Recombineering-proficient E. coli Strain GB08-red
Contents
1. Remark Prepare a 10 L arabinose Sigma A 3256 stock solution in ddH2O and use it fresh or frozen in small aliquots at 20 C Frozen aliquots should not undergo more than three freeze thaw cycles 4 Prepare the cells for electroporation Centrifuge for 30 sec at 11 000 rpm in a cooled microfuge benchtop centrifuge at 2 C Discard the supernatant by quickly tipping it out twice and place the pellet on ice Resuspend the pellet with 1 ml chilled ddH2O or 10 glycerol pipetting up and down three times to mix the suspension Repeat the centrifugation and resuspend the cells again Centrifuge and tip out the supernatant once more 20 to 30 ul will be left in the tube with the pellet Keep the tube on ice 5 Add 100 ng of the linear fragment and 100 ng of the circular plasmid to each of the two microfuge tubes induced and uninduced and pipette the mixture into the chilled electroporation cuvette In parallel pipette 1 ul from tube 3 and 4 into each of the two tubes of the control 6 Electroporate at 1350 V 10 uF 600 Ohms This setting applies to an Eppendorf Electroporator 2510 using an electroporation cuvette with a slit of 1mm Other devices can be used but 1350 V and a 5 ms pulse are recommended 7 Add 1 ml LB medium without antibiotics to the cuvette Mix the cells carefully by pipetting up and down and pipette back into the microfuge tube Incubate the cultures at 37 C with shaking for about 90 min Recombination will2. THE RECOMBINEERING COMPANY GENE BRIDGES peor En eering proficient E coli Strain GBO8 red tliat No KUUY rRed ET Seen binaylon Version 1 1 May 2014 TITITITITITI Tit I Il I Wi nu I ala i i BEH 11 a 14 CONTENTS Recombineering proficient E coli Strain GBO8 red aaa aaa aaa aaa aaa kaaa nana 2 Experimental Outline 2 2 2 2 2 2 nen sen ea dana 3 How Red ET Recombination works uneesnnnnnennnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnannnnnnnannenn namen nn anne 4 Technical protocol 2 a onda ende 5 4 1 Generation of a functional cassette flanked by homology arMS 0aaaaaaaanaaa aaa kaaa kakaa 5 4 2 Insertion of a PGK gb2 neo cassette into a plasmid backbone uusrsnnennnnnnnennnnnn 6 4 3 Verification of successfully modified plasmid by restriction analysis e ee a ee 8 4 4 Maps and sequencCesS aaa anna nakana naka aan ka aan kaaa annna 9 Troubleshooting ik aaia adado en 10 References and Patent aaa vana aaa aaa anna 12 6 1 References e i i i E E IZ E E ZR Senet ates Ae aes 13 6 2 PLCS e e E ANI A A ES E RR EEZ E 13 Purchaser Notification Warranty eena vana ana aaa aa aaa aaa aan 13 Other products available from Gene Bridges aaa ananasa ananasa aaa ananasa aaa aaa nana 14 DNA Engineering Services Available from Gene BridgesS
3. aaa aaa ana aaa aaa aaa aaa aaa annnnnana 15 Please read The products listed in this manual are for research purposes only They are not designed for diagnostic or therapeutic use in humans animals or plants Success depends on following the protocols exactly as they are described Do read the trouble shooting guide before beginning your experiments Red ET Recombination is the intellectual property of Gene Bridges GmbH Safety Some chemical reagents used with this system are dangerous if handled carelessly Take care when using chemical reagents such as isopropanol and ethidium bromide and electrical apparatus high voltage power supplies gel electrophoresis and electroporation apparatus Follow the manufacturers safety recommendations 1 Recombineering proficient E coli Strain GBO8 red Introduction Red ET recombination relies on homologous recombination in vivo in E coli and allows a wide range of modifications on DNA molecules of any size and at any chosen position Homologous recombination is the exchange of genetic material between two DNA molecules in a precise specific and accurate manner Homologous recombination occurs through homology regions which are stretches of DNA shared by the two molecules that recombine Because the sequence of the homology regions can be chosen freely any position on a target molecule can be specifically altered Red ET recombination allows you to choose homology arms as short as 50 bp for homol
