpreted as representing official policies either expressed or implied of the Regents of the University of California Contributors Sun Microsystems Inc Keith Muller Mark Nudelman Jan Simon Pendry AT amp T DAVID M GAY Copyright C 1991 by AT amp T Permission to use copy modify and distribute this software for any purpose without fee is hereby granted provided that this entire notice is included in all copies of any software which is or includes a copy or modification of this software and in all copies of the supporting documentation for such software THIS SOFTWARE IS BEING PROVIDED AS IS WITHOUT ANY EXPRESS OR IMPLIED WARRANTY IN PARTICULAR N
232. appear in all copies and that both the copyright notice and this permission notice appear in supporting documentation and that any documentation advertising materials and other materials related to such distribution and use acknowledge that the software was developed by the University of Oregon The name of the University of Oregon may not be used to endorse or promote products derived from this software without specific prior written permission THE UNIVERSITY OF OREGON DOES NOT MAKE ANY REPRESENTATIONS ABOUT THE SUITABILITY OF THIS SOFTWARE FOR ANY PURPOSE THIS SOFTWARE IS PROVIDED AS IS AND WITHOUT ANY EXPRESS OR IMPLIED WARRANTIES INCLUDING WITHOUT LIMITATION THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE TITLE AND NON INFRINGEMENT IN NO EVENT SHALL UO OR ANY OTHER CONTRIBUTOR BE LIABLE FOR ANY SPECIAL INDIRECT OR CONSEQUENTIAL DAMAGES WHETHER IN CONTRACT TORT OR OTHER FORM OF ACTION ARISING OUT OF OR IN CONNECTION WITH THE USE OR PERFORMANCE OF THIS SOFTWARE Other copyrights might apply to parts of this software and are so noted when applicable 239 B Acknowledgments 240 Questions concerning this software should be directed to Kurt Windisch kurtw antc uoregon edu Id LICENSE v 1 2 1998 05 29 21 58 19 kurtw Exp Part of this program has been derived from PIM sparse mode pimd The pimd program is covered by the license in the accompanying file named LICENSE pimd T
233. bbbbb b 0000000000 NetWare 000000000000000000000000000000000 Windows 950 79 3 80 iIPXH OD D 000 PX00000000 000 000 0 0 0 000 00 0 00000 40000 0 0000000000000000000000000000000000000000000000 0 00000000000000000000 40000000000000000000000000 U 20 00000000000 DLCIQ Group 0000000000 12 00000000000000000 RIP 26 lt 100000000000000000 Group 0000000 IPX 0 0000000000000000 200000000 000 216100000 0 0000000000000000000000000000 0 0 000000000000000000 500000 8 2261000000000 veo DLCIQ Group 0 000000000000000000000000000000000000 0000000000000 0 30 ISDN 00 000000 13550000 RIPSAP 81 000000000000000000000 30 00000000000000000000000000000 2 00000 0 00000 00000000 040000 SAPO 00000000000000000000000000000000000 Ul 0 00000000000000000000 41 000000 42 00000000000000 43 000000000000000 44 000000000 45 000000 46 0000000000000 81 4 0000 4 1 1 1 OOOO 00000 00000 00 00 00 0 0 00 00 0 0 0 0 00 0 0 0 0 00000 IEEE 802 1 100000000000000000000000000 WAND OU 000000000 000000000000000000 00 2000 ATMO 000000000000000000
234. cess P Switched Virtual Channe Terminal Adapter Top Level Aggregation I Length and Value Of Service Tag Protocol Identifier the Telecommunication Time To Live Unspecified Bit Rate Unspecified Bit Rate pl User Datagram Protocol User Network Interface Usage Parameter Control Variable Bit Rate Virtual Channel Virtual Virtual Channel Identif Virtual LAN Virtual Leased Line Virtual Path Virtual Path Identifier Virtual Router Redundan Wide Area Network Weighted Fair Queueing Work Station World Wide Web lticast lticast Dense Mode lticast Sparse Mode 5 PDU 0000 el Connection Permanent Virtual Circuit n tocol tocol next generation ng MIB rarchy ce otocol itecture ocol nt Protocol achment work ge oint l Connection Transmission Control Protocol Internet Protocol dentifier echnology Committee us Call Virtual Circuit ier cy Protocol 0000 1111 11 11 1 1 1 1 1 0000000000000000 OC Q7 31 73 02 e7 50563i AX2000R 21 OR EAR OR 0000000000000 0274 CLOT OLE CXRBO Ah al gt 1 amp 14 32 000 ETET
235. conditions and the following disclaimer in the documentation and or other materials provided with the distribution 3 The name of the author may not be used to endorse or promote products derived from this software without specific prior written permission THIS SOFTWARE IS PROVIDED BY THE AUTHOR AS IS AND ANY EXPRESS OR IMPLIED WARRANTIES INCLUDING BUT NOT LIMITED TO THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE DISCLAIMED IN NO EVENT SHALL THE AUTHOR BE LIABLE FOR ANY DIRECT INDIRECT INCIDENTAL SPECIAL EXEMPLARY OR CONSEQUENTIAL DAMAGES INCLUDING BUT NOT LIMITED TO PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES LOSS OF USE DATA OR PROFITS OR BUSINESS INTERRUPTION HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY WHETHER IN CONTRACT STRICT LIABILITY OR TORT INCLUDING NEGLIGENCE OR OTHERWISE ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE HENRY SPENCER Copyright 1992 1993 1994 Henry Spencer rights reserved This software is not subject to any license of the American Telephone and Telegraph Company or of the Regents of the University of California Permission is granted to anyone to use this software for any purpose on any computer system and to alter it and redistribute it subject to the following restrictions 1 The author is not responsible for the consequences of use of this software no matter how awful even if they ari
