HmiRQP0002 hsmq0104
Contents
1. 1 Prepare denaturing gel Add 1 g of agarose into 75 ml of de ionized water Boil the agarose for 1 2 minutes and cool it down to about 70 Add 10 ml of 10X MOPS 15 ml of f ormaldehyde and 5 ul of ethidium bromide EB Pour the gel into a tray with big combs Cover the tray 7 2 Prepare electrophoresis buffer 1X MOPS Take 50 ml of 10X MOPS and dilute 1 10 to the final volume of 500 ml with de ionized water Pour the buffer into a gel box and add some EB to it 7 3 Preparation of RNA sample Take 3 ul of the RNA sample and add DEPC to a total volume of 18 ul Heat the sample at 65 for 10 minutes Cool it down immediately Add 2 ul of 1X RNA loading buffer into the sample 7 4 RNA electrophoresis Place the RNA gel in a gel box with 1X MOPS electrophoresis buffer Pre run the gel at 100 V for 5 minutes Load the treated RNA samples into the gel and run at 100 V until the bromophenol blue runs to about one third the length of the gel Take a picture using a UV scanner 8 RNA detection results Electrophoresis results of RNAs from 10 different tissues 3 ul RNA each well See table 8 2 for the specific lane information Table 8 2 RNA sample source concentration and the ratio of OD260 OD280 All in One miRNA qPCR Primer Manual and Validation Report Lane Tissue Concentration ng l OD A260 A280 1 Brain 2385 1 9 2 Lung 2430 1 94 3 Liver 2521 1 91 4 Kidney 3444 1 94 5 Breast 27852. for about 10 minutes Add 200 ul of chloroform per 1 ml of TRIzol Close the cap and vortex vigorously for 1 minute Let the samples settle down at room temperature for 2 5 minutes Centrifuge at 12 000 g for 15 minutes at 6 Remove tubes from the centrifuge being careful not to disturb the liquid The samples should be separated into 3 layers with RNA in the top layer 3 RNA Precipitation Carefully transfer about 450 ul per 1 ml TRIzol of the supernatant to a new centrifuge tube containing 600 ul of cold 2 propanol Mix well and keep at 20T for 10 minutes Then centrifuge at 12 000 g for 10 minutes at 6T 4 Washing Remove the supernatant Add 500 ul of cold 75 ethanol Vortex until a pellet forms at the bottom of the tube Centrifuge at 12 000 g for 5 minutes 6 Remove the supernatant Centr ifuge briefly again and remove the remaining supernatant 5 Dissolve RNA Air dry the samples for 5 to 10 minutes Do not over dry the samples The samples are dry when they turn white Dissolve the samples in 30 ul of DEPC water Label the samples properly and store them at 80T 6 Determine RNA Concentration Take 1 ul of RNA sample Dilute the sample 1 10 in DEPC water RNA concentration can be measured with a NanoDrop Thermo Scientific DEPC water should be used as a blank Record both the RNA concentration and the ratio of A260 A280 All in One miRNA qPCR Primer Manual and Validation Report 7 RNA electrophoresis 7
3. 1 87 6 Testis 2972 1 9 7 Placenta 3515 1 91 8 Spleen 3344 1 91 9 Heart 3394 1 91 10 Pancreas 3101 1 91 Note In order to detect miRNAs the extracted RNA must contain small molecular weight RNAs The kit used for RNA extraction must be applicable for isolation of total RNA or small RNA The quality of RNA is critical to the success of downstream experiments Follow the instructions of the RNA extraction kit exactly Examine RNA samples by electrophoresis to ensure high quality miRNA reverse transcription 1 Thaw all the reagents needed for miRNA reverse transcription Mix reagents well by gently inverting the tubes Spin down briefly and keep on ice 2 Prepare miRNA reverse transcription reaction Add the following reagents into an RNase free reaction tube which is pre cooled on ice The final volume should be 25 ul All in One miRNA qPCR Primer Manual and Validation Report Reagents Volume Final concentration Total RNA 2 ug 2 5 U ul Poly A Polymerase 1 pl 25U RTase Mix 1 ul 5X Reaction Buffer 5 ul 1X ddH20O RNase DNase free to 25 ul Note The total RNA in the reaction must contain small molecular RNA If total RNA is used the amount of RNA should be between 1 ng 5 pg If the purified small molecular RNA is used the amount of RNA should be between 0 1 ng 1 ug 3 Reverse Transcription Reaction Mix reaction solution well Spin down briefly Incubate the reaction sol
