siRNA Generation Kit
Contents
1. 150 nucleotides downstream from the start codon E which would prevent the dicedsiRNAs dsiRNAs es from potentially competing with proteins involved in translation initiation sense LASSA 1 1 2 The size of the target template NNI N antisense The Recombinant Dicer Enzyme performs best with ai double stranded RNA dsRNA between 500 1000 1 1 3 2 PCR Protocol bp in length Dicer also works with longer dsRNAs even full length cDNAs However for silencing a single gene using a 500 bp dsRNA is sufficient We recommend that you use templates that are 500 1000 bp in length Prepare a 100 ul reaction mix as follows IMPORTANT 1 The yield of dsRNA might be low if the DNA template is smaller than 300 bp or the gene is GC 10 ul 10 x PCR buffer We recommend that you use the PCR Control Plasmid which contains a 700 bp GFP gene as positive control template rich and longer than 2 kb 2 The dicer enzyme might not 1 pl 10 mM each dNTP digest well if the dsRNA is smaller than 300 bp Tul DNA template 50 ng 1 ul D primer 1ug ul 1 ul 3 primer 1ug ul 1 1 3 Adding T7 P ters to the DNA templat aa ng AEA ee SSE x Ul DNA polymerase Amount varies depending on the supplier The DNA template must contain the T7 RNA 86 x ul pits 9 pean polymerase promoter site at both ends so that it can be used as a template for in vitro transcription with PCR program the TurboScript T7 Transcription Kit 94 C for 3 minutes T7 promoter se2. P SIRNA Generation Kit T510001 _G niantis The Dicer siRNA Generation Kit contains sufficient reagents for generating small interfering RNAs siRNAs from up to 5 different genes and for 50 transfections in 24 well plates Sub Kit Content Amount Recombinant Dicer Enzyme Kit 20 C 50 units 10 mM ATP 1 vial 50 pl Dicer Stop Solution 1 vial 100 ul 1 vial 1 ml 1 vial 10 pl 1 vial 10 pl 1 vial 40 pl 5 Ul Nuclease free Water TurboScript T7 Transcription Kit T7 Enzyme Mix 5 reactions T7 Reaction Buffer NTP Mix DNase 1 vial 2X Gel Loading Buffer 1 vial 175 ul Nuclease free Water 1 vial 1 ml LiCl Precipitation Solution 1 vial 175 pl GFP Control Plasmid 1 vial 10 ul gWiz GFP 1 0 g l 5 Control Primer 1 vial 10 ul 1 0 ug ul 3 Control Primer 1 vial 10 ul 1 0 ug ul GeneSilencer siRNA Transfection GeneSilencer siRNA Transfection Reagent 1 vial 180 ul Reagent Kit 50 transfections siRNA Diluent 1 vial 1 5 ml RNA Purification Column 1 RNA Purification Column 1 5 columns Hydration Buffer 1 bottle 4 ml RNA Purification Column 2 RNA Purification Column 2 5 columns Shipping Shipped frozen dry ice See recommended storage conditions in table above All components are stable for six months when stored properly 20 C Room temperature AOmMATP S Dicer Stop Solution NucleasefreeWater Jival o T7 EnzymeMx vial 10 S T7 Reaction Buffer vaou i PNTPMix o vil 40
3. S DNase A ial 2X Gel Loading Buffer Avia 175 _Nuclease free Water 1 vial LiCl Precipitation Solution Avia 175 yl GFP Control Plasmid tial 10 ul gWiZIGFP 1 0 uglu 5 Control Primer 3 Control Primer _GeneSilencer siRNA Transfection Reagent __ 4 C SIRNA Diluent o RNA Purification Column 1 Hydration Buffer S Pomeren LRNA Purification Column 2 LRoom temperature Room temperature RELATED PRODUCTS Catalog Number Size esses Recombinant Human Dicer Enzyme Kit T510002 50 Units TurboScript T7 Transcription Kit T510003 20 Reactions RNA Purification Column 1 RNA Purification Column 2 Turbo Dicer siRNA Generation Kit Turbo Dicer Recombinant Enzyme Kit GeneSilencer siRNA Transfection Reagent 0 75 ml GeneSilencer siRNA Transfection Reagent 5 x 0 75 ml 1505750 5 x 200 Reactions Limited Label License for the Recombinant Dicer Enzyme This product is covered by several patent applications owned by the Stanford University The purchase of this product conveys to the buyer the limited non exclusive non transferable right without the right to resell repackage or further sublicense under these patent rights to perform the siRNA production methods claimed in those patent applications for research purposes solely in conjunction with this product No other license is granted to the buyer whether expressly by implication by estoppel or otherwise In particular the purchase of t