236. e must display the following acknowledgement This product includes software developed for the NetBSD Project by Frank van der Linden 4 The name of the author may not be used to endorse or promote products derived from this software without specific prior written permission THIS SOFTWARE IS PROVIDED BY THE AUTHOR AS IS AND ANY EXPRESS OR IMPLIED WARRANTIES INCLUDING BUT NOT LIMITED TO THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE DISCLAIMED IN NO EVENT SHALL THE AUTHOR BE LIABLE FOR ANY DIRECT INDIRECT INCIDENTAL SPECIAL EXEMPLARY OR CONSEQUENTIAL DAMAGES INCLUDING BUT NOT LIMITED TO PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES LOSS OF USE DATA OR PROFITS OR BUSINESS INTERRUPTION HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY WHETHER IN CONTRACT STRICT LIABILITY OR TORT INCLUDING NEGLIGENCE OR OTHERWISE ARISING IN ANY WAY OUT OF THE USE OF THIS Acknowledgments SOFTWARE EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE THEO DE RAADT Copyright C 1992 3 Theo de Raadt lt deraadt fsa ca gt rights reserved Redistribution and use in source and binary forms with or without modification are permitted provided that the following conditions are met 1 Redistributions of source code must retain the above copyright notice this list of conditions and the following disclaimer 2 Redistributions in binary form must reproduce the above copyright notice this list of
237. edu gt Some of the code for making the agent embeddable into another application were adopted by David Waitzman Many more over the years BSDI Internet Server BERKELEY SOFTWARE DESIGN INC Copyright C 1992 1993 1994 1995 1996 1997 Berkeley Software Design Inc This product includes BSDI Internet Server developed by Berkeley Software Design Inc 228 Acknowledgments THE REGENTS OF THE UNIVERSITY OF CALIFORNIA of the documentation and software included in the 4 4BSD and 4 4BSD Lite Releases is copyrighted by The Regents of the University of California Copyright 1979 1980 1983 1986 1988 1989 1991 1992 1993 1994 The Regents of the University of California All rights reserved Redistribution and use in source and binary forms with or without modification are permitted provided that the following conditions are met 1 Redistributions of source code must retain the above copyright notice this list of conditions and the following disclaimer 2 Redistributions in binary form must reproduce the above copyright notice this list of conditions and the following disclaimer in thedocumentation and or other materials provided with the distribution 3 All advertising materials mentioning features or use of this software must display the following acknowledgement This product includes software developed by the University of California Berkeley and its contributors 4 Neither the name of the Un
238. eely subject to the following restrictions 1 The origin of this software must not be misrepresented you must not claim that you wrote the original software If you use this software in a product an acknowledgment in the product documentation would be appreciated but 1s not required 2 Altered source versions must be plainly marked as such and must not be misrepresented as being the original software 3 This notice may not be removed or altered from any source distribution Jean loup Gailly Mark Adler gzip prep ai mit edu madler alumni caltech edu If you use the zlib library in a product we would appreciate not receiving lengthy legal documents to sign The sources are provided for free but without warranty of any kind The library has been entirely written by Jean loup Gailly and Mark Adler it does not include third party code If you redistribute modified sources we would appreciate that you include in the file ChangeLog history information documenting your changes che HTTP server Copyright C 2000 The Apache Software Foundation All rights reserved Redistribution and use in source and binary forms with or without modification are permitted provided that the following conditions are met 1 Redistributions of source code must retain the above copyright notice this list of conditions and the following disclaimer 2 Redistributions in binary form must reproduce the above copyright notice this list of conditions and the
239. ern California rights reserved Permission to use copy modify and distribute this software and its documentation in source and binary forms for lawful purposes and without fee is hereby granted provided that the above copyright notice appear in all copies and that both the copyright notice and this permission notice appear in supporting documentation and that any documentation advertising materials and other materials related to such distribution and use acknowledge that the software was developed by the University of Southern California and or Information Sciences Institute The name of the University of Southern California may not be used to endorse or promote products derived from this software without specific prior written permission THE UNIVERSITY OF SOUTHERN CALIFORNIA DOES NOT MAKE ANY REPRESENTATIONS ABOUT THE SUITABILITY OF THIS SOFTWARE FOR ANY PURPOSE THIS SOFTWARE IS PROVIDED AS IS AND WITHOUT ANY EXPRESS OR IMPLIED WARRANTIES INCLUDING WITHOUT LIMITATION THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE TITLE AND NON INFRINGEMENT IN NO EVENT SHALL USC OR ANY OTHER CONTRIBUTOR BE LIABLE FOR ANY SPECIAL INDIRECT OR CONSEQUENTIAL DAMAGES WHETHER IN CONTRACT TORT OR OTHER FORM OF ACTION ARISING OUT OF OR IN CONNECTION WITH THE USE OR PERFORMANCE OF THIS SOFTWARE Other copyrights might apply to parts of this software and are so noted when applicable Questions concerning this s
240. ery Request PPPoE Active Discovery Session confirmation PPPoE Active Discovery Terminate Personal Computer Protocol Control Information Peak Cell Rate Protocol Data Unit PHYsical layer protocol Protocol Implementation Conformance Statement PID PI PIM DM PIM SM PIM SSM POS PPP PRI PSNP PSS IPng J UO UJ UD J H a VCI VPI VRRP WAN WFQ WS WWW Protocol IDentifier Protocol Independent Mu Protocol Independent Mu Protocol Independent Mu Protocol Independent Multicast Source Specific Multicast PPP over SONET SDH Point to Point Protocol PPP over Ethernet Primary Rate Interface Partial Sequence Number Product Support Service Permanent Virtual Chann Quality of Service Router Advertisement Remote Defect Indicatio REJect Request For Comments Routing Information Pro Routing Information Pro Remote Loop Back Routing Manager Remote Network Monitori Routing Processor Reverse Path Forwarding ReQuest Source Address Service Access Point Start Delimiter Synchronous Digital Hie Service Data Unit Super Digital I interfa Service Data Unit NSAP SELector Start Frame Delimiter Single Mode Fiber Simple Mail Transfer Pr Systems Networking Arch Sub Network Access Prot Simple Network Manageme Sequence Numbers PDU Subnetwork Point of Att Synchronous Optical Net Shortest Path First Spanning Tree Sequenced Packet Exchan Source Service Ac