4. e A107 Enhanced FLP Expression Plasmid 710 FLPe with kanamycin km resistance marker for use in E coli only e A112 Cre Expression Plasmid 705 Cre cm resistance marker e A113 Cre Expression Plasmid 706 Cre tet resistance marker e A201 Enhanced Eukaryotic FLP Expression Plasmid pC AGGS FLPe 9 DNA Engineering Services Available from Gene Bridges Instead of performing your own DNA manipulations let the Gene Bridges DNA Engineering Service Team do the work for you We work for many commercial and research organizations across the world to provide DNA modifications in low or high copy plasmids cosmids BACs and the E coli chromosome Contact our DNA Engineering Service by email at contact genebridges com for details and prices This page intentionally left blank Gene Bridges Recombineering proficient E coli Strain GBO8 red Version 1 1 May 2014 17 18 This page intentionally left blank Gene Bridges Recombineering proficient E coli Strain GBO8 red Version 1 1 May 2014 This page intentionally left blank Gene Bridges Recombineering proficient E coli Strain GBO8 red Version 1 1 May 2014 19 Gene Bridges GmbH Commercial Centre Im Neuenheimer Feld 584 69120 Heidelberg Tel 49 0 6221 13 70 811 Fax 49 0 6221 13 70 829 contact genebridges com www genebridges com
5. separated even when they were tangled before 12 6 References and Patents 6 1 References e Zhang Y Buchholz F Muyrers J P P and Stewart A F A new logic for DNA engineering using recombination in Escherichia coli Nature Genetics 20 123 128 1998 e Angrand P O Daigle N van der Hoeven F Scholer H R and Stewart A F Simplified generation of targeting constructs using ET recombination Nucleic Acids Res 27 e16 1999 e Muyrers J P P Zhang Y Testa G and Stewart A F Rapid modification of bacterial artificial chromosomes by ET recombination Nucleic Acids Res 27 1555 1557 1999 e Muyrers J P P Zhang Y Buchholz F and Stewart A F RecE RecT and Redo Red initiate double stranded break repair by specifically interacting with their respective partners Genes Dev 14 1971 1982 2000 e Muyrers J P P Zhang Y Benes V Testa G Ansorge W and Stewart A F Point mutation of bacterial artificial chromosomes by ET recombination EMBO Reports 1 239 243 2000 e Zhang Y Muyrers J P P Testa G and Stewart A F DNA cloning by homologous recombination in Escherichia coli Nature Biotech 18 1314 1317 2000 e Muyrers J P P Zhang Y and Stewart A F Recombinogenic engineering new options for cloning and manipulating DNA Trends in Bioch Sci 26 325 31 2001 e Fu J Teucher M Anastassiadis K Skarnes W and Stewart A F A recombineering pipeline to make condition
6. 0 6 000 60 5 000 50 4 000 40 3 000 30 2 500 25 2 000 20 1 500 15 1 000 100 800 80 600 60 400 40 200 20 Figure 3 Restriction analysis of pSub Hoxa11 lanes 1 2 and 10 clones after insertion of the of the PGK gb2 neo cassette lanes 3 12 Se Bgll digestion M Hyperladder Bioline Although nearly all clones will show the expected restriction pattern for a successful integration of the PGK gb2 neo cassette the mother plasmid usually still persists in the cell High copy plasmids like pBluescript or pSub11 Hoxa which is used for the control experiment replicate to up to several hundred copies per cell Due to this high copy number not all plasmid copies will be recombined at the same time resulting in a mixed phenotype where both plasmids are detectable side by side in the cell see also Figure 3 for the control experiment To separate the modified plasmid from its unmodified mother plasmid take a small amount of the isolated plasmid DNA about 1 ng and re transform a fresh aliguot of competent E coli cells with it Pick several colonies the next day perform plasmid mini prep plasmid DNA isolation following the protocol of your choice and check these DNA preparations by restriction digestion After the re transformation step the majority of the analyzed clones should show the restriction pattern for the modified plasmid only For the control experiment the restriction pattern for the plasmid pSub Hoxa11 neo after Bg
