Home

DNA Walking SpeedUp Kit

image

Contents

1. 15 6 Troubleshooting Guide 17 Appendix A Primer Design 18 Appendix B Expected Results 19 Related Products 21 Seegene s Distributors 22 www see gene com 1 Introduction As a third commercial application of Seegene s proprietary ACP Annealing Control Primer Technology maximizing PCR specificity DNA Walking SpeedUp Kit is directed to the method using our unique DNA Walking ACP DW ACP primer designed to capture unknown target sites and the optimized PCR conditions referred as DW ACP PCR technology hereunder Due to the unique features of the DW ACP primer system DW ACP PCR technology enables the researchers to obtain only genuine unknown target products up to the length up to 2 kb of which Tag polymerase is able to synthesize This method provides the most powerful and revolutionary way to directly amplify unknown sequences adjacent to known sequences Figure1 Whole genomic DNA total RNA cDNA or plasmid clone can be used as a Starting material DW ACP1 DW ACP2 DW ACP3 DW ACP4 f i i i vy NG Known sequence DNA Walking Se ACP PCR Unknown sequence
2. TSP1 DW ACP2 EB Template DNA 1 PCR product 1 nested PCR Amplification of Universal Primer or DW ACP N o an unknown 2 PCR product target sequence TSP3 2 4 nested PCR 3 PCR product Direct sequencing OR Cloning of the final amplified unknown target product Figure 1 Flow chart of the general DNA Walking ACP PCR Technology DW ACP and TSP denote DNA Walking Annealing Control Primer and Target Specific Primer respectively www see gene com Applications 1 SpeedUp Sequencing Speed up sequencing of genomic DNA cDNA or plasmid e Direct amplification and sequencing of unknown sequences flanking a known cloned sequence without subcloning or shotgun cloning Genomic sequence projects DNA Walking SoeedUp Kit provides a simple and fast PCR based method using our patented DW ACP primer system for amplifying unknown sequences adjacent to Known genomic DNA or cDNA sequences and providing templates for direct sequencing of the amplified unknown target DNA sequence Whole genomic DNA or single strand cDNA generated by RT can be used as a template for direct amplification and sequencing or cloning of an unknown target sequence The beauty of DNA Walking SpeedUp Kit comes from the ACP s maximized specificity along with the optimized two stage PCR conditions 2 SoeedUp BAC Clone Sequencing Speed up sequencing of BAC clone Direct amplification and sequencing of B
3. Second nested PCR 1 Add the following reagents to a PCR tube for the PCR reaction on ice 1 ul Second PCR products 5 ul 10X buffer with 1 5mM MgCl 1 ul 10 uM Universal primer 1 ul 10 uM Target specific primer 3 TSP3 5 ul 2 mM dNTP ul Distilled water 0 5 ul Tag DNA polymerase 5U ul 50 ul Total volume Note If you have a smearing problem in the third PCR reaction the second PCR products can be diluted 10 100 fold by adding distilled water Note We strongly recommend the use of Taq DNA polymerase of Roche Cat No 1418432 or Invitrogen Cat No 10342 for the best results but cannot guarantee the positive results with other Tag polymerases Note We recommend the use of DW ACP N if non specific products are generated by using the Universal primer 2 Place the tube in a preheated 94 C thermal cycler Note It is important to preheat 94 C the thermal cycler before placing the tube in Commence the PCR reaction immediately using the following program segment No of cycles Temperature Duration 1 1 94 C 3 min 2 35 94 C 40 sec 60 65 C 40 sec 72 C 90 sec 3 1 72 C 7 min Note We recommend the GeneAmp PCR System 9700 of Applied Biosystems having a heated lid 3 Run 5 10 ul of the PCR products on 1 5 2 agarose gel stained with EtBr www see gene com 11 12 4 Extract the band on the agarose gel Note We recommend the use of GLASSMILK gel extraction kit e g BIO 101 GENECLEAN II KIT to extract
