Home

NxSeq Long Mate Pair Library Kit

1. 15 2 User Supplied Reagents Equipment Reagent Supplied By Exonuclease Treated Insert Coupler From step 14 3 AMPure XP Beads Beckman Coulter 1 5 mL LoBind Microcentrifuge tubes Eppendorf Magnetic rack for 1 5 2 mL tube Invitrogen 70 Ethanol Prepare fresh daily User 15 3 Protocol Equilibrate AMPure beads to room temperature for at least 30 minutes Vortex the beads to resuspend them Equilibrate Elution Buffer EB to room temperature prior to use Set up the bead clean up reaction add each reagent in the following order Reagent Volume HL Exonuclease Treated Insert Coupler 205 5 AMPure XP Beads 205 5 Perform all of the following steps at room temperature Mix gently by pipetting up and down 10 times Incubate at room temperature for 5 minutes do not use a magnetic rack during the incubation Place the tube in a magnetic rack until the supernatant becomes clear 5 minutes With tube in the magnetic rack remove the supernatant with a pipette and discard 15 3 Wash Wash the beads by adding 750 uL of 70 ethanol to the tube and pipetting the ethanol up and down 4 times without disturbing the beads Remove the ethanol by pipetting and discard Repeat the 15 3 Wash steps Remove all remaining ethanol and let the bead pellet air dry for approximately 5 minutes while still in the magnetic rack With the tube in a magnetic rack add the following reagent Reagent V
2. 10 4 Protocol To the tube containing the digested insert coupler from step 9 3 set up the Streptavidin bead clean up reaction add each component in the following order Reagent Volume HL Digested Insert Coupler from step 9 3 40 Biotin Capture Buffer BCB 45 Nuclease Free Water 4 Biotin Capture Reagent BCR 1 Total 90 Mix gently by pipetting up and down 10 times Place tube in thermomixer or heat block and incubate according to the following parameters Step Temperature Time 1 50 C 30 minutes 2 25 C 15 minutes Spin the tube briefly to collect materials at the bottom of the tube Add the following reagent to the tube Reagent Volume HL Washed Streptavidin Beads from step 10 3 10 Unless instructed otherwise perform all of the following steps at room temperature Mix gently by pipetting up and down 10 times Place tube in thermomixer or heat block and incubate according to the following parameters Step Temperature Time 1 25 C 15 minutes Place the tube in a magnetic rack until the supernatant becomes clear 5 minutes With tube in the magnetic rack remove the supernatant with a pipette and discard 10 4 Wash With the tube in a magnetic rack add 100 uL of Biotin Wash Buffer BWB Remove the tube from the magnetic rack and re suspend thoroughly by gently pipetting up and down 10 times Place the tube in magnetic ra
3. Ambion AM993 Yes Yes Yes DEPC treated 1 5 mL Eppendorf DNA Eppendorf 22431021 Yes Yes Yes LoBind Microcentrifuge tubes 0 2 mL thin wall PCR Various Various Yes Yes Yes tubes Qubit dsDNA HS Assay Invitrogen Q32854 Yes Yes Yes Kit Bioanalyzer DNA Kits Agilent 5067 4626 Yes Yes Yes Options include Technologies 5067 1508 e Agilent High Sensitivity DNA Kit e Agilent DNA 12000 Kit optional Included with 0 75 Agarose cassettes Dye Free Low Range Page 7 of 67 MA162 RevA NxSeq 20 kb Mate Pair Library Kit Protocol Equipment Recommended Catalog Used for Blue SeaKem Vendor 2 8 kb Pippin Elutrap Protocol 5A 5B Wide Bore Pipet Tips Axygen TF 205 WB L No Yes Yes 200 uL R S Wide Bore Pipet Tips Axygen TF 1005 WB No Yes Yes 1000 uL R S Eppendorf Centrifuge Eppendorf 5424 No Yes Yes Electrophoresis supplies Various Various No Yes Yes e SeaKem Gold Lonza 50152 No Yes Yes Agarose Lucigen 50020 1 or e Markers 1K plus and NEB 50010 1 100 bp NEB N3012S e Marker Lambda DNA N3019S Hindlll digest e Marker Lambda DNA Mono Cut Mix Covaris g TUBE Covaris 520079 or No Yes Yes 520104 Refrigerator 4 C Various Various No Yes Yes calibrated to 4 5 C BluePippin Sage Science n a No Yes No Elutrap Whatman 10 447 700 No No Yes Long wave UV 365 nM UVP Inc Model UVL No No Yes Blak Ray Lamp 56 2100 Bioanalyzer Agilent Various
4. Reagent Name tubesinkit Cap Map Identifier Part Number A943018 Identifier Junction Code 1 JC JC Junction Code F812816 6 Reagent T4 Polynucleotide 1 PNK PNK F93135 6 Kinase Accura HotStart 2X 1 AMM AMM Accura 2X MM B732793 Master Mix Primer Mix Index 12 1 12 12 Index 12 B713077 NxSeq Long Mate Pair Index Kit Reagent Name tubes in kit Cap Map Identifier Part Number A913078 1 Identifier Primer Mix Index 1 1 1 1 Index 1 F813066 1 Primer Mix Index 2 1 2 2 Index 2 F813067 1 Primer Mix Index 3 1 3 3 Index 3 F813068 1 Primer Mix Index 4 1 4 4 Index 4 F813069 1 Primer Mix Index 5 1 5 5 Index 5 F813070 1 Primer Mix Index 6 1 6 6 Index 6 F813071 1 Primer Mix Index 7 1 7 7 Index 7 F813072 1 Primer Mix Index 8 1 8 8 Index 8 F813073 1 Primer Mix Index 9 1 9 9 Index 9 F813074 1 Primer Mix Index 10 1 10 10 Index 10 F813075 1 Primer Mix Index 11 1 11 11 Index 11 F813076 1 Primer Mix Index 12 1 12 12 Index 12 F813077 1 Customer Supplied Reagents and Equipment Note The customer supplied reagents and equipment vary depending on the size selection method Reagent Recommended Catalog Used for Blue SeaKem Vendor 2 8 kb Pippin Elutrap Protocol Step 5A Step 5B SeaKem Gold Agarose Lonza 50152 No Yes Yes 50X TAE agarose gel Thermo B49 No Yes Yes running buffer Scientific Lambda DNA Hindlll NEB N3012S No Yes Yes
5. Digested Insert Coupler From step 9 3 Thermomixer or heat block set at 50 C Eppendorf Thermomixer or heat block set at 25 C Eppendorf Thermomixer or heat block set at 65 C Eppendorf 10 3 Prepare Streptavidin Beads MyOne C1 Equilibrate Elution Buffer EB Biotin Wash Buffer BWB and Biotin Capture Buffer BCB to room temperature prior to use Add the following reagents to a clean 1 5 mL LoBind tube Reagent Volume HL Streptavidin Beads MyOne C1 40 Biotin Wash Buffer BWB 100 Total 140 Perform all of the following steps at room temperature Mix gently by pipetting up and down 10 times Place tube in magnetic rack until the supernatant becomes clear 5 minutes With tube in the magnetic rack remove the supernatant with a pipette and discard Remove the tube from the magnetic rack Add 100 uL of Biotin Wash Buffer BWB Mix gently by pipetting up and down 10 times Place tube in magnetic rack until the supernatant becomes clear 5 minutes With tube in the magnetic rack remove the supernatant with a pipette and discard With the tube in the magnetic rack and add the following reagent Page 31 of 67 MA162 RevA NxSeq 20 kb Mate Pair Library Kit Protocol Reagent Volume HL Biotin Wash Buffer BWB 10 Remove the tube from the magnetic rack Mix gently by pipetting up and down 5 times Do not vortex Keep beads on ice until ready for use
6. The circularized inserts are then treated with exonuclease to remove unwanted linear DNA and then digested with a selection of endonucleases to produce the correctly sized di tags Biotin capture is used to remove the unwanted DNA fragments prior to the addition of a Junction Code Reagent The library is re circularized amplified by PCR and then sequenced on an Illumina platform Page 3 of 67 MA162 RevA NxSeq 20 kb Mate Pair Library Kit Protocol Workflow Diagram End Repa jo Insert Coupler Ligation A Tail t Adopt Exonuclease Genomic DNA ShearDNA E E 5 s df Digestion ize Selec a 2 x 150 Base Illumina Reads IA yr AA 1 pi Read 1 N Chimera Code Sequence Chimera Code Sequence Adaptor Adaptor Restriction Endonuclease Junction Code Ligation Left Mate Pair Junction Right Mate Pair Index a Cod Digestion Circularization Library Amplification eee Biotin Capture Exonuclease Digestion os Size Selection SES Read 2 I Junction Code o Insert Adaptor Chimera Code Sequences i Coupler Figure 1 Schematic of NxSeq Library construction Workflow Timeline The NxSeq Long Mate Pair protocol contains multiple optional stopping points However the protocols can be used to generate sequence ready mate pair libraries in three days The table below lists the three day work flow Day Steps Estimated Time 1 1 Shear DNA to Appropriate Size Hands On 1 1 2 hours
7. 575 9695 Product Guarantee Lucigen guarantees that this product will perform as specified for one year from the date of shipping Product Description The NxSeq Long Mate Pair Library Kit is designed to generate mate pair libraries for sequencing on Illumina platforms When combined with fragment library sequencing data mate pair library sequences enable superior genome assembly closure and finishing Applications include de novo genome assembly chromosomal rearrangement detection haplotyping and BAC sequencing There are two protocols available for this product e This protocol MA162 uses gel based clean up steps for insert size selection and is recommended for spanning repeats from 10 20 kb e MA160 uses a fast and easy gel free bead clean up step for insert size selection and is recommended for spanning repeats lt 8 kb For complex genomes such as plant or animal genomes we recommend constructing multiple mate pair libraries ranging from 2 20 kb which would use both protocols In most cases very complex genomes will also benefit from a separate product the pNGS Fosmid NxSeq 40 kb Mate Pair Library Kit available separately Please contact custserv lucigen com with any questions Workflow Using this method genomic DNA is sheared to the desired size end repaired A tailed and ligated to adaptors The insert is size selected and ligated to a unique coupler that contains encrypted Chimera Code sequences
8. Enzymes Faool De en F agyalcus 37 dien ye Reala Adl Del NA A A Page 9 of 67 MA162 RevA NxSeq 20 kb Mate Pair Library Kit Protocol The images below provide examples of restriction enzyme testing that were used to identify recommended restriction enzymes te 3 33 3 El gt 33 a rn 3 r z 3 gt s 2 222283339323 x lt I lt I x x w ea Figure 2 Results of E coli restriction digest testing Optimal results are seen with HpyCH4V and Rsal Haelll v u Doa O a 3 33 gt 8 Ss 33 2 2 33 23 Gnz ti3 233 nn3 gt D Z Y x 888 os amp x ss earerees 8 10000 g38 um E E ZH att IE Figure 3 Results of T aquaticus restriction digest testing Optimal results are seen with Alul and Rsal Accll e 5 E 3 3 3 DOM gt g y o x J D s 2 T e 5 aa S 22 8 36a 3 8 x TI Ar E foca E I Uncut ss meee 82338 sss meen Figure 4 Results of Human gDNA restriction digest testing Optimal results are seen with Alul and Haelll Rsal Page 10 of 67 MA162 RevA NxSeq 20 kb Mate Pair Library Kit Protocol General Recommendations Use Eppendorf Lo Bind 1 5 mL tubes throughout the protocol Thaw all kit reagents on ice prior to use Use wide bore tips to handle High Molecular Weight DNA Use a Qubit Fluorometer or equivalent to perform all sample q
9. Kit Box 2 5 libraries 13400 1 A943018 1 Components and Storage Store all kits and components at 20 C ya 5 C max 25 C min 1 NxSeq Long Mate Pair Kit Box 1 Reagent Name tubes in kit Cap Map Identifier Part Number A943016 Identifier Elution Buffer 1 EB EB Elution Buffer F882705 6 End Repair Tailing 2 ERB ERB E R Buffer F882709 6 Buffer End Repair Enzyme 1 ERE ERE E R Enzyme F93034 6 Mix Klenow Fragment 1 KF KF Klenow F93626 6 Adaptor 1 ADT ADT Adaptor F813105 6 Ligase 1 LIG Lig Ligase F832792 6 1 Reagents only in box 1 NxSeq Long Mate Pair Kit Box 2 Reagent Name tubes in kit Cap Map Identifier Part Number A943018 Identifier Elution Buffer 6 EB EB Elution Buffer F882705 6 Klenow Fragment 1 KF KF Klenow F93626 5 Ligase 1 LIG Lig Ligase F832792 5 Coupler Mix 1 CM CM Coupler F823007 6 10X Ligase Buffer 1 10X 10X Ligase Buffer F88912 6 Nuclease 1 1 N1 N1 Nuclease 1 F832799 6 Nuclease 2 1 N2 N2 Nuclease 2 F83920 6 Biotin Wash Buffer 4 BWB BWB Biotin Wash F882794 6 Biotin Capture Buffer 1 BCB BCB Biotin Buffer F882711 6 Biotin Capture Reagent 1 BCR BCR Biotin Reagent F812766 6 Tailing Buffer 1 TB TB Tailing Buffer F882713 6 Page 5 of 67 MA162 RevA NxSeq 20 kb Mate Pair Library Kit Protocol
