pCDH cDNA Cloning and Expression Lentivectors
Contents
1. SBI System Biosciences pCDH cDNA Cloning and Expression Lentivectors Cat s CD500 CD700 User Manual Store kit at 20 C on receipt A limited use label license covers this product By use of this product you accept the terms and conditions outlined in the Licensing and Warranty Statement ver 5 082212 contained in this user manual pCDH cDNA Cloning Lentivectors Contents Vi Introduction and Background Cat CD500 CD700 series A Purpose of this Manual 2 B Advantages of the Lentivector Expression System 2 C pCDH cDNA Cloning and Expression Lentivectors 3 D List of Components Lees 7 E Additional Required Materials 7 F Safety Guidelines ss 9 Protocol A cDNA Amplification LLL sss 11 B Primer Design for T2A Vector Cloning hmmm 11 C Preparation of Digested pCDH Vectors sic cs 12 D Cloning of cDNA into pCDH Vectors fao 13 E Packaging of pCDH Expression Construct sss 15 Troubleshooting A Large number of colonies on control plate 16 B No or low number of colonies on plate with cDNA sample 16 C No correct cDNA inserts on 17 References us his Alette 18 Appendix A Maps and Features for pCDH Vectors i 19 B Descriptions of Features in pCDH Vectors sss i cttw 22 C Properties of copGFP Fluorescent Protein 23 D Related Products sss 23 E Technical Support sss 24 Licensing and Warranty Statement i 25 888 266 5066 Toll Free2. LTR 235 414 Gag 567 919 RRE 1076 1308 Env 1309 1797 cPPT 1798 1916 CMV 1922 2271 EF1 2315 2860 copGFP 2874 3629 WPRE 3639 4229 3ALTR 4301 4534 SV40polyA 4606 4737 SV40 ORI 4746 4892 pUC ORI 5262 5935 c AmpR 6080 6940 c 5 LTR to 3 LTR 4 300 bp Features RSV 7 234 5 LTR 235 414 Gag 567 919 RRE 1076 1308 Env 1309 1797 cPPT 1798 1916 EF1 1928 2473 T2A peptide 2518 2571 PuroR 2578 3174 WPRE 3190 3780 3ALTR 3852 4085 pCDH cDNA Cloning Lentivectors Cat CD500 CD700 series RSV 5 LTR AmpR RRE pCDH EF1 MCS Eny T2A Puro cPPT BstBI pUC ORI Cat CD520A 1 7 095 bp SV40 ORI ye id SV40 poly A peptide PuroR 3 ALTR WPRE bade 7 pCDH EF1 MCS T2A copGFP CD521A 1 RSV S LTR RRE pCDH EF1 MCS env T2A copGFP cPPT BstBI pUC ORI Cat CD521A 1 7 260 bp EFI MCS SV40 ORI i T2A peptide SV40 poly A SALTR wore copGFP 8 pCDH MCS T2A Puro MSCV CD522A 1 RSV s LTR AmpR pCDH MCS T2A Puro MSCV pUC ORI Cat CD522A 1 6 971 bp pCDH MCS T2A copGFP MSCV pUC ORI Cat CD523A 1 7 136 bp SV40 ORI SV40 poly A 888 266 5066 Toll Free 650 968 2200 outside US Page 17 Features RSV 7 234 5 LTR 235 414 Gag 567 919 RRE 1076 1308 Env 1309 1797 cPPT 1798 1916 EF1 1928 2473 T2A peptide 2518 2571 copGFP 2578 3333
3. 650 968 2200 outside US Page 1 System Biosciences SBI User Manual I Introduction and Background A Purpose of this Manual This manual provides details and information necessary to generate expression constructs of your gene of interest in the pCDH cDNA Cloning and Expression Lentivectors Specifically it provides critical instructions on amplification and cloning cDNA into the pCDH vectors and verification of the final expression constructs This manual does not include information on packaging the pCDH expression constructs into pseudotyped viral particles or transducing your target cells of choice with these particles This information is available in the user manual Lentivector Expression Systems Guide to Packaging and Transduction of Target Cells which is available on the SBI website www systembio com Before using the reagents and material supplied with this system please read the entire manual B Advantages of the Lentivector Expression System Lentiviral expression vectors are the most effective vehicles for the delivery and expression of a gene of interest to almost any mammalian cell including non dividing cells and model organisms C A Machida 2003 M Federico 2003 W C Heiser 2004 As with standard plasmid vectors it is possible to introduce lentivector expression constructs in plasmid form into the cells with low to medium efficiency using conventional transfection protocols However by packaging the lentivect
4. C A Dyer J M Aucioin and F I Smith Comparison of promoter strengths on gene delivery into mammalian brain cells using AAV vectors Gene Therapy 1996 3 437 447 W C Heiser Edit Methods in Molecular Biology Volume 246 Gene delivery to mammalian cells 2004 Humana Press X Yu X Zhan J D Costa V M Tanavde Z Ye T Peng M T Malehorn X Yang C I Civin and L Cheng lentiviral vectors with two independent internal promoters transfer high level expression of multiple transgenes to human hematopoietic stem progenitor cells Molecular Therapy 2003 7 827 838 V Appendix A Maps and Features for pCDH Vectors 1 pCDH CMV MCS CD500B 1 RSV S LTR Features RSV 7 234 5 LTR 235 414 AmpR Gag 567 919 RRE 1076 1308 Env 1309 1797 PCDH CMV MCS cPPT 1798 1916 CMV 1922 2271 Cat CD500B 1 WPRE 2322 2912 6 227 bp 3ALTR 2984 3217 pUC ORI i SV40polyA 3289 3420 SV40 ORI 3429 3575 NG pUC ORI 3945 4618 c SV40 ORI one AmpR 4763 5623 c SV40 poly A 3 ALTR 5 LTR to 3 LTR 2 983 bp 2 pCDH CMV MCSr CD501A 1 Features RSV 7 234 5 LTR 235 414 Gag 567 919 RRE 1076 1308 Env 1309 1797 cPPT 1798 1916 CMV 1922 2271 WPRE 2326 2916 3ALTR 2988 3221 SV40polyA 3293 3424 SV40 ORI 3433 3579 pUC ORI 3949 4622 c AmpR 4767 5627 c 888 266 5066 Toll Free 650 968 2200 outside US Page 15 S LTR to 3 LTR 2 987 bp System Bi