4. having known or unknown deletion or insertion mutation using genomic DNA Splicing analysis DNA Walking SpeedUp Kit provides a simple and fast PCR based method using our patented DW ACP primer system for detecting deletion insertion or isoform by using whole genomic DNA or total RNA as a starting material This kit can be used to screen unknown mutations or unknown isoform as well as known mutations or known isoforms Without cloning or library construction process whole genomic DNA or first strand cDNA can be used as a template for direct screening of deletion insertion or isoform The beauty of DNA Walking SpeedUp Kit comes from the ACP s maximized specificity along with the optimized two stage PCR conditions Information of DNA Walking SpeedUp Kit Product Name Cat Size DWSK V101 1 DNA Walking SpeedUp Kit SK V10 DWSK V102 www see gene com 7 2 List of Components 1 2 5 uM DW ACP1 primer for first PCR reaction DW ACP1 5 ACP AGGTC 3 2 2 5 uM DW ACP2 primer for first PCR reaction DW ACP2 5 ACP TGGTC 3 3 2 5 uM DW ACP3 primer for first PCR reaction DW ACP3 5 ACP GGGTC 3 4 2 5 uM DW ACP4 primer for first PCR reaction DW ACP4 5 ACP CGGTC 3 5 10 uM DW ACP N primer for second PCR reaction DW ACP N 5 ACPN GGTC 3 6 10 uM Universal Primer for third PCR reaction Uni primer 5 TCACAGAAGTATGCCAAGCGA 3 3 Storage Conditions Store the reagents below 20 C Avoid mult
5. optimized two stage PCR conditions 4 SoeedUp Transgene Location Detection Speed up determination of location or orientation of a transgene in a transgenic organisms such as plant animal insect fish and bacteria e Direct amplification and isolation of DNA fragments having a flanking region of a transgene using transgenic genomic DNA e Direct amplification and cloning or sequencing of DNA fragments having a flanking region of a transgene DNA Walking SoeedUp Kit provides a simple and fast PCR based method using our patented DW ACP primer system for determining the location or orientation of a transgene in transgenic organisms since this kit allows the amplification of unknown sequences flankning a known transgene sequence the insertion position or orientation of a transgene can be determined Without cloning or library construction of transgenic genomic DNA whole genomic DNA can be used as a template for direct screening of transgene location or orientation The beauty of DNA Walking SpeedUp Kit comes from the ACP s maximized specificity along with the optimized two stage PCR conditions www see gene com 5 SpeedUp Deletion Insertion Isoform Detection Speed up detection of deletion insertion or isoform using genomic DNA or total RNA from experimental samples e Direct isoform detection and isolation using total RNA without cloning or library screening or Northern blot hybridization e Direct cloning of DNA fragments
6. your interest from the agarose 5 Clone the extracted product into a TA cloning vector Note If you want to perform the sequencing directly without cloning step you can commence the direct sequencing using universal primer or target specific primer TSP www see gene com lt lt Plasmid DNA gt gt A First PCR reaction DNA Walking ACP PCR First PCR reaction in four individual tubes is performed independently using a primer pair each comprising the combination of DW ACP1 2 3 or 4 and TSP1 primer 1 Add the following reagents to a PCR tube on ice ul 5 ul 1 ul 1 ul 5 ul ul 0 5 ul 50 ul Plasmid DNA 10 20 ng 10X buffer with 1 5mM MgCl 2 5 uM DW ACP one of DW ACP1 2 3 and 4 10 uM Target specific primer 1 TSP1 2 mM dNTP Distilled water Tag DNA polymerase 5U ul Total volume Note We strongly recommend the use of Taq DNA polymerase of Roche Cat No 1418432 or Invitrogen Cat No 10342 for the best results but cannot guarantee the positive results with other Taq polymerases 2 Place the tube in a preheated 94 C thermal cycler Note It is important to preheat 94 C the thermal cycler before placing the tube in 3 Commence the PCR reaction immediately using the following program Segment 4 2 3 4 5 No of cycles Temperature Duration 1 94 C 5 min 1 42 C 1 min 1 72 C 2min 20 94 C 40 sec 55 C 40 sec 72 C 90 sec 1 72 C 7 min Note We rec