10. Microcentrifuge tubes Eppendorf Ethidium Bromide Solution 10 mg mL BioRad 10X Loading Dye Various 5A 3 Protocol BluePippin Size Selection e Prepare the 0 75 agarose dye free cassette according to the following instructions O Gently tap any bubbles out from behind the elution modules O Remove electrophoresis buffer from all five elution modules and replace it with fresh electrophoresis buffer O Seal the elution modules shut with the provided tape O Ensure that the buffer level is sufficient in all chambers O Fill each sample well completely with electrophoresis buffer and then remove 40 uL from each well O Calibrate the instrument and test the cassette Do not use any lanes that fail e Prepare the insert for loading onto the BluePippin O Add 10 kb 20 uL of BluePippin loading solution to the tube containing 60 uL of resuspended insert DNA Do not vortex to mix 15 and 20 kb 40 uL of BluePippin loading solution to the tube containing 120 uL of resuspended insert DNA Do not vortex to mix O Mix by pipetting up and down about 10 times with a wide bore pipet tip until the sample is equilibrated with loading solution O Spin the tube briefly to collect materials at the bottom of the tubes Page 18 of 67 MA162 RevA NxSeq 20 kb Mate Pair Library Kit Protocol e _ Load the cassette with 40 uL of S1 marker in one lane designated as the reference lane Using a wide bore tip load 40 uL of the resuspended inser
11. Sequence Code 1 TGGACT 2 TCTGGA 3 ACTTCG 4 TGATGT 5 TGAGTC 6 TCGTGA 7 TGACTG 8 GTGCTA 9 TCAGGT 10 GAGGTT 11 ATGTCA 12 AGTTGT 13 GTATGA 14 TTAGAC 15 GTCTAC 16 CGTGTA 17 GTTGGA 18 GTTCTC 19 CGATTC 20 AATCTC 21 GGTTAC 22 TAGGTC 23 TCACCT 24 GAGTCT Appendix l Size Distribution of 20kb Inserts Size distributions of sequenced 10 15 and 20 kb Long Mate Pair Libraries are shown below Qualified long span mate pairs were mapped against reference genomes and the pair distance distribution was plotted in CLC Genomics Workbench Paired distance distribution 2200 2000 1800 1600 1400 1200 1000 Count 600 400 200 Figure 17 Size Distribution of 20 kb Insert Size Selected with BluePippin Qualified long span mate pairs were mapped against the repeat masked reference genome GRCh38 and the pair distance distribution was plotted in CLC Genomics Workbench High Pass 20 50 kb range mode 35 kb selection 15 20 kb definition Marker S1 Page 64 of 67 MA162 RevA NxSeq 20 kb Mate Pair Library Kit Protocol Paired distance distribution 45000 40000 35000 30000 25000 Count 20000 15000 10000 5000 QW Bw L2 gt gt Y on Ss oo oo rs gt DAS A US D Pe D Pe O Fe D Pe 2 Gb Y Y Tao Ss Figure 28 Size Distribution of 20kb Insert Size Selected with Elutrap Sequencing data was mapped against the reference E coli strain K12 and plotted as Paired Distance Distribution Pai
12. digest testing Restriction Enzyme Options Enzyme Supplier HpyCH4V Restriction Enzyme NEB Rsal Restriction Enzyme 10 U uL Alul Restriction Enzyme 10 U uL Haelll Restriction Enzyme 10 U uL CutSmart Buffer Accll Restriction Enzyme 10 U uL Takara General Digestion Set up e Add the following reagents to 0 2 mL thin wall PCR tube s Reagent Final concentration per reaction gDNA 200 ng Buffer CutSmart 2 uL Restriction Enzyme s 10 Units not to exceed 2 uL Nuclease free water To 20 uL Total 20 uL e Mix by pipetting up and down 10 times e Incubate reaction s at 37 C for 30 min e Run reaction s as well as undigested gDNA on 1 7 gel agarose or or E gel with DNA ladder e g 100 bp ladder e Review results on gel agarose or E gel Figure 2 e Determine optimal restriction enzyme s Ideal digests will contain the majority of the smear within a 500 700 bp size range For optimal sequencing results the recommendation is to perform two side by side restriction digests using at least 1 enzyme for each digest and pool the digested material prior to cleanup see step 11 for details The table below provides recommendations for restriction enzymes for four reference genomes See Appendix A Example Experimental Set up for Restriction Enzyme Testing for an example of Restriction Enzyme testing using E coli Genome GC Content Restriction
13. edges of a standard 85 x 85 x 24 mm plastic weigh boat The slits should allow current to pass through but not the agarose plugs The container is placed in an electrophoresis chamber with enough buffer to cover the bottom and allow current to pass through the container Place the agarose plugs in the container in line with the current with just enough buffer to allow current to pass but not allow the plugs to float or move Apply 100 V for 5 min lt 240 kb inserts or 10 min gt 240 kb inserts After electrophoresis drain the buffer and place the agarose plugs in the EluTrap Removal of Small Fragments Pre EluTrap ae AI 100 V for 5 10 min an Notice of Limited Label License Copyright Patents Warranties Disclaimers and Trademarks This product is the subject of U S Patent 8 329 400 and pending patent applications licensed exclusively to Lucigen Corporation This product was developed and manufactured by Lucigen Corporation Middleton WI Page 67 of 67 MA162 Rev A
14. for a minimum of 45 minutes NOTE Keeping the samples in the cassette for longer than 45 minutes increases the recovery of high molecular weight DNA samples from the elution modules Samples can remain in the cassette for as long as 14 16 hours overnight e Slowly extract the 40 uL size selected DNA samples from each of the two or four sample lane elution modules O Use a regular 20 200 uL tip wide bore tips will not fit in the elution module o Do not pipet the samples up and down e Combine the two or four lanes for each sample into a single 1 5 mL Lo Bind tube Page 19 of 67 MA162 RevA NxSeq 20 kb Mate Pair Library Kit Protocol To each of the two or four sample lane elution modules add 40 uL of 0 1 Tween 20 Allow the solution to sit in the elution module for 1 minute Do not pipet the sample up and down Gently and slowly extract the 40 uL sample from each sample lane elution module and add it into the 1 5 mL Lo Bind tube for a total of 160 uL for 1 OKb samples and 320 uL for 15 Kb and 20 Kb samples 5A 4 Protocol Precipitation of Captured Insert DNA In the tube with the size selected sample set up the precipitation reaction add each reagent in the following order Reagent Volume HL Volume HL 10kb insert 15 and 20kb insert Insert DNA 160 320 3 M NaOAc pH 7 0 0 1X 16 32 GlycoBlue 1 1 100 Isopropanol 1 5X 240 480 Mix by inverting the tube 10 times Incubate at 2
15. kb Mate Pair Library Kit Protocol Appendix A Example Experimental Set up for Restriction Enzyme Testing The table below provides an example experimental set up to identify the appropriate restriction enzymes for E coli Note the use of individual restriction enzymes and pooled restriction enzymes e Add the following reagents to 0 2 mL thin wall PCR tubes Reagent 1 2 3 4 5 6 7 BL ML ML pL ML uL HL E coli gDNA 100 ng pL 2 2 2 2 2 2 2 10X CutSmart Buffer 2 2 2 2 2 2 2 Rsal 10 U uL 1 Alul 10 U uL 1 HpyCH4V 5 U uL 2 Accll 10 U L 1 Haelll 10 U uL 1 Accll Haelll 1 Alul HypCH4V 1 Nuclease free water 15 15 14 15 15 15 15 Total 20 20 20 20 20 20 20 1 Use of CutSmart Buffer NEB is highly recommended Buffers from other vendors have not been tested and may not be compatible with the restriction enzyme s used to digest the gDNA 2 If using a pool of restriction enzymes mix 10 Units of each enzyme in a 1 5 mL LoBind tube and use 1 uL for the digest Page 54 of 67 MA162 Rev A NxSeq 20 kb Mate Pair Library Kit Protocol Appendix B The Effect of the Size Range of Sheared DNA on Insert Size When shearing DNA it is important to create and size select for fragments that are larger than the desired size range Any given preparation of sheared DNA contains more fragments of smaller sizes Panel A which are cloned
16. more efficiently than the larger fragments Thus the insert size of your final library will be skewed to the lower size range of your sheared DNA Megaruptor gTubes A 50 S E E g Bs 5 g T 22 23323 pe u v u Z 505 40 D 228 w g g El gt x Nmn I D n o T ur o 5 9 3 O 5 D u ww 10000 o 20 mA a p 6000 E w 4000 E gt a E e 10 1000 O amp 1225 5 10 20 40 80 Fragment Size kb Paired distance distribution Pared Gstarke EDO C 50000 i 45000 35000 l g 30000 25000 pus 20000 15000 10000 3000 o t al IHNEN n I 4 o 6 D Le SAIN ARAS ES In NEN N ON ON ATI AAA Distance bp Distance bp Figure 1 Effect of size range of sheared DNA on insert size A The size range of fragments in sheared DNA is shown in the Red curve A library created from this preparation of sheared DNA is typically skewed toward the lower end of the size range Green curve because of the number of molecules associated with a given size of DNA fragment Given an equal mass of DNA there will be more smaller fragments than larger fragments B Examples of DNA sheared on a Megaruptor and with gTubes Note that the final library size will be at the lower size range of the sheared DNA D Analysis of two sequenced libraries T aquaticus gDNA C and E coli K12 gDNA D sheared with gTubes Page 55 of 67 MA162 RevA NxSeq 20 kb Mate Pair Library Kit Prot
17. of amplification Examples of amplification artifacts include e Single strand DNA which can form secondary structures hairpins and run at a higher size range indicated by black arrow in figure below e Reduced amplicons size as shown in figure below for Cycles 23 Black and 24 Red for this GC rich genome 78 GC Amplification artifacts can be reduced or eliminated by reducing the number of PCR cycles or increasing the post PCR 72 C extension time For the example below 20 or 21 cycles will produce sufficient DNA for library sequencing after 8 reactions are combined and size selected 1504 Amplification ifacts PCR Cycles i 24 merece 100 4 50 TT Tre Asa 35 100 200 300 400 500 700 2000 10380 Over Amplification Over amplification is defined as producing far more library DNA than is needed for sequencing Over amplification can be reduced or eliminated by reducing the number of PCR cycles used In the example above 20 or 21 cycles will produce sufficient DNA for library sequencing Page 58 of 67 MA162 Rev A NxSeq 20 kb Mate Pair Library Kit Protocol Appendix E Additional Instructions for Sample Pooling Prior to Sequencing Compatible Index Primer Combinations When using the Index Primer Mixes from the NxSeq Long Mate Pair Index Kit use the following guidelines to pool two or more indexed libraries together for single indexed sequencing on an Illumina Sequencer Number of Poole
18. 0 C for a minimum of 10 minutes up to overnight 14 16 hours Centrifuge at 4 C for 30 minutes at 15 000 RPM Remove supernatant being careful not to disturb the blue pellet Immediately add 600 uL of 70 Ethanol Centrifuge at 4 C for 5 minutes at 15 000 RPM Remove supernatant with a pipette while being careful not to disturb the pellet Air dry for 10 minutes Carefully re suspend the pellet in 50 uL Elution Buffer EB Incubate eluted sample for 15 min at RT 5A 5 Concentration Quantify using Qubit according to manufacturer s instructions Record the concentration in ng uL Confirm the minimum amount and concentration of DNA required to proceed Insert Size Minimum Amount DNA Minimum Concentration DNA Required Required 10kb 500 ng 10 0 ng uL 15 kb 750 ng 15 0 ng L 20 kb 1000 ng 20 0 ng uL MA162 RevA Page 20 of 67 NxSeq 20 kb Mate Pair Library Kit Protocol 5A 6 Size Confirm the correct size selection e Visualize on 0 3 SeaKem Gold agarose gel Run with Lambda DNA Hindlll digest 30 ng and Lambda DNA Mono Cut Mix 200 ng Bands at 10 15 17 and 23 kb should be visible See Figure 3 Proceed directly to step 6 Ligation of Insert to Coupler c Doa O o GO gt sta 6 fa O C o coo v E v c2 Ova Ona T u a o a Wie ZOC e ZOC 2425 Y 222 5 194 0 194 0 145 5 145 5 97 0 97 0 48 5 m za 43 5 23 1 S 23 1 94 ES lt A 9 4 6 6 6
