Home
PDF (Complete Thesis) - California Institute of Technology
Contents
1. sess 52 Figure 3 2 Screening Strategy for Anchor Ligand Determination eseeesssss 59 Figure 3 3 Biotin PEG yleaf Pra Anchor ligand eeeeeeeneeeeree 61 Table 3 1 Excel Table of Tryptic Fragment Analysis sseseeeeeeenereennn 66 Figure 3 5 yleaf PEGs TAT Cy5 0 ccsccccccsssccecssssececseseeecssssceecsesaeeecsesueeessesueeessesaeeessesaeeesesea 67 Figure 3 6 Design of Screening Target Epitope sessssssesseeeeeeeene enne enne 69 Table 3 3 Hit sequences from Anchor screen against 33 mer peptide fragment 16hr 71 Figure 3 7 Clustering of Anchor Sequence Ligands by AA Similarity sesssssse 71 Figure 3 8 Streptavidin Agarose Pulldown Assays for Anchor Ligand Binding Affinity 72 Figure 3 9 CD Spectra of 33mer Epitope Fragment used in screening usessssss 73 Figure 3 10 HPLC detected Immunoprecipitation Assay for Epitope Targeting Verification 75 Figure 3 11 ELISA Assay Verification of Epitope Targeting sseeeeeeeeneee 75 Figure 3 12 Ligand Directed Labeling Diagram eeeseeeeeeeeneennenn 76 Figure 3 13 Fluorescent Gel Image to Confirm Cy5 Labeling seeeseeeeeess 76 Figure 3 14 Images of Labeled and Unlabeled MALDI TOF Spectra of Unlabeled top and Eabel
2. esee 133 Figure A 4 Dip at front of spectra indicative of bad pump seal sseussse 135 Figure A 5 Leak Test Procise Software Screen ssessssssseeeeeeeeeeee nennen nennen 136 Chapter 1 Introduction gt a nk 16 1 1 Protein Catalyzed Click PCC Peptide Capture Agents for Biomarker Detection and Therapeutics Detecting cancer associated biomarkers is a necessary step on the road to personalized medicine as emerging therapeutics require the identification of specific patient populations that will respond to targeted therapiest Methods for protein biomarker detection are highly desirable for rapidly screening changes in protein mutation status monitoring patient treatment and simple point of care diagnostics Techniques that rely on detecting or monitoring protein levels mainly use antibodies for the capture and measurement of these proteins Antibodies however are biological reagents that are inherently unstable vary from batch to batch can exhibit high levels of cross reactivity with other antibodies and are expensive to produce Diagnostic assays are frequently prohibitively limited in both cost and stability due to the restrictions of the gold standard antibody detection agents Peptides can be the missing link for both inexpensive biomarker detection and targeting traditionally undruggable proteins Peptide protein interactions cover a large surface
3. 36 2 3 2 Screening via Antibody Signal Amplification Target Only Screens 39 2 3 3 Introduction of an ANnti SCre n eecseesseceeeceeeeeeeeaeeeeeeeceaeeeeaaeeteaeeeeeeeeaeensaaeeeeeees 40 2 3 4 Introduction of a Click Product Screen eene 43 2 3 5 Introduction of a Preclear iene a a rataa aaaea a ea aiaiaaeo iaaa e nnn nnne 45 2 3 6 Use of Alkyne Versus Azide Libraries ccccessscccceseessssseaeceeeceseessaeaeeeeseessessaaeens 46 2 3 7 Typical Flow of Screening urriena enne nnne nana nsa na an 48 2 4 Conclusions ec e e a mee a ee sve d eet te et veas 49 2 5 Acknowledgements e ote e ete Nette 50 2 6 References ip RD e Ip e 50 Chapter o eie t cian EE 51 3 1 NEO DUCTION E 52 3 1 1 The E17K Mutation in the Pleckstrin Homology Domain of Akt1 52 3 1 2 A General Strategy for Targeting Single Amino Acid Point Mutations in Proteins 53 3 2 Materials and Methods eeene nennen ennemi trenes nnn en nennen 54 3 2 1 Akt1 PH Domain Expressiors t tette retreat se ees 54 3 2 2 Design and Synthesis of Epitope Targeting Anchor Target Peptide 56 3 2 3 CD Spectroscopy of 33 mer Target Peptide Epitope cccssssecececessessnteeeeeeeens 56 3 2 4 Screen for Initial Anchor Ligand Peptide cccccssssccccecessssssseceeeeeeessesseseaeeeeeens 57 3 2 5 Hit Library Bead Sequence Analysis nennen enne 59 3 2 6 Streptavidin Agarose