7. AC clone from BAC ends without subcloning or shotgun cloning Genomic sequence projects DNA Walking SoeedUp Kit provides a simple and fast PCR based method using our patented DW ACP primer system for amplifying unknown sequences adjacent to Known sequences or BAC vector sequence and providing templates for direct sequencing of the amplified unknown target DNA sequence Without shotgun cloning of BAC clone BAC clone DNA can be used as a template for direct sequencing of the insert DNA The beauty of DNA Walking SpeedUp Kit comes from the ACP s maximized specificity along with the optimized two stage PCR conditions www see gene com 5 3 SpeedUp Genome Walking Promoter region cloning or sequencing Gene structure Exon Intron junction Gap filling Quick sequencing of larger size of DNA Transgene Location e Deletion or insertion detection Splicing analysis DNA Walking SpeedUp Kit provides a simple and fast PCR based method using our patented DW ACP primer system for amplifying unknown sequences adjacent to Known genomic DNA sequences and providing templates for direct sequencing of the amplified unknown target DNA sequence This kit can be used for a variety of applications such as analysis of gene structure exon intron junction or direct amplification and sequencing or cloning of unknown genomic DNA sequences The beauty of DNA Walking SpeedUp Kit comes from the ACP s maximized specificity along with the
8. D Seegene DNA Walking SpeedUp Kit SpeedUp Sequencing SpeedUp BAC Clone Sequencing SpeedUp Genome Walking SpeedUp Transgene Location Detection SpeedUp Deletion Insertion Isoform Detection User Manual Version 1 2 Published April 2004 Catalog No DWSK V101 10 rxns DWSK V102 25 rxns Storage Conditions 20 C For Research Use Only Product Warranty and Liability Seegene warrants the performance of all products as described when used according to instruction Any problem incurred for any reason other than misuse should be reported to Seegene immediately This warranty limits our liability to replacement of the products Safety Warning and Precautions This product is limited for research use only not recommended or intended for diagnosis of disease in humans or animals Do not use internally or externally in humans nor animals Ordering Information and Technical Services Seegene USA Seegene Inc P O Box N 142 21 Samsung dong Kangnam gu Del Mar CA 92014 0376 Seoul 135 090 USA Korea Tel 858 610 9610 Tel 82 2 566 9830 Fax 858 623 9610 Fax 82 2 566 9831 E mail intfo see gene com E mail info see gene com URL www see gene com URL www see gene com www see gene co kr The PCR process is covered by patents owned by Hoffman La Roche Inc No license or immunity under any other patent is either expressed or implied by the sale of any Seegene product www see gene com Table of Conten