7. 57 62 C 2 5 72 C 4 2 Insertion of a PGK gb2 neo cassette into a plasmid backbone In the next step prepare electro competent cells from strain GBO8 red shortly after inducing the expression of the recombination proteins In advance prepare the linear DNA fragment with homology arms that you will insert into your plasmid Use tube 2 PGK gb2 neo PCR product and tube 3 pSub Hoxa1 1 to perform a control experiment in parallel 1 Inoculate 1 0 ml LB medium without addition of antibiotics with GBO8 red and incubate the culture over night at 37 C 2 Before starting the next day e Chill ddH2O or 10 glycerol on ice for at least 2 h e Chill electroporation cuvettes 1 mm gap e Cool benchtop centrifuge to 2 C Set up 4 lid punctured microfuge tubes 2 for your own experiment and 2 for control experiment containing 1 4 ml each of fresh LB medium and inoculate two of them with 30 ul fresh overnight culture for your experiment the other two with 30 ul of the overnight culture from the control experiment Incubate the tubes at 37 C for 1 5 h shaking at 1100 rpm until OD600 0 3 3 Add 50 ul 10 L arabinose to one of the tubes for your own experiment and to one of the control tubes giving a final concentration of 0 3 0 4 This will induce the expression of the Red ET Recombination proteins Do not use D arabinose Leave the other tubes without induction as negative controls Incubate all at 37 C shaking for 35 minutes
8. C Circular plasmid sie Electroporation into GBO8 red cells 2 I Red ET Figure 1 workflow 1 Transform E coli GBO8 red cells with a mixture of linear DNA and circular plasmid For your convenience a plasmid and a control insert kanamycin resistance marker gene sharing 50bp of terminal homology arms are provided for a control experiment Red ET Recombination step The expression of reda and redB genes mediating Red ET recombination is induced by the addition of L arabinose After induction the cells are prepared for electroporation Subsequently the circular plasmid and the linear fragment PCR product are co electroporated Since the PCR product encodes for a kanamycin resistance gene only colonies carrying successfully modified plasmids will survive kanamycin selection on the agar plates Subsequent DNA mini preparation is used to confirm the successful integration of the DNA fragment In most cases an additional retransformation step is required to isolate the modified plasmid from all copies of the original plasmid 3 How Red ET Recombination works Target DNA molecules are precisely altered by homologous recombination in E coli cells which express the phage derived protein pairs either RecE RecT from the Rac prophage or Reda Red from A phage These protein pairs are functionally and operationally similar RecE and Reda are 5 3 exonucleases and RecT and Red are DNA annealing proteins A functional interact
9. PLC Also note that the electronic sequences provided from databases may not be 100 correct If you are trying to target a repeated sequence in your BAC or plasmid you may experience problems because the homology region at the end of the linear fragment can target more than one site Observation No colonies on your plate after Red ET Recombination If you do not obtain any colonies after recombination the following parameters should be checked 1 The linear DNA fragments PCR products and the circular plasmid o could be wrong check it by restriction digest or sequencing o could be degraded check an aliquot on an agarose gel o could have incorrect homology arms if possible verify the correct homology arms by sequencing 2 The Red ET reaction did not take place because o noor the wrong type of arabinose was used for induction please make sure you use L arabinose o in very rare cases increasing the time for recombination from 70 min incubation after electroporation to up to four hours is necessary for successful recombination 3 Problems with and after the electroporation o cells are not competent enough to take up the linear DNA Please make sure that the cells were kept on ice and that the water or 10 glycerol is sufficiently cold Linear DNA has been shown to be about 10 fold less active than DNA transformed in circular form Eppendorf Operation Manual Electroporator 2510 version 1 0 Make sure that the