241. eter Dropper dscp priority discard upc penalty drop penalty discard penalty dscp Shaper 0000 qos queue list D 1 0000000000000000 2 5 00000000000000000000 queue bandwidth O 53 2 Diff serv 54 D 26 4 41 4127888 _ EHRE m E EE Discard Discard Discard 753A 2223 2 7241 E Priority 226 Priority 5 25 Priority ag iris 5x Ca Priority 5 x2 0 1 DSCPIE 238390 DSCP4 10380 E Best Efforto Ll AFO HERE WABEBMASUMEE 2 89 2 6 X2 80 2285 1 LARLY 2 Diff serv 23 II HO D D ELO ET D E 000000 28 0000000000000000000000000000 00000 QoS 000000000000000 000000000002 00000000000000 0 0000000000000000000000000000000 0 0000 95500000 0000000000000000000 23 1 EEE HU Filter D D 95000 0 00000000000000000 0000 10000000000000000000000000 e 0000 20000000000000000000000 0000 300000000000000000000000 Diffserv 0000000000000000000 24 DiffsevQ 0000000000 000000 inbound outbound MF Marker BA Meter
242. face Converter Guaranteed Frame Rat High level Data Link Control Keyed Hashing for Message Authentication Internet Assigned Numbers Authority Internet Control Message Protocol Internet Control Message Protocol version 6 Identifier International Electrotechnical Commission Institute of Electrical and Electronics Engineers Inc the Internet Engineering Task Force Internet Group Management Protocol IS IS Hello System VII 0000 ILMI INS IP IPsec IPv4 IPv6 IPV6CP IPX ISDN IS 18 15 150 ISP ITU T LAN LCP 115 LB C LOR LSP D D OoOo 5 2 0 lt lt lt H 5 HO nj ID E HD DE PHY PICS VIII Interim Local Management Interfac Information Network System Internet Protocol Security Architecture for IP Internet Protocol version 4 Internet Protocol version 6 IPv6 Control Protocol Internetwork Packet Exchange Integrated Services Digital Network Intermediate System Information technology Telecommunications and Information xchange between systems Intermediate system to Intermediate system Intra Domain routeing information exchange protocol for use in conjunction with the Protocol for providing the Connectionless mod twork Service ISO 8473 International Organization for Standardization Internet Se
243. he pimd program is COPYRIGHT 1998 by University of Southern California Part of this program has been derived from mrouted The mrouted program is covered by the license in the accompanying file named LICENSE mrouted The mrouted program is COPYRIGHT 1989 by The Board of Trustees of Leland Stanford Junior University mrouted The mrouted program is covered by the following license Use of the mrouted program represents acceptance of these terms and conditions 1 STANFORD grants to LICENSEE a nonexclusive and nontransferable license to use copy and modify the computer software mrouted hereinafter called the Program upon the terms and conditions hereinafter set out and until Licensee discontinues use of the Licensed Program 2 LICENSEE acknowledges that the Program is a research tool still in the development state that it is being supplied as is without any accompanying services from STANFORD and that this license is entered into in order to encourage scientific collaboration aimed at further development and application of the Program 3 LICENSEE may copy the Program and may sublicense others to use object code copies of the Program or any derivative version of the Program All copies must contain all copyright and other proprietary notices found in the Program as provided by STANFORD Title to copyright to the Program remains with STANFORD 4 LICENSEE may create derivative versions of the Program LICENSEE hereby grant
244. hts reserved Redistribution and use in source and binary forms with or without modification are permitted provided that 1 source code distributions retain the above copyright notice and this paragraph in its entirety 2 distributions including binary code include the above copyright notice and this paragraph in its entirety in the documentation or other materials provided with the distribution and 3 all advertising materials mentioning features or use of this software display the following acknowledgement This product includes software developed by the University of California Lawrence Berkeley Laboratory and its contributors Neither the name of the University nor the names of its contributors may be used to endorse or promote products derived from this software without specific prior written permission THIS SOFTWARE IS PROVIDED AS IS AND WITHOUT ANY EXPRESS OR IMPLIED WARRANTIES INCLUDING WITHOUT LIMITATION THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE 237 B Acknowledgments 238 zlib Apa Copyright notice C 1995 1996 Jean loup Gailly and Mark Adler This software is provided as is without any express or implied warranty In no event will the authors be held liable for any damages arising from the use of this software Permission is granted to anyone to use this software for any purpose including commercial applications and to alter it and redistribute it fr
245. interface 0000000000000000000 000000000 show ipx traffic GOOOOOOOOOOOOO m 1 1 1 1 1 1 1 1 1 1 1 1 1 clear traffic restart ipx 2 000000000000000 ping ipx IPX D DH B UO D dump protocols ipx ipx monitor 000000000000000000000 no ipx monitor 000000000000000000000 000000 show spanning tree show bridge fdb 000000000000000000 show bridge interface 0000000000000000000000 show bridge traffic clear bridge traffic 0000000000000000 restart bridge 0000000000000 dump protocols bridge bridge monitor 000000000000000000000 no bridge monitor 161 8 0000 8 6 MC 0 000000000000000000000000 600000000000000000000 0 0000000000000000000000000000000000 8 6 1 1 MCI EL 0000000000000000000000000000000 600000 6 0 0000000000000000000000000000000000000 200 10 0 900000 10000000000000 00000000000000000 6 000000000000000000000000 000000000000000000 60000000000000000000 00000