4. ur dE Phosphatase E XXX 5a Stre a Phosphatase Binders BCIP PH Domain Domain Domain i x Initial Hits Off Target Initial Hits PHDomain d sweptavicin 9 C bos SpecificHits Alkaline Phosphatase ES 1 In site Click Hits Non specific Hits Figure 4 2 Screening Strategy Biligand Determination a Preclear Any library beads that bind to the screening reagents are removed b Target Screen Precleared beads are incubated with the target and anchor ligand and allowed o click The presence of the his tagged PH Domain is detected via an anti His antibody c Anti Screen Hit beads from the target screen are incubated with the off target PH Domain and anti his antibody These hit beads bind to both the target and off target WT and E17K mutant d Product Screen The beads are probed with streptavidin alkaline phosphatase to determine which contain the click product and thereby have shown biligand formation 4 22 Streptavidin Agarose Immunoprecipitation Pull down Assays to Test Biligand Candidates Figure 4 6 Four biligand candidates were segregated based on their hydrophobicity and sequence homology using principal component analysis as for the anchor ligands screened in Chapter 3 Biligands were synthesized by coupling the 2 ligand onto Rink Amide Resin on the Titan peptide synthesizer The amide group on the end of the Lys N3 was capped by shaking the resin with 2mL acetic anhydride 2mL NMP
5. P ajojo jajo QD 2 Q Q 2 q x E E v jv o r J x The product screen is an elegant step in the screening process that allows for the very specific narrowing of the sequence space It has become such a huge part of the success of the OBOC capture agent development process that naive anchor screens which inherently cannot 45 include product screens have been completely eliminated This switch to all in situ click screens has greatly increased both the specificity and affinity of the original anchor ligands dramatically improving the quality of the final PCC agent Details of the rationale and results from these more targeted screens can be seen in Chapter 3 No in situ Anti Biotin Product Specific Hits Alkaline Phosphatase In situ Click Hits Figure 2 9 Sample Product Screening Step The specific hits that survive the anti screen are stripped of all non covalent binders and incubated with anti biotin alkaline phosphatase or streptavidin The purple hits from this screen indicate those in which a click reaction has covalently attached the anchor ligand onto the library bead 2 3 5 Introduction of a Preclear Three of the candidates from Table 2 4 were scaled up In order to do this the secondary arm is clicked to the original anchor using Cu l to form a biligand and is tested for binding to the PSA protein Unfortunately none of the biligand candidates shown in Ta
6. Biotin MALDI TOF MS expected 2248 1 observed M H 2249 1 90 4 2 3 Screen for Triligand Peptide The best biligand candidate as determined in immunoprecipitation assays yleaf triazole Tz yksy was scaled up Figure 4 3 with a C terminal PEGs biotin for detection during the assay by coupling PEG onto NovaTag Biotin resin EMD Lys Ns yksy was coupled onto the resin on the Titan peptide synthesizer and FMOC Pra Otbu was clicked on as previously The remaining Lys Ns yleaf portion was then synthesized on the Titan the Lys Ns serving as the click handle for the triligand screen The screens Figure 4 4 were completed using a random 5 D amino acid library with a C terminal D propargylglycine alkyne click handle and were otherwise performed exactly as for the biligand including all concentrations Three hit beads were discovered in this screen and the first hit had a nonsensical sequence so it could not be used Both of the usable hits were scaled up and tested for binding using ELISA assays 91 Precleared 19 Library CXsXoX3X4Xs Anti biotin m BCIP j e Alkaline Phosphatase Biliga 3 Biligand N3 may A Anti biotin AP and Biligand Binders A BCIP INE oo AEN NEN Domain e e Alkaline ee Phosphatase x e e Initial Hits C e ze A E Ti dap iu n a mt N Specific Hits e e Off Target Anti His Initial Hits PH Domain Alkaline Phosphatase ee Non specific Hits d
7. grows away from the location of the E17K point mutation increasing the affinity while maintaining the selectivity of the final PCC agent upon the addition of these secondary and tertiary arms proved challenging For example the biligand exhibited an increase in affinity for the E17K mutant protein but this is offset by an even larger increase in affinity for the WT protein However at the triligand stage the selectivity for E17K Akt1 relative to WT Akt1 is largely recovered Additionally there is a slight preference for E17K Akt1 relative to E17K Akt2 Figure 4 10 The homology of the PHD between these isoforms is 7996 as calculated by a pairwise sequence analysis using Blast2Seq between the Akt1 E17K structure PDB ID 2UZR and the Akt2 PH Domain structure PDB ID 1P6S The binding curves of 4B yield ECso values for the E17K Akt1 of 61nM 19nM and 45nM for the yleaf ligand the biligand and the triligand respectively Anchor e gt Wildtype Biligand E17K Triligand 10 107 10 10 PHD Figure 4 9 Full ELISA curves of Anchor Biligand and Triligand The ELISAs show that the biligand red has an increased affinity for the E17K PH Domain from the anchor ligand blue but also for the wildtype protein The triligand green restores the affinity and selectivity of the anchor ligand BH WT protein BE E17K protein 1 N N S S Figure 4 10 Point ELISA of Triligand binding to Akt1 and Akt2