19. 0 1000 2000 10380 Example trace of final size selected library using Agencourt AMPure XP Reagent Page 49 of 67 MA162 RevA NxSeq 20 kb Mate Pair Library Kit Protocol 35 100 150 200 300 400 500 600 1000 2000 10380 bp Example trace of overlaid samples amplified library vs size selected library O Optional Safe Stopping Point DNA can be stored at 20 C Page 50 of 67 MA162 RevA NxSeq 20 kb Mate Pair Library Kit Protocol 18 Illumina Sequencing You must spike a 5 PhiX Control Illumina into the mate pair library sample or sample pool prior to loading on sequencer A Important Note The PhiX control is critical to ensure sufficient diversity of the first 30 cycles of the sequencing run The information generated from the PhiX control can also be used to confirm the sequencer and sequencing reagents are performing as expected If performance issues are seen and the PhiX control was not spiked into the sample Lucigen will not be able to eliminate the sequencing as the cause of the issues and therefore will not replace any NxSeq Long Mate Pair Library kits Information on the expected performance of the PhiX control can be found on Illumina s website o MiSeg http www illumina com systems miseg performance specifications ilmn o HiSeq2500 http www illumina com systems hiseg_ 2500 1500 performance specifications ilmn Proceed with Illumina sequencing with the MiSeq NexSeq 500 or the HiSeq2500 using
20. 0 kb 5 2 52 2 e 2 e e x N d ca id ib w id ar g e 0 3 0 5 1 0 Figure 4 Zone of Compression ZOC Inserts located in the Zones of Compression are excised for elution using the Elutrap dd d dl da aa gt 23kb taa Figure 5 Gel Isolated Insert Sheared adapted insert was gel isolated on a 0 8 SeaKem Gold agarose gel The marker is a Lambda Hindlll digest The lower bands are un ligated adaptor Page 23 of 67 MA162 RevA NxSeq 20 kb Mate Pair Library Kit Protocol 5B 4 Protocol Elutrap Capture of Insert DNA Set up the Elutrap according to manufacturer s instructions Place two agarose plugs in the Elutrap next to the white BT2 filter stacked horizontally or vertically side by side 15 and 20 kb libraries require 2 Elutraps each Apply 150 Volts for 5 hours A ter electrophoresis reverse the polarity of the electrodes and apply 200 Volts for 20 seconds to remove DNA from the BT1 membrane Remove the buffer containing the insert from the sample chamber with a 1000 mL pipette tip and place into a fresh 1 5 mL LoBind tube approximately 400 to 500 mL Take care not to puncture the fragile white BT2 membrane Note The amount of sample removed will be variable 5B 5 Protocol Precipitation of Captured Insert DNA Measure the volume of the sample removed from the sample chamber X in table below Split into two tubes if the volume of the mixture exceeds 1 5 mL Add th
21. 2 End Repair Elapsed Time 5 hours 3 A Tailing 4 Ligation of Adaptor 2 5A Size Selection of Adaptor Ligated DNA with Blue Pippin Hands On 2 1 2 hours OR Elapsed Time 8 2 hours 5B Size Selection of Adaptor Ligated DNA with SeaKem Gold Agarose and EluTrap Note Step 6 ends with 6 Ligation of Insert to Coupler overnight ligation overnight ligation 3 7 Exonuclease Treatment Hands On 2 hours 8 Clean up of Exonuclease Treated Insert Coupler Elapsed Time 8 Y hours 9 Restriction Enzyme Digest 10 Biotin Capture 11 Junction Code Ligation 12 Clean up of Insert Coupler with Junction Code 13 DNA Re circularization 14 Exonuclease Treatment 4 15 Clean up of Exonuclease Treated Coupler Insert Hands On 3 hours 16 Amplification using Accura HotStart 2X Master Mix Elapsed Time 6 hours 17 Size Selection of Amplified Mate Pair Library 18 Illumina Sequencing Page 4 of 67 MA162 RevA NxSeq 20 kb Mate Pair Library Kit Protocol Product Designations Product Kit Size Catalog Part Number s number NxSeq Long Mate Pair Library Kit 5 libraries 13000 1 A943016 1 A943018 1 NxSeq Long Mate Pair Library and Index 5 libraries 13100 1 A943016 1 Kit 12 indices A943018 1 A913078 1 NxSeq Long Mate Pair Index Kit 12 indices 5 13200 1 A913078 1 libraries each NxSeq Long Mate Pair Library Kit Box 1 5 libraries 13300 1 A943016 1 NxSeg Long Mate Pair Library
22. 20 kb Mate Pair Library Kit Protocol 7 Exonuclease Treatment During this step the Heat Killed Ligated Insert Coupler from step 6 4 is treated to remove any linear DNA 7 1 NxSeq Long Mate Pair Kit Box 2 Reagents Reagent Cap Identifier Nuclease 1 N1 Nuclease 2 N2 7 2 Reagents Equipment Needed Reagent Supplied By Heat Killed Ligated Insert Coupler From Step 6 4 Thermomixer or heat block set at 37 C Eppendorf Thermomixer or heat block set at 80 C Eppendorf 7 3 Protocol e Inthe tube s with the Heat Killed Ligated Insert Coupler set up the exonuclease treatment add each reagent in the following order Reagent Volume uL per Tube Heat Killed Ligated Insert Coupler 400 Nuclease 1 N1 7 Nuclease 2 N2 5 Total 412 e Mix gently by pipetting up and down 10 times with a wide bore tip e Place tube s in a thermomixer or heat block and incubate according to the following parameters Step Temperature Time 1 37 C 30 minutes 2 80 C 30 minutes e Place the tube s on ice for 2 minutes e Spin the tube s briefly to collect materials at the bottom of the tube s e Proceed directly to Step 8 Clean up of Exonuclease Treated Insert Coupler Page 28 of 67 MA162 RevA NxSeq 20 kb Mate Pair Library Kit Protocol 8 Clean Up of Exonuclease Treated Insert Coupler In this step the Exonuclease Treated Insert Coupler from
23. 300 500 or 600 cycle chemistries The mate pair libraries should not be sequenced using 50 75 and 150 cycle chemistries for any of the three Illumina Platforms These kits do not have enough cycles to read through the Chimera Code and Insert Adaptor portions of the library If multiplexing normalize and pool samples according to the appropriate Illumina Platform User s Manual Note The Illumina SAV and BaseSpace Data By Cycle charts generated for NxSeq Mate Pair libraries will look different from SAV charts generated for Nextera libraries A non random variable length spacer was added between the sequencing primer binding site and the chimera code sequences to shift downstream sequence and prevent sequencing software errors This results in vari able intensity for the first 30 cycles of Read 1 and Read 2 of a sequencing run See figures below for example charts RA Data By Cycle 000000000 AADHE All Lanes All Channels es Intensity v 1400 All Lanes v All Channels v oth Surfaces Y Intensity Page 51 of 67 MA162 RevA NxSeq 20 kb Mate Pair Library Kit Protocol Figure 81 NxSeq Long Mate Pair K12 E coli Libraries sequenced on the MiSeq using the MiSeq Reagent Kit v2 500 cycle RA wa Data By Cycle 000000000 A9B48 All Lanes All Channels Intensity v 1600 1400 Both Surfaces Y Intensity ALL Lanes v J All Channels Cycle Figure 92 Nextera Mate Pair K12 E coli Libraries sequenced
24. 6 4 4 4 4 E coli K12 Human Figure 3 PFGE analysis of un sheared genomic DNA Sheared DNA and Size Selection with the BluePippin for inserts 20 kb and above Page 21 of 67 MA162 RevA NxSeq 20 kb Mate Pair Library Kit Protocol 5B Insert Size Selection using SeaKem Gold Agarose and Elutrap During this step the Precipitated Insert with Ligated Adaptor from step 4 4 is cleaned up using SeaKem Gold Agarose and Elutrap See Appendix J for removal of contaminating small fragments 5B 1 NxSeq Long Mate Pair Kit Box 1 Reagents Reagent Cap Identifier Elution Buffer EB 5B 2 Reagents Equipment Needed Reagent Supplied By Precipitated Insert with Ligated Adaptor From step 4 4 SeaKem Gold Agarose Lonza 50X TAE agarose gel running buffer Thermo Scientific Ethidium Bromide Solution 10 mg mL BioRad Electrophoresis supplies Various 10X Loading Dye Various Elutrap Whatman 3 M NaOAc pH7 0 Ambion GlycoBlue Ambion 100 Isopropanol User 1 5 mL LoBind Microcentrifuge tubes Eppendorf 5B 3 Protocol Agarose Gel Size Selection e Prepare a SeaKem Gold agarose gel O Add SeaKem Gold Agarose to 1X TAE according to the table below Insert size SeaKem Gold 1X TAE mL Agarose g 10 kb 1 0 100 15 kb 0 5 100 20 kb 0 3 100 O Heat the TAE and agarose mixture to boiling to dissolve agarose O Cool the solution for 10 sec in a cold water bath
25. BE gt 100 ng uL 20 kb shearing More DNA might be needed depending on DNA shearing method O Optional Safe Stopping Point DNA can be stored at 20 C 28 kb G Tube Shear wm un 2 2 z 8 O ao E G B 5 a amp y E c v G kE o 73E2 225700 L 3 lt Y wn XX L au ins d t 10000 ww 10 1 vas 6000 se 4000 Figure 2 Sheared genomic DNA Genomic DNA was sheared to approximately 28 kb with a g TUBE and visualized on a 0 3 SeaKem Gold agarose gel Markers include High Mass Ladder Lambda Hindlll Lambda genomic DNA and Lambda Mono Cut Mix Page 13 of 67 MA162 RevA NxSeq 20 kb Mate Pair Library Kit Protocol 2 End Repair During this step the sheared gDNA from step 1 is end repaired Each end repair reaction is limited by the number of DNA molecules Therefore the number of reactions performed at this step is determined by the insert size Insert Size Recommended of reactions 10 kb 4 1876 ng each reaction 15 kb 8 1876 ng each reaction 20 kb 8 1876 ng each reaction 2 1 NxSeq Long Mate Pair Kit Box 1 Reagents Reagent Cap Identifier End Repair Tailing Buffer ERB End Repair Enzyme Mix ERE 2 2 User Supplied Reagents Equipment Reagent Supplied By Purified Sheared gDNA From step 1 3 Nuclease Free Water Ambion 0 2 mL thin wall PCR tubes Eppendorf Thermocycler User 2 3 Protocol Add the follo
26. Incubate eluted sample for 15 min at RT For 20kb inserts combine the two tubes into a clean 1 5mL Lo bind tube for a total of 35 uL O Optional Safe Stopping Point DNA can be stored at 20 C MA162 RevA Page 29 of 67 NxSeq 20 kb Mate Pair Library Kit Protocol o Restriction Enzyme Digest In this step the cleaned insert coupler from step 8 3 is digested with multiple restriction enzymes The choice of enzyme s will determine the library size for sequencing determined in Pre Work Restriction Enzyme Selection Note Random shearing methods such as Gtubes or Megaruptor must not be used in place of restriction enzyme digests 9 1 NxSeq Long Mate Pair Kit box 2 Reagents None 9 2 User Supplied Reagents Equipment Reagent Supplied By Cleaned Insert Coupler From step 8 3 Restriction Enzyme s NEB or Takara CutSmart Buffer NEB Thermomixer or heat block set at 37 C Eppendorf Thermomixer or heat block set at 80 C Eppendorf 9 3 Protocol e To each tube from step 8 3 set up the restriction enzyme digests adding each reagent in the following order For optimal sequencing results we recommend using different restriction enzymes or enzyme pools for Rxn 1 and Rxn 2 see Prior to starting Restriction Enzyme Selection page 8 Reagent Rxn 1 Rxn 2 Volume uL Volume uL Cleaned Insert Coupler 17 17 CutSmart Buffer 2 2 Restriction Enzyme or Restriction Enzym
27. Pair Library Kit Protocol 14 Exonuclease Treatment In this step the re circularized Insert Coupler from step 13 3 is treated to remove linear DNA 14 1 NxSeq Long Mate Pair Kit box 2 Reagents Reagent Cap Identifier Nuclease 1 N1 Nuclease 2 N2 14 2 User Supplied Reagents Equipment Reagent Supplied By Re circularized Insert Coupler From step 13 3 Thermomixer or heat block set at 37 C Eppendorf Thermomixer or heat block set at 80 C Eppendorf 14 3 Protocol e Setup the exonuclease reaction add each reagent in the following order Reagent Volume HL Re circularized Insert Coupler 200 Nuclease 1 N1 3 Nuclease 2 N2 25 Total 205 5 e Mix gently by pipetting up and down 10 times e Place the tube in a thermomixer or heat block and incubate according to the following parameters Step Temperature Time 1 37 C 30 minutes 2 80 C 30 minutes e Place the tube on ice for 2 minutes e Spin the tube briefly to collect materials at the bottom of the tube O Safe Stopping Point DNA can be stored at 20 C Page 39 of 67 MA162 RevA NxSeq 20 kb Mate Pair Library Kit Protocol 15 Clean Up of Exonuclease Treated Insert Coupler In this step the Exonuclease Treated Insert Coupler from step 14 3 is cleaned 15 1 NxSeq Long Mate Pair Kit box 2 Reagents Reagent Cap Identifier Elution Buffer EB