4. 21 47 0 309 1 357 1 876 1 2 4 Conclusion Based on these results a qPCR annealing temperature between 61 4 and 63 3 is recommended This range gives the highest amplification efficiency as well as the best relative discrimination between the four single base different miRNAs 11 All in One miRNA qPCR Primer Manual and Validation Report VIII Limited Use License and Warranty Limited Use License Following terms and conditions apply to use of all OmicsLink ORF Expression Clones in all lentiviral vectors and Packaging Kit the Product If the terms and conditions are not acceptable the Product in its entirety must be returned to GeneCopoeia within 5 calendar days A limited End User license is granted to the purchaser of the Product The Product shall be used by the purchaser for internal research purposes only The Product is expressly not designed intended or warranted for use in humans or for therapeutic or diagnostic use The Product must not be resold repackaged or modified for resale or used to manufacture commercial products without prior written consent from GeneCopoeia This Product should be used in accordance with the NIH guidelines developed for recombinant DNA and genetic research Use of any part of the Product constitutes acceptance of the above terms Limited Warranty GeneCopoeia warrants that the Product meets the specifications described in the accompanying Product Datasheet If i
5. AGIGAGGUUGUAUAGUU hsa let 7f UGAGGUAGUAG A IUUGUAUAGUU The BLAST alignment shows that a single base difference exists between the four miRNAs hsa let 7a hsa let 7c hsa let 7e and hsa let 7f To discriminate and validate the primer of interest hsa let 7a Four plasmids were constructed for each of the four miRNAs 1 2 2 Sequence result of the miRNA qPCR plasmids hsa let 7c sequence result 1 020 050 Sad hsa let 7e sequence result at EN 75 se R TG AGGTAG TAG AT Tt G amp G TAT A OG TO UT OUR A hsa let 7f sequence result aT am 1 2 3 qPCR validation Using the All in One miRNA qRT PCR Detection Kit the hsa let 7a specific primer was validated using miRNA expression plasmids for hsa let 7a hsa let 7c hsa let 7e and hsa let 7f as templates about 10 molecules reaction The percent relative discrimination was calculated using the differences between the Ct values of the mismatched template and the matching template with respect to the hsa let 7a specific primer Relative discrimination e x100 The results are shown in the table below 10 All in One miRNA qPCR Primer Manual and Validation Report g Ct value for miRNA expression plasmid Annealing Relative Discrimination amplification Temp C let 7a let 7c let 7e let 7f let 7c let 7e let 7f 64 5 19 70 27 94 26 76 26 51 0 332 0 753 0 895 63 3 16 82 26 10 24 20 23 96 0 161 0 600 0 713 61 4 15 73 24 07 21 94
6. GeneCopoeia Expressway to Discovery All in One miRNA qPCR Primer Catalog number HmiRQP0002 User Manual and Primer Validation Report GeneCopoeia Inc 9620 Medical Center Drive 101 Rockville MD 20850 USA 301 762 0888 866 360 9531 inquiry genecopoeia com www genecopoeia com 2009 GeneCopoeia Inc All in One miRNA qPCR Primer Manual and Validation Report Primer Manual and Validation Report I Introduction Il Product Information Ill Additional Materials Required or Recommended IV Procedure V Storage VI Applications VII All in One miRNA qPCR primer validation report VIII Limited Use License and Warranty Introduction miRNAs are single stranded non coding RNA molecules that are