8. 19 N No in situ Anti Biotin A Product Specific Hits Alkaline Phosphatase e e In situ Click Hits Figure 4 4 Screening Strategy for Triligand Determination a Preclear Any library beads that bind to the screening reagents are removed b Target Screen Precleared beads are incubated with the target and biligand and allowed to click The presence of the his tagged PH Domain is detected via an anti His antibody c Anti Screen Hit beads from the target screen are incubated with the off target PH Domain and anti his antibody These hit beads bind to both the target and off target WT and E17K mutant d Product Screen The remaining beads are probed with streptavidin to determine which contain the click product and thereby have shown triligand formation 4 2 4 Full ELISA Curves for Ligands The full curve ELISAs were obtained using streptavidin coated ELISA plates Pierce The ligands anchor biligand two triligand candidates ivdae and iryrn and eflya scrambled anchor peptide blank were laid down on the plate at a concentration of 14M for one hour Two lanes of each ligand were used on the plate for both proteins WT and E17K GST PHD The plates were blocked with 596 BSA for two hours Dilutions of both WT and E17K GST PHD proteins were made in 0 5 BSA in 1xTBS ranging from 14M down to 0 5nM by serially diluting 1 2 down a series of 8 samples For each ligand a no protein blank was also used The proteins were incu
9. Anvikar A Baird K Bancone G Bansil P Carter N Cheng Q Culpepper J Eziefula C Fukuda M Green J Hwang J Lacerda M McGray S Menard D Nosten F Nuchprayoon l Oo N N Bualombai P Pumpradit W Qian K Recht J Roca A Satimai W Sovannaroth S Vestergaard L S Von Seidlein L G6PD testing in support of treatment and elimination of malaria recommendations for evaluation of G6PD tests Malaria journal 2013 12 391 7 Cappellini M D Fiorelli G Glucose 6 phosphate dehydrogenase deficiency Lancet 2008 371 9606 64 74 8 Phage Concentration Calculator http www abdesignlabs com technical resources phage calculator accessed May 2 125 Appendix A Use Care and Maintenance of Procise 494 CLC Edman Degradation Protein Sequencer 126 A 1 Regular Use A 1 1 Loading a Bead There are 4 cartridges on the Edman and each can be loaded with a bead The cartridge is unscrewed from the machine and the lid with the hose coming out of the top should ALWAYS be rested on the cartridge holder and not left to dangle This stretches out that hose and it will need to be replaced The cartridge top unscrews Inside there are two quartz sample holders and the bead fits in between them With gloves on use a finger on each side of the cartridge to hold the second quartz sample holder in place while you turn the cartridge upside down and let the top part slide out These q
10. 5 3 4 Focused Library Screening eesesssssssseeeeeeee eene eene enne nnn nnne naa 122 5 4 Conclusions reta tete eh e etg RE Pe Red eee Een e EU eunte dto qa e Re enne 123 5 5 Acknowledgements eem DIR oats 124 5 6 References sioe ot p EP Ee e t p e ies 124 AppendbCoAds tete iet ies ett he rte tee dd a eio at edet decide Aad eodein 125 A 1 Reg lar UJse 4 e d oot soto rt A e E eese Ee dE 126 A 1 1 Loading a Bead i cse Rouen n etal cas HIS E 126 A 1 2 SolVents iu id eie eei he i rer hate pe eel eni baee eee en iade ded 127 A 1 3 Ordering eie eh eren tede he e edes 128 A 1 4 Contacting AB cepe ee a e eet pe baa eve ier EUR Ne ER Ee enas 128 A 1 5 Idle miachile ore eee n ete re tree 129 A 1 6 Settings usce teet tti t ht teu tes 129 A 2 Troubleshooting esae BRI a RR RM Gr RM IE 131 A 2 1 Computer Errors Freezing or Not Saving Spectra ssseseseeeee 131 A 2 2 Machine Bottle Runs Dry esses eene eene ennt nna asses ensi ian 132 A 2 3 HPEC Bottle Ru ns Dry 5 oet 132 A 2 4 Baseline Errors Dip at front of Spectra cccccccccccecessssscecececeseesestsaeeeeeeeseseees 133 A 2 5 Baseline Errors Stretched Out Amino Acid Standards sesssse 135 A 2 6 Pressure Errors Change Bottle Seals 135 A 2 7 Pressure Errors Clogged Lines essen nnne nnne 136 xii List of Figures and Tables Chapter 2 Figure 2 1 Iterative In Situ Click Scre