246. ion 2 of the Simple Network Management Protocol SNMPv2 RFC 1905 1996 Protocol Operations for Version 2 of the Simple Network Management Protocol SNMPv2 RFC 1906 1996 Transport Mappings for Version 2 of the Simple Network Management Protocol SNMPv2 190701996 Management Information Base for Version 2 of the Simple Network Management Protocol SNMPv2 RFC 1908 1996 Coexistence between Version 1 and Version 2 of the Internet standard Network Management Framework 2115 1997 Management Information Base for Frame Relay DTEs Using SMIv2 RFC 2233 The Interfaces Group MIB using SMIv2 19970 10 2452 IP Version 6 Management Information Base for the Transmission Control 19980 120 Protocol RFC 2454 IP Version 6 Management Information Base for the User Datagram Protocol 1998 120 RFC 2465 Management Information Base for IP Version 6 Textual Conventions and 19980 120 General Group RFC 2466 Management Information Base for IP Version 6 ICMPv6 Group 1998 120 2495 1999 0 10 Definitions of Managed Objects for the DS1 E1 DS2 and E2 Interface Types RFC2496 1999 0 10 Definitions of Managed Objects for the DS3 E3 Interface Type 2787 2000 3 Definitions of Managed Objects for the Virtual Router Redundancy Protocol 225 00A 0000 16 RADIUS A 27 RADIUS 00000000000
247. iversity nor the names of its contributors may be used to endorse or promote products derived from this software without specific prior written permission THIS SOFTWARE IS PROVIDED BY THE REGENTS AND CONTRIBUTORS AS IS AND ANY EXPRESS OR IMPLIED WARRANTIES INCLUDING BUT NOT LIMITED TO THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE DISCLAIMED IN NO EVENT SHALL THE REGENTS OR CONTRIBUTORS BE LIABLE FOR ANY DIRECT INDIRECT INCIDENTAL SPECIAL EXEMPLARY OR CONSEQUENTIAL DAMAGES INCLUDING BUT NOT LIMITED TO PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES LOSS OF USE DATA OR PROFITS OR BUSINESS INTERRUPTION HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY WHETHER IN CONTRACT STRICT LIABILITY OR TORT INCLUDING NEGLIGENCE OR OTHERWISE ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE The Institute of Electrical and Electronics Engineers and the American National Standards Committee X3 on Information Processing Systems have given us permission to reprint portions of their documentation In the following statement the phrase this text refers to portions of the system documentation Portions of this text are reprinted and reproduced in electronic form in the second BSD Networking Software Release from IEEE Std 1003 1 1988 IEEE Standard Portable Operating System Interface for Computer Environments POSIX copyright C 1988 by the Institute of Electric
248. kkkkkkkkkkkkkkkk Some of this software has been modified by BBN Corporation and is a derivative of software developed by Carnegie Mellon University Use of the software remains subject to the original conditions set forth above kkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkk Some of this software is Copyright 1989 by TGV Incorporated but subject to the original conditions set forth above kkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkk Some of this software is Copyright C 1983 1988 Regents of the University of California All rights reserved Redistribution and use in source and binary forms are permitted provided that this notice is preserved and that due credit is given to the University of California at Berkeley The name of the University may not be used to endorse or promote products derived from this software without specific prior written permission This software is provided as is without express or implied warranty kkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkk Primary Author Steve Waldbusser Additional Contributors Erik Schoenfelder schoenfr ibr cs tu bs de additions fixes and enhancements for Linux by 1994 1995 David Waitzman Reorganization in 1996 Wes Hardaker lt hardaker ece ucdavis edu gt Some bug fixes in his UC Davis CMU SNMP distribution were adopted by David Waitzman David Thaler lt thalerd eecs umich
249. lay 0000000 ARG 2 L JL BA 1 34 frping DLCI 16 IPF FL Alae3E4 L 1 82 F XfTULI C 2 Ib emi ol IPF EL Ala ODLCI 16 zping frane relaya L ASILI PLAJI xI ping frame relaya 42 2 IL VU Ic Se MHSEBAZSNS ping atm 000 50 ATM0000 0O 0000000000000000000000000000000000000000 OAMLoopbackQ 000000000000000000000000000 2000000000000 166 8 0000 0000000 000000 0000000 0000000000 89 3 Il ll lU U 0 000000000000000000000 00000000 test interfaces D 0 e 00000000000000000 00 no test interfaces OOO 11 test interfaces O O no test interfaces 00000000000000000000 0 test interfaces O O no test interfaces 0 0000000000000000000000000000000000 087 0000000000000 2792 m ABE 1 amp AI JL 2 5 2188g WAN DHE
250. n of computer software or portions thereof marked with this legend must also reproduce the markings Any person other than the Government who has been provided access to such software must promptly identify the Contractor The Contractor Licensor is NextHop Technologies Inc located at 517 West William Street Ann Arbor MI 48103 SNMP kkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkk Copyright 1988 1996 by Carnegie Mellon University Rights Reserved Permission to use copy modify and distribute this software and its documentation for any purpose 227 B Acknowledgments and without fee is hereby granted provided that the above copyright notice appear in all copies and that both that copyright notice and this permission notice appear in supporting documentation and that the name of CMU not be used in advertising or publicity pertaining to distribution of the software without specific written prior permission CMU DISCLAIMS ALL WARRANTIES WITH REGARD TO THIS SOFTWARE INCLUDING ALL IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS IN NO EVENT SHALL CMU BE LIABLE FOR ANY SPECIAL INDIRECT OR CONSEQUENTIAL DAMAGES OR ANY DAMAGES WHATSOEVER RESULTING FROM LOSS OF USE DATA OR PROFITS WHETHER IN AN ACTION OF CONTRACT NEGLIGENCE OR OTHER TORTIOUS ACTION ARISING OUT OF OR IN CONNECTION WITH THE USE OR PERFORMANCE OF THIS SOFTWARE kkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkk
251. ng OOOO SAPOOOOOOOOOOOOOOOOOOOOOOOOOOO 1000 5 00000000 74 3 000000000000000000000000000000000 5 000000000 0000 0 00000000 00000 200 00000 00 0 SAP 0 0000000000000000000 0000000000000000000000 00000000000 e SAPO DU QD O BL D SAPOOOOOOO 0000000000000000000 00000000000 000000000000000 O 000000 20 0 000000000000000000000000000 Output 0 D D Input 00 2000000000000 Server type Server NetWork Port Network 0 00000000000000000000000000000000000000000000 U fester 000000000 3 5 5 00000000000000 82000000000 Forwarding O 0 Filtering 0 O 0 00000000000000000000000 1000 RPOOOOOOOOOOOOO 000000000000
252. nternet Draft draft ietf pim sm v2 new 05 txt 20020 80 Protocol Independent Multicast Sparse Mode PIM SM Specification revised 00000 55 6 1 Dn mn A38 0000 0000 000 RFC23731998 70 IP Version 6 Addressing Architecture RFC2460 1998 12 Internet Protocol Version 6 IPv6 Specification 2461 1998 120 Neighbor Discovery for IP Version 6 IPv6 RFC2462 1998 12 Ipv6 Stateless Address Autoconfiguration 2463 1998 120 Internet Control Message Protocol ICMPv6 for the Internet Protocol Version 6 Ipv6 Specification 2473 1998 0 120 Generic Packet Tunneling in IPv6 Specification RFC2710 1999 100 Multicast Listener Discovery for IPv6 RFC3056 2001 20 Connectioin of IPv6 Domains via IPv4 Clouds 00A 0000 19 IPv6 DHCP 000000000 1000 0000 0000 000 RFC3315 90080 Dynamic Host Configuration Protocol for IPv6 DHCPv6 draft ietf dhcpv6 opt prefix delegation 05 txt IPv6 Prefix Options for DHCPv6 20030 100 draft ietf dhc dhepv6 opt dnsconfig 05 txt DNS Configuration Options for DHCPv6 20030 80 draft ietf dhc dhcpv6 opt timeconfig 03 txt Time Configuration Options for DHCPv6 20030 100 draft ietf dhc dhcpv6 interop 01
253. o the following restrictions 1 The author is not responsible for the consequences of use of this software no matter how awful even if they arise from defects in it 2 The origin of this software must not be misrepresented either by explicit claim or by omission 3 Altered versions must be plainly marked as such and must not be misrepresented as being the original software WASHINGTON UNIVERSITY IN SAINT LOUIS Copyright C 1993 1994 Washington University in Saint Louis rights reserved Redistribution and use in source and binary forms with or without modification are permitted provided that the following conditions are met 1 Redistributions of source code must retain the above copyright notice this list of conditions and the following disclaimer 2 Redistributions in binary form must reproduce the above copyright notice this list of conditions and the following disclaimer in the documentation and or other materials provided with the distribution 3 AII advertising materials mentioning features or use of this software must display the following acknowledgement This product includes software developed by the Washington University in Saint Louis and its contributors 4 Neither the name of the University nor the names of its contributors may be used to endorse or promote products derived from this software without specific prior written permission THIS SOFTWARE IS PROVIDED BY WASHINGTON UNIVERSITY AND CONTRIBUTORS AS IS
254. oftware should be directed to Pavlin Ivanov Radoslavov pavlin catarina usc edu Id LICENSE pimd v 1 1 1998 05 29 21 58 20 kurtw Exp Part of this program has been derived from mrouted The mrouted program is covered by the license in the accompanying file named LICENSE mrouted The mrouted program is COPYRIGHT 1989 by The Board of Trustees of Leland Stanford Junior University LTCS Label Traffic Control System Copyright C 1999 Harris and Jefferies Inc All rights reserved Copyright C 2000 NetPlane Systems Inc All rights reserved 241 B Acknowledgments 242 KAME IPv6 STACK Copyright C 1995 1996 1997 1998 1999 and 2000 WIDE Project All rights reserved Redistribution and use in source and binary forms with or without modification are permitted provided that the following conditions are met 1 Redistributions of source code must retain the above copyright notice this list of conditions and the following disclaimer 2 Redistributions in binary form must reproduce the above copyright notice this list of conditions and the following disclaimer in the documentation and or other materials provided with the distribution 3 Neither the name of the project nor the names of its contributors may be used to endorse or promote products derived from this software without specific prior written permission THIS SOFTWARE IS PROVIDED BY THE PROJECT AND CONTRIBUTORS AS IS AND ANY EXPRESS OR IMPLIED WAR
255. onegotiation 0401000000000 0 000000000000000000000000000000000000000000000 0 00000000000000000000000000000000000000000000000 050 0000000 0000 IEEE802 1Q Tag VLAN O 0 0 0 0 0 0 0 IEEES021p 0 0 000 00000 0000 9 1 2 Tag VLAN J I LAN I LH B U U 0000 00 000 000000000000000000000 10 VLAN 0000000000 O 1 4000 12600000000 0000000000 OOO 000000000 VEANO OOO 0 00 0000 0 000 00000 00 176 9 0000000 0000LAN000000000 v40 00 12600000000 Tag VLAN U 20 Tag VLAN OOO 0000000000000 LANG OOOO TagVLAND0000000000000LAN0000 0 Tag VLANDO0O00000000000000000000000000 e vang 0000000 00Ta 000000000000000 8000000000000000000000000000 00000000000000 Ta 00000000000000000 00000 0 000000000000000000000 TPID Tag Protocol Identifier 0x8100 0 9100 030 000000000 0000000000 000000000 00000000 00 124000 1260 000 00000000000000000000 6 000000000000000000 0 000000000000000000000 000000000000 e IPXD ODD 0000000000 e 40 000000000000 e 0000000000000 0 40 VLAN ID VLAN 2 00001 000000000000000000000