5. use contact SBI Purchase of the product does not grant any rights or license for use other than those explicitly listed in this Licensing and Warranty Statement Use of the Product for any use other than described expressly herein may be covered by patents or subject to rights other than those mentioned SBI disclaims any and all responsibility for injury or damage which may be caused by the failure of the buyer or any other person to use the Product in accordance with the terms and conditions outlined herein Limited Warranty SBI warrants that the Product meets the specifications described in the accompanying Product Analysis Certificate If it is proven to the satisfaction of SBI that the Product fails to meet these specifications SBI will replace the Product or provide the purchaser with a refund This limited warranty shall not extend to anyone other than the original purchaser of the Product Notice of nonconforming products must be made to SBI within 30 days of receipt of the Product SBI s liability is expressly limited to replacement of Product or a refund limited to the actual purchase price SBI s liability does not extend to any damages arising from use or improper use of the Product or losses associated with the use of additional materials or reagents This limited warranty is the sole and exclusive warranty SBI does not provide any other warranties of any kind expressed or implied including the merchantability or fitness of the Produ
6. and translation of the CMV driven transcripts SV40 polyadenylation signal enables efficient termination of transcription and processing of recombinant transcripts Hybrid RSV 5LTR promoter provides a high level of expression of the full length viral transcript in producer 293 cells Genetic elements cPPT gag env LTRs necessary for packaging transducing and stably integrating the viral expression construct into genomic DNA V40 origin for stable propagation of the pCDH plasmid in mammalian cells pUC origin for high copy replication and maintenance of the plasmid in E coli cells Ampicillin resistance gene for selection in E coli cells 888 266 5066 Toll Free 650 968 2200 outside US Page 5 System Biosciences SBI User Manual D List of Components Component Conc Amount pCDH cDNA Expression Vector 0 5 ug ul 20 ug All plasmids are shipped at a concentration of 0 5 ug ul and an amount of 20 ug All plasmids are shipped in dry ice or blue ice and should be stored at 20 C upon receipt Properly stored plasmids are stable for 12 months from the date received Available pCDH cDNA Cloning and Expression Lentivectors Vectors without reporter Catalog pCDH CMV MCS CD500B 1 pCDH CMV MCSr CD501A 1 pCDH EF1 MCS CD502A 1 Vectors with reporter genes Catalog pCDH CMV MCS EF1 Puro T CD510B 1 pCDH CMV MCS EF1 copGFP CD511B 1 pCDH EF1 MCS T2A Puro CD520A 1 pCDH EF1 MCS T2A copGFP CD521A 1 pCDH MCS T2A Pur
7. or longer time g Take 5 ul of the PCR reaction and run it on a 1 2 agarose EtBr gel in 1X TAE buffer to identify clones with correct insert Grow a positive clone with the cDNA insert in an appropriate amount of LB Amp Broth and purify the construct using an endotoxin free plasmid purification kit see Section I E Confirm identity of the cDNA insert by sequence analysis of the construct using the one of the PCR primers Alternatively you may use one of the following sequencing primers which are located upstream of the MCS Vectors with CMV 5 CACGCTGTTTTGACCTCCATAGA 3 Vectors with EF1 5 CTCCACGCTTTGCCTGACCCTGCTT 3 Vectors with MSCV 5 GGGGTACAGTGCAGGGGAAAGAAT 3 Page 12 ver 5 082212 www systembio com pCDH cDNA Cloning Lentivectors Cat CD500 CD700 series E Packaging of the pCDH Expression Constructs into Pseudoviral Particles If you are planning to create a stably transduced cell line expressing your gene of interest you first need to package the cDNA lentiviral construct into lenti pseudoviral particles For this purpose you will need to purchase the pPACKH1 Lentivector Packaging Kit from SBI see Appendix Figure 3 schematically shows all steps which need to be performed in order to generate pseudoviral packaged cDNA expression constructs ER mcs R Packaging Expression 4 pVSV G Plasmid s Construct e pPACK Packaging Plasmid Mix A g Step 1 Co transfect 293TN cells with a lentiviral
8. Rd Mountain View CA 94043 Phone 650 968 2200 888 266 5066 Toll Free Fax 650 968 2277 E mail General Information info systembio com Technical Support tech systembio com Ordering Information orders systembio com Page 20 ver 5 082212 www systembio com pCDH cDNA Cloning Lentivectors Cat CD500 CD700 series Vi Licensing and Warranty Statement Limited Use License Use of the pCDH cDNA Cloning and Expression Vector i e the Product is subject to the following terms and conditions If the terms and conditions are not acceptable return all components of the Product to System Biosciences SBI within 7 calendar days Purchase and use of any part of the Product constitutes acceptance of the above terms The purchaser of the Product is granted a limited license to use the Product under the following terms and conditions The Product shall be used by the purchaser for internal research purposes only The Product is expressly not designed intended or warranted for use in humans or for therapeutic or diagnostic use The Product may not be resold modified for resale or used to manufacture commercial products without prior written consent of SBI This Product should be used in accordance with the NIH guidelines developed for recombinant DNA and genetic research HIV Vector System This Product or the use of this Product is covered by U S Patents Nos 5 665 577 and 5 981 276 and foreign equivalents owned by the Da