11. E ii anchor ligand with the pss tosylate dye label and Figure 3 4 TAT PEG yleaf pip tosyl EG Cy5 Labeling experiments were incubated for two days at performed using a yleaf anchor ligand blue that was built onto a TAT peptide red with a PEG spacer black The labeling arm consisted of a pip spacer tosyl labeling group and EG spacer green with a Cy5 dye pink payload MALDI TOF MS expected m z 3316 observed m z M H 3317 50 room temperature The mixture was lyophilized after two days and then denatured by boiling in SDS PAGE loading buffer The labeled protein was run alongside an unlabeled control on an Any KD gel Biorad then imaged on an Odyssey fluorescent gel reader Figure 3 13 After confirming that labeling had occurred the gel was stained with BioSafe Coomassie blue stain BioRad and the blue protein bands were cut out The gel pieces were trypsin digested using the Pierce In gel Digest Kit following all of the manufacturer s instructions The tryptic fragments from both the unlabeled and labeled protein digests were lyophilized to concentrate them taken up in 2uL of 5096 H20 50 Acetonitrile and were analyzed by MALDI TOF MS Initially analyses were performed by considering any peak that was present in the labeled protein sample that was not present in the unlabeled sample The weight of the dye labeling arm 552 3 g mol was subtracted from these peaks and the corresponding
12. and the codons were optimized for expression in E coli The first 124 N terminal amino acids from full length Akt1 were used as the PH Domain DNA and a 6 his tag separated by a thrombin cleavage site was added at the C terminus of the protein for purification In order to make the E17K mutant of the PH Domain the glutamic acid in position 17 was mutated to a lysine via QuikChange Stratagene following all of the manufacturer s protocols The DNA was synthesized in a pJexpress 414 vector containing an ampicillin resistant gene to be expressed in E coli cells Protein expression was performed by the Protein Expression Center at Caltech using their standard bacterial expression protocol and purified via Ni NTA column The proteins expressed in this manner were used for the pull down assays confirming the anchor binding via immunoprecipitation assays and for the biligand screens These PH Domain proteins were unsuitable for long term storage under a large variety of tested conditions so a GST tag was added to hopefully improve the long term stability For that reason the DNA from DNA 2 0 was amplified out of the pJExpress vector using polymerase chain reaction PCR to insert the restriction enzyme sites EcoRI and Notl for insertion into a pGEX 4T 1 vector containing a GST tag The primers used were 5 AGAGAATCCATGTCCGACGTCGCGATCGTAAAGGAAGGG 3 5 TCTGCGGCCGCTTAGTGGTGATGATG 3 Both the wildtype and E17K mutant DNA were amplified out of
13. for everything Your support whether by phone email gchat or random cards and care packages has certainly seen me through my fair share of tough times Thank you for being one of the most caring and considerate people have ever met And to Marc whom still miss as a lab partner to this day Whoomp There it is Last but not least to AJ You have shown me the very definition of bravery and strength and strive to face much lesser adversity with your grace and courage miss you every day and you remain as you will forever the never ending source of my inspiration Love you always viii Table of Contents Drug C a ae iv Acknowledgerrnents iiid itid td r es oae dede eaea aia oos gus di cea gex dude geo do cea esae de Ree Puedes V l istof Figuresand Tables xen ete e dede ide elo cetutusdee tec ide E xii Surg e 15 1 1 Protein Catalyzed Click PCC Peptide Capture Agents for Biomarker Detection and MING Vea PO UUICS eseis ae eaae eE e aae EAEE e aE EEE ie ree d LL EEEE 16 1 2 Epitope Targeting Strategles nice eese a e ra aaee 18 1 3 In Situ Click Screening Using Azide Containing Phage Display Libraries 21 1 4 Acum M 22 Chapter 2 cote eem nente LM mM LL EVE 25 2 1 WAT O DUCT ON cR 26 2 1 1 Iterative In Situ Click Chemistry for Prote