10. Pro and Eukaryotic Neomycin Selection Cassette PGK gb2 neo e A002 FRT flanked Pro and Eukaryotic Neomycin Selection Cassette FRT PGK gb2 neo FRT e A003 loxP flanked Pro and Eukaryotic Neomycin Selection Cassette loxP PGK gb2 neo loxP e A004 FRT flanked Pro and Eukaryotic Neomycin Selection Cassette plus loxP site FRT PGK gb2 neo FRT loxP e A005 FRT flanked Pro and Eukaryotic Neomycin Selection Cassette plus loxP site 2 version loxP FRT PGK gb2 neo FRT e A006 FRT flanked Chloramphenicol Selection Cassette FRT cm FRT e A007 loxP flanked Chloramphenicol Selection Cassette loxP cm loxP e A008 FRT flanked Ampicillin Selection Cassette FRT amp FRT e A009 loxP flanked Ampicillin Selection Cassette loxP amp loxP e A010 FRT flanked Pro and Eukaryotic Hygromycin Selection Cassette FRT PGK gb2 hygro FRT e A011 loxP flanked Pro and Eukaryotic Hygromycin Selection Cassette loxP PGK gb2 hygro loxP e A012 FRT flanked Pro and Eukaryotic Neomycin Selection Cassette with attached codon improved Cre iCre FRT PGK gb2 neo FRT Additional strains and plasmids e A104 Enhanced FLP Expression Plasmid 707 FLPe with tetracycline tet resistance marker for use in E coli only e A105 Enhanced FLP Expression Plasmid 708 FLPe with chloramphenicol cm resistance marker for use in E coli only e A106 Enhanced FLP Expression Plasmid 709 FLPe with ampicillin ap resistance marker for use in E coli only
11. al targeting constructs Methods in Enzymology 477 125 144 2010 e Fu J Bian X Hu S Wang H Huang F Seibert P M Plaza A Xia L Muller R Stewart A F and Zhang Y Full length RecE enhances linear linear homologous recombination and facilitates direct cloning for bioprospecting Nature biotechnology 30 440 448 2012 6 2 Patents Red ET recombination is covered by one or several of the following patents patent applications and related ones e Stewart A F Zhang Y and Buchholz F 1998 Novel DNA cloning method relying on the E coli RecE RecT recombination system European Patent No 1034260 United States Patent No 6509156 e Stewart A F Zhang Y and Muyrers J P P 1999 Methods and compositions for directed cloning and subcloning using homologous recombination European Patent No 1204740 United States Patent No 6355412 e Zhang Y Fu J and Stewart A F 2011 Direct Cloning WO2011 154927 These patents and patent applications are owned by Gene Bridges or owned by the EMBL and exclusively licensed to Gene Bridges 7 Purchaser Notification Warranty The purchase of this product conveys to the purchaser the non transferable right to use this product for research purposes only The purchaser cannot sell or otherwise transfer this product or its components to a third party No rights are conveyed to the purchaser to use this product or its components for a commercial purpose Commercial p
12. ion between RecE and RecT or between Reda and Red is also required in order to catalyse the homologous recombination reaction Recombination occurs through homology regions which are stretches of DNA shared by the two molecules that recombine Figure 2 The recombination is further assisted by A encoded Gam protein which inhibits the RecBCD exonuclease activity of E coli Double stranded break 3 5 RecE 5 3 2 or Reda exonuclease ili KIH BJE BSE BE U DODO RecT me orRedB Single strand binding proteins 5 3 3 Joint molecule formation DNA replication Figure 2 Mechanism of Red ET Recombination Double stranded break repair DSBR is initiated by the recombinase protein pairs RecE RecT or Redo Red First RecE or Reda digests one strand of the DNA from the double stranded break leaving the other strand as a 3 ended single stranded DNA overhang Then RecT or Red binds and coats the single strand The protein nucleic acid filament aligns with homologous DNA Once aligned the 3 end becomes a primer for DNA replication E coli strain GBO8 red harbours an arabinose inducible gbaA operon redy red reda and recA at the ybcC locus Fu et al 2010 The recombination window is therefore limited by the transient expression of the recombineering proteins Thus the risk of unwanted intra molecular rearrangement is minimized 4 Technical protocol 4 1 Generation of a fu