4. 10190 Telesis Court San Diego CA 92121 Removing salts and unincorporated nucleotides with RNA Purification Column 1 IMPORTANT This step requires a fixed angle rotor microcentrifuge On a variable speed microcentrifuge DO NOT use the pulse button which overrides the speed setting and takes the rotor to maximum g force VKM060413 Faye 2 2 1 2 2 2 1 3 2 2 1 4 2 2 1 5 2 2 1 6 2 2 1 7 Tap the RNA Purification Column 1 to settle the dry gel in the bottom of the spin column Hydrate the column with 650 ul of Hydration Buffer Cap vortex tap out air bubbles and hydrate at room temperature 5 15 min Optional Once hydrated these columns can be stored in the refrigerator up to 3 days Spin the column at 750 x g for 4 min to remove excess interstitial fluid keeping track of the Orientation of the column in the rotor by marking the column Discard the wash tube and immediately apply the sample 20 100 wl DIRECTLY TO THE CENTER OF THE GEL BED at the top of the column without disturbing the gel surface or contacting the sides of the column with the pipette tip or reaction mixture Place the column in the sample collection tube and place in the rotor maintaining the same orientation as in Step 2 2 1 4 Spin the column in the tube at 750 x g for 3 min Your sample will be in the collection tube 2 2 2 Removing undigested dsRNA with RNA Purification Column 2 2 2 2 1 2 2 2 2 2 2 2 3 2
5. 23 34 3 Parrish S J Fleenor S Xu C Mello and A Fire 2000 Functional anatomy of a dsRNA trigger differential requirement for the two trigger strands in RNA interference Mol Cell 6 1077 1087 4 Hamilton A J and D C Baulcombe 1999 A species of small antisense RNA in posttranscriptional gene silencing in plants Science 286 950 952 5 Sijen T J Fleenor F Simmer K L Thijssen S Parrish L Timmons R H Plasterk and A Fire 2001 On the role of RNA amplification in dsRNA triggered gene silencing Cell 107 465 476 6 Bernstein E A A Caudy S M Hammond and G J Hannon 2001 Role for a bidentate ribonuclease in the initiation step of RNA interference Nature 409 363 366 7 Hutvagner G J McLachlan A E Pasquinelli E Balint T Tuschl and P D Zamore 2001 A cellular function for the RNA interference enzyme Dicer in the maturation of the let 7 small temporal RNA Science 293 834 838 8 Knight S W and B L Bass 2001 A role for the RNase III enzyme DCR 1 in RNA interference and germ line development in Caenorhabditis elegans Science 293 2269 2271 9 Boutla A C Delidakis Livadaras M Tsagris and M Tabler 2001 Short 5 phosphorylated double stranded RNAs induce RNA interference in Drosophila Curr Biol 11 1776 1780 10 Hammond S M E Bernstein D Beach and G J Hannon 2000 An RNA directed nuclease mediates post transcriptional gene silencing in Drosophila cells Nature 404 293 296 11 Ui
6. Check cells for contamination Thaw a new batch of cells Cells are too confluent or cell density too low Check culture medium pH kind used last time changed Check equipment for proper function culture plates incubators etc Reduce GeneSilencer concentration in 20 30 increments to avoid toxicity Aggregation Excess GeneSilencer used Decrease the amount of GeneSilencer reagent Genlantis VKM060413 Page 8 of 8 10190 Telesis Court San Diego CA 92121 Toll Free 888 428 0558 858 457 1919 Web http www genlantis com
7. Tei K S Zenno Y Miyata and K Saigo 2000 Sensitive assay of RNA interference in Drosophila and Chinese hamster cultured cells using firefly luciferase gene as target FEBS Lett 479 79 82 12 Elbashir S M J Harborth W Lendeckel A Yalcin K Weber and T Tuschl 2001 Duplexes of 21 nucleotide RNAs mediate RNA interference in cultured mammalian cells Nature 411 494 498 13 Elbashir SM Harborth J Weber K Tuschl T 2002 Analysis of gene function in somatic mammalian cells using small interfering RNAs Methods 26 2 199 213 Genlantis VKM060413 Page 7 of 8 10190 Telesis Court San Diego CA 92121 Toll Free 888 428 0558 858 457 1919 Web http www genlantis com GenePORTER Transfection Reagent Manual APPENDIX Quality Control All components in the TurboScript T7 