9. WPRE 3355 3945 3ALTR 4017 4250 SV40polyA 4322 4453 SV40 ORI 4462 4608 pUC ORI 4978 5651 c AmpR 5796 6656 c S LTR to 3 LTR 4 016 bp Features RSV 7 234 5 LTR 235 414 Gag 567 919 RRE 1076 1308 Env 1309 1797 cPPT 1798 1916 T2A peptide 1972 2025 PuroR 2032 2628 WPRE 2644 3234 3ALTR 3306 3961 MSCV 3344 3755 SV40 polyA 4033 4164 SV40 ORI 4173 4319 pUC ORI 4689 5362 c AmpR 5507 6367 c 5 LTR to 3 LTR 3 961 bp Features RSV 7 234 5 LTR 235 414 Gag 567 919 RRE 1076 1308 Env 1309 1797 cPPT 1798 1916 T2A peptide 1972 2025 copGFP 2032 2787 WPRE 2809 3399 3ALTR 3471 4126 MSCV 3509 3920 SV40polyA 4198 4329 SV40 ORI 4338 4484 pUC ORI 4854 5527 c AmpR 5672 6532 c S LTR to 3 LTR 3 892 bp System Biosciences SBI B Descriptions of Features in pCDH Vectors Feature Function Required for viral reverse transcription self 3 ALTR inactivating 3 LTR with deletion in U3 region AU3 prevents formation of replication competent viral particles after integration into genomic DNA R Ampicillin resistant gene for selection of the plasmid Amp in E coli Constitutive Human cytomegalovirus CMV CMV n ahoa promoter for transcription of reporter and or cloned p cDNA insert Copepod green fluorescent protein similar to regular copGFP EGFP but wit
10. after thawed Quality of competent cells may be tested by transforming a circular plasmid to determine cell competency Use competent cells with a transformation efficiency of at least 1x10 colonies ug of pUC19 plasmid b Wrong antibiotic or too The plates used for cloning should much antibiotic in the contain 50 100 ug ml ampicillin in media the media C Nocorrect cDNA inserts If the colony number for the cDNA sample is more than for the negative control sample e vector only but you failed to amplify cDNA insert it could be that 1 Inactive Taq polymerase Test the activity of the PCR master mix by amplifying cDNA from the original template Replace the PCR reagents if they are proven inactive 2 Wrong primer was used Make sure you are using the correct primers for the specific orientation of cDNA insert 3 Notenough clones were screened Pick more colonies for screening Page 14 ver 5 082212 www systembio com pCDH cDNA Cloning Lentivectors Cat CD500 CD700 series IV References C A Machida Edit Viral vectors for gene therapy Methods and Protocols 2003 Humana Press C S Swindle H G Kim and C A Klug Mutation of CpGs in the murine stem cell virus retroviral vector long terminal repeat represses silencing in embryonic stem cells J Biol Chem 2004 279 34 41 E D Papadakis S A Nicklin A H Baker and S J White Promoters and control elements designing expression cassettes for gene therap
11. al biohazard risk of possible recombination with endogenous viral sequences to form self replicating virus or the possibility of insertional mutagenesis For a description of laboratory biosafety level criteria consult the Centers for Disease Control Office of Health and Safety Web site at http www cdc gov od ohs biosfty bmbl4 bmbl4s3 htm It is also important to check with the health and safety guidelines at your institution regarding the use of lentiviruses and always follow standard microbiological practices which include e Wear gloves and lab coat all the time when conducting the procedure e Always work with pseudoviral particles in a Class II laminar flow hood e All procedures are performed carefully to minimize the creation of splashes or aerosols e Work surfaces are decontaminated at least once a day and after any spill of viable material e All cultures stocks and other regulated wastes are decontaminated before disposal by an approved decontamination method such as autoclaving Materials to be decontaminated outside of the immediate laboratory area are to be placed in a durable leakproof properly marked biohazard infectious waste container and sealed for transportation from the laboratory e Please keep in mind that pCDH vectors are integrated into genomic DNA and could have a risk of insertional mutagenesis Page 8 ver 5 082212 www systembio com pCDH cDNA Cloning Lentivectors Cat CD500 CD700 series II Prot
12. ammalian cells The copGFP marker is a novel natural The copGFP protein is a non toxic non aggregating green monomeric GFP like protein from copepod Pontellina sp protein with fast protein maturation high stability at a wide range of pH pH 4 12 and does not require any additional cofactors or substrates The copGFP protein has very bright fluorescence that exceeds at least 1 3 times the brightness of EGFP the widely used Aequorea victoria GFP mutant The copGFP protein emits green fluorescence with the following characteristics emission wavelength max 502 nm excitation wavelength max 482 nm quantum yield 0 6 extinction coefficient 70 000 M cm Due to its exceptional properties copGFP is an excellent fluorescent marker which can be used instead of EGFP for monitoring delivery of lentivector constructs into cells Page 18 ver 5 082212 User Manual www systembio com pCDH cDNA Cloning Lentivectors Cat CD500 CD700 series D Related Products e pPACKH1 Lentivector Packaging Kit Cat LV500A 1 Unique lentiviral vectors that produce all the necessary HIV viral proteins and the VSV G envelope glycoprotein from vesicular stomatitis virus required to make active pseudoviral particles 293TN cells SBI Cat LV900A 1 transiently transfected with the pPACKH1 and a pCDH cDNA expression construct produce packaged viral particles containing a pCDH cDNA construct e FIV Based pCDF cDNA Clon
13. ct for a particular purpose SBI is committed to providing our customers with high quality products If you should have any questions or concerns about any SBI products please contact us at 888 266 5066 2012 System Biosciences SBI 888 266 5066 Toll Free 650 968 2200 outside US Page 21