28. Yes Yes Yes Electrophoresis supplies Various Various Yes Yes Yes Agarosg Lucigen 50020 1 or Yes Yes Yes e Markers 1K plus and 50010 1 100 bp Prior to starting Restriction Enzyme Selection Before proceeding with library construction you must identify the restriction enzyme s needed to digest the gDNA to 400 900 bp desired final library after PCR amplification This step is critical to ensure the kit performs as designed and the sequencing coverage is uniform The restriction enzyme s needed will vary for each genome The optimal digestion method may be multiple digests with individual restriction enzymes or multiple digests with a combination of two or more restriction enzymes Each enzyme or combination of enzymes will produce a different digestion pattern and will add diversity to the genome coverage Lucigen recommends performing multiple digestion reactions using both individual restriction enzymes and combinations of enzymes provided by NEB or Takara and then visualize the digest results on an E Gel Agilent Bioanalyzer or agarose gel Page 8 of 67 MA162 RevA NxSeq 20 kb Mate Pair Library Kit Protocol Start by digesting with the individual restriction enzymes After visualizing these digests on a gel subsequent combination digests can be tested For example two or more infrequent cutting enzymes can be combined to produce the desired digestion pattern See figures 2 4 below for example gels of restriction
29. ace the tube back into the magnetic rack Page 48 of 67 MA162 RevA NxSeq 20 kb Mate Pair Library Kit Protocol Remove all remaining ethanol and let the bead pellet air dry for approximately 5 minutes while still in the magnetic rack e With the tube in a magnetic rack add the following reagent Reagent Volume HL Elution Buffer EB 22 Remove the tube from the magnetic rack Mix the beads and the buffer by pipetting up and down 10 times Do not vortex Incubate at 37 C for 5 minutes do not use a magnetic rack during the incubation Mix gently by pipetting up and down 10 times Place the tube in a magnetic rack until the supernatant becomes clear 2 minutes Remove 20 uL and place in clean 1 5 mL LoBind tube 17 4 Concentration Quantify using Qubit dsDNA HS Assay and Qubit 2 0 Fluorometer according to manufacturer s instructions e Ensure that your sample is the appropriate concentration for your sequencing system or provider 17 5 Size Confirmation Cleaned Mate Pair Library e Dilute 1 uL of library to 1 ng uL Analyze the diluted library on the Bioanalyzer High Sensitivity Chip to determine size distribution 160 N J j 140 7 j y ia Ft gt f 1004 ri Y ES 80 60 fi f f o T Ll j I f Ht 20 7 JRS i el N IR E PO ER ARA Lu a HT 204 Tr f T T T f T TT f 1 35 100 150 200 300 400 500 60
30. ally specify 4 kb 6 kb Assembly Software Options De novo sequencing provides novel information for a target with unknown sequence However sequencing without a reference poses challenges Several analysis software options listed in the table below make de novo sequencing possible The program SSPACE can be used to add mate pair data to existing assemblies contig sets Open Source Commercially available Ray DNAStar SeqMan NGen Allpaths LG CLC Genomics Workbench Velvet SOFTGENETICS NextGENe SPAdes 3 5 ABySS Can use raw sequencer reads as input Page 62 of 67 MA162 Rev A NxSeq 20 kb Mate Pair Library Kit Protocol Appendix H Sequence and Location Information Adaptor Chimera Code Sequences and Junction Code Sequence Feature Sequence 5 CCACTGTGTCCGTCAAGCGAT 3 5 CCAATGTGTCCGTCAAGCGAT 3 GGTTCATCGTCAGGCCTGACGATGAACC Read 1 left Adaptor Read 2 right Adaptor Junction Code Sequence Library Details Pre PCR Library r Chimera Code Sequences PCR Primer Insert Adaptors Junction Code PCR Primer Index 1 12 AAA AMPLIFICATION Post PCR library Index Flow Cell Sequencing Binding Primer Site Index lt Read One Read Two Sequencing Sequencing Primer Primer Page 63 of 67 MA162 RevA NxSeq 20 kb Mate Pair Library Kit Protocol Chimera Sequence Chimera Code
31. and add 15 uL of Ethidium Bromide 10 mg mL O Pour into an electrophoresis casting tray approximately 15 cm wide and 10 cm long with a comb to form 1 cm X 2 mm wells When polymerized place agarose gel into an electrophoresis chamber containing 1X TAE buffer Add O 10 kb 50 uL 10X Loading Dye to the 50 uL pooled precipitated insert with ligated adaptors from step 4 4 8 ug tube O 15 and 20 kb 100 uL 10X Loading Dye to the 100 uL pooled precipitated insert with ligated adaptors from step 4 4 16 ug tube Load 50 uL sample into 2 4 internal wells 4 ug well Load 2 0 uL each Lambda DNA Hindlll digest into two outer wells approximately 1 ug Page 22 of 67 MA162 Rev A NxSeq 20 kb Mate Pair Library Kit Protocol Run gel according to the table below Insert size Conditions 10 kb 100 Volts 60 minutes 15 kb 100 Volts 60 minutes 20 kb 70 Volts 75 minutes Note Reversing electrode polarity for 20 seconds at 1 min and 30 min into the electrophoresis can help decrease small insert contamination Excise the insert DNA band from the gel using a long wave UV hand held lamp and a single edge razor blade O Cut the agarose gel at the lower edge of the Lambda Hindlll 23 kb bands and make a second cut approximately 5 mm above the first cut O Remove the approximately 1 cm X 5 mm agarose plugs containing the insert DNA and place in a 1 5 mL tube See example in Figures 4 and 5 20 kb 15 kb 1
32. bs Lucigen Simplifying Genomics NxSeq Long Mate Pair Library Kit Generating Libraries using 10 20 kb inserts FOR RESEARCH USE ONLY NOT FOR HUMAN OR DIAGNOSTIC USE Lucigen Corporation 2905 Parmenter St Middleton WI 53562 USA Toll Free 888 575 9695 608 831 9011 FAX 608 831 9012 lucigen lucigen com www lucigen com MA162 RevA NxSeq 20 kb Mate Pair Library Kit Protocol Table of Contents Technical SURBON ia 23 Product Description me ecm deemed 3 WOTKTIOW AP e 3 PrOQUCEDESIONA ON S SAPERERERRBERENERNBEREBEREREEENEREEDEEBEREEEREEEEEPEEEBEEEEEREBEENEREREESOEFEREEEETESEEREEREFEENEETESERESEREBERSEEEFERSE 5 Components and Storage u s 3 0 0n0uu rin 5 Customer Supplied Reagents and EquipMent ccccccccccccncncncncncnnnncncnoncnnnnononononnnononnnnnnnononnnorennnnnnnnos 6 Prior to starting Restriction Enzyme Selection uunsssssnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 89 General Recommendations coccion A ed 11 Detaled PEOTOCOL sins a 11 1 Shear DNA to Appropriate SiZe ocoocooonnncccccnncconcnannnnnncnnnnnnnnnnnnnnnnnnnnnnnnnrnnnnnnnrnnnrnnnnrrnnnnnnnnnns 11 25 End Repa setei ee e a a ee ee 1445 BDA I ee ee ee ee ee a 1546 4 Ligation Of Adaptor een 1647 5A Size select the Adaptor Ligated DNA with BluePippin 2444244444Hnnnnnnnnnnnnnnnnnnnennnnnnnn 1849 5B Insert Size Selection using SeaKem Gold Agarose and Elutrap nnnnnnennnn
33. ce the tube on ice for 2 minutes e Spin the tube briefly to collect materials at the bottom of the tube e Proceed directly to Step 12 Clean Up of Insert Coupler with Junction Code MA162 RevA Page 35 of 67 NxSeq 20 kb Mate Pair Library Kit Protocol 12 Clean Up of Insert Coupler with Junction Code In this step the Insert Coupler Ligated with Junction Code from step 11 3 is cleaned 12 1 NxSeq Long Mate Pair Kit box 2 Reagents Reagent Cap Identifier Elution Buffer EB 12 2 Reagents Equipment Needed Reagent Supplied By Insert Coupler Ligated with Junction Code From step 11 3 AMPure XP Beads Beckman Coulter 1 5 mL LoBind Microcentrifuge tubes Eppendorf Magnetic rack for 1 5 2 mL tube Invitrogen 70 Ethanol Prepare fresh daily User 12 3 Protocol Equilibrate AMPure beads to room temperature for at least 30 minutes Vortex the beads to resuspend them Equilibrate Elution Buffer EB to room temperature prior to use Set up the bead clean up add each reagent in the following order Reagent Volume HL Insert Coupler Ligated with Junction Code 120 Elution Buffer EB 30 AMPure XP Beads 150 Total 300 Perform all of the following steps at room temperature Mix gently by pipetting up and down 10 times Incubate at room temperature for 5 minutes do not use a magnetic rack Place tube in magnetic rack until the supernatant b
34. ck until the supernatant becomes clear 5 minutes Remove the supernatant using a pipette and discard Page 32 of 67 MA162 RevA NxSeq 20 kb Mate Pair Library Kit Protocol e Repeat the 10 4 Wash step TWICE more for a total of three washes e With the tube in the magnetic rack add the following reagent Reagent Volume HL Elution Buffer EB 52 e Remove the tube from the magnetic rack e Mix the beads and the buffer by gently pipetting up and down 10 times Do not vortex e Place tube in thermomixer or heat block and incubate according to the following parameters Temperature Time Step 1 65 C 10 minutes e Place the tube in a magnetic rack until the supernatant becomes clear 5 minutes e Remove 50 uL and place in a clean 1 5 mL LoBind tube e Proceed directly to Step 11 Junction Code Ligation MA162 RevA Page 33 of 67 NxSeq 20 kb Mate Pair Library Kit Protocol 11 Junction Code Ligation In this step the Junction Code will be ligated to the Biotin Captured Insert Coupler from step 10 4 thawing vortex to bring Tailing Buffer back into solution prior to use 11 1 NxSeq Long Mate Pair Kit box 2 Reagents Reagent Cap Identifier Tailing Buffer Klenow Fragment KF Junction Code Reagent JC Ligase LIG 11 2 User Supplied Reagents Equipment Reagent Supplied By Biotin Captured Insert Coupl
35. ctory with sequence file and scripts then type python IlluminaChimera Clean4 py your_R1_inputfilename fastq MA162 RevA Page 61 of 67 NxSeq 20 kb Mate Pair Library Kit Protocol Note the input filenames must contain R1 and R2 During processing the script will use the R1 filename as the base filename Four output files will be created mates_ICC4_your_R1_filename fastq mates_ICC4_your_R2_filename fastq nonmates_ICC4_your_R1_filename fastq nonmates_ICC4_your R2_filename fastq 3 Split the mates files into simulated Read1 and Read2 files by running JunctionSplit7 py Type python IlluminaNxSeqJunction Split7 py mates_ICC4_your_R1_inputfilename fastq Again it is not necessary to specify the R2 filename if both names differ only at R1 vs R2 Three sequence output files will be created R1_lJS7_mates_ ICC4 your_R1_filename fastq R2_lJS7_mates ICC4 your _R2_filename fastq unsplit_JS7_mates_ICC4_your_R1R2_filename fastq 4 The R1 F and R2 R files can be loaded in an assembler program such as SPAdes or CLC Genomics Workbench as FR mate pairs 5 For programs expecting RF pairs e g DNAStar SeqMan NGen etc reverse complement both files with Seqtk or equivalent 6 Specify the expected mate pair distance based on your initial fragment size selection during library construction A reasonable range to begin with is 20 of initial fragment size e g for a 5 kb library initi
36. d Samples Options for Index Primers Index Primers to Use 2 1 Index 6 and Index 12 Index 5 Index 6 and Index l 12 2 plex option with any other index Index 4 Index 5 Index 6 and Index 12 3 plex option with any other index If pooling 5 12 samples use the 4 plex options with any other available indices Libraries should be pooled in equimolar amounts If multiplexing normalize and pool samples according to the appropriate Illumina Platform User s Manual It is important to use compatible indices when pooling to maintain color balance of each base of the index read during sequencing For proper imaging on the Illumina platform at least one base needs to be read in the green laser channel G or T and the red laser channel A or C Using incompatible indices could result in image registration failure and ultimately run failure When setting up a sample sheet in Illumina Experiment Manager select TruSeq LT from the drop down menu Use A001 A012 when entering sample information since these sequences correspond with the NxSeq Long Mate Pair Index sequences Page 59 of 67 MA162 RevA NxSeq 20 kb Mate Pair Library Kit Protocol Appendix F Double Bead Clean Up Protocol Bead Size Selection E Wash 7 lane er Bauch lt Eie ps Discard Discard Liquid Ethanol Lio x Figure 1 Double Size Selection When a library contains fragments that are both too small and too large to s