Transcription Kit are functionally tested by PCR amplification of the GFP Control Plasmid Each 20 ul reaction yields at least 50 80 ug of dsRNA after a 4 hour incubation Recombinant Dicer Enzyme Kit components are tested using 1 ug of dsRNA from the GFP Control Plasmid At least 0 5 ug of dsiRNA must be produced after 12 18 hours of incubation The GeneSilencer siRNA Transfection Kit is functionally qualified by transfecting labeled siRNA in cultured cells Troubleshooting Guide Possible Causes Recommended Solutions Difficulty obtaining PCR products Sub optimal primer design Re design primers by changing the gene specific portions of the primer
8. per well 96 wells 1 0 25 48 wells 1 75 25 24 wells 3 5 25 3 2 3 Prepare the siRNA solution by first mixing the siRNA Diluent and serum free medium SFM according to Table 2 below Use the Diluent SFM mix to dilute the recommended amount of dsiRNA in Table 2 Mix well by pipetting up and down several times Incubate at room temperature for 5 minutes IMPORTANT Avoid vortexing the siRNA Diluent mix Table 2 siRNA Dilutions For Adherent Cells Tissue Recommended sIRNA Diluent Final culture amount of ul serum free transfection plate type dsiRNA medium ul well volume ul ng well 96 wells 125 257 15 100 48 wells 250 5 0 15 200 24 wells 500 10 0 15 500 3 2 4 Add the RNA solution from Step 3 2 3 to the diluted GeneSilencer solution from Step 3 2 2 Incubate at room Genlantis VKM060413 10190 Telesis Court San Diego CA 92121 temperature for 5 minutes to allow the siRNA lipid complexes to form IMPORTANT You can incubate the siIRNA GeneSilencer mix for longer than 5 minutes but make sure not to exceed 30 minutes in order to maintain maximum siRNA transfection efficiency 3 2 5 Add the siRNA GeneSilencer mix to cells growing in serum containing medium Incubate at 37 C for 24 hours See Table 2 for final transfection volume NOTE For some cell lines like HeLa MDCK and CHO K1 transfection efficiencies may be higher if serum is omitted from the medium during the first 4 hours of transfection After
9. 2 2 4 2 2 2 5 2 2 2 6 2 2 2 1 Insert the sample reservoir into one of the vials provided Add 10 ul of nuclease free water into the sample reservoir without touching the membrane with the pipette tip Seal the attached cap Place the assembly in a microcentrifuge and counterbalance with a similar device Spin at 500 x g for 2 minutes Empty any nuclease free water in the collection tube Add the samples from step 2 2 1 7 into the sample reservoir without touching the membrane with the pipette tip Seal with the attached cap Place assembly in a microcentrifuge and counterbalance with a similar device Spin at 500 x g for 15 minutes do not centrifuge more than 15 minutes Remove assembly from centrifuge Separate collection vial from sample reservoir Purified dsiRNA is in the collection vial undigested large dsRNAs remain in the sample reservoir Store the dsiIRNA at 20 C 2 2 3 Qualification of Purification Products For RNA molecules 1 A2s0 unit corresponds to 40 ug ml siRNA yield can be calculated as follows A250 X dilution factor X 40 ug ml RNA NOTE Typically each microgram of dsRNA yields about 0 5 ug of dsiIRNA Page 5 of 8 Toll Free 888 428 0558 858 457 1919 Web http www genlantis com GenePORTER Transfection Reagent Manual 3 Transfecting dsiRNA with the GeneSilencer siRNA Transfection Reagent 3 1 Transfection Optimization Guidelines 3 1 1 Adherent cells Altho
10. ase free Water and quantitate by spectrophotometry Store at 20 C until later use Genlantis VKM070419 Page 3 of 8 10190 Telesis Court San Diego CA 92121 Toll Free 888 428 0558 858 457 1919 Web http www genlantis com GenePORTER Transfection Reagent Manual 1 2 Generation of dsRNA 1 2 1 talk Transcription Reaction Assembly Thaw the frozen reagents Place the T7 Enzyme Mix on ice it is formulated in glycerol and does not freeze at 20 C Vortex the T7 Reaction Buffer and the NTP Mix until they are completely in solution Once thawed store the NTP Mix on ice Keep T7 Reaction Buffer at room temperature while assembling the reaction IMPORTANT All reagents should