14. droski U S patents 5 665 577 and 5 981 276 Both FIV based and HIV based lentivector systems are designed to maximize their biosafety features which include e A deletion in the enhancer of the U3 region of 3 ALTR ensures self inactivation of the lentiviral construct after transduction and integration into genomic DNA of the target cells e The RSV promoter in HIV based vectors and CMV promoter in FIV based vectors upstream of 5 LTR in the lentivector allow efficient Tat independent production of viral RNA reducing the number of genes from HIV 1 that are used in this system e Number of lentiviral genes necessary for packaging replication and transduction is reduced to three gag pol rev and the corresponding proteins are expressed from different plasmids for HIV based packaging plasmids lacking packaging signals and share no significant homology to any of the expression lentivectors pVSV G expression vector or any other vector to prevent generation of recombinant replication competent virus e None of the HIV 1 genes gag pol rev will be present in the packaged viral genome as they are expressed from packaging plasmids lacking packaging signal therefore the lentiviral particles generated are replication incompetent e Pseudoviral particles will carry only a copy of your expression construct Despite the above safety features use of SBI s lentivectors falls within NIH Biosafety Level 2 criteria due to the potenti
15. e We recommend using Stbl2 or OmniMax 2 T1R competent cells for transformation and propagation of the lentivector construct to avoid unwanted lentivector recombination events 3 Identify Clones with the cDNA Insert a Depending on the ratio of colony numbers for the cDNA sample vs the negative control sample randomly pick 5 or more well isolated colonies and grow each clone in 100 ul of LB Broth with 75 ug ml ampicillin at 30 C for 2 hours with shaking b Use 1 ul of each bacterial culture for screening cDNA inserts by PCR and continue to grow the culture for another 4 hours Store the culture at 4 C 888 266 5066 Toll Free 650 968 2200 outside US Page 11 System Biosciences SBI User Manual c Prepare a PCR Master Mix with PCR primers flanking the cDNA insert 1 rxn 10 rxn Composition 0 5 ul 5 ul PCR primer 1 10 uM 0 5 ul 5 ul PCR primer 2 10 uM 0 5 ul 5 ul 50X dNTP mix 10 mM of each 2 5 ul 25 ul 10X PCR Reaction Buffer 19 5 ul 195 ul Nuclease free water 0 5 ul 5 ul Tag DNA polymerase approx 5 U ul 24 0 ul 240 ul Total volume Mix the master mix very well and aliquot 24 ul into each well of 96 well PCR plate or individual tubes e Add 1 ul of each bacterial culture from step b into each well or tube f Proceed with PCR using the following program 94 C 4 min 1 cycle 94 C 0 5 min then 68 C 1 min 1 kb 25 cycles 68 C 3 min 1 cycle depending on the size of final PCR product use a shorter
16. e 3 primer for amplifying the target sequence First of all do not include a stop codon at the 3 end of target sequence this would prevent the expression of the reporter gene secondly place the target sequence in frame with the 2A peptide For example if you would like to clone your target sequence between Xba1 and BstB1 you would need to add one more nucleotide at the end of your target sequence in order to make it in frame with the 2A peptide and reporter gene Figure 2 888 266 5066 Toll Free 650 968 2200 outside US Page 9 System Biosciences SBI User Manual T2A sequence tccggg gag ggc aga gga agt ctt cta aca tgc ggt gac gtg gag gag aat ccc ggc cct Swa1 BamH1 Noti tctaga ttcqaatttaaatcggatccgcggccgct Xba1 BstB1 Target Sequence Ligation TS tctaga TS ntt cga att taa atc gga tcc gcg gcc gct gag ggc ggc cct tcc ggg Puro Xbal BstB1 Swal BamH1 Not1 T2A Sequence Fig 2 Sequence arrangement after target sequence is inserted between Xba1 and BstB1 in cDNA cloning vector pCDH EF1 MCS T2A Puro An additional nucleotide n is added after the last codon of the target sequence in order to keep it in frame with the T2A sequence C Preparation of Digested pCDH Vector Digest the pCDH vector with the corresponding restriction enzymes used in the preparation of the cDNA fragments and then verify complete digestion of the vector by agarose gel electrophoresis We suggest that you perform only preparativ
17. e gel purification of the digested vector if more than one restriction enzyme is used If you use a single restriction enzyme dephosphorylation as well as gel purification of the vector is necessary to reduce the background in the vector ligation step Page 10 ver 5 082212 www systembio com pCDH cDNA Cloning Lentivectors Cat CD500 CD700 series D Cloning of cDNA into pCDH Vector The optimal insert to vector molar ratio may be different for different inserts Always try at least two different ratios e g 10 1 and 30 1 for each experiment Also make sure to include one negative control reaction which contains only the digested vector 1 Ligation of cDNA to Vector a Dilute the gel purified digested vector to 10 ng ul b Setup 10 ul ligation reactions for each sample and control as follows 1 0 ul Digested pCDH Vector 10 ng ul 7 0 ul cDNA insert usually 30 50 ng or Nuclease free water 1 0 ul 10X T4 DNA Ligase Buffer 1 0 ul T4 DNA ligase 40 U ul 10 0 ul Total volume c Incubate the ligation reactions at 16 C for 1 2 hrs if it is sticky end ligation For blunt end ligation use an overnight incubation 2 Transform E coli with the ligation product Transform competent cells with a transformation efficiency of at least 1x10 colonies ug pUC19 with the whole ligation reaction 10 ul following the protocol provided with the competent cells Plate the transformed bacteria on LB Ampicillin agar plates Not
