MethylAffinityTM Methylated DNA Enrichment Kit For
Contents
1. The DNA fragmentation enzyme is a mix of restriction enzymes that cut DNA at non CpG region 1 Prepare DNA restriction digestion reaction in a DNase free tube as indicated below 10xDNA fragmentation buffer 5 0 ul Genomic DNA up to 2 ug DNA fragmentation enzyme 2 0 ul Double destilled H20 to bring the final volume to 50 ul Tap the bottom of the tube gently to mix well Spin the tube briefly Note Use more fragmentation enzyme if more genomic DNA is to be digested 1ul of fragmentation enzyme is able to digest 1 ug of genomic DNA Incubate the tube at 37 C for 2 hours or overnight 3 Check the completion of cleavage by agarose gel 2 3 electrophoresis using a fraction of the digestion reaction 4 Incubate the tube at 70 C for 20 minutes to inactivate enzymes The fragmented genomic DNA samples can be stored at 20 C or processed with GCM beads following the instruction in Section V V Methylated DNA enrichment procedure The following protocol is for enriching methylated DNA from up to 1 yg of fragmented genomic DNA samples For DNA samples greater than 1 ug scale up proportionally Basic protocol one step elution 1 Rinse and pellet the GCM beads 1 Gently tap the GCM beads tube to resuspend the beads evenly 2 Transfer 20 ul of beads suspension to a 1 5 ml DNase free tube 3 Add 200 ul of Binding Buffer to the beads Mix gently 4 Spin the tube briefly to pellet the beads Carefully aspirate and discard th2. the previous step aN aa 3 4 5 Note For gradient elution please see below Gradient elution protocol Optional To study methylation status precisely sometimes fractionation of methylated DNA fragments based on the density of methylated CpG dinucleotides is required In such cases gradient elution can be performed In the MethylAffinity Methylated DNA Enrichment Kit besides the standard Elution Buffer which contains 1 M NaCl a Low Salt Buffer containing no NaCl and a High Salt Buffer containing 2 M NaCl are also provided Gradient concentrations of NaCl from 350 mM to 2 M can be easily prepared by mixing the Low Salt and High Salt Buffers at different ratios Instead of performing standard elution at Step 4 elution buffers with gradient salt concentration from low to high can be used to elute and fractionate methylated DNA fragments based on the density of methylated CpGs Note The enriched methylated DNA can be used directly for quantitative PCR analysis or stored at 20 C for later use The DNA can also be precipitated by adding 3 M sodium acetate at 1 1 o sample volume and cold 100 ethanol at 3 fold of sample volumes MethylAffinity Methylated DNA Enrichment Kit User Manual VI Appendix Positive and negative control PCR reaction conditions and primer sequences 0 5 ul Template enriched mouse genomic DNA 0 25 ul Hot Start Taq polymerase 5U ul 5 ul 5x PCR reaction buffer 2 ul primer set 2U
3. Expressway to Discovery MethylAffinity Methylated DNA Enrichment Kit For rapid purification and enrichment of methylated DNA Cat No MAK GCM 30 30 reactions User Manual GeneCopoeia Inc 9620 Medical Center Drive 101 Rockville MD 20850 USA 301 762 0888 866 360 9531 inquiry genecopoeia com www genecopoeia com 2013 GeneCopoeia Inc MethylAffinity Methylated DNA Enrichment Kit User Manual USER MANUAL MethylAffinity Methylated DNA Enrichment Kit I Introduction Il Advantages and Protocol Overview Ill Kit Components and Storage IV DNA Preparation and Fragmentation V Methylated DNA Enrichment Procedure VI References VII Limited Use License and Warranty Introduction DNA methylation in mammals is involved in many cellular processes and is responsible for gene silencing by recruitment of transcriptional repression complexes It plays a critical role in development However massive methylation of the promoter regions has been frequently observed in cancer which can cause transcription repression of tumor suppressor and DNA repair genes MethylAffinity Methylated DNA Enrichment Kit provides a GCM bead based method for quick enrichment of methylated DNA fragments from whole genome The enriched sample improves the performance of downstream analysis such as RT PCR microarray and sequencing for methylation status and location studies GCM recombinant protein is designed based