be microfuged briefly before opening to prevent loss and contamination of material that may be present around the rim of the tube 1 2 1 2 Assemble the transcription reaction at room 1 2 2 1 2 3 Genlantis 10190 Telesis Court San Diego CA 92121 temperature The following amounts are for a single 20 ul reaction Reactions may be scaled up or down if desired Add to 20 ul Nuclease free Water 8 yl NTP mix 2 ul T7 Reaction Buffer 1 ug PCR template DNA from step 1 1 4 8 2 Ul T7 Enzyme Mix IMPORTANT The spermidine in the T7 Reaction Buffer can co precipitate the template DNA if the reaction is assembled on ice Add the T7 Reaction Buffer after the water and the NTP Mix are already in the tube Gently flick the tube or pip
11. e TurboScript reaction should be run on a denaturing agarose or acrylamide gel alongside an aliquot of RNA of known concentration Stain the samples with EthBr and simply compare the intensity of the unknown sample to that of the known RNA sample to estimate its concentration 2 Generating siRNAs Using Recombinant Dicer Enzyme 2 1 Dicer Reaction 2 1 1 2 2 ZN 2 1 4 Keep the Dicer Reaction Buffer at room temperature while assembling the reaction The following amounts are for a single 10 ul reaction 2 5 Ul x Nuclease free water x Ul dsRNA 1 ug 1 ul 10 mM ATP 0 5 ul 50 mM MgCle 4ul Dicer Reaction Buffer 2 ul Recombinant Dicer Enzyme 1 Unit IMPORTANT Avoid using excess dicer enzyme it may decrease the amount of dicedsiRNA dsiRNA generated from the digestion reaction 1 ug of dsRNA control template will yield about 0 5 ug of dsiRNA which is sufficient for one or two transfections in 24 well plates using the GeneSilencer siRNA Transfection Reagent Adjust the reaction volume accordingly if you need more dsiRNAs Incubate overnight 12 to 18 hours at 37 C Stop the reaction by adding 2 ul Dicer Stop Solution Check dsiRNA 22 base pairs by using one of the following methods a 3 agarose Gel TAE b 15 native polyacrylamide gel 29 1 cast in 1X and electrophoresed in 0 5X TBE Run at 10 Watts 4 C Visualize RNA by EthBr staining 2 2 Purification of siRNAs 2 2 1 Genlantis
12. ed RNAs dsRNAs into cells 1 2 3 Several studies indicate that RNAi is an evolutionarily conserved defense mechanism directed against invading viral genomes or aberrant transcription products 4 5 In vitro Studies using Drosophila lysates revealed that 21 25 nucleotide small interfering RNA duplexes siRNAs are the mediators of gene silencing These siRNAs are derived from processing of the dsRNA by an RNase Il like enzyme 6 7 8 The mechanism involves the recruitment of siRNAs into a multi protein complex known as RNA Induced Silencing Complex RISC which interacts with the target RNA to mediate cleavage in a catalytic fashion 6 9 10 Although cellular uptake of long trigger dsRNAs by organisms such as C elegans and Drosophila has proven to be an effective method to induce RNAi long dsRNAs tend to result in non specific gene suppression in vertebrate cells due in part to Type interferon response 11 Subsequent studies using synthetic siRNAs less than 30 nucleotides demonstrated that siRNAs can bypass the mammalian interferon response and cause effective gene specific silencing in mammalian cells 1 12 In addition the gene silencing effect caused by siRNA can be detected even after many cell divisions These properties make siRNA a useful tool for a broad range of research areas in mammalian cells How Dicer siRNA Generation Kit Works The Dicer siRNA Generation Kit mimics the natural RNA interference process by using recomb