9. GENECLEAN II KIT to extract your interest from the agarose 5 Clone the extracted product into a TA cloning vector Note If you want to perform the sequencing directly without cloning step you can commence the direct sequencing using universal primer or target specific primer TSP www see gene com 6 Troubleshooting Guide No band a You may have a problem with primer design Re design your target specific primers b Reduce the annealing temperature c Extend the length of extension d Check the quality of template DNA e Your target DNA may have a GC rich region f a b Retry the PCR reaction using long distance DNA polymerase Your interest may be multicopies You may have a problem with primer design Re design your target specific primers c The template DNA may be contaminated d If you use transgenic DNA transgene may have multiple copies in different genomic DNA loci It is critical to set up the PCR reaction on ice before samples are placed in the thermal cycler Retry the PCR reaction using other thermostable DNA polymerase Check the quality of template DNA or primer oligonucleotides You may have a problem with the concentration of the first and second PCR products used in each nested PCR reaction Have the first and second PCR products diluted up to 100 or more fold You may have a problem with primer design Re design your target specific primers d Retry the PCR reaction using o
10. TSPs Nested primers are designed to amplify an internal region of the original amplified product The TSP2 and TSP3 indicate nested primers www see gene com Appendix B Expected Results The control experiments were conducted using mouse ICR cDNA genomic DNA or bacteria genomic DNA Three target specific primers TSP1 2 and 3 for each gene were designed to amplify unknown target sequences adjacent to the known sequences First PCR reaction was performed using DW ACPs and TSP1 primer as described in section 5A In the second and third PCR reactions DW ACP N and TSP2 and Universal primer and TSP3 were used as described in sections 5B and 5C respectively Figure 3 The amplification of the 5 end region sequences of PBP cDNA using DNA Walking SpeedUp Kit Each of four different DW ACP1 lane 1 DW ACP2 lane 2 DW ACP3 lane 3 and DW ACP4 lane 4 generated one major product showing a different size These products were turned out to be the 5 end region sequences of PBP cDNA by sequence analysis These results indicate that the DNA Walking SpeedUp kit can be applied to amplify the unknown sequences adjacent to a known partial CDNA sequence ee Figure 4 PCR amplification products for mouse TNF a promoter region using DNA Walking SpeedUp Kit Each of four different DW ACP1 lane 1 DW ACP2 lane 2 DW ACP3 lane 3 and DW ACP4 lane 4 generated one major product showing a different size These results t
11. e com C Third PCR reaction Second nested PCR 1 Add the following reagents to a PCR tube for the PCR reaction on ice 1 ul Second PCR products 5 ul 10X buffer with 1 5mM MgCl 1 ul 10 uM Universal primer 1 ul 10 uM Target specific primer 3 TSP3 5 ul 2 mM dNTP ul Distilled water 0 5 ul Tag DNA polymerase 5U ul 50 ul Total volume Note If you have a smearing problem in the third PCR reaction the second PCR products can be diluted 10 100 fold by adding distilled water Note We strongly recommend the use of Taq DNA polymerase of Roche Cat No 1418432 or Invitrogen Cat No 10342 for the best results but cannot guarantee the positive results with other Tag polymerases Note We recommend the use of DW ACP N if non specific products are generated by using the Universal primer 2 Place the tube in a preheated 94 C thermal cycler Note It is important to preheat 94 C the thermal cycler before placing the tube in Commence the PCR reaction immediately using the following program segment No of cycles Temperature Duration 1 1 94 C 3 min 2 35 94 C 40 sec 60 65 C 40 sec 72 C 90 sec 3 1 72 C 7 min Note We recommend the GeneAmp PCR System 9700 of Applied Biosystems having a heated lid 3 Run 5 10 ul of the PCR products on 1 5 2 agarose gel stained with EtBr www see gene com 15 16 4 Extract the band on the agarose gel Note We recommend the use of GLASSMILK gel extraction kit e g BIO 101