4. M 2 ul 2 5 mM dNTP mix Add H2O to bring the final volume to 25 ul PCR cycling conditions 95 C 10 min x 1 95 C 10 sec 60 C 10 sec 72 C 15 sec x 35 cycles 72 C 7 min x 1 The sequences of Beta actin promoter primers negative control F AGCCAACTTTACGCCTAGCGT R TCTCAAGATGGACCTAATACGGC The sequence of GAPDH promoter primers negative control F CTCTGCTCCTCCCTGTTCC R TCCCTAGACCCGTACAGTGC The sequence of IAP primers positive control F CTCCATGTGCTCTGCCTTCC R CCCCGTCCCTTTTTTAGGAGA Vil References 1 Cross S H Charlton J A Nan X and Bird A P 1994 Purification of CpG islands using a methylated DNA binding column Nature genetics 6 236 244 2 Fatemi M and Wade P A 2006 MBD family proteins reading the epigenetic code Journal of cell science 119 3033 3037 3 Mohn F Weber M Schubeler D and Roloff T C 2009 Methylated DNA Immunoprecipitation MeDIP Methods in molecular biology 507 55 64 VI Limited Use License and Warranty Limited Use License Following terms and conditions apply to use of the MethylAffinity Methylated DNA Enrichment Kit the Product If the terms and conditions are not acceptable the Product in its entirety must be returned to GeneCopoeia within 5 calendar days A limited End User license is granted to the purchaser of the Product The Product shall be used by the purchaser for internal research purposes only The Product is expressly no
5. anty GeneCopoeia does not provide any other warranties of any kind expressed or implied including the merchantability or fitness of the Product for a particular purpose GeneCopoeia is committed to providing our customers with high quality products If you should have any questions or concerns about any GeneCopoeia products please contact us at 301 762 0888 2013 GeneCopoeia Inc GeneCopoeia Products are for Research Use Only Copyright 2013 GeneCopoeia Inc Trademarks GeneCopoeia MethylAffinity GCM GeneCopoeia Inc MAKGCM 032113
6. e supernatant 4 MethylAffinity Methylated DNA Enrichment Kit User Manual 2 Bind methylated DNA to the GCM beads Sample tube 1 Add fragmented genomic DNA up to 1 ug to the 1 5ml tube containing the GCM beads 2 Then add 5 ul 2 5 ug of pUC19 DNA to the tube 3 Bring the final volume to 100 ul with Binding Buffer Control tube 1 Add 1 ul mouse genomic DNA 100 ng provided in the kit to the 1 5ml tube containing the GCM beads 2 Then add 5 ul 2 5 ug of pUC19 DNA to the tube 3 Bring the final volume to 100 ul with Binding Buffer Close the tubes tightly and rotate the tubes on a rotisserie shaker for 1 hour at room temperature Alternatively the tubes can be rotated overnight at 4 C 3 Wash the beads 1 Spin the tubes at 1 000xg for 1 minute to pellet the beads 2 Carefully transfer the supernatants to new tubes Note Save the supernatants here to make sure the binding reaction was performed correctly and the methylated DNA has been captured 3 Wash the beads with 200 ul Binding Buffer for 4 times Carefully aspirate and discard the supernatant completely 4 One step elution 1 Resuspend the beads with 25 ul Elution Buffer Mix gently but thoroughly 2 Incubate for 5 minutes at room temperature Spin the tubes at 1 000xg for 1 minute to pellet the beads Transfer the supernatants that contain eluted methylated DNA to new tubes Repeat the above elution process and pool the supernatants from this step and
7. ed DNA Enrichment Kit User Manual Consistency All kit components are produced using highest quality reagents The kits are strictly quality controlled to ensure batch to batch consistency Protocol Overview Rinse and pellet GCM beads Bind methylated genomic DNA fragments to the GCM beads 1 hour at RT Pellet the beads Wash to remove non methylated DNA Elute methylated DNA from the beads lll Kit Components and Storage Total lt 2 hours Sufficient kit components are provided for enriching methylated DNA from up to 30 ug of fragmented genomic DNA Note Contents Amounts Shipping Storage temperature 30 rxns temperature GCM beads 25 suspension t 600 ul Ice pack 20 C Stable for at least 12 months Binding Buffer contains 300 mM 35 ml Ice pack 4 C NaCl Stable for at least 12 months Elution Buffer contains 1 M NaCI 5ml Ice pack 4 C Stable for at least 12 months Low salt Buffer contains no NaCl 10 ml Ice pack 4 C Stable for at least 12 months High salt Buffer contains 2 M 10 ml Ice pack 4 C NaCl Stable for at least 12 months pUC19 DNA 0 5 pg ul sonicated 150 ul Ice pack 20 C Stable for at least 12 months Mouse genomic DNA sonicated 15 ul Ice pack 20 C 100 ng ul Stable for at least 12 months Beta actin promoter primer set for 30 ul Ice pack 20 C negative control 2 uM Stable for at least 12 months GAPDH pr