18. erminate it at any time by destroying all Products containing WPRE in your control It will also terminate automatically if you fail to comply with the terms and conditions of the license agreement You shall upon termination of the license agreement destroy all Products containing WPRE in you control and so notify SBI in writing This License shall be governed in its interpretation and enforcement by the laws of California Contact for WPRE Licensing The Salk Institute for Biological Studies 10010 North Torrey Pines Road La Jolla CA 92037 Attn Office for Technology Management Phone 858 435 4100 extension 1275 Fax 858 450 0509 CMV Promoter The CMV promoter is covered under U S Patents 5 168 062 and 5 385 839 and its use is permitted for research purposes only Any other use of the CMV promoter requires a license from the University of lowa Research Foundation 214 Technology Innovation Center lowa City IA 52242 CopGFP Reporter This product contains a proprietary nucleic acid coding for a proprietary fluorescent protein s intended to be used for research purposes only Any use of the proprietary nucleic acids other than for research use is strictly prohibited USE IN ANY OTHER APPLICATION REQUIRES A LICENSE FROM EVROGEN To obtain such a license please contact Evrogen at license evrogen com SBI has pending patent applications on various features and components of the Product For information concerning licenses for commercial
19. estriction enzyme s or use a longer reaction time For best results gel purify and dephosphorylate the vector after single enzyme digestion Also check the sequences of the PCR primers in order to be sure that the necessary restriction sites are present B No or low number of colonies on plate with cDNA sample The efficiency of cDNA cloning into the pCDH vector depends on many factors including size purity integrity modification of insert selection of restriction sites etc If your cDNA sample ligation resulted in only a few colonies please continue with PCR screening first If none of these few colonies has the right insert or you did not get any colonies at all it may be caused by 1 Inappropriate ratio of insert to vector Not enough or too much insert could inhibit the ligation reaction Try a different ratio of insert to vector to optimize the ligation reaction Sometimes the yield of the ligation reaction may also be improved by increasing both the insert and vector amounts 2 Low ligation efficiency a Inactive ligase and or Test your ligase and reaction ligase reaction buffer buffer for activity using different vector and insert Replace the reagents if they are proven inactive b Ligation inhibitors EDTA and high salt may inhibit the are present ligation reaction 3 Low transformation efficiency a Low quality or poor Handle the competent cells gently handling of competent Many cells do not allow re freezing cells
20. expression construct and pPACK packaging plasmid mix 293TN Z Producer K Cells 4 Step 2 Collect viral particles amp Pseudoviral X w e determine the titer Particles 3 I Step 3 Infect target cells Target Cells Step 4 Assay Cells e g by FACS analysis Fig 2 Schematic presentation of the packaging procedure for lentivector expression constructs and making of stable cell lines The Lentivector Expression System User Manual includes the procedural information for packaging and transducing the expression constructs This user manual is also available on the SBI web site www systembio com Although you can create stable transfectants with the lentiviral construct using standard transfection and selection protocols transduction of the lentiviral CDNA construct using packaged pseudoviral particles is the most efficient way to deliver cDNA constructs in a wide range of cells including dividing non dividing and hard to transfect cells 888 266 5066 Toll Free 650 968 2200 outside US Page 13 System Biosciences SBI User Manual Ill Troubleshooting A Large number of colonies on negative control plate If you see that the colony number on the negative control plates with no insert is equal or more than on the plate with the cDNA sample there is probably undigested plasmid contamination Check your digestion conditions and repeat digestion with an increased concentration of r
21. for various applications Table 1 A gene of interest can be cloned under a CMV or EF1 promoter with or without another expression cassette for a reporter gene copGFP or Puro R Genes can be either expressed transiently through transfection or stably expressed in a target cell line through transduction with packaged viral particles target gene Expression promoter level pCDH EF1 MCS robust in most cell pCDH EF1 MCS T2A Puro Medium Pes including primary differentiated pCDH EF1 MCS T2A copGFP EF cells pCDH MCS T2A Puro MSCV MSCV hematopoietic stem pCDH MCS T2A copGFP MSCV MSCV cell lines pCDH CMV MCS cmv pCDH CMV MCSr CMV commonly used cell i lines e g HeLa pCDH CMV MCS EF1 Puro CMV High HEK293 HT1080 E E H1299 2 pCDH CMV MCS EF1 copGFP cDNA vectors Application o o P4 a 2 o E 7 Page 2 ver 5 082212 www systembio com pCDH cDNA Cloning Lentivectors Cat CD500 CD700 series Table 1 pCDH Vector Applications Comparison of the expression levels of different promoters and the various applications proposed for each cDNA vector EF1 elongation factor 1a MCS multiple cloning sites T2A self cleavable 2A peptide MSCV 5 LTR promoter from mouse stem cell virus CMV cytomegalovirus promoter Choice of Promoter The major concern of cDNA expression in lentivectors is the efficiency level and stability of expression in target cell lines The Cytomegalovirus CMV p