14. ypwve Biotin eefef E17K PHD Biotin yleaf protein Biotin elnhy Figure 3 8 Streptavidin Agarose Pull down Assays for Anchor Ligand Binding Affinity Streptavidin agarose was incubated with a panel of potential anchor sequences that were synthesized with biotin tags These resins were then incubated with either wildtype or E17K Mutant PH Domain to measure the amount of protein that is pulled down by each potential anchor ligand 2 92 CD Spectroscopy of 33 mer Target Peptide Epitope In order to determine whether the epitope used in the screen would retain the secondary structure of the full protein CD spectroscopy was performed Figure 3 9 The biotin tagged alkyne containing fragment that was used as a screening target was tested and the resultant spectra do show the presence of secondary structure This result is confirmed by the 73 disappearance of this structural signature upon the addition of a denaturing guanidine HCl buffer More importantly the characteristic dip at 217nM of the blue fully natured fragment spectra is the signature of a B sheet which is the expected structure of this part of the full protein We can assume then that this fragment is maintaining a structure similar to that of the natured protein even with the incorporation of the click handle Therefore peptide binding to the E17K fragment should see a surface similar to that of the full length PH Domain protein The messiness of the spectra fr
15. 2142 1499 13 946 76 1507 814 955 444 4112 05 8 684 1515 1 962 73 1507 814 955 444 4687 71 7 286 1567 65 1015 28 1565 8591 1013 489 7907 73 1 7909 1639 2 1086 83 1645 9403 1093 57 21961 13 6 7403 1707 53 1155 16 1701 0101 1148 64 12923 9 6 5199 1791 09 1238 72 1795 9606 1243 591 5200 25 4 8706 1802 79 1250 42 1800 0105 1247 641 8149 76 2 7795 1851 79 1299 42 1841 9813 1289 61 4331 77 9 8087 1995 47 1443 1 1957 1459 1404 78 4368 22 38 3241 2212 04 1659 67 2213 208 1660 838 95735 94 1 168 EEWTTAIQTVADGLK 2225 51 1673 14 2213 208 1660 838 17712 89 12 302 2233 95 1681 58 2213 208 1660 838 12256 12 20 742 2284 12 1731 75 2344 242 1791 872 5711 7 60 122 2306 92 1754 55 2344 242 1791 872 6553 24 37 322 2344 23 1791 86 2344 242 1791 872 4506 1 0 012 EAPLNNFSVAQCQLMK 2383 46 1831 09 2362 2571 1809 887 8608 79 21 2029 2406 7 1854 33 2362 2571 1809 89 4338 6 44 4429 67 The peak at 2212 was not seen on the unlabeled mass spec but is seen on the labeled fragment and was considered a hit The peak at 2211 is also however a common mass seen for trypsin We do see this particular unlabeled fragment fly in the MALDI TOF MS 1659 and know that this is a site that can be labeled based on the ESI
16. 22 5 Hit Library Bead Sequence Analysis Hit sequences were segregated based on their hydrophobicity and sequence homology using principal component analysis The algorithm analyzes a series of peptides via hydrophobicity and sequence homology and graphs them on a 2D sequence map Figure 3 7 Clusters of hits were circled and one peptide from each cluster was scaled up and tested for binding to both wildtype and E17K mutant PH domain The ligands chosen for scale up were dqntr ypwve eefef yleaf and elnhy Any ligand candidates that were difficult to call on the sequencing were not chosen for scale up and testing 3 2 6 Streptavidin Agarose Immunoprecipitation Pull down Assays for Binding Affinity Pull down assays were done on streptavidin agarose resin Invitrogen The resin was incubated with N terminal biotinylated anchor peptide candidates identified via the principle component analysis seen in Figure 3 7 The anchor candidate coated beads were then incubated with both wildtype and E17K mutant protein to compare the selectivity of the ligands as well as the binding ability 60 Assays were performed using 50uL of streptavidin agarose slurry 25uL resin in Spin X tubes Sigma to allow for the easy removal of the solutions Resin was aliquotted into 14 tubes six ligands plus a blank tested against two different proteins then washed three times with 1x TBST 1x TBS 0 196 Tween 20 Each set of tubes was incubated with a 1