12. he distribution size alternative splicing eerceretteren forms and level of your transcripts in one experiment ap T Ea od Zoo Blot We are offering zoo blot pre made Southern blot including 12 different species for your screening assays Genomic DNAs were prepared from human rat SD mouse ICR dog cow pig rabbit chicken frog Xenops fish Zebra fish C elegans and yeast Genomic DNAs We are offering genomic DNAs obtained from 12 different sample sources for your screening assays Seegene s genomic DNA is qualified for genomic analysis including PCR and library construction a hehe www see gene com 21 Seegene s Distributors Italy Scientifix Pty Ltd PO Box 18 Southland Centre Cheltenham Victoria Tel 61 3 9462 7488 Fax 61 395487177 Free call 1800 007 900 E mail info scientifix com au URL wwsoientifix com au BioCat GmbH Im Neuenheimer Feld 581 D 69120 Heidelberg Tel 49 6221 585844 Fax 49 6221 5858 09 E mail info biocatde URL wwbiocat de ImmunoSource BVBA Ruiterslaan 29 B 2980 Halle Zoersel Tel 32 3 38536 85 Fax 323 38438 18 E mail info immunosource com URL wwvimmunosource com Bio Can Scientific Inc 2170 Dunwin Drive Unit 5 Mississauga ONL5L1C7 Tel 1 9058282455 Fax 1 905 828 9422 E mail orders biocan com URL wwwbiocan com Bio mediator Linnaistentie 5 FIN 01640 Vantaa Tel 358 9 852 4898 Fax 358 9 852 4884 E mail i
13. iple freeze thaw 4 Reagents and Equipment to be Supplied by User Tag polymerase 2 mM dNTP Target specific primers TSP Micro centrifuge Thermal cycler PCR purification kit www see gene com 5 Protocol for DNA Walking SpeedUp Kit lt lt Whole genomic DNA or cDNA gt gt A First PCR reaction DNA Walking ACP PCR Firs PCR reaction in four individual tubes is performed independently using a primer pair each comprising the combination of DW ACP1 2 3 or 4 and TSP1 primer 1 Add the following reagents to a PCR tube on ice ul Whole genomic DNA or cDNA 50 100 ng 5 ul 10X buffer with 1 5mM MgCl 4 ul 2 5 uM DW ACP one of DW ACP1 2 3 and 4 1 ul 10 uM Target specific primer 1 TSP1 5 ul 2 mM dNTP ul Distilled water 0 5 ul Tag DNA polymerase 5U ul 50 ul Total volume Note We strongly recommend the use of Taq DNA polymerase of Roche Cat No 1418432 or Invitrogen Cat No 10342 for the best results but cannot guarantee the positive results with other Taq polymerases 2 Place the tube in a preheated 94 C thermal cycler Note It is important to preheat 94 C the thermal cycler before placing the tube in 3 Commence the PCR reaction immediately using the following program segment No of cycles Temperature Duration 1 1 94 C 5 min 2 1 42 C 1 min 3 1 72 C 2min 4 20 30 94 C 40 sec 55 C 40 sec 72 C 90 sec 5 1 72 C 7 min Note We recommend the GeneAmp PCR System 9700
14. nfo bio mediator com URL wwbio mediator com BioCat GmbH Im Neuenheimer Feld 581 D 69120 Heidelberg Tel 49 6221 585844 Fax 49 6221 5858 09 E mail info biocatde URL wwbiocat de Line Analytics Life Sciences Ltd 8 F Eastwood Centre 5A Kung Ngam Village Road Hong Kong SAR PRC Tel 852 2578 5839 Fax 852 2807 2674 E mail line lineanalytics com URL wwwilineanalytics com TALRON 17 Hazait St Rehovot 76349 Tel 972 8 9472563 Fax 9728 9471156 E mail sales talron co l URL wwwialron co i CABRU s as Via Caduti per la Patria 47 20050 Peregallo di Lesmo MI Tel 390396981589 Fax 39 039 6065174 Emal info cabruit Luxembourg United Ki WI LA www see gene com Funakoshi Co Ltd 9 7 Hongo 2 chome Bunkyo ku Tokyo 113 0033 Tel 81 3 5684 1622 Fax 81 35684 1633 E mail reagent funakoshi co jo URL vww funakoshi co jp ImmunoSource BVBA Ruiterslaan 29 B 2980 Halle Zoersel Tel 32 3 38536 85 Fax 323 38438 18 E mail info immunosource com URL wwvimmunosource com All Eights M Sdn Bhd 45 Jalan TS 610A Suband Industrial Park 47510 Subang Jaya Selangor Darul Ehsan Tel 60 3 563349 88 Fax 60356330261 E mai al8 alleights com my URL wwallelght com my ImmunoSource BVBA Ruiterslaan 29 B 2980 Halle Zoersel Tel 32 3 3853685 Fax 323 38438 18 E mail info immunosource com URL wwvimmunosource com All Eight Marketing Services Pte Ltd No 6 Harper Road 03 02 Leo