37. d on the graph in Figure 1B in Appendix C This amount of beads will bind fragments of 900 bp and larger for removal When you add 0 155X beads and buffer to the saved supernatant the buffer concentration will be increased to 0 67X beads and buffer 0 67X 0 515X 0 155X beads and will bind DNA fragments between 400 and 900 bp DNA fragments smaller than 400 bp will be removed when the beads are washed X original sample volume Page 60 of 67 MA162 RevA NxSeq 20 kb Mate Pair Library Kit Protocol Appendix G Sequence Analysis Filtering Scripts Assembly Software Options Location of Scripts The scripts can be found at http www lucigen com NGS Long Read Mate Pair Scripts Sample html Overview Sequence reads from Illumina instruments are output as two reads for each cluster corresponding to the left and right ends respectively of the amplified molecule Each read should begin with a Chimera Code and linker sequence The Junction Code marks the location of the central portion of the original insert and may occur in R1 only in R2 only or for small inserts in both R1 and R2 The workflow first filters the two raw sequence files R1 fastq and R2 fastq into four files e R1 and R2 of mates containing only true mates matching Chimera Codes found at the beginning of both R1 and R2 and e R1 and R2 of nonmates containing everything else which will include chimeras mismatched Chimera Code sequence
38. digest Lambda DNA Mono Cut NEB N3019S No Yes Yes Mix 3 M NaOAc pH7 0 Ambion AM9740 No Yes Yes 100 Isopropanol Various Various No Yes Yes GlycoBlue Ambion AM9516 No Yes Yes 10 SDS Solution Ambion AM9822 No Yes Yes Proteinase K NEB P8107S No Yes Yes Ethidium Bromide Solution Bio Rad 161 0433 No Yes Yes at 10 mg mL 10X Loading Dye Various Various No Yes Yes Page 6 of 67 MA162 RevA NxSeq 20 kb Mate Pair Library Kit Protocol Reagent Recommended Catalog Used for Blue SeaKem Vendor 2 8 kb Pippin Elutrap Protocol Step 5A Step 5B 0 75 Agarose cassettes Sage Science BLF7510 No Yes No Dye Free Low Range S1 marker Sage Science No Yes No Loading solution Sage Science No Yes No 0 1 Tween 20 Sage Science No Yes No Life AM9740 No Yes No 3 M Sodium Acetate Technologies HpyCH4V Restriction NEB R0620S Yes Yes Yes Enzyme Rsal Restriction Enzyme R0167S Yes Yes Yes 10 U uL Alul Restriction Enzyme R0137S Yes Yes Yes 10 U uL Haelll Restriction Enzyme R0108S Yes Yes Yes 10 U uL CutSmart Buffer B7204S Yes Yes Yes comes with Restriction Enzymes Accll Restriction Enzyme Takara 1002A Yes Yes Yes 10 U uL Dynabeads MyOne Life 65001 Yes Yes Yes Streptavidin C1 Technologies Agencourt AMPure XP Beckman A63881 or Yes Yes Yes Magnetic Beads Coulter A63882 100 Ethanol Various Various Yes Yes Yes Nuclease Free Water not
39. e Buffer 10X Ligase LIG 6 2 User Supplied Reagents Equipment Reagent Supplied By Size selected DNA with Adaptor From step 5A 6 or 5B 6 Nuclease Free Water Ambion Refrigerator set at 4 5 C Various Thermomixer or heat block set at 70 C Eppendorf Pipet designed for volumes under 2uL Various 6 3 Determine Amount of Insert Required Use the following equation to determine the amount of size selected DNA with adaptor material is required for step 6 4 Protocol NOTE The optimal condition for this step is to use equal amounts of insert and coupler in the ligation reaction The size of the coupler included in the kit is 2000 bp and the amount of coupler specified for each reaction is 100 ng insert size bp 2000 bp 5000 bp Example 2000 bp x 100 ng ng insert Y x100ng 250ng 6 3 1 Calculate and record the amount of insert required e Use the following equation to determine the required volume of size selected DNA with adaptor required X based on the concentration determined in step 5A 5 or 5B 5 Z and the amount of insert Y in ng as calculated above Y Amount in ng Z Concentration in TA ng X volume in uL 6 3 2 Calculate and record the volume of insert required X volume in uL MA162 RevA NxSeq 20 kb Mate Pair Library Kit Protocol 6 4 Protocol amp IMPORTANT NOTE For 10 and 15 kb insert ligations the insert will be ligated in a single
40. e following to the tube s containing the insert DNA Reagent Volume Example 1 Example 2 Volume HL Volume HL Gel Excised Insert DNA step 5B 3 X 400 500 3 M NaOAc pH 7 0 0 1X 0 1 X 44 55 GlycoBlue 1 uL 1 1 100 Isopropanol 1 5X 1 5X 660 825 Mix by inverting the tube 10 times Incubate at 20 C for a minimum of 10 minutes up to overnight 14 16 hours Centrifuge at 4 C for 30 minutes at 15 000 RPM Remove supernatant being careful not to disturb the blue pellet Immediately add 600 uL of 70 Ethanol Centrifuge at 4 C for 5 minutes at 15 000 RPM Remove supernatant with a pipette while being careful not to disturb the pellet Air dry for 10 minutes Carefully re suspend the pellet s using the following amounts of Elution Buffer EB O Single Tube 50 uL O Two Tubes 25 uL in each tube Incubate eluted sample for 15 min at room temperature If sample is split into two tubes and resuspended in 25 uL of Elution Buffer EB pool tubes into clean 1 5mL tube Page 24 of 67 MA162 RevA NxSeq 20 kb Mate Pair Library Kit Protocol e Combine 15 and 20 kb insert Elutrap samples 2 Elutraps each 5B 5 Concentration Quantify using Qubit according to manufacturer s instructions e Record the concentration in ng uL e Confirm the minimum amount and concentration of DNA required to proceed using the table below Insert Size Minimum Amount DNA Minimum Conce
41. e pool 1 1 Total 20 20 1 Use of CutSmart Buffer NEB is highly recommended Buffers from other vendors have not been tested and may not be compatible with the restriction enzyme s used to digest the gDNA If using a pool of restriction enzymes mix 10 Units of each enzyme in a 1 5 mL LoBind tube and use 1 uL for the digest e Mix gently by pipetting up and down 10 times e Place tubes in a thermomixer or heat block and incubate according to the instructions below Step Temperature Time 1 37 C 30 minutes 2 80 C 15 minutes Place the tube on ice for at least 2 minutes Spin the tube briefly to collect materials at the bottom of the tube Combine restriction digested material into one 1 5 mL LoBind tube Keep tube on ice until next step to prevent digestion by inactivated restriction enzyme Proceed directly to Step 10 Biotin Capture Page 30 of 67 MA162 RevA NxSeq 20 kb Mate Pair Library Kit Protocol 10 Biotin Capture In this step the target sequence insert coupler from step 9 3 will be captured and purified to remove competing fragments 10 1 NxSeq Long Mate Pair Kit box 2 Reagents Reagent Cap Identifier Biotin Wash Buffer BWB Biotin Capture Buffer BCB Biotin Capture Reagent BCR Elution Buffer EB 10 2 User Supplied Reagents Equipment Reagent Supplied By Streptavidin beads MyOne C1 Invitrogen Nuclease Free Water Ambion
42. eagents Reagent Cap Identifier Elution Buffer EB Accura HotStart 2X Master Mix AMM Primer Mix Index 12 12 NxSeq Long Mate Pair Library Index Kit 1 12 16 2 Reagents Equipment Needed Reagent Supplied By Cleaned Treated Insert Coupler From step 15 3 Nuclease Free Water Ambion AMPure XP Beads Beckman Coulter 1 5 mL LoBind Microcentrifuge tubes Eppendorf Magnetic rack for 1 5 2 mL tube Invitrogen 70 Ethanol Prepare fresh daily User Thermocycler User 16 3 Identify Optimal Number of Cycles Test Amplification a IMPORTANT NOTE For multiplexing set up one reaction per Index Use a different Index for each library See Appendix E for selection of compatible Index Primers e Setup PCR reaction volume specified in uL Reagent Volume HL Accura HotStart 2X Master Mix AMM 10 Primer Mix Index 12 Cap Identifier 12 2 Nuclease free water 6 Mate Pair Library DNA Step 17 3 2 Total 20 lf multiplexing use an appropriate Primer Mix Index for each library See Appendix E Page 42 of 67 MA162 RevA NxSeq 20 kb Mate Pair Library Kit Protocol 16 3 PCR Reaction Place the tube in a thermocycler and cycle according to the following parameters Step Temperature Time 1 94 C 2 minutes 2 94 C 15 seconds 3 60 C 15 seconds 4 72 C 60 seconds 5 Repeat steps 2 4 for 19 more cycles 6 72 C 5 minute
43. eagents Reagent Cap Identifier 10X Ligase Buffer 10X Ligase LIG T4 Polynucleotide Kinase PNK 13 2 User Supplied Reagents Equipment Reagent Supplied By Cleaned Ligated Insert Coupler From step 12 3 Nuclease Free Water Ambion Thermomixer or heat block set at 25 C Eppendorf Thermomixer or heat block set at 70 C Eppendorf 13 3 Protocol Set up the ligation reaction add each reagent in the following order Reagent Volume HL Cleaned Ligated Insert Coupler 50 Nuclease Free Water 126 10X Ligase Buffer 10X 20 T4 Polynucleotide Kinase PNK 2 Total 198 Mix gently by pipetting up and down 10 times Place the tube in a thermomixer or heat block and incubate according to the following parameters Step Temperature Time 1 25 C 10 minutes Add the following to the reaction Reagent Volume HL Kinased Reaction 198 Ligase LIG 2 Total 200 Mix gently by pipetting up and down 10 times Place the tube in a thermomixer or heat block and incubate according to the following parameters Step Temperature Time 1 25 C 45 minutes 2 70 C 15 minutes Place the tube on ice for 2 minutes Spin the tube briefly to collect materials at the bottom of the tube Proceed directly to step 14 Exonuclease Treatment MA162 Rev A Page 38 of 67 NxSeq 20 kb Mate
44. ecomes clear 5 minutes With tube in the magnetic rack remove the supernatant with a pipette and discard 12 3 Wash Wash the beads by adding 750 uL of 70 ethanol to the tube and pipetting the ethanol up and down 4 times without disturbing the beads Remove the ethanol by pipetting and discard Repeat the 12 3 Wash step twice Spin briefly to collect material in the bottom of the tube and place the tube back into the magnetic rack Remove all remaining ethanol and let the bead pellet air dry for approximately 5 minutes while still in the magnetic rack Page 36 of 67 MA162 RevA NxSeq 20 kb Mate Pair Library Kit Protocol e With the tube in the magnetic rack add the following reagent Reagent Volume HL Elution Buffer EB 52 e Remove the tube from the magnetic rack e 12 3 Mix Mix the beads and the buffer gently by pipetting up and down 10 times Do not vortex e 12 3 Incubate Incubate at 37 C for 5 minutes do not use a magnetic rack during the incubation e Repeat the 12 3 Mix step e Place the tube in a magnetic rack until the supernatant becomes clear 2minutes e Remove 50 uL and place in a clean 1 5 mL LoBind tube O Optional Safe Stopping Point DNA can be stored at 20 C Page 37 of 67 MA162 RevA NxSeq 20 kb Mate Pair Library Kit Protocol 13 DNA Re circularization In this step the Cleaned Ligated Insert Couplers are re circularized 13 1 NxSeq Long Mate Pair Kit box 2 R
45. equence these fragments can be removed with beads resulting in a library with an optimal size range for sequencing Briefly 1 Add beads to sample and mix 2 Place tube on magnetic rack 3 Transfer liquid to new tube and discard tube with beads 4 Add second volume of beads and mix 5 Place on magnetic rack 6 Discard liquid and Wash 2x with 70 ethanol 7 Dry beads 8 Add Elution Buffer and remove from magnetic rack to allow for resuspension of DNA 9 Place tube on magnetic rack 10 Transfer liquid to new tube and discard beads Discard Discard Beads Beads Bead size selection is based on the concentration of Polyethylene glycol PEG and sodium chloride NaCl in the bead buffer solution A higher concentration will bind both small and large fragments while a lower concentration will only allow binding of larger fragments When a small amount of beads and buffer is added to your sample large DNA fragments will bind to the beads and when these beads are discarded the large contaminating DNA fragments will be discarded with the beads By adding a second aliquot of beads and buffer to your sample the concentration of PEG and NaCl will increase and allow binding of the desired range of DNA fragments Smaller contaminating DNA fragments will not bind and will be removed when the beads are washed If your optimal library size range for sequencing is between 400 and 900 bp for example you would add 0 515X beads and buffer to your sample base