17. 5 BSA and one time with 1xTBS The resin was then incubated with 200uL of the 7M guanadine HCl pH 2 0 buffer used to strip beads in the screen The guanidine buffer was spun out of the beads in Spin X tubes and injected onto a Beckman Coulter semi prep HPLC with a reverse phase C18 analytical column The peak seen on the HPLC illustrated how much of the 33 mer epitope bound to either the yleaf anchor or to blank beads 22 0 Ligand Directed Tosyl Labeling Experiments For these assays the yleaf anchor was appended with an N terminal FMOC piperidine 4 carboxylic acid pip as a linker on 300mg of rink amide resin in NMP using standard FMOC amino acid coupling techniques The resin was equilibrated in anhydrous DCM and 250uL of 3 chlorosulfonyl benzylchloride tosyl was added with 450uL of DIEA and shaken for 30 minutes at room temperature Then 250uL of 2 2 2 aminoethoxy ethoxy ethanol EG 450uL of DIEA and 19mg DMAP in anhydrous DMC were added and shaken overnight The resin was washed and equilibrated in NMP and 2eq Cy5 carboxylic acid Lumiprobe was coupled at 37 C overnight 63 using standard FMOC coupling techniques The resin was washed TFA cleaved and HPLC purified as usual see Figure 3 4 for image In order to label the mf TEE protein 50uL of full length wu 78 USC CS DL ams DC H E GST E17K PH Domain from gU M GT d OOK ze wan Signalchem was treated M 2 with 10x molar excess of the Pa O V
18. 9 x 108 It should be noted that there is a significant prevalence for guanine at the first position of a codon as can be seen in Figure 5 4 This leads to a greater prevalence of the Glycine G amino acid in the overall distribution Figure 5 5 Stop codons and Cysteine C amino acids are repressed since the production of functional phages is prohibited with these sequences which is to our benefit The statistical distribution of the library sequences is otherwise unremarkable Figure 5 4 Distribution of Random Nucleotides There is a significant prevalence for G in the first position for unknown reasons Recall that the third position is limited to T and G due to the NNK format of the library 113 B expected E found li slit A C D E FGH KLMNPQRSTVWYX Figure 5 5 Distribution of Amino Acids The high prevalence of the G base pair in the first position lead to a much higher prevalence of the G amino acid than was expected Otherwise the distribution is as to be expected 5 25 Design and Synthesis of G6PD Target and Scrambled Target for Screening The capture agent that will effectively detect G6PD in clinical settings must be able to bind to a site on the protein surface that has 40 the least rate of mutation in order to 35 0 ul ons 30 a ClassI ensure the most efficient capture of the 25 20 protein with diverse sequence variance bk d a g As seen in Figure 5 6 exons 2
19. G6PD Capture for Malaria Eradication ccccccccsssssscccececessessaeeeeeeesessscssaeeeesens 104 5 2 Materials and Methods eite tte treten ert eluate deiode aeaiia 106 5 2 1 Preparation of Plasmid for Incorporation of Azidophenylalanine and Amp Resistant Genes i dee RE Te Poen ee let N Te ud pe Eure eser tat ee Eee ens 106 5 2 2 Test of Azidophenylalanine Incorporation into a Protein in E coli 110 5 2 3 Test of Azidophenylalanine Incorporation into M13KE Phage 110 5 2 4 Synthesis of M13KE Azidophenylalanine Terminated 7 mer Random Library 111 5 2 5 Design and Synthesis of G6PD Target and Scrambled Target for Screening 113 5 2 6 Optimized Phage Library Target Screening Conditions eseeeesss 115 5 2 7 Testing Phage Plaques for Library INS rts cc cccccccscsssssssseceeecessesesssaeeeeeesseeeees 117 xi 5 2 8 Incorporation of Azidophenylalanine into Phage Libraries 118 5 2 9 Optimized Phage Library Click Screening Conditions eeeeeeess 119 5 3 Results and Discussionz oce Eee dv TN ceases v dee ERE RM eae 119 5 3 1 Test of Azidophenylalanine Incorporation into a Protein in E coli 119 5 3 2 Test of Azidophenylalanine Incorporation into M13KE Phage 120 5 3 3 Phage Library Screening Conditions and Results esee 121
20. GCT CCA TCC CTC CAA CCG CAA CAT CGA CGC CTA AAT AAT G 110 522 Test of Azidophenylalanine Incorporation into a Protein in E coli The ampicillin resistant vector pAC AzPheRS 6TRN developed above also carries a chloramphenicol acetyltransferase CAT or Cm gene where residue D112 is mutated to an amber stop codon E coli TOP10 F cells were transformed with pAC AzPheRS 6TRN plasmid and plated on an LB agar plate supplemented with ampicillin 100 ug mL and tetracycline 12 5 ug mL Colonies were slow growing and were therefore incubated for 24 hours at 37C An LB broth culture of 5 mL supplemented with ampicillin 100 ug mL and tetracycline 12 5 ug mL was inoculated with a single colony and grown overnight at 37 C The overnight culture 1 mL each was diluted into two 7 mL cultures with appropriate antibiotics An azidophenylalanine stock solution was prepared freshly by dissolving the amino acid in 50 DMSO and 50 acidic water pH 2 0 with HCl A blank stock solution containing only the DMSO acid without amino acid was also prepared The amino acid or blank stock solution was added to the diluted culture to the final concentration of 2 mM or 0 mM azidophenylalanine After incubating at 37 C for two hours 34 ug mL of chloramphenicol was added to each culture Each culture was allowed to grow further at 37 C and the level of growth was assessed by ODeoo at 6 and 18 hours of incubation 5 2 3 Test of Azidophenylalanine Incorp