13. ette the mixture up and down gently then microfuge the tube briefly so that the reaction mixture is at the bottom of the tube Incubate at 37 C for 2 4 hours IMPORTANT The first time a new template is transcribed the recommended incubating 2 4 hours To determine the optimum incubation time for maximum yield with a given template a time course experiment can be done To do this set up a TurboScript T7 Transcription reaction and remove aliquots of the reaction at various intervals for example after 1 hour 2 hours 4 hours 6 hours and overnight incubations To remove template DNA add 1 ul DNase to each 20 ul T7 Reaction Mix well and incubate for 15 min at 37 C Check the dsRNA on a 1 agarose gel TAE by using the 2X Gel Loading Buffer NOTE dsRNA will migrate like DNA i e a 500 bp dsRNA will migrate at the same rate as a 500 bp band in a DNA ladder ssRNA will migrate much faster than dsDNA of equivalent size You may see faint slower migrating bands above the full length transcript on non denaturing gels These may be the result of secondary structures within the transcript and can be ignored VKM060413 1 3 Recovery of dsRNA dsRNA can be directly used with the Recombinant Dicer Enzyme Kit but purified dsRNA obtained from the following procedure can give slightly better results 1 3 1 1 3 2 1 3 3 1 3 4 Precipitate the RNA by adding 30 ul Nuclease free Water and 30 ul LiCl Preci
14. his product does not include nor carry any right or license to use develop or otherwise exploit this product commercially and no rights are conveyed to the buyer to use the product or components of the product for any other purposes including without limitation provision of services to a third party generation of commercial databases or clinical diagnostics or therapeutics In addition any user that purchases more than 5 000 in any calendar quarter may be outside the above research license and will contact Stanford University for a license This product is sold pursuant to a license from Stanford University and Stanford University reserves all other rights under these patent rights For information on a license to the patent rights for uses other than in conjunction with this product or to use this product for purposes other than research please contact Stanford University at 650 723 0651 This is Stanford University reference S02 028 Genlantis VKMo070419 Page 1of 8 10190 Telesis Court San Diego CA 92121 Toll Free 888 428 0558 858 457 1919 Web http www genlantis com Introduction to RNA Interference RNA interference RNAi has become an important tool for studying gene functions because it allows sequence specific gene suppression in a variety of organisms e g plants insects and nematodes and cultured mammalian cell lines RNAi is characterized by targeted mRNA degradation after introduction of sequence specific double strand
15. inant human dicer enzyme to cleave in vitro transcribed dsRNA into a pool of 22 bp siRNAs Figure 1 The Dicer siRNA Generation Kit relies on two novel technologies for efficient siRNA production First the TurboScript T7 Transcription Kit utilizes a novel technology to allow rapid synthesis of 10 to 50 times the amount of RNA produced by conventional in vitro transcription reactions The secret behind high yield is that each DNA template is copied hundreds of times This ensures that you will have sufficient dsRNA after annealing the transcribed sense and antisense RNA strands The second key technology is an ultra active form of human recombinant dicer enzyme that can cleave more than 95 of dsRNA template into 22 bp siRNAs within 12 hours under optimized reaction conditions Figure 2 With abundant supply of dsRNA templates and subsequent efficient dsRNA cleavage you are sure to have sufficient siRNAs in every single species to achieve gene silencing Advantages of Dicer siRNA Generation Kit Compared to conventional siRNA construction methods such as chemical synthesis and hairpin siRNA expression vectors the Dicer siRNA Generation Kit offers the following advantages No guesswork A mixture of siRNAs has a better chance of success than a single siRNA design Cost effective No wasted time and money due to failed siRNAs High efficiency More regions of genes are screened for silencing Ideal for use with GeneSilence