13. l digest is 422 bp 692 bp 1730 bp 1836 bp 1959 bp 3485 bp 4162 bp and 5234 bp Figure 4 BAND SIZE bp ng BAND 10 000 100 8 000 80 6 000 60 5 000 50 4 000 40 3 000 30 2 500 25 2 000 20 1 500 15 1 000 100 800 80 600 60 400 40 200 20 Figure 4 Restriction analysis Bg l digestion of four colonies obtained in the control experiment after re transformation M Hyperladder Bioline While clone 1 still contains both plasmids in the cell as indicated by the 7759 bp fragment the three other clones show only the pattern expected for pSub Hoxa11 neo 4 4 Maps and sequences araC gam red reda recA Figure 5 Diagram of the arabinose inducible red operon redy a and recA inserted at the ybcC locus 10 5 Troubleshooting Problems with the recombination reaction can be caused by a number of different factors Please review the information below to troubleshoot your experiments We highly recommend performing a positive control experiment using the components provided in the kit For homologous recombination the two DNA molecules must share two regions of perfect sequence identity Wrong nucleotides in the homology region can completely abolish recombination Since oligonucleotides are used to add the homology regions they have to be synthesized properly and be of excellent quality Take into account that long oligonucleotides especially if they are longer than 80bp require additional purification steps such as H
14. nctional cassette flanked by homology arms Oligonucleotide design I Choose 50 nucleotides N so directly adjacent upstream 5 to the intended insertion site Order an oligonucleotide with this sequence at the 5 end At the 3 end of this oligo include the PCR primer sequence for amplification of the PGK gb2 neo cassette given in italics below Upper oligonucleotide oligo 1 5 N so AATTAACCCTCACTAAAGGGCG 3 II Choose 50 nucleotides N so directly adjacent downstream 3 to the intended insertion site and transfer them into the reverse complement orientation Order an oligonucleotide with this sequence at the 5 end At the 3 end of this oligo include the 3 PCR primer sequence also in reverse complement orientation for the PGK gb2 neo cassette given in italics below Lower oligonucleotide oligo 2 5 N so TAATACGACTCACTATAGGGCTC 3 If desired include restriction sites or other short sequences in the ordered oligo s between the 5 homology regions and the 3 PCR primer sequences PCR The oligonucleotides are suspended in dH20 at a final concentration of 10 pmol ul A standard PCR protocol is given below PCR reaction in 50 ul 38 5 ul dH2O 5 0 ul 10 x PCR reaction buffer 2 0 ul 5 mM dNTP 1 0 ul upper oligonucleotide 1 0 ul lower oligonucleotide 1 0 ul PCR template 0 5 ul Taq polymerase 5 U ul e An annealing temperature of 57 62 C is optimal e Thirty cycles 1 95 1
15. now occur 8 Streak the cultures with a loop onto LB agar plates containing the appropriate antibiotics for the plasmid e g ampicillin 100 ug ml plus kanamycin 50 ug ml for the control You should obtain gt 100 colonies and the ratio of induced uninduced bacterial colonies should exceed 10 1 More than 95 of all colonies growing on the agar plates conditioned with the appropriate antibiotics will have successfully recombined copies of the plasmid Please note that although most kanamycin resistant colonies will contain the correct plasmid recombinant in rare cases it is possible that secondary recombination usually deletions between internal repeats in the plasmid can also occur To confirm the correct recombination event pick 10 20 colonies from your experiment and 2 from the control reaction isolate plasmid DNA and analyze the DNA by restriction digestion 4 3 Verification of successfully modified plasmid by restriction analysis Analyze an aliquot of your plasmid DNA by restriction digestion For the control experiment the restriction pattern for the original plasmid pSub Hoxa11 after Bgll digest is 422 bp 692 bp 1730 bp 1836 bp 1959 bp 3485 bp and 7759 bp The integration of the PGK gb2 neo cassette leaves the smaller fragments intact but results in a cleavage of the 7759 bp fragment into two smaller ones with 4162 bp and 5234 bp respectively M3 4 5 6 7 10 11 12 M M BAND SIZE bp ng BAND 10 100 8 000 8
