・ アメリカ−連邦 - 安全衛生情報センター
Contents
1. E BIBLE HEEL B GERE2. 4 Bae EE Tb 0000 0000 0000 90000 ou 00 66Federal Register at 64946 200108 0000000000
3. EZ E L3 E3 E3 E3 5 ES E3 E3 E3 L3 L3 C3 C3 E3 EST Ed Exc ET E EZ E 3 ETE EZ L3 L3 C3 C3 U U U U U U U Assessment M ethodology for Occupational Exposure to Environmental Tobacco Smoke 63 Federal Register at 34934 34935 1998 o0 m OAS o0 a EET Ey SES ETE E LES os os r3 8 0 Lm LEE L3 Eun Em SS Poo 2500 EXE UE Flag MERE EE ik Bon 2500 FS Coo e Fl e E Hm E Ei CRDI Hm Ee Hm 5
4. 56 9 58 n 5 0 00 9 200000000000000 10 000000000000000000000 2
5. 25 o mm E E SJ 3 Ed Ez mmm mm 2 2 BA L3 L3 L3 L3 EJ L3 C3 CE DL E D E z Es E EI SES EE ES Ed t Fa ES zx was EE EE ESI EE TEST ESL 4 EIE E L3 L3 O LJ 3 E
6. 0 024 43 11 188 3 968 7 121 104 932 40 091 68 138 000 230 00000000000 0000000 25 HH BH EE TE EE EE EHE BILE 3 5 51 0 580 000000 0000000000 500 0000000 20 000 0100 0000000000 4 0000 000000000 00 HHHBBBHH 100000 2000000000000 000 U S Department of Labor OSHA Office of Regulator Analysis 1994 Indoor Air Quality 59 15968 16039 1
7. UDDDDDBDBBDBDBDSBUDBUUDDUDUUDUDBDDHBDUD Occupational Safety and Health 5008 00 00000000000 70000 100000000000 440000 17 120 0000000000000 000 1300000 UD 1900000 200000 22 U 5 3 5
8. 5 3 m r3 Ed L3 L3 o E r3 L3 L3 p rJ q Jj q J J 2 H ELE L1 r3 e og 0000 000000 0000000 0 0 0 0 0 000 Dun 000 000 Dun 2 0 1 0 0 0 00000 0 0 00000 0 0 00000 0 0 00000 0 o 3 L3 C3 C3 5
9. 11
10. 5 60 boo 5 2 0 00 Secretary of Health and Human Services 8 O National Institute for Ooo000p a 54 a a Boo maaa 223 ES Eie E 0 8 ha 2000002000 HEROA a Ea cmm Tone B eI EEG rima mnmmsuHHWBpmMpBm amp THgmeODgm 221 7102 aoza
11. 00001 00 SE SNS EET 6 157 EET HE EDT
12. 9 NOU OA 000 non industrial work environments 0 EE EE 000 00 00000000000 00001 0 industrial work environments
13. gdh RA AD a Ra 60 Uu 5 EP Rg A OOOO plenum B chase 000 5 E EST EZ pj EJ EJ o FJ OOOO E J Jj m 0 L 0 uu 0 L3 L3 Fd L3 L3 m L3 EJ LE LJ 000 40 000000006060 OOO nsory irritation uuu U U se ergies 0 asthma T nosocomial infections 0 0 humidifier s aires U 0 o 000 u uut uu ry all h
14. 40 CO 040 000000 5 5 5 8 18 0 3 1 21 8 29U S C A s 65106 00 000000000000 000000 199500 251000000600 00 2570000 9 290 5 5 6670 000000000000000000000 100 257 2580 0
15. 00 03 MEM INANE PAWS BABA AUD BEEN BWIMO 0 00 00 as built construction document 4 0 O HVAC 36 0 00 00000000000000000000000 0000000 0000 000000 0 0 0 potable water systems 0 00000000 0 0 0 energy management sysstem jliguugaagggaagauggauaguggaaguguamgaugaugulrctedeltlu 000000 W000 8 90 3 v U 39 cooling coil condensate drip 0 0 drainage 0 0 0 0 outside air damp
16. 0 0000 OOOO eu 1000 h 0 gt 00 h 5 0 0 au U 6 0 n 420000 13 0 00 00000000 3440 3330
17. BROS 5 fn p a Er 3 gt r3 00 oog LE aoo oono Iz GebnnuuuaguugogsugHEngn ugg DHA E EI og gt A Hg r3 2525555 9 Bgm m uu rouuuz gmm auunmgmumm SOO Lung c 060 50 0 Boone a 143 Occupational Safety and Health O0 AERA ET SEE EET BS EE D
18. 100 90 0 A o ADAU E o 00000 19940 3000000000 0 0 00 Indoor Air Quality 0 0000 Tn oa ng om DAD Pa 20010 120000000 A 1 Lo Op Opan e nm lt z o E ed E FDS s vm Go um aantoon ORG 00 SS 2o70 r3 o o ri
19. Federal Register 0 00 00 000 00000 HT EEE ENE EE 30 0 E EE EIE T E PS TAB EPA EE gg 80 DE ELTE BREEN EA 07000000000 OSHA 0000000000000000 00000000000 Occupational Safety and Health Administration B D Assistant secretary of Labor 000000 0 0 0 0 0 OOOO Compliance Safety and Health Officers 0 OOO 00 000 8 1410 0 0 0 0 regulation U U