16. n If you have a fluorometer or a fluorescence microplate reader Molecular Probes RiboGreen fluorescence based assay for RNA quantitation is a convenient and sensitive way to measure RNA concentration Follow the manufacturer s instructions for using RiboGreen Quantitation by ethidium bromide fluorescence The intensity of ethidium bromide EthBr staining of dsRNA in an agarose gel can give a rough estimate of RNA yield 1 4 3 1 Spot assay If unincorporated nucleotides have been removed an EthBr spot assay can be used to quantitate RNA concentration Make a standard curve with several 2 fold dilutions of an RNA solution of known concentration Start at about 80 ng ul and go down to about 1 25 ng ul Make a few dilutions of the unknown Page 4 of 8 Toll Free 888 428 0558 858 457 1919 Web http www genlantis com 1 4 3 2 GenePORTER Transfection Reagent Manual RNA and add EthBr to 1 ng ul to each dilution of both RNAs Spot 2 ul of the control RNA samples and the unknown RNA dilutions onto plastic wrap placed on a UV transilluminator Compare the fluorescence of the RNAs to estimate the concentration of the sample RNA Make sure that the sample dilutions are in the linear range of EthBr fluorescence This assay will detect as little as 5 ng of RNA with an error of about 2 fold Denaturing gel electrophoresis If unincorporated nucleotides have not been removed from the reaction an aliquot of th
17. ncer siIRNA ratio by using 0 5 7 ul of GeneSilencer for each 100 ng of siRNA Use a low siRNA quantity to optimize this parameter After establishing the optimal GeneSilencer siRNA ratio vary the siRNA quantity over the ranges suggested in the Methods and Procedures section Use recommended buffer 100 mM NaCl 50 mM Tris pH 7 5 in RNase free water to dilute siRNA Do not use water as it can denature the siRNA Thaw out a fresh aliquot of cells and passage once or more before passage for gt 2 months transfecting Avoid using cells that have been in culture or passaged for an excessive time Use cells that are 50 70 confluent on the day of transfection Optimal cell density may vary depending on cell type Improper storage GeneSilencer reagent is very stable but long exposure to elevated temperatures and or excessive freeze thaw cycles may cause degradation store at 4 C Use ONLY serum free medium when forming the GeneSilencer siRNA complex Optimize GeneSilencer siRNA ratio and siRNA amount as indicated on page 6 Section 3 1 siRNA concentration GeneSilencer siRNA GeneSilencer sIRNA complexes should be freshly prepared If complexes complexes not freshly have been prepared and stored for longer than 45 minutes aggregation may prepared occur Sub optimal GeneSilencer Too much GeneSilencer or too much siRNA could cause aggregation Adjust SIRNA ratio used the ratio as outlined above Cytotoxicity Unhealthy cells
18. pend the cells in the appropriate growth medium serum free or serum containing to achieve a final cell density listed in Table 5 3 3 6 Transfer resuspended cells to culture plates according to Table 5 below Page 6 of 8 Toll Free 888 428 0558 858 457 1919 Web http www genlantis com GenePORTER Transfection Reagent Manual Table 5 Volume and Cell Number to Transfer Into Culture Dishes Tissue culture Resuspended cells Number of cells plate or dish volume to transfer to each transferred to each type well ml well approx 96 wells 0 1 1 x 10 48 wells 0 2 2 x 10 24 wells 0 5 5x 10 3 3 7 Add the siRNA GeneSilencer mix to resuspended cells in Table 5 above Gently mix the cells by pipetting up and down several times to avoid cell clumping Incubate at 37 C for 24 hours 3 3 8 Add fresh tissue culture medium to growing cells as needed Most RNA interference can be detected within 48 hours post transfection References f Caplen N J S Parrish F Imani A Fire and R A Morgan 2001 Specific inhibition of gene expression by small double stranded RNAs in invertebrate and vertebrate systems Proc Natl Acad Sci U S A 98 9742 9747 2 Grishok A A E Pasquinelli D Conte N Li S Parrish Ha D L Baillie A Fire G Ruvkun and C C Mello 2001 Genes and mechanisms related to RNA interference regulate expression of the small temporal RNAs that control C elegans developmental timing Cell 106