16. ogous recombination which can easily be added to a functional cassette by long PCR primers E coli strain GBO8 red harbours an arabinose inducible gbaA operon redy red reda and recA at the ybcC locus Fu et al 2010 The PGK gb2 neo cassette supplied with the kit is designed to allow kanamycin neomycin selection in prokaryotic and eukaryotic cells respectively It combines a prokaryotic promoter gb2 for expression of kanamycin resistance in E coli with a eukaryotic promoter PGK for expression of neomycin resistance in mammalian cells The prokaryotic promoter gb2 is a slightly modified version of the Em7 promoter it mediates higher transcription efficiency than the generally used Tn5 promoter The promoter of the mouse phosphoglycerate kinase gene PGK is used as the eukaryotic promoter A synthetic polyadenylation signal terminates kanamycin neomycin expression Contents of the kit 1 GB08 red Glycerol stock of recombineering proficient E coli strain GBO8 red 500 ul 25 glycerol 2 PGK gb2 neo PCR product PGK gb2 neo cassette flanked by 50 bp long homology arms for the control experiment 100 ng ul 10 ul 3 pSub Hoxa11 high copy plasmid containing 15 kb of the mouse Hoxa11 gene for the control experiment 100 ng ul 20 ul 4 This manual with protocols maps and sequences Please store tube 1 at 80 C tubes 2 3 at 20 C 2 Experimental Outline a Linear DNA fragment PGK gb2 neo
17. time constant is around 5 ms o make sure that there is no arching during the electroporation process o make sure that after electroporation the cells are plated on the appropriate concentration of antibiotics depending on the copy number of the plasmid or BAC Similar number of colonies on both plates the induced and the uninduced one A similar number of colonies on both plates induced and uninduced one indicates that there are still traces of the circular or supercoiled plasmid used for preparing the linear plasmid backbone left in the sample Since the transformation efficiency of linear fragments is 10 fold less than that of circular DNA molecules you may obtain a background even if no traces were visible on an agarose gel If the linear DNA fragment was obtained by restriction digestion use less DNA and gel purify the fragment If the linear fragment was obtained by PCR set up a Dpnl digest for your PCR product and gel purify it at the end You cannot separate the recombined plasmid from the non recombined one after recombination even after re transformation high copy plasmid In very rare cases we have observed that after recombination it is difficult to separate the original plasmid from the recombined one If you cannot separate them by dilution of the plasmid and re transformation you can choose a single cutting restriction enzyme and digest the plasmid for a few minutes After re transformation the two plasmids should be
18. urposes shall include any activity for which a party receives consideration of any kind These may include but are not limited to use of the product or its components in manufacturing to provide a service information or data use of the product for diagnostic purposes or re sale of the product or its components for any purpose commercial or otherwise Limited Warranty Gene Bridges is committed to providing customers with high quality goods and services Gene Bridges assumes no responsibility or liability for any special indirect incidental or consequential loss or damage whatsoever This warranty limits Gene Bridges GmbHr s liability only to the cost of the product 8 Other products available from Gene Bridges General information e Kits are available for non commercial research organizations Commercial companies or for profit organizations require a sub license to use Red ET Recombination The complete product list as well as all information about how to order kits in your country is given on our website www genebridges com Additional Kits e K001 Quick and Easy BAC Modification Kit e K002 Counter Selection BAC Modification Kit e K003 BAC Subcloning Kit e K004 Quick and Easy Conditional Knockout Kit FRT FLPe e K005 Quick and Easy Conditional Knockout Kit loxP Cre e K006 Quick and Easy E coli Gene Deletion Kit e K008 Direct cloning proficient E coli strain GBOS dir Additional functional cassettes e A001
Download Pdf Manuals
Related Search