21. Gene Therapy Of Infectious Diseases Annual Review of Microbiology 1997 51 1 257 283 23 Millward S W Henning R K Kwong G A Pitram S Agnew H D Deyle K M Nag A Hein J Lee S S Lim J Pfeilsticker J A Sharpless K B Heath J R Iterative in Situ Click 24 Chemistry Assembles a Branched Capture Agent and Allosteric Inhibitor for Akt1 Journal of the American Chemical Society 2011 133 45 18280 18288 24 Millward S W Agnew H D Pitram S Lai B T Rohde R D Hardman N Protein catalysed capture agents for molecular imaging Internation Hospital Equipment and Solutions 2013 25 Wang L Xie J Schultz P G Expanding the Genetic Code Annual Review of Biophysics and Biomolecular Structure 2006 35 1 225 249 26 Tian F Tsao M L Schultz P G A phage display system with unnatural amino acids J Am Chem Soc 2004 126 49 15962 3 25 Chapter 2 Evolution of the OBOC Peptide Library Screening Protocol 26 2 1 Introduction 2T Iterative In Situ Click Chemistry for Protein Catalyzed Capture PCC Agent Development Previous work in the Heath lab demonstrated that the flexibility of chemically synthesized One Bead One Compound OBOC peptide libraries could be combined with the selective power of the in situ click process to develop multi peptide ligand capture agents that can serve as drop in antibody replacements in assays These peptide ligands can b
22. T Gordon J Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets procedure and some applications Proceedings of the National Academy of Sciences 1979 76 9 4350 4354 9 Tsukiji S Miyagawa M Takaoka Y Tamura T Hamachi l Ligand directed tosyl chemistry for protein labeling in vivo Nat Chem Biol 2009 5 5 341 343 10 Coin l Beyermann M Bienert M Solid phase peptide synthesis from standard procedures to the synthesis of difficult sequences Nature protocols 2007 2 12 3247 56 11 Pashkova A Moskovets E Karger B L Coumarin Tags for Improved Analysis of Peptides by MALDI TOF MS and MS MS 1 Enhancement in MALDI MS Signal Intensities Analytical Chemistry 2004 76 15 4550 4557 Chapter 4 Expansion of E17K Selective Anchor Ligand into an Inhibitor zt o o diei H Q H o H NH o Y o x x o m o 4 NH g N N iny aan OZN iH n M o j H o H N Y ou H ESTA NY H H 84 4 1 Introduction As described in previous chapters there is increased interest in compounds that can selectively inhibit a disease associated mutant protein target while sparing the wildtype WT variant PHD inhibiting compounds with selectivity for the E17K variant of Akt have not been reported The specificity of the yleaf anchor ligand described in Chapter 3 for the E17K Akt1 in live cells coupled with the proximity of the E17K mutation to the PIP3 binding site
23. Target Only Screens Detecting hit peptides via fluorescence was a very time consuming process in which the high noise from the overwhelming presence of positively charged amino acids meant that very little meaningful output was obtained For this reason a new method of screening was developed using Figure 2 6 Image of Hit Bead Developed with BCIP NBT a tag less protein to switch the screening High background lighter purple surrounding beads could be removed through later preclear and antiscreen steps focus from the charged dye label back to the target This technique relied on anti target antibodies conjugated to alkaline phosphatase which is an enzyme that can form a dark purple precipitate in the presence of its BCIP NBT substrate This meant that any hit now showed up as a very dark purple bead in a sea of clear The label less detection technique therefore provided the additional benefit of a colorimetric readout of a hit allowing for the much easier separation of these beads from the rest of the library As can be seen in sample screen results in Table 2 2 the high prevalence of positively charged amino acids is gone In fact the comparison between Table 2 1 and Table 2 2 is startling considering that the only difference between these two screens is the target detection method This demonstrates that the dye label was having a dramatic effect on the quality of hit sequences and was responsible for much of the large tim