19. pitation Solution to the mixture from Step 1 2 4 Mix thoroughly Chill for gt 30 min at 20 C Centrifuge at 4 C for 15 minutes at maximum speed to pellet the RNA Carefully remove the supernatant Wash the pellet once with 1 ml 70 ethanol and centrifuge again to maximize removal of unincorporated nucleotides Carefully remove the 70 ethanol and resuspend RNA in Nuclease free Water or TE Buffer Determine the RNA concentration and store at 20 C or 70 C IMPORTANT Lithium chloride precipitation may not efficiently precipitate RNAs smaller than 300 nucleotides or if the concentration of RNA is lower than 0 1 pg ul To precipitate from TurboScript reactions that are thought to have low RNA yields do not dilute the transcription reaction with water prior to adding the LiC Precipitation Solution 1 4 Quantitation of dsRNAs 1 4 1 1 4 2 1 4 3 Quantitation by UV light absorbance Reading the Az o of a diluted aliquot of the reaction is Clearly the simplest way to determine yield but any unincorporated nucleotides and or template DNA in the mixture will contribute to the reading Typically a 1 500 dilution of an aliquot of a TurboScript reaction will give an absorbance reading in the linear range of a spectrophotometer For RNA molecules 1 A2s0 unit corresponds to 40 ug ml so the RNA yield can be calculated as follows A260 X dilution factor x 40 ug ml RNA Assessing dsRNA yield with RiboGree
20. quence 1 940C for 30 seconds TAATACGACTCACTATAGGGAGA 98 C for 30 seconds 35 cycles NOTE The underlined sequence shown above is the 68 C for 1 minute 1kb minimum promoter sequence needed for efficient eC tore minules transcription The 1 base in bold is the first base i incorporated into RNA during transcription The 20 base 4 C storage T7 promoter region includes 2 bases which will form the first 2 bases of the transcribed RNA Yields of transcription 1 1 4 Purification of PCR Product It is important to use a product are greatly reduced if the 1 or 2 G residues are clean PCR product to ensure high dsRNA yield Purify changed PCR product as follows 1 1 3 1 Design gene specific PCR primers by using the 1 1 4 1 Add 1 10 volume of 3 M sodium acetate pH 53 diagram below We recommend using 20 bases 1 1 4 2 Add 2 volumes of ethanol that are gene specific in each primer 1 1 4 3 Mix well and chill at 20 C for 30 min 9 Primer 1 1 4 4 Pellet the DNA for 15 30 min in a 5 GCG TAATACGACTCACTATAGGGAGA NNNNNNNNNN 3 microcentrifuge at top speed leader T7 promoter sequence Target DNA 20 bases 1 1 4 5 Remove the supernatant carefully Resuspend the DNA pellet with 100 ul cold 70 ethanol 3 Primer 1 1 4 6 Spin at top speed for 15 min 0 GCG TAATACGACTCACTATAGGGAGA NNNNNNNNNN 3 1 1 4 7 Remove the supernatant carefully and air dry leader T7 promoter sequence Target DNA 20 bases DNA pellet 1 1 4 8 Resuspend the DNA in 20 ul of Nucle
21. r siRNA Transfection Reagent Genlantis 10190 Telesis Court San Diego CA 92121 VKM070419 Figure 1 How Dicer siRNA Generation Kit Works T7 promoter Sense A PVvTCrTQTTYTCCTtTCLTrTTS phe ee sth ee sere bead Target Sequence banter Anti sense s i T7 promoter PCR T7 promoter Saad Target Sequence T7 promoter Anti sense Transcribe with T7 RNA polymerase M el A NS Aneal and cleanup WITS RNA Digestion using recombinant Dicer enzyme and clean up Sense RNA Fig 2 Efficient Digestion of Double stranded RNA with Recombinant Human Dicer Enzyme 1 ug of a 700 bp dsRNA after 12 hour of digestion by the dicer enzyme Lanes 1 marker 2 1 ul dicer 3 1 5 ul dicer 4 2 ul dicer 5 2 5 ul dicer 6 3 ul dicer 7 3 5 ul dicer 8 4 ul dicer 9 1 ug dsRNA control Page 2 of 8 Toll Free 888 428 0558 858 457 1919 Web http www genlantis com MATERIALS AND METHODS 1 Generating Double Stranded RNA dsRNA 0 GCG TAATACGACTCACTATAGGGAGA Target DNA 3 Template 3 Target DNA AGAGGGATATCACTCAGCATAAT GCG 5 1 1 Preparation of Template DNA for Transcription 1 1 1 Determining a target region The region selected for gene silencing does not seem to matter You may follow a method suggested 5 GCGTAATACGACTCACTATAGGGAGA Target CTCCCTATAGTGAGTCGTATTACGC 3 by Tuschl et al 13 and pick a region of about 100 3 CGCATTATGCTGAGTGATATCCCTCT DNA AGAGGGATATCACTCAGCATAATGCG 5