8. omoter primer set for 30 yul Ice pack 20 C negative control 2 uM Stable for at least 12 months IAP primer set for positive control 30 ul Ice pack 20 C 2 uM Stable for at least 12 months DNA fragmentation enzyme 2 000 30 ul Ice pack 20 C units ml Stable for at least 12 months DNA fragmentation buffer 10x 150 ul Ice pack 20 C Stable for at least 12 months DNA LoBind tubes 30 Ice pack Room temperature tGCM beads are supplied as 25 v v suspension in a buffer containing 50 v v glycerol Remove only the amount of beads required shortly before use Sufficient mouse genomic DNA and control primer sets are provided for 15 control reactions MethylAffinity Methylated DNA Enrichment Kit User Manual Materials required but not supplied Rotisserie Shaker DNase free ultrapure water 3 0 M sodium acetate pH 5 2 100 ethanol 75 ethanol TE buffer 10 mM Tris Cl pH 7 5 1 mM EDTA Reagents for PCR assays IV DNA preparation and fragmentation 1 lsolate genomic DNA using an established protocol Determine the DNA concentration by UV absorbance at 260nm Check the DNA quality by agarose gel electrophoresis and ratio of OD260nm OD280nm 2 Fragment the genomic DNA using either sonication or restriction enzyme digestion In either case make sure that the genomic DNA is fragmented to 250 500 bp in length The following protocol is the DNA fragmentation procedure using restriction enzyme digestion
9. on the functional domain of methyl binding domain MBD proteins It binds specifically to double stranded DNA e g genomic DNA containing methylated CpG dinucleotides unlike methylated DNA antibodies which can only bind to single stranded DNA Compared to wild type MBD proteins GCM has much stronger affinity for methylated DNA and minimal affinity for non methylated DNA which makes the binding more specific The affinity for GCM is proportional to the density of methylated CpG dinucleotides contained in the DNA fragment ll Advantages and Protocol Overview Fewer steps and less time In MethylAffinity Methylated DNA Enrichment Kit GCM is provided as immobilized GCM magenta beads GCM was cross linked to GeneCopoeia s proprietary magenta beads through strong non covalent binding The immobilized GCM beads significantly simplify the protocol Starting from fragmented DNA samples the whole procedure can be completed in less than 2 hours see Protocol Overview Highly Sensitive The genetically engineered GCM has much higher affinity than the wild type MBD The GCM beads are able to isolate DNA fragments which contain only a few of methylated CpG dinucleotides and can be used to enrich methylated DNA from nanograms of genomic DNA sample Easy to handle The magenta color of the GCM beads makes the pellet very easy to spot which greatly reduces the risk of incidental beads loss MethylAffinity Methylat
10. t designed intended or warranted for use in humans or for therapeutic or diagnostic use The Product must not be resold repackaged or modified for resale or used to manufacture commercial products or deliver information obtained in service without prior written consent from GeneCopoeia This Product should be used in accordance with the NIH guidelines developed for recombinant DNA and genetic research Use of any part of the Product constitutes acceptance of the above terms Limited Warranty GeneCopoeia warrants that the Product meets the specifications described in the accompanying Product Datasheet If it is proven to the satisfaction of GeneCopoeia that the Product fails to meet these specifications GeneCopoeia will replace the Product In the event a replacement cannot be 6 MethylAffinity Methylated DNA Enrichment Kit User Manual provided GeneCopoeia will provide the purchaser with a refund This limited warranty shall not extend to anyone other than the original purchaser of the Product Notice of nonconforming products must be made to GeneCopoeia within 30 days of receipt of the Product GeneCopoeia s liability is expressly limited to replacement of Product or a refund limited to the actual purchase price GeneCopoeia s liability does not extend to any damages arising from use or improper use of the Product or losses associated with the use of additional materials or reagents This limited warranty is the sole and exclusive warr
Download Pdf Manuals
Related Search