256. p 0000 00 0000 Diffserv 0000000000000000 25 OOOO DiffsevQO 0000 2 81 CAAA RI YF 2 0 1481 tH 2181 20 H HU 2 8 109 2 2 8 LINE 016142 818 DSCPE ERA BIRRE Traffic Conditioner MF BA Marker 0 0000000000000000000 22 0000000000 000000 Classifier 00000000000000000000 2000000000000 Marker MF Classifier 000000 880 000000000000 0 BA Classifier 0000000 8 TrafficConditioner Meter 8 0 0 Marker Shaper Dropper 0 0 0 Marker 00000000000000000000000 80 0000 0 00000000 Dropper Meter Shaper 00000000000000000 2 2 1 0 0000000000000 200000000 51 2 Diff serv 10 MF Classifier Multi Field Classifier MF Classifier 000000000000000000 20000000000000000000 20000000000000000000 1 3 0000000000000000 20 Marker Marker Q MF ClassifierQ 00 0 0 IPOOOU 60000 2 500000000000000000 0000000000000000000000000 2 0000000000000 BA Classifier Behavior aggregate Classifier BA Classifier 0000000000000000000000 0000000000000 0000 2
257. p 00000 U 400000000000 0 0000000000000000000000000000000000000000000 SNMP 00 00000000000 0000000000000000 00 0000000000600 0000 00 0000 00900000000 030 8 0 009000000000 0 0000000000000000000000000000000000000000 129 6 0 000000000000000000000 6 3 0000000000000 000000 00000000 Trap 0000000000 e 000000000000000 e 00000000000000000 e 00000000000000000000 000 5 000000000000000000 BGP Trap e RMON Trap 000 000 MiBIDDUBDDUBDDUDDUDDUDD 000000 Trap 000000000000000000000000000 000 8 0000000000000 0 000000000000000000 18000000 4 0000 800000000000 0000 6 44 PVC Trap 130 000000 PVC 0 000000000 000000000 0 O D 00000 PVCTrapp00000000000000000000000 00 0 00000 0000 0000000 0 0000000000000000000000000 0 0 Trap 00000000000000 800000000000000000 0000 0 0 0 00 00 0 ifindexD e grAtmIntfPVcFailues 0 00 000000000000 00000
258. rase protocol dump ipv6 unicast show mcache 60 08 000000000600 4 show ipv6 pim show ipv6 mroute IPv6 00 0000 00000 0 show ipv6 mld IPv6 31 01 show ipv6 rpf RPF EH D restart ipv6 multicast dump protocols ipv6 multicast erase protocol dump 6 ipv6 multicast 00000000000000000 QoS I show qos ip flow QoSIPOOOUDODOUD clear qos ip flow QoS 0000000000000 show qos flow clear qos flow show qos queueing 0 0000000000000000000000 clear qos queueing 0 0000000000000000000000 show ipx route show ipx servers 160 8 0000 00 00000 show ipx
259. rol Protocol Extensions for Name Server Addresses RFC1334 1992 100 PPP Authentication Protocols RFC1994 1996 80 PPP Challenge Handshake Authentication Protocol CHAP RFC14710998 60 The Definitions of Managed Objects for the Link Control Protocol of the Point to Point Protocol 1472 1993 0 60 The Definitions of Managed Objects for the Security Protocols of the Point to Point Protocol RFC1473 1993 60 Definitions of Managed Objects for the IP Network Control Protocol of the Point to Point Protocol 00A 0000 A 3 PPP over Ethernet 0000000000000 000000 00 000000000000000 00000000000 00000000 000 00172 00000000000000 000 00000000000 00000000000000 000 00000000000 2 WAN D 4 0000000000000 00 00 ITU T V 24 List of definitions for interchange circuits between data terminal equipment DTE and data circuit terminating equipment DCE ITU T V 35 Data transmission at 48 kilobits per second using 60 108 kHz group band circuits ITU T X 21 Interface between data terminal equipment and data circuit terminating equipment for synchronous operation on public data networks ANSI EIA RS 232 Interface Between Data Terminal Equipment and Data Circuit Terminating Equipment Employing Serial Binary Data Interchange
260. rranties including without limitation the implied warranties of merchantibility and fitness for any particular purpose tcpdump Copyright C 1989 Carnegie Mellon University rights reserved Redistribution and use in source and binary forms are permitted provided that the above copyright notice and this paragraph are duplicated in all such forms and that any documentation advertising materials and other materials related to such distribution and use acknowledge that the software was developed by Carnegie Mellon University The name of the University may not be used to endorse or promote products derived from this software without specific prior written permission THIS SOFTWARE IS PROVIDED AS IS AND WITHOUT ANY EXPRESS OR IMPLIED Acknowledgments WARRANTIES INCLUDING WITHOUT LIMITATION THE IMPLIED WARRANTIES OF MERCHANTIBILITY AND FITNESS FOR A PARTICULAR PURPOSE Copyright C 1990 1991 1993 1994 John Robert LoVerso All rights reserved Redistribution and use in source and binary forms are permitted provided that the above copyright notice and this paragraph are duplicated in all such forms and that any documentation advertising materials and other materials related to such distribution and use acknowledge that the software was developed by John Robert LoVerso THIS SOFTWARE IS PROVIDED AS IS AND WITHOUT ANY EXPRESS OR IMPLIED WARRANTIES INCLUDING WITHOUT LIMITATION THE IMPLIED WARRANTIES OF MERC
261. rvice Provider International Telecommunication Union Telecommunication Standardization Sector Local Area Network Link Control Protocol ight Emitting Diode Logical IP Subnetwork Loop Back Logical Link Control Low Latency Queueing 3 Weighted Fair Queueing Link Quality Report Link State PDU edia Access Control emory Card edia Access Control essage Digest 5 anagement Information Base ulticast Listener Discovery ulti Mode Fiber aximum Receive Unit aximum Segment Size aximum Transfer Unit Not AcKnowledge Network Address Port Translation Network Address Port Translation Protocol Translation Network Address Translation Network Address Translation Protocol Translation Network Control Protocol Neighbor Discovery Protocol Network Entity Title Network Basic Input Output System Network Interface board Next Level Aggregation Identifier Network Layer Protocol Network Service Access Point Not So Stubby Area Network Time Protocol Operation Administration and Management Optical Carrier level 12 concatetenation Optical Carrier level 3 concatenation Optical Carrier level 48 concatetenation Optical Network Unit Open Systems Interconnection Open Shortest Path First Organizationally Unique Identifier packet per second 5 PADding PPPoE Active Discovery Initiation PPPoE Active Discovery Offer PPPoE Active Discov