22. s and for the full length gene of interest optimize the PCR conditions The gene is too long Amplify portions of the gene in 500 to 700 bp fragments and proceed to transcribe dsRNAs from these fragments Neither template nor control Expired or defective kit Double check you have followed the procedure accurately consider trying the reaction work in generating component control reaction a second time If the control still fails this indicates that a kit dsRNA component may have expired Call Genlantis for troubleshooting and support The control reaction works with Wrong amount of DNA Check the amount and quality of template Also check an aliquot of the the TurboScript T7 template or poor DNA quality template DNA on an agarose gel to make sure it is intact and that it is the Transcription Kit but template expected size DNA template has high G C Optimize transcription reaction condition by doubling the amount of GTP and content CTP performing the reaction at 15 C and adding 0 5 1 DMSO dsiRNA yield is low No dsRNA or poor dsRNA Check the amount of dsRNA added Make sure that the correct fractions from quality the RNA Purification Columns are used or purify dsRNA before dicer reaction Too much Dicer Enzyme Use 1 unit of the enzyme for every microgram of dsRNA added 10 mM ATP is old Use fresh ATP solution Sub optimal GeneSilencer SIRNA ratio or Suboptimal Low Transfection Efficiency Optimize the GeneSile
23. this step add one volume of medium containing 20 serum then proceed to step 3 2 6 3 2 6 Add fresh tissue culture medium to growing cells as needed Most RNA interference can be detected within 48 hours post transfection 3 3 Transfection of Suspension Cells 3 3 1 The day before transfection split the cells as necessary to optimize their health and achieve log growth by transfection time 3 3 2 Prepare the GeneSilencer Reagent by diluting in serum free medium according to the recommended amount in Table 1 above 3 3 3 Prepare the dsiRNA solution by first mixing the siRNA Diluent and serum free medium SFM according to Table 4 below Use the Diluent SFM mix to dilute the recommended amount of dsiRNA in Table 4 Mix well by pipetting up and down several times Incubate at room temperature for 5 minutes IMPORTANT Avoid vortexing the siRNA Diluent mix Table 4 siRNA Dilutions For Suspension Cells Tissue cultur Recommended amoun jiRNA Diluent ul serun plate type of dsiRNA ng well free medium l well 96 wells 125 Z0 7 1 48 wells 250 5 0 15 24 wells 500 10 0 15 3 3 4 Add the dsiRNA solution from Step 3 3 3 to the diluted GeneSilencer solution from Step 3 3 2 Incubate at room temp for 5 minutes to form the siRNAl lipid complexes IMPORTANT See IMPORTANT note in 3 2 4 3 3 5 While the siRNA GeneSilencer mix is incubating spin down the cells from Step 3 3 1 remove the growth medium and re sus
24. ugh GeneSilencer consistently delivers high transfection efficiencies in a wide range of cell types to obtain maximum efficiency in particular cell lines some optimization may be needed The two critical variables are 1 GeneSilencer siIRNA ratio and 2 siRNA quantity To optimize these two variables a Determine the best GeneSilencer siIRNA ratio by using 0 5 7 ul of reagent for each 100 ng of siRNA Use a low siRNA quantity to optimize this parameter b Once the optimal ratio has been established vary the siRNA quantity over the suggested range At this point cell number can also be optimized 3 1 2 Suspension cells For suspension cells the optimization procedure is the same as for adherent cells except that the GeneSilencer siRNA ratio is higher IMPORTANT Gene suppression was observed with GFP dsiRNA generated from the GFP Control Plasmid Co transfection of 1 ug of GFP Control Plasmid and 500 ng of dsiRNA resulted in 60 suppression of GFP expression in transiently transfected NIH 3T3 cells 3 2 Transfection of Adherent Cells 3 2 1 The day before transfection plate cells so that they will be 50 70 confluent on the day of transfection 3 2 2 Prepare the GeneSilencer Reagent by diluting in serum free medium according to the recommended amount in Table 1 below Table 1 GeneSilencer Dilutions For Adherent Cells Tissue culture GeneSilencer Reagent ul plate or dish type serum ree medium ul
Download Pdf Manuals
Related Search