22. h brighter color as a reporter for the transfected transduced cells Central polypurine tract includes DNA Flap region cPPT involved in nuclear translocation and integration of transduced viral genome EF1 Constitutive Elongation factor 1a promoter for promoter transcription of reporter and or cloned cDNA insert env Packaging signal gag Packaging signal Constitutive LTR enhancer promoter of murine stem MSCV cell virus MSCV for transcription of reporter and or cloned cDNA insert pUC ORI Allows for high copy replication in E coli Puro Puromycin resistant marker for selection of the transfected transduced cells Rev response element binds gag and involved in RRE packaging of viral transcripts RSV S LTR Hybrid RSV promoter R US long terminal repeat required for viral packaging and transcription SV40 ORI Allows for episomal replication of plasmid in eukaryotic cells SV40 Poly A Transcription termination and polyadenylation The self cleaving 2A peptide mediates protein T2A Peptide cleavage from a single open reading frame to generate multiple proteins from a single promoter Woodchuck hepatitis virus posttranscriptional WPRE regulatory element enhances the stability of the viral transcripts C Properties of the copGFP Fluorescent Protein The pCDH copGFP Vectors contain the full length copGFP gene with optimized human codons for high level of expression of the fluorescent protein from the CMV EF1 or MSCV promoter in m
23. he coexpression of a reporter gene with the target CDNA Reporter genes have been cloned at either the first or second positions and we achieved high expression levels at both locations see Figure 1 A B 10 E 3 107 3 o vod rmm 10 10 10 10 FLi H FITC FLI H FITC pCDH EF 1 puro T2A copGFP pCDH puro T2A copGFP MSCV C D 888 266 5066 Toll Free 650 968 2200 outside US Page 3 System Biosciences SBI SS6 H Side Scatter FLI H FITC pCDH EF1 cG T2A Puro Fig 1 Flow cytometry analysis of HT1080 cells transduced with dual SSG H Side Scatter 04 Te vier Fm 10 Dy 10 10 FLI H FITC pCDH cG T2A Puro MSCV User Manual reporter constructs The puromycin resistance gene puro was cloned into pCDH EF1 MCS T2A copGFP A and pCDH MCS T2A copGFP MSCV B and the copGFP gene cG was cloned into pCDH EF1 MCS T2A Puro C and pCDH MCS T2A Puro MSCV D The resulting dual reporter constructs were packaged into pseudoviral particles followed by transduction into HT1080 cells All constructs were also puromycin resistant data not shown Page 4 ver 5 082212 www systembio com pCDH cDNA Cloning Lentivectors Cat CD500 CD700 series The HIV 1 derived pCDH vectors contain the following common features Multiple Cloning Site MCS for cloning the gene of interest in the MCS located downstream of the CMV promoter WPRE element enhances stability
24. ing and Expression Vectors gt pCDF1 MCS1 Cat CD100A 1 gt pCDF1 MCS2 EF1 Puro Cat CD110B 1 gt pCDF1 MCS2 EF1 copGFP Cat CD111B 1 e RNAi Cloning and Expression Lentivectors These FIV and HIV based single and double promoter shRNA and siRNA cloning vectors allow you to clone siRNA templates and efficiently transduce these siRNA constructs in a wide range of cells For a list of currently available vectors please visit our website at http www systembio com 888 266 5066 Toll Free 650 968 2200 outside US Page 19 System Biosciences SBI User Manual e MicroRNA Precursor Construct Collection FIV based microRNA Precursor Constructs allow you to express pre miRNA consisting of the stem loop structure and upstream and downstream flanking genomic sequence For a list of currently available vectors please visit our website at http www systembio com e PathNet Transcriptional Reporter Lentivectors FIV and HIV based transcriptional reporter vectors allow detection of the activation of transcriptional factors TFs in a natural environment nuclei For a list of currently available vectors please visit our website at http www systembio com E Technical Support For more information about SBI products and to download manuals in PDF format please visit our web site http www systembio com For additional information or technical assistance please call or email us at System Biosciences SBI 265 North Whisman
25. na Farber Cancer Institute Inc and licensed by SBI This product is for non clinical research use only Use of this Product to produce products for resale or for any diagnostic therapeutic clinical veterinary or food purpose is prohibited In order to obtain a license to use this Product for these commercial purposes contact the Office of Research and Technology Ventures at the Dana Farber Cancer Institute Inc in Boston Massachusetts USA WPRE Technology System Biosciences SBI has a license to sell the Product containing WPRE under the terms described below Any use of the WPRE outside of SBI s Product or the Products intended use requires a license as detailed below Before using the Product containing WPRE please read the following license agreement If you do not agree to be bound by its terms contact SBI within 10 days for authorization to return the unused Product containing WPRE and to receive a full credit The WPRE technology is covered by patents issued to The Salk Institute for Biological Studies SBI grants you a non exclusive license to use the enclosed Product containing WPRE in its entirety for its intended use The Product containing WPRE is being transferred to you in furtherance of and reliance on such license Any use of WPRE outside of SBI s Product or the Product s intended use requires a license from the Salk Institute for Biological Studies This license agreement is effective until terminated You may t