46. er From step 10 4 Thermomixer or heat block set at 25 C Eppendorf Thermomixer or heat block set at 37 C Eppendorf Thermomixer or heat block set at 70 C Eppendorf 11 3 Protocol Note Before you begin bring the Tailing Buffer to room temperature A precipitate will form upon e To the tube containing the biotin captured insert coupler from step 10 4 set up the ligation reaction add each reagent in the following order Reagent Volume HL Biotin Captured Insert Coupler from step 10 4 50 Tailing Buffer TB 50 Klenow Fragment KF 6 Total 106 e Mix gently by pipetting up and down 10 times e Place the tube in a thermomixer or heat block and incubate according to the following parameters Step Temperature Time 1 37 C 30 minutes 2 70 C 15 minutes e Place the tube on ice for 2 minutes e Spin the tube briefly to collect materials at the bottom of the tube e Add the following reagents Reagent Volume uL Biotin Captured DNA from step 11 3 106 Junction Code Reagent JC 6 Ligase LIG 8 Total 120 MA162 Rev A Page 34 of 67 NxSeq 20 kb Mate Pair Library Kit Protocol e Mix gently by pipetting up and down 10 times e Place the tube in a thermomixer or heat block and incubate according to the following parameters Step Temperature Time 1 25 C 30 minutes 2 70 C 15 minutes e Pla
47. identify the number of cycles that exceeds this minimum threshold while avoiding over amplification Determine the amount of Final Library needed for your application Pre Size Selection and select the number of PCR cycles required for the 8 reaction Bulk PCR If necessary perform a second Test amplification to confirm your cycle number selection Green indicates an optimal amount of DNA for size selection and sequencing Yellow indicates slightly lower or slightly higher amounts of DNA estimates within these values may be used Red indicates either an insufficient amount of DNA for sequencing or potential overamplification of library estimates within these values should not be used If test PCR yields more than 63 76 ng fewer than 17 cycles may be used in the 8 reaction bulk PCR Page 44 of 67 MA162 RevA NxSeq 20 kb Mate Pair Library Kit Protocol Test PCR Estimated Final Library Pre Size Selection 20 Cycles 15 Cycles 16 Cycles 17 Cycles 18 Cycles 19 Cycles 20 Cycles 21 Cycles 22 Cycles 23 Cycles 1 04 ng 1 88 ng 3 36 ng 6 08 ng 10 94 ng 19 68 ng 35 40 ng 63 76 ng 114 78 ng gt 206 60 ng a Minimum quantified PCR product in ng uL x 20 uL Test PCR at 20 cycles quantified PCR product in ng uL x 20 uL x 8 reactions Estimated Final Library Notes o The table above was generated using E coli 50 GC content The efficiency of the PCR reactions and therefore the ap
48. it Protocol e 16 7 Wash Wash the beads by adding 750 uL of 70 ethanol to the tube pipet the ethanol up and down 4 times without disturbing the beads Remove the ethanol by pipetting and discard e Repeat the 16 7 Wash step e Spin briefly to collect material in the bottom of the tube and place the tube back into the magnetic rack e Remove any remaining ethanol and let the bead pellet air dry for approximately 5 minutes while still in the magnetic rack e With the tube in a magnetic rack add the following reagent Reagent Volume HL Elution Buffer EB 202 Remove the tube from the magnetic rack Mix the beads and the buffer by pipetting up and down 10 times Do not vortex Incubate at 37 C for 5 minutes do not use a magnetic rack during the incubation Mix 10X with pipette Place the tube in a magnetic rack until the supernatant becomes clear 2 minutes Remove 200 uL and place in a clean 1 5 mL LoBind tube O Optional Safe Stopping Point DNA can be stored at 20 C Page 47 of 67 MA162 RevA NxSeq 20 kb Mate Pair Library Kit Protocol 17 Size Selection of Amplified Mate Pair Library In this step the purified amplified Mate Pair Library from step 16 is size selected O IMPORTANT NOTE For multiplexed libraries libraries that will be sequenced in one sequencing run will need to be pooled after size selection and final quantification See Appendix E Additional Instructions for Sample Pooling Pri
49. nnnnnnnnnnnnnnnnnnn nenn 2223 6 Ligation of Insert to Coupler anne a mennecatavet 2627 7 Exonuclease Trealment cuneneeene san A 2829 8 Clean Up of Exonuclease Treated Insert Coupler unnnnnnnnnnnnnnnnnnnnnnnnnnn nenn 2930 9 Restriction Enzyme Digest sen ea une 303 o een eier 3132 11 Junction Code LIGAN rencia 3435 12 Clean Up of Insert Coupler with Junction Code 44444444440nnnnnnnnnnnnnnnnnnnnnnnnnn nennen 3637 13 DNA Re CICUl ZA an 3839 14 Exonuclease Treatment nn nn nn nenn ann nn nn nen anna naeh han 3940 15 Clean Up of Exonuclease Treated Insert Coupler mm4z2404444444annnn nenne nennen 4044 16 Amplification Using Accura HotStart 2X Master Mix 222444444snennnnnnnennnnnnnnnnnnnnnnn nennen 4243 17 Size Selection of Amplified Mate Pair Library 4444444444B Rnnn Hanno nnnnnnnnnnnnnnnnnn nennen 4849 18 lamina Segueneing nesensee ee u a a REEE EER ENA 5152 19 Analysis of Sequencing Data from Illumina Instruments 4444444444nnnnnnnnnn nennen 5354 Appendix A Example Experimental Set up for Restriction Enzyme Testing 0eeee 5455 Appendix B The Effect of the Size Range of Sheared DNA on Insert Size uuunnnnnsnnnnnnnennnnnn 5556 Appendix C Determining Bead Concentration ursssssnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnennnn 5758 Appendix D Additional Information on Amplificati
50. ntration DNA Required Required 10kb 500 ng 10 0 ng uL 15 kb 750 ng 15 0 ng uL 20 kb 1000 ng 20 0 ng uL 5B 6 Size Confirm the correct size selection e Visualize on 0 3 SeaKem Gold agarose gel Run with Lambda DNA Hindlll digest 30 ng and Lambda DNA Mono Cut Mix 200 ng The 10 15 17 and 23 kb bands should be visible See Figures 6 and 7 Proceed directly to step 6 Ligation of Insert to Coupler High 5 A Hind3 A DNA A Mono Insert 1000 A Hind3 Genomic High 5 ltt Figure 6 Gel Isolated Insert DNA 20 kb insert DNA was gel isolated on a 0 3 SeaKem Gold agarose gel and eluted with an Elutrap electro eluter Purified insert DNA was visualized on a 0 3 SeaKem Gold agarose gel Markers include High Mass Ladder Lambda Hindlll Lambda genomic DNA and Lambda Mono Cut Mix System ss 07 82 63 5 be mt 48 5 gt 33 5 23 1 15 9 42 Figure 7 Optional Method for Visualization FIGE analysis of purified insert DNA Insert DNA arrow was separated on a 0 6 agarose gel by Field Inversion Gel Electrophoresis using a BioRad CHEF DR Ill MA162 RevA Page 25 of 67 NxSeq 20 kb Mate Pair Library Kit Protocol 6 Ligation of Insert to Coupler During this step the size selected DNA with adaptor from step 5A 6 or 5B 6 is ligated to the coupler 6 1 NxSeq Long Mate Pair Kit Box 2 Reagents Reagent Cap Identifier Coupler Mix CM 10X Ligas
51. ocol 5 2 majority of smear is above 4 kb no free adaptors remain Figure 2 Confirmed size selection of 5 kb insert size in step 7 5 Lane 2 sheared genomic DNA from Step 1 Lane 3 End repaired A tailed adaptor ligated insert Lane 4 Bead cleaned insert from Step 6 Lane 5 Size selected insert ready for ligation to coupler Check that no free adaptors remain in the sample seen as a band below 250 bp and that most of the smear below the desired insert size has been eliminated Page 56 of 67 MA162 RevA NxSeq 20 kb Mate Pair Library Kit Protocol Appendix C Determining Bead Concentration The appropriate bead concentration is based on the lower end of the desired insert size range For example if your sheared material ranges in size from 2 4 kb the amount of beads used in Step 7 Size Selection on page 17 should be 0 44X or 176 uL Bead Size Selection RT A Library 5 y B 4500 o o 2 e 550 x x x 8 3 4000 500 N N gy E E 3500 3 3 g 55 300 Sheared DNA 2 u 10000 O 6000 2000 3 g 2000 ua 1500 os 06 07 08 09 1000 lt i000 Z Fragments 0 40 X o 500 Removed 0 42 X 0 44 X 0 0 3 0 4 0 5 0 6 0 7 0 8 0 9 Bead Volume X Sample Volume Figure 1 Effect of bead concentration on DNA size selection A Gel image of three different insert sizes The lower end of the size distribution is highlighted with the red arrows and the recommended volume
52. of beads to be used is provided B Comparison of bead concentrations to the sample cut off When selecting the optimal bead volume for insert size selection locate your insert size on the left axis and draw a horizontal line to the graphed line and then draw a vertical line down to the bottom axis Determine the bead volume and multiply this value by your sample volume This value will be the amount of beads to add to your sample for size selection Do not use less than 0 4X beads as this will result in the loss of your sample The inserted graph in the upper right corner of graph B is an enlarged view of the smaller DNA fragments 300 to 500 bp Beads must be brought to room temperature RT prior to use Mpa re sag zi Save js i mH E fees zl Y Discard Discard Liquid Ethanol gt PRS Beads Figure 2 Buffer Exchange 1 Sample DNA 2 Add beads to sample and mix incubate 5 min 3 Place tube on magnetic rack 4 Discard liquid and Wash 2x with 70 ethanol 5 Dry beads for 5 min 6 Add Elution Buffer remove from magnetic rack to allow resuspension of DNA 7 Place tube on magnetic rack after incubation 8 Transfer liquid to new tube and discard beads Page 57 of 67 MA162 RevA NxSeq 20 kb Mate Pair Library Kit Protocol Appendix D Additional Information on Amplification Artifacts Amplification Artifacts Amplification artifacts are primarily due to limiting resources in the PCR master mix after several cycles
53. of the tubes e Pool ligation reactions o For 10kb libraries pool reactions 1 4 into clean 1 5 mL LoBind tubes o For 15 and 20kb libraries pool reaction 1 4 and 5 8 into two clean 1 5 mL LoBind tubes MA162 RevA NxSeq 20 kb Mate Pair Library Kit Protocol Calculate the total volume of pooled ligation reactions and record the value Reagent Volume uL Volume uL Volume uL for each reaction reactions 1 4 reactions 5 8 Ligated Material 124 496 496 10 SDS Solution 8 32 32 Proteinase K 8 32 32 Total 140 560 560 Mix by inverting tube 10 times Spin briefly to collect material in the bottom of the tube Place tube in the thermomixer or heat block and incubate according to the following parameters Step Temperature Time 1 37 C 30 minutes 4 4 Protocol Precipitate Ligated Material In the tube containing the material treated with Proteinase K set up the precipitation reactions add each reagent in the following order Reagent Volume uL Volume uL reactions 1 8 reactions 9 16 Proteinase K treated DNA 560 560 3 M NaOAc 56 56 GlycoBlue 1 1 100 Isopropanol 900 900 Mix by inverting tube 10 times Incubate at room remperature for 10 minutes Centrifuge at room temperature 25 C for 30 minutes at 15000 RPM Note SDS will precipitate at lower temperatures Remove supernatant being careful not to disturb
54. ollowing order Reagent Volume HL Megaruptor sheared DNA 400 3 M NaOAc 0 1x 44 GlycoBlue 1 100 Isopropanol 1 5x 660 e _ Mix by inverting tube 10 times Incubate at 20 C for 10 minutes e Centrifuge at 4 C for 30 minutes at 15000 RPM e Remove supernatant being careful not to disturb the blue pellet Immediately add 600 uL of 70 Ethanol e Centrifuge at 4 C for 5 minutes at 15000 RPM e Remove supernatant with a pipette while being careful not to disturb the pellet Centrifuge briefly and remove excess supernatant without disturbing pellet e Air dry for 5 minutes Re suspend the pellet in 100 uL EB 1 2 Size confirmation of sheared gDNA e Confirm the correct size of the sheared gDNA o Visualize on a 0 3 SeaKem Gold agarose gel in 1X TAE buffer 70 V 75 minutes Use the A Hindlll and A Monocut ladders See Figure 2 for example gel image Page 12 of 67 MA162 Rev A NxSeq 20 kb Mate Pair Library Kit Protocol 1 3 Quantification of Sheared gDNA e Quantify the sample from step 1 3 Purified Sheared gDNA using Qubit dsDNA HS Assay Kit with the Qubit 2 0 Fluorometer according to manufacturer s instructions Minimum amount and concentration of DNA required to proceed DNA should be in either Low TE 0 1 mM EDTA 10 mM Tris pH 8 or 10 mM Tris pH 8 5 Insert Size Minimum Amount DNA Required Minimum Concentration DNA Required 10 kb 15 kb 15 ug for u g TU