262. s STANFORD a royalty free license to use copy modify distribute and sublicense any such derivative works At the time LICENSEE provides a copy of a derivative version of the Program to a third party LICENSEE shall provide STANFORD with one copy of the source code of the derivative version at no charge to STANFORD 5 STANFORD MAKES NO REPRESENTATIONS OR WARRANTIES EXPRESS OR IMPLIED By way of example but not limitation STANFORD MAKES NO REPRESENTATION OR WARRANTIES OF MERCHANTABILITY OR FITNESS FOR ANY PARTICULAR PURPOSE OR THAT THE USE OF THE LICENSED PROGRAM WILL NOT INFRINGE ANY PATENTS COPYRIGHTS TRADEMARKS OR OTHER RIGHTS STANFORD shall not be held liable for any liability nor for any direct indirect or consequential damages with respect to any claim by LICENSEE or any third party on account of or arising from this Agreement or use of the Program 6 This agreement shall be construed interpreted and applied in accordance with the State of California and any legal action arising out of this Agreement or use of the Program shall be filed in Acknowledgments a court in the State of California 7 Nothing in this Agreement shall be construed as conferring rights to use in advertising publicity or otherwise any trademark or the name of Stanford The mrouted program is COPYRIGHT 1989 by The Board of Trustees of Leland Stanford Junior University PIM sparse mode pimd Copyright C 1998 by the University of South
263. s software must display the following acknowledgement This product includes software developed by Christopher G Demetriou 4 The name of the author may not be used to endorse or promote products derived from this software without specific prior written permission THIS SOFTWARE IS PROVIDED BY THE AUTHOR AS IS AND ANY EXPRESS OR IMPLIED WARRANTIES INCLUDING BUT NOT LIMITED TO THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE DISCLAIMED IN NO EVENT SHALL THE AUTHOR BE LIABLE FOR ANY DIRECT INDIRECT INCIDENTAL SPECIAL EXEMPLARY OR CONSEQUENTIAL DAMAGES INCLUDING BUT NOT LIMITED TO PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES LOSS OF USE DATA OR PROFITS OR BUSINESS INTERRUPTION HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY WHETHER IN CONTRACT STRICT LIABILITY OR TORT INCLUDING NEGLIGENCE OR OTHERWISE ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE 233 B Acknowledgments 234 DAVID HOVEMEYER Copyright C 1995 David Hovemeyer lt daveho infocom com gt rights reserved Redistribution and use in source and binary forms with or without modification are permitted provided that the following conditions are met 1 Redistributions of source code must retain the above copyright notice this list of conditions and the following disclaimer 2 Redistributions in binary form must reproduce the above copyright notice this
264. se from flaws in it 2 origin of this software must not be misrepresented either by explicit claim or by omission Since few users ever read sources credits must appear in the documentation 3 Altered versions must be plainly marked as such and must not be misrepresented as being the original software Since few users ever read sources credits must appear in the documentation 4 This notice may not be removed or altered diff grep Copyright C 1988 1989 1992 1993 1994 Free Software Foundation Inc This program is free software you can redistribute it and or modify it under the terms of the GNU General Public License as published by the Free Software Foundation either version 2 or at your option any later version This program is distributed in the hope that it will be useful but WITHOUT ANY WARRANTY 235 B Acknowledgments 236 without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE See the GNU General Public License for more details You should have received a copy of the GNU General Public License along with this program if not write to the Free Software Foundation Inc 675 Mass Ave Cambridge MA 02139 USA less Copyright C 1984 1985 1989 1994 1995 1996 Mark Nudelman rights reserved Redistribution and use in source and binary forms with or without modification are permitted provided that the following conditions are met 1 Redistribu
265. stentValue 12 resourceUnavailable 18 commitFaild 14 undoFaild 15 0 00000000000000000000000000000000 notWriteable 17 000000000 inconsistentName 18 0000 6 64 6 4 1 1 1 1 HUB 0 0 0 0 0 trap 0000000000 00000000000 00000 00000000000000 SNMPOOOOOOOO 0 000000000000000000000000000000000000000 80000000000000000000000000 0 0 000000000000000000000000000000000000000 00000000000 o0 Oo oO 0 0 0 0 0 0 0 0 0 0 0 0 000 V 6 4 2 0000000000000 20000000000000000000000000000000 0000000000000000000 6 18 0000000000 r 257 Bii 10 GHRMIB 1MsysObject DOER ESNA 1 5 70554 FL Z F2 ZOTERI zd Hak PBS 2 755026 3 SENDERS EDES L Th D ORI BIER F 2 TIBET 6 4 3 UO MIBI Trap GBP Trap RMON Tra
266. tions of source code must retain the above copyright notice this list of conditions and the following disclaimer 2 Redistributions in binary form must reproduce the above copyright notice in the documentation and or other materials provided with the distribution THIS SOFTWARE IS PROVIDED BY THE AUTHOR AS IS AND ANY EXPRESS OR IMPLIED WARRANTIES INCLUDING BUT NOT LIMITED TO THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE DISCLAIMED IN NO EVENT SHALL THE AUTHOR BE LIABLE FOR ANY DIRECT INDIRECT INCIDENTAL SPECIAL EXEMPLARY OR CONSEQUENTIAL DAMAGES INCLUDING BUT NOT LIMITED TO PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES LOSS OF USE DATA OR PROFITS OR BUSINESS INTERRUPTION HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY WHETHER IN CONTRACT STRICT LIABILITY OR TORT INCLUDING NEGLIGENCE OR OTHERWISE ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE tcpd Copyright 1995 by Wietse Venema Allrights reserved Some individual files may be covered by other copyrights This material was originally written and compiled by Wietse Venema at Eindhoven University of Technology The Netherlands in 1990 1991 1992 1993 1994 and 1995 Redistribution and use in source and binary forms are permitted provided that this entire copyright notice is duplicated in all such copies This software is provided as is and without any expressed or implied wa