26. ne downstream 2A Peptide enabled dual expression system Coexpression of a reporter gene together with a gene of interest is a useful approach for selecting transfected or transduced cells This is commonly achieved by using two independent internal promoters such as CMV and EF1 in pCDH CMV MCS EF1 copGFP or by linking two transgenes with an internal ribosomal entry site IRES element in a single bicistronic transcript Many dual promoter pairs have shown a high level of expression of both transgenes in standard cell lines however promoter interference often occurs in some cell lines There are also two main problems that limit the use of IRES the large size and the imbalanced expression between the first and second cistrons H Mizuguchi 2000 X Yu 2003 The self cleaving 2A peptides have been used successfully to generate multiple proteins from a single promoter in many applications P de Felipe 2004 M J Osborn 2005 P de Felipe 2006 The 2A like sequences exist in several viruses and are used to mediate protein cleavage from a single open reading frame Through a ribosomal skip mechanism the 2A peptide prevents normal peptide bond formation between the 2A glycine and the 2B proline without affecting the translation of 2B M L Donnelly 2001 T2A Peptide 2A GeneA EGRGSLLTCGDVEENP GP GeneB 2B SBI s cDNA expression vectors incorporate the 2A like sequence T2A from the insect virus Thosea asigna to mediate t
27. o MSCV CD522A 1 pCDH MCS T2A copGFP MSCV CD523A 1 new version of pCDH1 MCS1 Cat CD500A 1 originally named pCDH1 MCS2 Cat CD501A 1 T new version of pCDH1 MCS1 EF 1 Puro Cat CD510A 1 t new version of pCDH1 MCS1 EF1 copGFP Cat CD511A 1 For MCS sequences for the various vectors please refer to Appendix E Additional Required Materials For Cloning e Restriction enzymes for digestion of the vectors and or inserts Recommended New England BioLabs enzymes High Fidelity Long distance PCR enzymes T4 DNA Ligase and ligation reaction buffer Recommended New England BioLabs T4 DNA Ligase 400 U ul Cat M0202S Dilute to 40 U ul in 1X ligation buffer with the provided 10X buffer just before use High efficiency competent E coli cells RecA Recommended MaxEfficiency Stbl2 competent cells Life Tech Cat 10268 019 or One Shot OmniMAX 2 TIR competent cells Cat 4 C854003 Petri plates containing LB Agar media with 50 pg ml Ampicillin For Screening Inserts and Sequencing e Taq DNA polymerase reaction buffer and dNTP mix Recommended Clontech Titanium Tag DNA polymerase Cat 639208 e PCR machine e 2 3 1X TAE Agarose gel For Purifying cDNA Constructs after Cloning e Plasmid purification kit Recommended QIAGEN Endofree Plasmid Maxi Kit Cat 12362 The following kit combination can be used for Midi scale up to 200 ug of plasmid DNA preparation of endotoxin free DNA gt QIAfil
28. ocol The following section provides general guidelines for the cloning of cDNA amplified by PCR into pCDH vectors A cDNA Amplification Full length cDNA fragments can be recloned from another plasmid or amplified by PCR PCR based cloning is the most convenient way for full length cDNA cloning in pCDH vectors The cDNA lentivector does not contain an ATG initiation codon A translation initiation sequence must be incorporated in the insert cDNA if the cDNA fragment to be cloned does not already have an ATG codon We also recommend including a Kozak sequence i e GCCACC before the ATG for optimal translation For amplification of the target cDNA fragment design a 5 primer containing a Kozak sequence and ATG codon and 3 primer with unique restriction sites present in the MCS of the pCDH vector but not present in the cDNA sequence Amplify the cDNA fragment by high fidelity long distance PCR using about 200 ng of plasmid template DNA and a minimum number of cycles usually 12 15 cycles purify digest the amplified product with end specific restriction enzyme s and purify the digested PCR product in a 1 2 agarose gel to prevent contamination with the original plasmid used for amplification B Primer Design for Cloning into Vectors with T2A Sequence Since the gene of interest and the reporter gene in cDNA expression vectors containing a T2A peptide sequence will form one open reading frame extra attention should be paid when designing th
29. or construct into viral particles you can obtain highly efficient transduction of expression constructs even with the most difficult to transfect cells such as primary stem and differentiated cells The expression construct transduced in target cells is integrated into genomic DNA and provides stable long term expression of the target gene SBI offers a third generation of the most popular HIV 1 based lentivector expression system which consists of three main components 1 The lentiviral expression vector e 9 PCDH EF1 MCS T2A Puro 2 The lentiviral packaging plasmids e g PPACKH1 Packaging Plasmid mix 3 A pseudoviral particle producer cell line e g 293TN cells The expression lentivector contains the genetic elements responsible for packaging transduction stable integration of the viral expression construct into genomic DNA and expression of the target gene sequence The packaging vector provides all the proteins essential for transcription and packaging of an RNA copy of the expression construct into recombinant viral particles To produce a high titer of viral particles expression and packaging vectors are transiently co transfected into producer mammalian cells e g HEK 293 cells For a detailed description of SBI s Lentivector expression system please refer to the Lentivector Expression System user manual C pCDH Cloning and Expression Lentivectors SBI provides a collection of cDNA cloning and expression vectors