55. olume HL Elution Buffer EB 22 Remove the tube from the magnetic rack Page 40 of 67 MA162 RevA NxSeq 20 kb Mate Pair Library Kit Protocol e 15 3 Mix Mix the beads and the buffer gently by pipetting up and down 10 times Do not vortex e 15 3 Incubate Incubate at 37 C for 5 minutes do not use a magnetic rack during the incubation e Repeat the 15 3 Mix step e Place the tube in a magnetic rack until the supernatant becomes clear 2 minutes e Remove 20 uL and place in a clean 1 5 mL LoBind tube O Optional Safe Stopping Point DNA can be stored at 20 C Page 41 of 67 MA162 RevA NxSeq 20 kb Mate Pair Library Kit Protocol 16 Amplification Using Accura HotStart 2X Master Mix In this step the exonuclease treated insert coupler from step 15 3 is amplified Prior to full amplification of the library we recommend that you perform a test reaction to determine the optimal number of cycles to reduce the potential for over amplification If you see inconsistent performance e g amplification artifacts or over amplification using 2 uL oftemplate and 20 cycles additional test reactions may be necessary See Appendix D Additional Information on Amplification Artifacts for more information After determining the optimal number of cycles for amplification using instructions below generate a fully amplified library for subsequent size selection and sequencing 16 1 NxSeq Long Mate Pair Kit box 2 R
56. on Artifacts unssnnussennnnnnnnnnnnnnnnnnnnnnnnnnnnnn 5859 Appendix E Additional Instructions for Sample Pooling Prior to Sequencing rrr 5960 Appendix F Double Bead Clean Up Protocol uuueessnnnssnnnnnnnnnnnnnnnnunnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 6064 Appendix G Sequence Analysis Filtering Scripts Assembly Software Options 6162 Appendix H Sequence and Location Information uessunesennnnnnennnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 6364 Appendix I Size Distribution of 20kb Inserts unnssnnnsennnnnnnnnnnnnnnnunnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 6465 Appendix J Removal of Contaminating Small Fragment uussuunnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 6768 Technical Support Lucigen is dedicated to the success and satisfaction of our customers Our products are tested to assure they perform as specified when used according to our recommendations It is imperative that the reagents supplied by the user especially the specimens to be amplified are of the highest quality Please follow the instructions carefully and contact our technical service representatives if additional information is necessary We Page 2 0f 67 MA162 Rev A NxSeq 20 kb Mate Pair Library Kit Protocol encourage you to contact us with your comments regarding the performance of our products in your applications Thank you Lucigen Technical Support Email techserv lucigen com Phone 888
57. on the MiSeq using the MiSeq Reagent Kit v2 500 cycle Page 52 of 67 MA162 RevA NxSeq 20 kb Mate Pair Library Kit Protocol 19 Analysis of Sequencing Data from Illumina Instruments The raw sequencing reads from Illumina instruments contain a variety of Chimera codes adaptor codes and Junction Code combinations It is necessary to filter and trim the raw reads prior to assembly according to the following workflow using scripts written in Python The scripts can be found at http www lucigen com NGS Long Read Mate Pair Scripts Sample html After this filtering the data can be assembled using open source or commercially available software Alternatively the open source assembler SPAdes 3 5 is capable of using raw sequencing reads during assembly performing all filtering trimming and mate pair splitting internally See Appendix G Sequence Analysis for details on the filtering process scripts and assembly software options See Appendix H Sequence and Location Information for information on the sequences and location of Adaptor Chimera Code Sequences and Junction Code Sequences Illumina IlluminaNxSeq gt 90 typically eae ee R2 true mates mates Read2 gt 90 unsplit R1R2 R1 nonmates amp chimeras use as single end reads lt 10 typically R2 nonmates amp chimeras Figure 1 Workflow to filter and trim the raw reads prior to assembly Page 53 of 67 MA162 RevA NxSeq 20
58. or to Sequencing for instructions on sample pooling 17 1 NxSeq Long Mate Pair Kit box 2 Reagents Reagent Cap Identifier Elution Buffer EB 17 2 Reagents Equipment Needed Reagent Supplied By Mate Pair Library From step 16 AMPure XP Beads Beckman Coulter 1 5 mL LoBind Microcentrifuge tubes Eppendorf Magnetic rack for 1 5 2 mL tube Invitrogen 70 Ethanol Prepare fresh daily User 17 3 Protocol Equilibrate AMPure beads to room temperature for at least 30 minutes Vortex the beads to resuspend them Equilibrate Elution Buffer EB to room temperature prior to use Set up the bead size selection reaction add the beads to the Mate Pair Library Reagent Volume uL 2 300 bp cutoff Mate Pair Library 200 AMPure XP Beads 130 Perform all of the following steps at room temperature Mix gently by pipetting up and down 10 times Incubate at room temperature for 5 minutes do not use a magnetic rack during incubation Place the tube in a magnetic rack until the supernatant becomes clear 5 minutes With tube in the magnetic rack remove the supernatant with a pipette and discard 17 3 Wash Wash the beads by adding 750 uL of 70 ethanol to the tube pipet the ethanol up and down 4 times without disturbing the beads Remove the ethanol by pipetting and discard Repeat the 17 3 Wash step Spin briefly to collect material in the bottom of the tube and pl
59. plicability of the table above will depend on the GC content of the genome o Fewer cycles will reduce the potential for over amplification o Amplifying more template will increase the complexity of your library Amplifying the entire library will provide the greatest complexity A IMPORTANT NOTE Amplification of genomes with very high gt 60 or low lt 40 GC content may result in low yield If the Test PCR reaction step 18 3 shows minimal or no amplification it is recommended to substitute a polymerase that has been optimized for PCR of extreme genomes However these polymerases may result in lower fidelity and could affect sequence accuracy Examples of alternative polymerases for amplifying high low GC content genomes include e KAPA Biosciences Library Amplification Kit catalog KK2611 e Phusion Hot Start Flex 2X Master Mix catalog M0536S e Takara Ex Taq DNA polymerase HotStart version catalog RROO6A Page 45 of 67 MA162 RevA NxSeq 20 kb Mate Pair Library Kit Protocol 16 6 Library Amplification for Size Selection and Sequencing e Generate Master Mix for 8 reactions per library according to the table below O IMPORTANT NOTE For multiplexed libraries each library will be amplified using a Master Mix containing a unique Primer Mix Index After amplification and bead clean up step 17 the libraries will need to be quantified individually and pooled prior to sequencing See Appendix E Additional Instruc
60. red distance distribution 90000 80000 70000 60000 50000 Count 40000 30000 20000 10000 Distance bp Figure 39 15 kb Mate Pair E coli Elutrap MA162 RevA Page 65 of 67 NxSeq 20 kb Mate Pair Library Kit Protocol Paired distance distribution 90000 80000 70000 60000 50000 Count 40000 30000 20000 10000 gt o O ig a A 2 ae Xp ea a a OP GG o og o Coo ro Co He 9 Fe 9 9 9 Bo QD U a u a U a Y Y a AA Distance bp Figure 440 10 kb Mate Pair E coli Elutrap Paired distance distribution 28000 26000 24000 22000 20000 18000 16000 14000 12000 10000 8000 6000 4000 2000 Count o 9 9 A Y 9 s X 2 2 2 E R o 0 SS O gt o O lt 5 Sy o Q o o 0 o Q o e kr A 2 2 2 o Y Z s O Se O Se 2 Se O S Se 20 9 2 2 29 x o Y Y Y Y Vo Vo Distance bp Figure 544 20 kb Mate Pair Thermus aquaticus Elutrap MA162 Rev A Page 66 of 67 NxSeq 20 kb Mate Pair Library Kit Protocol Appendix J Removal of Contaminating Small Fragments Removal of small fragments from mate pair insert preparations After plugging DNA fragments of the desired size from an agarose gel small contaminating fragments can be removed by briefly electrophoresing the plugs A container for holding the plugs during electrophoresis can be made by cutting 2 small slits at the bottom
61. s 7 4 C Hold Equilibrate AMPure beads to room temperature for at least 30 minutes Vortex the beads to resuspend them Equilibrate Elution Buffer EB to room temperature prior to use Purify the amplified reaction Transfer the contents of the tube s from step 16 3 PCR Reaction 20 uL each to a 1 5 mL LoBind tube and add the following reagents Reagent Volume HL 16 3 PCR Reaction from step 16 3 20 Elution Buffer EB 30 AMPure XP Beads 90 Total 140 Perform all of the following steps at room temperature Mix gently by pipetting up and down 10 times Incubate at room temperature for 5 minutes do not use a magnetic rack during incubation Place the tubes in a magnetic rack until the supernatant becomes clear 5 minutes With tube in the magnetic rack remove the supernatant with a pipette and discard 16 3 Wash Wash the beads by adding 750 uL of 70 ethanol to the tube pipet the ethanol up and down 4 times without disturbing the beads Remove the ethanol by pipetting and discard Repeat the 16 3 Wash step Spin briefly to collect material in the bottom of the tube and place the tube back into the magnetic rack Remove all remaining ethanol and let the bead pellet air dry for approximately 5 minutes while still in the magnetic rack With the tubes in a magnetic rack add the following reagent Reagent Volume uL Elution Buffer EB 22 Remove the tube from
62. s and non mate reads lacking a recognizable Chimera Code The mates files must be split into simulated Read1 and Read2 files for use by assembly programs by detecting the Junction Code and trimming appropriately If the Junction Code is not found in either R1 or R2 both reads are saved in the unsplit_R1R2 file and may be used as single unpaired reads for assembly Notes The NxMate workflow results in mate pair reads that are in Forward Reverse orientation FR IlluminaChimera Clean4 script also trims the 5 end of every true mate read to remove the Chimera Code and linker sequences Reads saved into the nonmates file are not trimmed or otherwise processed Contamination scanning and deduplication should be performed after splitting the reads to avoid influence of Chimera Code and Junction Code sequences Software requirements tested on Ubuntu 12 04 Software Available From Python 2 6 or 2 7 https www python org downloads ParseFastQ py https gist github com xguse 1866279 Regex module https pypi python org pypi regex BioPython http biopython org wiki Download IlluminaChimera Clean4 py Lucigen IlluminaNxSeqJunction Split7 py Lucigen Perform Sequence Analysis 1 Copy IlluminaChimera Clean4 py llluminaNxSegJunction Split7 py and ParseFastQ py into directory with the uncompressed R1 and R2 fastq sequence files 2 Open terminal or command prompt and cd into the dire
63. s with a wide bore tip Place the tube in a thermocycler and incubate according to the following parameters Step Temperature Time 1 37 C 20 minutes 2 70 C 15 minutes 3 4 C Hold e Proceed directly to step 4 Ligation of Adaptor MA162 RevA Page 15 of 67 NxSeq 20 kb Mate Pair Library Kit Protocol 4 Ligation of Adaptor During this step the A tailed gDNA from step 3 3 is ligated to the adaptor NOTE Do not vortex the adaptor Mix by pipetting up and down and spin down briefly prior to use 4 1 NxSeq Long Mate Pair Kit Box 1 Reagents Reagent Cap Identifier Adaptor ADT Ligase LIG 4 2 User Supplied Reagents Equipment Reagent Supplied By A tailed gDNA From step 3 3 10 SDS Solution Ambion Proteinase K NEB 3 M NaOAc pH7 Ambion 100 Isopropanol Various GlycoBlue Ambion Thermocycler User 4 3 Protocol Ligation In the tube with the A tailed gDNA set up the ligation reactions add each reagent in the following order Reagent Volume HL for each reaction A tailed gDNA 104 Adaptor ADT 12 Ligase LIG 8 Total 124 e Mix by pipetting up and down 10 times with a wide bore tip Place tube in the a thermocycler and incubate according to the following parameters Step Temperature Time 1 25 C 40 minutes 2 4 C Hold e Spin the tubes briefly to collect materials at the bottom