267. titutt for Informatikk University of Tromso Norway Permission to use copy modify and distribute this software and its documentation is hereby granted provided that both the copyright notice and this permission notice appear in all copies of the software derivative works or modified versions and any portions thereof and that both notices appear in supporting documentation THE UNIVERSITY OF TROMSO ALLOWS FREE USE OF THIS SOFTWARE IN ITS AS IS 243 B Acknowledgments 244 CONDITION THE UNIVERSITY OF TROMSO DISCLAIMS ANY LIABILITY OF ANY KIND FOR ANY DAMAGES WHATSOEVER RESULTING FROM THE USE OF THIS SOFTWARE The author requests users of this software to send back any improvements or extensions that they make and grant him and or the University the rights to redistribute these changes without restrictions Invenia Innovation A S Copyright C Invenia Innovation A S Norway All rights reserved Author Feike W Dillema Invenia Innovation A S Norway Permission to use copy modify and distribute this software and its documentation is hereby granted provided that both the copyright notice and this permission notice appear in all copies of the software derivative works or modified versions and any portions thereof and that both notices appear in supporting documentation INVENIA INNOVATION A S ALLOWS FREE USE OF THIS SOFTWARE IN ITS AS IS CONDITION INVENIA INNOVATION A S DISCLAIMS ANY LIABILITY OF ANY KIND
268. tributions in binary form must reproduce the above copyright notice this list of conditions and the following disclaimer in the documentation and or other materials provided with the distribution 3 All advertising materials mentioning features or use of this software must display the following acknowledgement This product includes software developed by WIDE Project and and its contributors 4 Neither the name of the University nor the names of its contributors may be used to endorse or promote products derived from this software without specific prior written permission THIS SOFTWARE IS PROVIDED BY THE PROJECT AND CONTRIBUTORS AS IS AND ANY EXPRESS OR IMPLIED WARRANTIES INCLUDING BUT NOT LIMITED TO THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE DISCLAIMED IN NO EVENT SHALL THE PROJECT OR CONTRIBUTORS BE LIABLE FOR ANY DIRECT INDIRECT INCIDENTAL SPECIAL EXEMPLARY OR CONSEQUENTIAL DAMAGES INCLUDING BUT NOT LIMITED TO PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES LOSS OF USE DATA OR PROFITS OR BUSINESS INTERRUPTION HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY WHETHER IN CONTRACT STRICT LIABILITY OR TORT INCLUDING NEGLIGENCE OR OTHERWISE ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE University of Tromso Copyright C 1999 2000 2001 2002 University of Tromso Norway All rights reserved Author Feike W Dillema The Pasta Lab Ins
269. trol and Congestion Control in B ISDN 1 610 B ISDN Operation and Maintenance Principles and Functions ATM Forum UNI V3 0 V3 1 ATM Forum TM Traffic Management Specification V4 0 Addendum to Traffic Management V4 0 for ABR parameter negotiation ATM Forum TM Traffic Management Specification V4 1 af tm 0121 000 AAL 1 362 B ISDN ATM Adaptation Layer AAL Functional Description 1 363 5 B ISDN Adaptation Layer AAL Specification Type 5 LLC RFC 1483 Multiprotocol Encapsulation over ATM Adaptation Layer 5 0000 000 2225 Classical IP and ARP over RFC 2492 IPv6 Over ATM Networks 8 IPOOOUOU 40000000000 0000 0000 000 RFC791 1981 0 90 Internet Protocol RFC792 981 90 Internet Control Message Protocol 826 1982 110 An Ethernet Address Resolution Protocol Or converting network protocol addresses to 48 bit Ethernet address for transmission on Ethernet hardware 922 1984 10 Broadcasting Internet datagrams in the presence of subnets RFC950 1985 8 Internet Standard Subnetting Procedure RFC1027 1987 10 Using ARP to implement transparent subnet gateways 1122 1989 10 Requirements for Internet hosts communication layers 219 00A 0000 0000 0000 RFC1519 993 9 000 Classless Inter Domain Routing CIDR an Address Assignment and Aggregation Strategy RFC1812 995 60 1933 1996 0 40
270. uest a c SNMP GetResponse noSuchName c a 1 b 2 3 a PC WS SNMPvx 0 0000000 0 GetResponse MIB 0 endOfMibView 0000 SNMPv2 000 GetNextRequest 0000000000000000 123 6 5 0 6 9 GetNextRequest O 0 0 0 0 0 SNMPv2c FEE SNMPIZ Yz GetNextRequest a c SNMP x lt 57 m FMIB GetResponse b 2 c endOfMibVi ew 1 b 1 b 2 623 PC WS 6 3 3 GetBulkRequest U GetBulkRequest 1 00 00 GetNextRequest 0 00000000000000000000 0 0000000000000000000000000 8000000000000000000 8000000000000000000000000000 1300000000 00000000 800000000000000000000 800000000000 GetResponse 1 000000 MBOOOOOOOOOOO 800000000000000000 0000000 MIB UU 0 Ul GetResponseQ 0000000 MIB 0 endOfMibView D OOO GetNextRequest 0000000000000000 6 10 GetBulkRequest 000000 018 8 gt 281 82 LAE ARE 52 2 GetBulkRequest U 3 L 2 SNMP x 3 GetResponse b 2 d 4 c 3 e 5 0 ULIXES SRBIITERGOMIBI ZE27 32 amp ARG GetBulkRequest a L 2 SNMP 52 SWMPI LZrL2k GetResponse b 2 hzendOfMi bV i ew 3 hzendOfMi bV i ew 6 3 4 SetRequest I D U

Download Pdf Manuals

image

Related Search

Related Contents

A Criação de Valor em Portugal Dissertação para  User`s Manual v0.63 - Center for the Study of Digital Libraries  FiFi-SMSer  PERIGO! - Bosch Security Systems  Pertutti  Philips arcitec Electric shaver RQ1085  fornitura tubazioni, pezzi speciali preisolati e verifica meccanica per  NAS-7450 / NAS-7850 - PLANET Technology Corporation.  SUNNY EXPLORER 1.1 - User Manual  MODELO MTCA 09 MANUAL DE INSTRUCCIONES  

Copyright © All rights reserved.
Failed to retrieve file