15. ng Huat Building Singapore 369674 Tel 65 6288 6388 Fax 65 6284 9805 E mail alleght alleightcom URL wwwalieightcom BioCat GmbH Im Neuenheimer Feld 581 D 69120 Heidelberg Tel 49 6221 585844 Fax 49 6221 5858 09 E mail info biocatde URL wwbiocat de Protech Technology Enterprise Co Ltd 14F C No 3 Building F YuanQu amp 115 NanKang Dist Taipei Taiwan R O C Tel 886 2 2381 0844 Fax 886 2 2655 7601 E mail howardwu mait hinetnet URL wwbio protech com tw Insight Biotechnology Limited PO Box 520 Wembley HA9 7XX Tel 44 20 83850308 Fax 44208385 0302 E mail info insightbio com URL wwwi nsighibio com Note www see gene com 23 gotta see gene Seegene www see gene com
16. of Applied Biosystems having a heated lid www see gene com 9 4 Purify the PCR products using PCR purification kit to remove the primers such as the DW ACPs and the TSP1 used in the first PCR reaction Note We recommend the use of PCR purification kit e g QIAGEN Cat No 28106 for this step Note If you have a smearing problem in the third PCR reaction you can dilute the first PCR products 10 fold or up to 100 fold B Second PCR reaction First nested PCR 1 Add the following reagents to a PCR tube for the PCR reaction on ice 172 ul First PCR products 5 ul 10X buffer with 1 5mM MgCl 1 ul 10 uM DW ACP N 1 ul 10 uM Target specific primer 2 TSP2 5 ul 2mM dNTP ul Distilled water 0 5 ul Tag DNA polymerase 5U tl 50 ul Total volume Note We strongly recommend the use of Taq DNA polymerase of Roche Cat No 1418432 or Invitrogen Cat No 10342 for the best results but cannot guarantee the positive results with other Taq polymerases 2 Place the tube in a preheated 94 C thermal cycler Note It is important to preheat 94 C the thermal cycler before placing the tube in 3 Commence the PCR reaction immediately using the following program Segment No of cycles Temperature Duration 1 1 94 C 3 min 2 30 gt 35 94 C 40 sec 60 C 40 sec 72 C 90 sec 3 1 72 C 7 min Note We recommend the GeneAmp PCR System 9700 of Applied Biosystems having a heated lid 10 www see gene com C Third PCR reaction
17. ommend the GeneAmp PCR System 9700 of Applied Biosystems having a heated lid 4 Purify the PCR products using PCR purification kit to remove the primers such as the DW ACPs and the TSP1 used in the first PCR reaction www see gene com 13 Note We recommend the use of PCR purification kit e g QIAGEN Cat No 28106 for this step Note If you have a smearing problem in the third PCR reaction you can dilute the first PCR products 10 fold or up to 100 fold B Second PCR reaction First nested PCR 1 Add the following reagents to a PCR tube for the PCR reaction on ice 1 2 ul First PCR products 5 ul 10X buffer with 1 5mM MgCl 1 ul 10 uM DW ACP N 1 ul 10 uM Target specific primer 2 TSP2 5 ul 2mM dNTP ul Distilled water 0 5 ul Tag DNA polymerase 5U ul 50 ul Total volume Note We strongly recommend the use of Tag DNA polymerase of Roche Cat No 1418432 or Invitrogen Cat No 10342 for the best results but cannot guarantee the positive results with other Taq polymerases 2 Place the tube in a preheated 94 C thermal cycler Note It is important to preheat 94 C the thermal cycler before placing the tube in 3 Commence the PCR reaction immediately using the following program segment No of cycles Temperature Duration 1 1 94 C 3 min 2 20 94 C 40 sec 60 C 40 sec 72 C 90 sec 3 1 72 C 7 min Note We recommend the GeneAmp PCR System 9700 of Applied Biosystems having a heated lid 14 www see gen