30. osciences SBI RSV 5 LTR AmpR 4 E 1 pCDH CMV MCSr Cat 4 CD501A 1 pUC ORI 6 231 bp P p SV40 poly A 3 ALTR WERE 3 pCDH EF1 MCS CD502A 1 RSV s LTR TE p y y RRE pCDH EF1 MCS e Cat CD502A 1 Swal pUC ORI 6 428 bp cPPT 6 EFI SV40 ORI G a ace SV40 poly A 3 ALTR WPRE 4 pCDH CMV MCS EF1 Puro CD510B 1 RSV s LTR AmpR 477 PH RRE peDH cMV MCS EF1 Puro RI pico Cat 4 CD510B 1 7 377 bp SV40 ORI AR SV40 poly A f ky 3 ALTR WPRE PuroR 5 pCDH CMV MCS EF1 copGFP CD511B 1 RSV 5 LTR AmpR I pCDH CMV MCS EF1 copGFP PUC ORI Cat CD511B 1 o 7 544 bp SV40 ORI NE SV40 poly A k 3 ALTR WPRE copGFP 6 pCDH EF1 MCS T2A Puro CD520A 1 Page 16 ver 5 082212 User Manual www systembio com Features RSV 7 234 5 LTR 235 414 Gag 567 919 RRE 1076 1308 Env 1309 1797 cPPT 1798 1916 EF1 1928 2473 WPRE 2523 3113 3ALTR 3185 3418 SV40polyA 3490 3621 SV40 ORI 3630 3776 pUC ORI 4146 4819 c AmpR 4964 5824 c 5 LTR to 3 LTR 3 184 bp Features RSV 7 234 5 LTR 235 414 Gag 567 919 RRE 1076 1308 Env 1309 1797 cPPT 1798 1916 CMV 1922 2271 EF1 2315 2860 PuroR 2866 3462 WPRE 3472 4062 3ALTR 4134 4367 SV40polyA 4439 4570 SV40 ORI 4579 4725 pUC ORI 5095 5768 c AmpR 5913 6773 c S LTR to 3 LTR 4 132 bp Features RSV 7 234 5
31. romoter is a strong and most commonly used viral promoter that constitutively expresses downstream genes While the CMV promoter works perfectly in the most common cell lines it shows poor expression in some stem cell lines and hematopoietic cell lines R F Doll 1996 E D Papadakis 2004 The housekeeping elongation factor 1a EF1 promoter has been shown to exceed and outlast CMV mediated expression in retroviral lentiviral and adenoviral vectors in hematopoietic cell lines K Tokushige 1997 H Nakai 1998 C Teschendorf 2002 EF1 also performs well in most common cell lines MSCV promoter is the 5 LTR promoter of murine stem cell virus When a portion of the U3 region of the 3 HIV LTR was replaced with the U3 region of MSCV LTR the resulted hybrid HIV MSCV LTR has dramatically increased the transgene expression level in human CD34 hematopoietic cells J K Choi 2001 After integration into genomic DNA this promoter transcribes a long transcript with an intron in the 5 UTR flanked with splice donor and acceptor sites derived from the lentiviral vector Further studies found that additional CpG mutations in the MSCV LTR reduced transcriptional silencing in embryonic stem cells C S Swindle 2004 We constructed cDNA expression vectors with the CpG deficient MSCV incorporated into the 3 HIV LTR After integration into genomic DNA 3 MSCV LTR will replace the 5 LTR and provide a high level of expression of the target gene and reporter ge
32. ter Plasmid Midi Kit Cat 12243 and EndoFree Plasmid Buffer Set Cat 19048 Please visit the QIAGEN website to download the specialized protocol that is not contained in the current user manual gt http www1 giagen com literature protocols pdf QP15 pdf For Transfection of pCDH Constructs into Target Cells e Transfection Reagent Recommended Invitrogen Lipofectamine 2000 Cat 11668 027 Page 6 ver 5 082212 www systembio com pCDH cDNA Cloning Lentivectors Cat CD500 CD700 series For Packaging of pCDH Constructs in Pseudoviral Particles e In order to package your pCDH cDNA constructs into VSV G pseudotyped viral particles you will need to purchase the pPACKH1 Lentivector Packaging Kit Cat LV500A 1 The protocol for packaging and transduction of packaged pseudoviral particles is provided in the Lentivector Expression Systems User Manual e 293 Producer Cell Line Recommended SBI 293TN Cell Line Cat LV900A 1 or ATCC 293 Cells Cat CRL 11268 e Transfection Reagent Recommended Invitrogen Lipofectamine Cat 18324 111 and Plus Reagent Cat 11514 015 888 266 5066 Toll Free 650 968 2200 outside US Page 7 System Biosciences SBI User Manual Safety Guidelines SBI s expression lentivectors together with the pPACK packaging plasmids comprise the third generation lentiviral expression system The HIV based lentivectors are based on the vectors developed for gene therapy applications by Dr J G So
33. y Current Gene Therapy 2004 4 89 113 J K Choi N Hoang A M Vilardi P Conrad S G Emerson and A M Gewirtz Hybrid HIV MSCV LTR Enhances transgene expression of lentiviral vectors in human CD34 hematopoietic cells Stem Cells 2001 19 236 246 K Tokushige D Moradpour T Wakita M Geissler N Hayash and J R Wands Comparison between cytomegalovirus promoter and elongation factor 1 alpha promoter driven constructs in the establishment of cells expression hepatitis C virus core protein J Virol Methods 1997 64 73 80 M Federico Edit Methods in Molecular Biology Volume 229 Lentivirus gene engineering protocols 2003 Humana Press M J Osborn A P Mortari R T McElmurry S K Bell et al A picornaviral 2A like sequence based tricistronic vector allowing for high level therapeutic gene expression coupled to a dual reporter system Molecular Therapy 2005 12 569 574 M L Donnelly et al Analysis of the aphthovirus 2A 2B polyprotein cleavage mechanism indicates not a proteolytic reaction but a novel translational effect a putative ribosomal skip J Gen Virol 2001 82 1013 1025 P de Felip Skipping the co expression problem the new 2A CHYSEL technology Genetic Vaccines and Therapy 2004 2 13 P de Felip G A Luke L E Hughes D Gani C Halpin and M D Ryan E unum pluribus multiple proteins from a self processing polyprotein TRENDS in Biotechnology 2006 24 68 75 R F Doll J E Crandall
Download Pdf Manuals
Related Search