on average about 22 nucleotides in length that regulate gene expression and thereby regulate different physiological activity in the cell However they are difficult to detect due to their short lengths All in One miRNA qPCR primers are specific miRNA upstream detection primers for qPCR When combined with the GeneCopoeia All in One miRNA qRT PCR Detection Kit the primers can be used for miRNA quantitation GeneCopoeia All in One miRNA qPCR primers have been validated in qPCR reactions using their specific cDNAs as templates ll Product Information PCR Package Catalog size Conc size HmiRQP0002 hsmq 0104 MIMAT0000062 hsa let 7a 75bp 100 uM HmiRQT0001 Positive Control cDNA Mix lll Addit
7. dT adaptor as the reverse transcription primer and a universal reverse qPCR primer that specifically matches to the oligo dT adaptor The mix cannot be used in conjunction with other miRNA Poly A tailing kits to validate the All in One miRNA qPCR primer V Storage Store in 20 and avoid repeated freeze thaw cycles VI Applications All in One miRNA qPCR Primers are used for detection of miRNA expression When combined with the All in One miRNA qRT PCR Detection Kit the primers can be used to detect miRNAs both qualitatively and quantitatively VII All in One miRNA qPCR Primer Validation Report A Materials and Methods 1 Instrument iQ5 Real Time PCR Detection System Bio Rad Reagents All in One miRNA qRT PCR Detection Kit Catalog Nos AOMD Q020 or AOMD Q050 Validation templates cDNAs extracted from 10 different human tissues All in One miRNA qPCR Primer Manual and Validation Report B Procedure RNA Extraction 1 Sample preparation Place a small amount of material from a human tissue sample into a pre cooled mortar Add a small amount of liquid nitrogen and grind the tissue to a fine powder Transfer the powder to a centrifuge tube containing 1 ml of TRIzol Invitrogen Vortex for 5 minutes If the samples are cultured cells use about 10 10 cells with 1 ml of TRIzol Pipette up and down until the cells are completely lysed 2 Phase separation Leave the cell or tissue samples at room temperature
8. ional Materials Required or Recommended GeneCopoeia All in One miRNA qRT PCR Detection Kit Cat Nos AOMD Q020 or AOMD Q050 All in One miRNA qPCR Primer Manual and Validation Report IV Procedure Upon receiving centrifuge the tubes at 12 000 rpm for 30 seconds so that the liquid stays at the bottom of the tubes The primers are dissolved in TE 10mM Tris Cl 1mM EDTA The concentration of each primer is 100 uM Dilute the primers to the concentration of 2 uM with sterilized ddH2O before use For each reaction take one of the primers and add it to a PCR primer reaction tube 2 ul primer for 20 ul reaction The final working concentration of the primer should be 0 2 uM The products are used together with the All in One miRNA qRT PCR Detection Kit For details refer to the appendix of primer specific All in One miRNA qPCR Validation Report Part B Procedure Section qPCR to detect miRNA The primers are provided with a positive control cDNA mix for use as templates for validation The quality of the primers may be validated with the method described in the appendix of primer specific All in One miRNA qPCR Validation Report Part B Procedure Section qPCR to detect miRNA These primers should be used with a miRNA Poly A tailing kit It is not suitable for use with a TaqMan miRNA detection kit The positive control cDNA mix is synthesized with the All in One miRNA qRT PCR Detection kit which uses a uniquely designed oligo
9. neCopoeia OmicsLink All in One GeneCopoeia Inc Trizol Invitrogen NanoDrop Thermo Scientific AOPM1001