20. 0000 2560 000000000 60000 00000 b000 49 0 90 5000000000000000 00000000000000000000000 0000 hid 3 0 3 153 30 D EE 5 000000000 an 20000 6 noo 600
21. AOD DNA RA EVI DER 30 1992 1200000000 D Environmental Protection 0000000 0 0 Respiratory Health Effects of Passive Smoking Lung Cancer and Other DisordersgOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOODOOOOOOO 31 0 000 59Federal Register at 15968 16039 00 199 0 DH 00 32 7000000000000 2 1000000 0000000000 3590 0000 147
22. 000000000 0A OA AB ugummumumuugmuuguaummuuuagaHudzmiulutluttlu 2000 2 00 20 2 000 0 2 000000 1 OOOO 5 2 EJ EST E 0 L 0 gt m 1 J L1 0 0 0 0 3 L 24 L3 L3 r3 mm 0 0
23. 5 155 L3 r3 z3 0 J D HVAC
24. EE EET 4 50 40000000600 2 l AR RTI ET BE BIET 000000600 00000600 TRE UD HH contaminants
25. ESAS E 00000000 000 0 0 0 designated PIJ 0000000 00000000 2000 00000 building systems 37 CERAM EET JE 0 6 1 6 schematics 0000000000 as built construction document 00 01 NAME WE WES EE APE outside air ventilation rate 000000000000000 potable hot water storage and delivery temperature 0 00000000 range of space relative humidityQ UD 0 D 0 space pressurization requirement 000 D operating performance 6088 0 00000000000000
26. J rJ q q q J ET EI 0 20 5 20000 General Duty 630586 6 Secretary of Laborl 10000000 00 00 United States Code Annotated 0290 651 678 00 0 0 00 29 04 651 7808 000000 2 OQO0000000000000000010 0000000000000000 00000 1120 200 19950 0 1120 D QD0000000000000000000000001970000000000000000 92 254 996 340 254 5 2 00 0 29U S C A 6510000 6 Industrial Union Department AFL CIO v American Petroleum Institute 448 U S 607 611 1980 000000000 00000 00 10ppm 000 1
27. EE ELDER BEC AME local source capture exhaust ventilation 2 0 20000000000000 029 part 1926 subpart E 0000 Personal Protective and Life Saving Equipment 29 C F R part 1926 52 Occupational Noise E xposure 29 C F R part 1910 subpart 00 29Cc F R part 1910 95 QOOOOOOOOOOOOOOOOOOOOOOOO 151 0 E DE q J Ld P3 E 5 L 0 5 0 0 0 L 3 ii 000 24 tati 0 00000000000000 00000 0 renovation and 60089 000 0 01 00000 00 0
28. Code of F edera U D Federal U 0100 lati 0 0 0 0 0 0 0 L3 00000 ons 0000 C U om agg L3 r3 Exp Ez 0 0 0 0 I Regulations Register 0 Federal F R HB D 000 000 Dun 000 000 f 0 2001 10 0 2670 00000000 D D Fede Regi standard uu uu 00 Regulations U U al Reg ter QO u 000 0 0 0 0 0 s 0 0 0 1200000000 0 0 0 0 9 0 0 0 0 0 0 0 0 0 0 94 0 0 0 0 0 9 ag 0 000 00 penaltylOOO 100 a0 0 000000060 WWE 5 B aaa an iwa 6 0000000 0 0 25600 000000000000000 0 OO tempoaryresrainingorder 13 an 20 000000600
29. EE BEER BEP ARR EBA EE ED ED SERE AABN AR MOB BE ED Bid CP DERE EET OOOO 1970 OSHAT ENE 004 OSHAO 50 00000000 0 00 IU Summary and Explanationg 0 000000 bD Definitions Paragraph b OOOO 000000000000000 5 00000000 0sHkag 50000000000000 00000000000000 148 0 Indoor air quality compliance program 0 IAQ ETT EPI ASQ
30. pau QO 0 hypersensitivity p Legionnaires disease carbon monoxide 0 formaldehyde 0 endotoxing 000000000 0 0 mycotoxin 00 000 ugggagagaggagagagaaga tuutd 800ppm0 000000000 000000 90 600 itis U esticides e r 00000 150 0 personal protective equipment 0 0000000000001 12 130 0000 0 009000000000 000600 uugagumugagagumuamuuguagguadguuuuuuti