64. step 7 3 is cleaned 8 1 NxSeq Long Mate Pair Kit Reagents None 8 2 Reagents Equipment Needed Reagent Supplied By Exonuclease Treated Insert Coupler From Step 7 3 3 M NaOAc 0 1X Ambion GlycoBlue Ambion 100 Isopropanol Various Thermomixer or heat block set at 37 C Eppendorf Thermomixer or heat block set at 80 C Eppendorf 8 3 Protocol Add the following to the sample of Exonuclease Treated Insert Coupler Reagent Volume uL per Tube Exonuclease Treated Insert Coupler 412 3 M NaOAc 0 1X 45 GlycoBlue 1 100 Isopropanol 680 Mix by inverting the tube s 10 times Incubate at 20 C for a minimum of 10 minutes up to overnight 14 16 hours Centrifuge at 4 C for 30 minutes at 15 000 RPM Remove supernatant being careful not to disturb the blue pellet re IMPORTANT NOTE Frequently the DNA is spread up the side of the tube and is difficult to see Always add the Elution Buffer to the side of the tube and elute the DNA by washing the side of the tube until the DNA is resuspended Immediately add 600 uL of 70 Ethanol Centrifuge at 4 C for 5 minutes at 15 000 RPM Remove supernatant with a pipette while being careful not to disturb the pellet Air dry for 10 minutes Carefully re suspend the pellet s in a total of 35 uL Elution Buffer EB using a wide bore tip For two tubes add 17 5 uL Elution Buffer EB to each tube
65. t DNA plus loading solution into each of the following lanes O For 10kb insert Two of the four remaining lanes O For 15 and 20kb inserts Four remaining lanes NOTE This protocol is optimized for 3 4 ug of DNA loaded per lane If your amount of input DNA is outside of this range additional optimization may be required e _ Under the Protocol Editor tab program the BluePippin run with the following parameters O Range Mode Settings see table below O BluePippin Cassette Definition see table below O Indicate the reference lane loaded with the S1 marker by choosing the appropriate flag and select apply reference to all lanes O For the four sample lanes select the range box O For the four sample lanes enter the desired start value and a desired end value from the table below Minimum Range Mode Settings BluePippin Cassette Definition Insert Size 10kb Bpstart 10000 Bpend 50000 o 75 DF Marker S1 high pass 6 10kb vs3 15kb Bpstart 15000 Bpend 50000 o 75 DF Marker 1 high pass15 20 kb 20kb Bpstart 18000 Bpend 50000 9 759 DF Marker S1 high pass15 20 kb e Save the parameters as a named pprot file e Under the Main tab click on start The required run time is dependent on the minimum insert size For example 10kb insert will take approximately 2 hours whereas a 20kb insert will take up to 4 5 e After the run ends allow the size selected samples to sit in the cassette
66. t size Options for shearing include the Diagenode Megaruptor or Covaris gTUBE Diagenode Megaruptor Final Recommended amount Recommended shearing conditions Desired of starting material Diagenode Megaruptor insert size Long Hydropore 10kb 15 ug in 400 uL Elution Long Fragment Sample Volume 400 uL Buffer EB Target Fragment Size 10kb 15kb 15 ug in 400 uL Elution Long Fragment Sample Volume 400 uL Buffer EB Target Fragment Size 15kb 20 kb 15 ug in 400 uL Elution Long Fragment Sample Volume 400 uL Buffer EB Target Fragment Size 20kb Page 11 of 67 MA162 RevA NxSeq 20 kb Mate Pair Library Kit Protocol Covaris g TUBEs Final Recommended amount Recommended shearing conditions Desired of starting material insert size j f g TUBE 6200 RPM for 2 minutes each 10kb 15 Hg nn E orientation using an Eppendorf model 5424 Centrifuge g TUBE 5500 RPM for 2 minutes each 15kb mg ie E orientation using an Eppendorf model 5424 Centrifuge g TUBE 4500 RPM for 3 minutes each 20 kb 15 Hg nn NA orientation using an Eppendorf model 5424 Centrifuge 1 1 Options for shearing e Diagenode Megaruptor e Covaris g TUBE Covaris Woburn MA Precipitate Megaruptor Sheared DNA to Concentrate g TUBE sheared DNA does not require concentration e Inthe tube containing the sheared DNA set up the precipitation reactions add each reagent in the f
67. the blue pellet Immediately add 600 uL of 70 Ethanol Centrifuge at room remperature for 5 minutes at 15000 RPM Remove supernatant with a pipette while being careful not to disturb the pellet Air dry for 10minutes For each tube resuspend the pellet in O 60 uL Elution Buffer EB with a wide bore tip for the BluePippin protocol in Section 5A O 50 uL Elution Buffer EB with a wide bore tip for the SeaKem Elutrap protocol in Section 5B Incubate the eluted sample for 15 min at room temperature Centrifuge at high speed 12 000 15 000 rpm for 5 minutes to remove insoluble material Transfer and pool the supernatants into a single clean 1 5 mL LoBind tube Page 17 of 67 MA162 RevA NxSeq 20 kb Mate Pair Library Kit Protocol 5A Size select the Adaptor Ligated DNA with BluePippin During this step the Precipitated Insert with Ligated Adaptor from step 4 4 is cleaned up using the BluePippin 5A 1 NxSeq Long Mate Pair Kit Box 1 Reagents Reagent Cap Identifier Elution Buffer EB 5A 2 Reagents Equipment Needed Reagent Supplied By Precipitated Insert with Ligated Adaptor From step 4 4 BluePippin Sage Science 0 75 Agarose cassettes Dye Free Low Range Sage Science S1 marker Sage Science Loading solution Sage Science 0 1 Tween 20 Sage Science 3 M Sodium Acetate Ambion 100 Isopropanol User 70 Ethanol Prepare fresh daily User 1 5 mL LoBind
68. the magnetic rack Mix the beads and the buffer by pipetting up and down 10 times Do not vortex Incubate at 37 C for 5 minutes do not use a magnetic rack during the incubation Mix 10x with pipette Place the tubes in a magnetic rack until the supernatant becomes clear 2 minutes Page 43 of 67 MA162 Rev A NxSeq 20 kb Mate Pair Library Kit Protocol e Remove 20 uL and place in a clean 1 5 mL LoBind tube 16 4 Size Confirmation Analyze 1 uL of the purified PCR amplification on Bioanalyzer High Sensitivity Chip and compare to example traces below Ideal traces will show a peak in size distribution between 150 2000 bp Product larger than 5000 bp could indicate over amplification 160 140 1 1204 tes TA AAA ML Filo wonton NS Lu T T T T T T Ti gt Tom 35 100 150 200 300 400 500 600 1000 2000 10380 bp Example trace of amplified library using Agencourt AMPure XP Reagent 16 5 Concentration Quantify 1 5 uL of test amplification using Qubit dsDNA HS Assay Kit with the Qubit 2 0 Fluorometer according to manufacturer s instructions e Use the concentration determined in step 18 5 and the table below to identify the number of PCR Cycles Needed for Optimal Library Amplification The minimum recommended concentration of amplified product is 0 3 ng uL or 6 ng total in 20 uL of bead purified PCR product After quantifiying the Test PCR 20 cycles with 2 uL library refer to this table to
69. tions for Sample Pooling Prior to Sequencing Reagent Volume Master Mix HL per rxn Volume HL Accura HotStart 2X Master Mix AMM 10 80 Primer Mix Index 12 Cap Identifer 12 2 16 Nuclease free water 6 48 Mate Pair Library DNA Step 17 3 2 16 Total 20 160 If multiplexing use an appropriate Primer Mix Index for each library e Aliquot 20uL of Master Mix into each 0 2mL thermocycler tube e Place the tubes in a thermocycler and cycle according to the following parameters Step Temperature Time 1 94 C 2 minutes 2 94 C 15 seconds 3 60 C 15 seconds 4 72 C 60 seconds 5 Repeat steps 2 4 for X more cycles 6 72 C 5 minutes 7 4 C Hold 1 Number of PCR cycles determined in step 16 3 16 6 Pooled Reaction Pool all PCR reactions into a clean 1 5 mL LoBind tube 16 7 Purify amplified reactions e Add AMPure XP beads to the DNA Reagent Volume uL 16 4 Pooled Reaction 160 AMPure XP Beads 288 e Perform all of the following steps at room temperature Mix gently by pipetting up and down 10 times Incubate at room temperature for 5 minutes do not use a magnetic rack during the incubation Place the tube in a magnetic rack until the supernatant becomes clear 5 minutes With tube in the magnetic rack remove the supernatant with a pipette and discard Page 46 of 67 MA162 RevA NxSeq 20 kb Mate Pair Library K
70. tube For 20 kb insert ligations the insert will be split into two tubes with 500ng in each tube Reagents for 10 and 15 kb inserts In a single fresh 1 5 mL LoBind tube 10 and 15 kb or two fresh 1 5 mL LoBind tubes 20 kb set up the following ligation reactions to generate the Ligated Insert Coupler add each reagent in the following order Size selected Insert with adaptor Tube 1 Volume uL x calculated in step 6 3 2 Coupler mix CM 3 0 Nuclease free water Up to 356 5 10X Ligase Buffer 10X 40 Ligase LIG 0 5 Total 400 Reagents for 20 kb inserts Tube 1 Volume uL Tube 2 Volume pL Size selected Insert with x 2 x 2 adaptor 500 ng each reaction calculated in step 6 3 2 calculated in step 6 3 2 Coupler mix CM 1 5 1 5 Nuclease free water Up to 356 5 Up to 356 5 10X Ligase Buffer 10X 40 40 Ligase LIG 0 5 0 5 Total 400 400 Mix gently by inverting tube s 10 times Incubate and heat kill the Ligated Insert Coupler from step 6 4 according to the table below Step Temperature Time 1 4 5 C Overnight 14 16 hours 2 70 C 15 minutes Place the tube s on ice for 2 minutes Spin the tube s briefly to collect materials at the bottom of the tube s Proceed directly to Step 7 Exonuclease Treatment MA162 Rev A NOTE Use a pipet designed for volumes under 2 uL to pipet the Ligase Page 27 of 67 NxSeq
71. uantification throughout the protocol o The ratios of material used in each ligation step throughout the protocol have been optimized for the best performance o The materials provided in the kit are quantified using Qubit 2 0 Fluorometer Life Technologies o The use of other quantification methods e g gel image A260 A280 may lower the efficiency of the kit and result in insufficient material to sequence Detailed Protocol 1 Shear DNA to Appropriate Size During this step the genomic DNA gDNA is sheared to an average size range that is larger than the desired insert size See Appendix B The effect of the size range of sheared DNA on insert size for additional information on shearing and size selection Notes gDNA used must be free of contaminating RNA gDNA used must be of a high molecular weight gt 20 kb gDNA must be resuspended in Low TE 0 1 mM EDTA 10 mM Tris pH 8 or in 10 mM Tris pH 8 5 Tagmentation from Illumina should not be used for shearing Tagmentation will add additional nucleotides and the use of Tagmentation has not been tested with the mate pair kit A sample loss of 20 60 is expected during shearing and clean up The percentage of sample loss will vary depending on the shearing method used This expected loss should be taken into account when determining the amount of gDNA to shear Use the tables below to determine the recommended amount of starting gDNA and shearing method for your final desired inser
72. wing reagents to 0 2 mL thin wall PCR tubes number of reactions determined in table in step 2 End Repair Reagent Amount for each reaction Purified sheared gDNA 1876 ng Nuclease Free Water Up to 46 uL End Repair Tailing Buffer ERB 50 uL End Repair Enzyme Mix ERE 4 uL Total 100 uL Mix by pipetting up and down 10 times using a wide bore tip Place tube s in a thermocycler and incubate according to the following parameters Step Temperature Time 1 25 C 25 minutes 2 72 C 30 minutes 3 4 C Hold Proceed directly to step 3 A Tailing MA162 Rev A Page 14 of 67 NxSeq 20 kb Mate Pair Library Kit Protocol 3 A Tailing During this step the End Repaired gDNA from step 2 3 is A tailed The number of reactions performed during this step is the same as the number of reactions performed in step 2 End Repair 3 1 NxSeq Long Mate Pair Kit Box 1 Reagents Reagent Cap Identifier Klenow Fragment KF 3 2 User Supplied Reagents Equipment Reagent Supplied By End repaired gDNA From step 2 3 Thermocycler User 3 3 Protocol e Using the tubes containing the End repaired sheared DNA set up the A tailing reaction add each reagent in the following order Reagent Volume uL for each reaction End repaired gDNA 100 Klenow Fragment KF 4 Total 104 Mix by pipetting up and down 10 time

NxSeq Long Mate Pair Library Kit

Contents

Download Pdf Manuals

Related Search

Related Contents