10. t is proven to the satisfaction of GeneCopoeia that the Product fails to meet these specifications GeneCopoeia will replace the Product In the event a replacement cannot be provided GeneCopoeia will provide the purchaser with a refund This limited warranty shall not extend to anyone other than the original purchaser of the Product Notice of nonconforming products must be made to GeneCopoeia within 30 days of receipt of the Product GeneCopoeia s liability is expressly limited to replacement of Product or a refund limited to the actual purchase price GeneCopoeia s liability does not extend to any damages arising from use or improper use of the Product or losses associated with the use of additional materials or reagents This limited warranty is the sole and exclusive warranty GeneCopoeia does not provide any other warranties of any kind expressed or implied including the merchantability or fitness of the Product for a particular purpose GeneCopoeia is committed to providing our customers with high quality products If you should have any questions or concerns about any GeneCopoeia products please contact us at 301 762 0888 2009 GeneCopoeia Inc GeneCopoeia Inc 9620 Medical Center Drive 101 Rockville Maryland 20850 Tel 301 762 0888 Fax 301 762 8333 Email inquiry genecopoeia com Web www genecopoeia com GeneCopoeia Products are for Research Use Only Copyright 2009 GeneCopoeia Inc Trademarks iQ5 Bio Rad Ge
11. ure range Rate of temperature change Duration Detection 66 C 95C 0 5 step 6 sec step Yes 30 30 sec No Note The above conditions are designed for use with the Bio Rad iQ5Q PCR instrument If other instruments are used adjust the extension time and conditions for analysis as recommended by the manufacturers The annealing conditions for each miRNA assay may be different Please refer to the details of the conditions in the following section All in One miRNA qPCR Primer Manual and Validation Report C Test Results hsa let 7a hsmq 0104 primer 1 1 Validation Amplifization Chart miValidate090708 2 Deta 2009 07 08 1124 opd a Met Peak Chart mvalilateO30706 2 Data 2009 07 08 1124 opd a0 4400 2 Se SS oe on 4200 RELY PCR Base Line Suktracted Curve Fit RFU p faz jasu h hsa let 7a Amplification Plot hsa let 7a Melting Analysis Curve GASILI 12 LS ALE L is 3 44 45 46 Electrophoresis Result in lane 61 62 63 64 contains two positive controls and two NTC 5 ul of the PCR of products run on 3 agarose gel All in One miRNA qPCR Primer Manual and Validation Report 1 2 Discrimination assay of primer with single base differences in their sequences 1 2 1 hsa let 7a BLAST hsa let 7a UGAGGUAGUAGGUUGUAUAGUU UGAGGUAGUAGGUUGUAU UGAGGU
12. ution at 37 for 60 minutes Terminate the reac tion by heating at 85 for 5 minutes The products of reverse transcription can be diluted 1 5 with sterile water for the downstream qPCR reaction qPCR to detect miRNA 1 Thaw 2X All in One qPCR mix from the All in One miRNA qRT PCR Detection Kit Mix well by inverting the tube several times Spin down briefly and keep on ice 2 Prepare qPCR reaction solution on ice All miRNAs are tested in duplicate NTC No template control is tested singly Reagents Volume Final Conceniration 2xAll in One qPCR Mix 10 uL 1X All in One miRNA qPCR Primer 2yuM 2uL 0 2 uM Universal Adaptor PCR Primer 2 uM 2uL 0 2 uM First strand cDNA diluted 1 5 2 uL ddH20 4 uL Final volume 20 uL All in One miRNA qPCR Primer Manual and Validation Report 3 Mix the qPCR reaction solution well Transfer the solution to a PCR tube Spin briefly to make sure that the reaction solution is at the bottom of the tube 4 The qPCR reaction using the standard 3 step method to detect the DNA amount these experiments were designed based on Bio Rad iQ5 instrument Melting analysis can be done immediately after the amplification reactions Number of Cycles Step Temperature Time Detection 1 Pre denature 95 10min No Denature 95 10sec No 40 Annealing See reference below 20sec No Extension 72 10sec Yes Temperat
Download Pdf Manuals
Related Search