31. 2 2 1 H 09000 00 1 0000000 0 19700000000 Occupational Safety and Health Act of 197011 OSHA D rc B B D B 7E 7I u 20 0 osHAr T 14 000000000 250000000000 BHA AAA RN RA AA AD A Bh 00 00 000000 0 5 eg L3 EI EJ Ed EJ ES Ej E ur EI J rJ rJ ao E gt L1 o 2 L1 L3 L3 L3 E E EE EYES EJ EJ EA EI L3 L3 L3 L3 J J DOSES 3 L1 L3 L3 OO C J EST E 1 ET E Ez ESI 9
32. 0 9 0 2
33. EJ EJ 0 0 BOA ADAG 9 0 cx OOOOOOOOOOOOO modificationgnOOOOOOOOOOOOOO 00060 UD O O designated employee representative 4 Director D HH D HU n 000000000 OOOO 000000000000000000000000
34. EST Og EST Er E EJ E E L1 L3 Jj L3 L3 OOO H 52 000000000000 10 0 L3 L3 L3 00 9 9 parc 0 0 0 0 0 000 a 2 C F R Par 191 00000035 0 0000000 0 0 0 0 0 9 20 og og og crm og w zal 0000 OOOO
35. 0 58 26022 0 person 0 00 0000000000000 65 57 FR 42102000 ud OOO competent 156
36. 158 1 12 0000000 00 2001 DAOR Y E ting on Risk E 25026 ug F 00 55 8 5 253 359 quantitative risk assessment 0 L3 C3 C3 EQ EIL h il 1 9 938 ma
37. ON Ex 6 og EIE onp Ec EE ia True S r3 2o Emp OS AD 5 ong LEE Boo P Pum5mu 2 2 m fo L3 rr EX EE Ooo oo Er Cm o nm e iE L3 mn 5 Ego s gt L3 mn a o mm oo r3 6 ESL Om 5 Q 0 oo Dan d erg ri Don Cogo ug ES ES 1 5 5 o0 20 as Hag EE Oop Togo oop o 898 op c 3 ra r3 Dog 2 gt 2 t3 N 6 Oon Hopa aiv p pem Hg 00 E El ES ES r3 o 55 09 u 22224 5 pip E E BEBO Ed O E CE DD op O85 gu0o0g4u0n0 o o EL 2 8 E a Haut 2 om puo 5 2 x Lu E mnm Edi Ee qup EE EXE o0000 s E 9 Or L3 L3 r3 E L3 C3 C
38. danger 120 0000000 0 00000 00000 90000000000000 000000019890 TE ERR REDE EAE p EP PR EE ER 0O 19910 5000000000 0 1991 90 20 BRR RENE NESE Request for Information 0 0 00 exposure assessment 70 ELS pr TESI 0 dng Bg EP BD 120000 0000000000000000 AMAT MAA AMA FE El la Eh es ETE
39. 00000 250 000000000000 3 0000000 250000 ES gt SOARS ODT rra o0poo0opop SFOS 20072 o20p00009 004 5 00 preemptionog 0 000000 5 5
40. 3 O ES congu OOO g OOO a Las BIET ele no E oga oo Hnonogdoaoa r3 ph r3 On og soo eE a a 1 un 5 23 66 Federal Register at 64946 2001 145 8000000000000 6 5 0 environmental tobacco s0o0300000000 19870 Ep DEBE EE United States Code 29 29 U S C 0000000000000 6 0 000 0000 6550 petitiong DEA DEDE BIB BE EET ET EET AAA grave
41. Bann Hg Ei Comm Ep ca nu Hpo 2000 Ba EE Huang lp Ig mpeg d sx cuu EJ Hir m Henug Elgy Bey o BG mg Dann Hg Bj m Ogon Ooo HE GAR po Room 86 7 zona Emo m poo Ss s ooN oo Ngon oooo 8565 0520 Et gt E E Er oeornmurnmu i x OO 00000 woo m 00000 goo Eire zu 0 L o000 ird 000000 rr OF uuu 159 5
42. SCR ag Dg NR ZA BABE 0000 1300000000000 ee DT RD Be ma al a oh rE 24 30000000000 2 OSHA6 0 02 00000000000000 0000A0000000000000000 26 ASH Action on Smoking and 000000000000000 00 19710000 27 56 Federal Register at 47892 1991 n 1920 30000000000000 29 HVAC Heating ventilation and air conditi 146
43. er 00000000 0 0 0 actuatorpy 00 B B d d air distribution ductwork DB D 00000000000 0 149 4 I B D water treatment log OOO X60 0 0 D illness 0 0000000 TE ELT E ET DEED OAR ET ET LH IAQOOOOOOOOOO building mechanical code 0000000 ventilation code 000000000 90 1000 0000000 900000 EL ED 0000000000000000000
44. ulut designated smoking area 0 ELSE BE E TIERE EE BAT ELE CBE E abo BE BE DP BE T ABE negative pressure 1 U 0 ERE ED eB BESTE EHI BERNA EAE E EE ET ER SN EE 1 0 U general ventilation 000000000 OO point sourcen
Download Pdf Manuals
Related Search