18. ther thermostable DNA polymerase e It is critical to set up the PCR reaction on ice before samples are placed in the thermal cycler Multiple bands www see gene com 17 18 Appendix A Primer Design You have to design target specific primers TSP for DNA Walking ACP PCR reactions You may have to design two nested primers for obtaining real products The primers should be 22 25 nucleotides long GC content gt 50 TSP1 55 CSTms60 C TSP2 TSP3 60 CS lt Tms65 C The primers should have a GC content of 50 70 The primers should not be able to form secondary structures due to internal complementarities Avoid containing sequences at the 3 end that allow base pairing with itself or other primer Avoid repetitive sequence or regions containing stretches of the same nucleotide Sometimes the specificity of your PCR reaction may be low high level of nonspecific background resulting in mispriming and the generation of false amplification products In this case design nested primers to amplify an internal region of the original amplified product Nested PCR increases specificity and sensitivity by reducing the nonspecific products DNA Walking PCR 1 PCR product First Nested PCR 2 PCR product DW ACP N or Universal primer Second Nested PCR 3 PCR product TSP3 TSP2 TSP1 Figure 2 The diagram of DNA Walking using DNA Walking ACP PCR Technology The spotted arrows indicate target specific primers
19. ts 1 Introduction 4 1 SpeedUp Sequencing 5 2 SpeedUp BAC Clone Sequencing 5 3 SpeedUp Genome Walking 6 4 SpeedUp Transgene Location Detection 6 5 SpeedUp Detection Insertion Isoform Detection 7 2 List of Components 8 3 Storage Conditions 8 4 Reagent and Equipment to be Supplied by User 8 5 Protocol for DNA Walking SoeedUp Kit lt lt Whole genomic DNA or cDNA gt gt A First PCR reaction 9 B Second PCR reaction 10 C Third PCR reaction 11 lt lt Plasmid DNA gt gt A First PCR reaction 13 B Second PCR reaction 14 C Third PCR reaction
20. urned out to be the promoter sequence of the TNF a gene by sequence analysis M Forever 100bp Ladder Personalizer www see gene com 19 20 Expected Results continued M 1 5 4 M Figure 5 PCR amplification products for bacteria argC promoter region using DNA Walking SpeedUp Kit M Forever 100bp Ladder Personalizer Lanes 1 4 one major product generated by each different DW ACP primer DW ACP1 2 3 and 4 from upstream of the argC gene from bacteria genomic DNA www see gene com Related Products Forever 100bp Ladder Personalizer Our unique 100 bp endless usage ladder system patent pending is clearly distinguished from any existing commercialized consumables 100 bp DNA ladder This system supplies templates plasmids which will be amplified to be used for size markers GeneFishing DEG kits All of the GeneFishing DEG kits DEG101 106 comprise 20 randomly selected arbitrary ACPs Annealing Control Primers and each DEG kit works equally for your target samples Full length cDNAs Seegene s Full length cDNAs are ideal to study gene expression in specific tissues and at specific developmental stages and also to clone the genes belonging to a multigene family N38 lait Pre made Northern Blots Northern blots are pre made for immediate use and designed to See Gene expression in specific tissues and at specific developmental stages Our eereeeeererete Northern blots allow you to assess t

Download Pdf Manuals

image

Related Search

Related Contents

secador profesional modelo: zhb2092    Black & Decker BDUH100-201 Use & Care Manual  Magnum ES42 Edge Switches Installation and User Guide  Remington HC5750  Automatic Banding Machine Operating instructions BA 40/800  Chap-2010C-Alimentation Gestion moteur  12月号 - 枝幸町  Longevity 880131 Instructions / Assembly  iStream 2 Issue 3 - Europe  

Copyright © All rights reserved.
Failed to retrieve file