24. The binding to both the wildtype and E17K mutant PH Domains was tested for both Akt1 and Akt2 The triligand maintains the selectivity for the E17K in both proteins and shows only a slight preference for the Akt1 isoform Fraction Bound 99 4 3 3 Inhibition Assays 100 The yleaf ligand the biligand and the triligand were all tested for their ability to block the Figure 4 11 PH Domain membrane binding in the presence of each ligand The first lane blank shows the amount of protein binding to PIP3 with no ligand Anchor ligand in respect to protein shows no decrease in binding but binding is starting to be blocked with the biligand and triligands E17K PHD binding with PIP3 Figure 4 11 Forthis test PIP3 coated resin Echelon Biosciences was used to mimic the PHD interaction with the cell membrane and could be used to bind the protein as in an immunoprecipitation assay The presence of an effective blocking compound would reduce the ability of the resin to capture the protein and would thus appear as a diminished signal in the corresponding western blot assay A control lane containing no capture agent was used to show baseline binding of the protein to the PIP3 resin As mentioned above the yleaf ligand produced no change in E17K binding ability but both the biligand and triligand exhibited the ability to block the PHD PIP3 interaction with the triligand being the most effective Fig 4D In an expand
25. and 3 have 0 ud HEN M EXON B3 EXON E EXON EXON EXON 7 9 11 12 13 the least number of total mutations Figure 5 6 Location 5 G6PD Mutations in protein Exons 2 and 3 show the least number of mutations and no Class mutations identified in the polypeptide sequence 5 provide an ideal location to target There are also no Class mutations that correlate to the most severe deficiencies in enzymatic activity Therefore these two exons are the ideal location to target in order to capture the most diverse pool of mutant G6PD proteins The region that is targeted by the capture agent should 114 also be distant from the NADP binding site in order not to interfere with the enzyme activity after capture In the crystal structure PDB ID 1QKI in Figure 5 8 the region encoded by exons 2 and 3 is unstructured in red in the bottom right of the protein This region is far from the active site seen in complex with the NADP at the top left of the protein and the enzyme is expected to retain its original level of activity after being captured at this position The region including these exons seen in Figure 5 7 has a few sites commonly mutated which are shown in red Therefore the capture agent must be targeted to the amino acids shown in black in order to ensure it is not binding to a highly mutated section of the protein The epitope that was selected for screening consists of amino acids 20 31 corresponding to the sequence LFQ
26. area producing antibody like affinities with unsurpassed specificities To date most peptide discovery techniques use genetically encoded libraries which allow for ease of library generation and rapid and simple sequencing These techniques permit screening of enormous numbers of compounds against a target of interest without any complicated syntheses or detailed knowledge of the target These libraries however are limited by the biological system from which they are derived both in terms of screening elements and library size Most of these systems such as phage display bacterial display and yeast display are confined to the natural amino acids because they use the cell machinery to make and express their libraries These systems limit the suitability of the resulting peptide capture agents due to the instability of biological peptides which are comprised of naturally occurring L amino acid monomers that can be degraded in biological systems and fluids 17 The Heath group has sought to alleviate the issue of peptide capture agent instability by relying exclusively on the use of unnatural amino acids Because biological libraries are not conducive to this type of work we have instead adopted a peptide screening method utilizing One Bead One Compound OBOC chemically synthesized libraries on 901m polystyrene beads This technique trivializes the inclusion of any unnatural amino acid or structure that can be chemically synthesized al
27. azide amino acid To test this two libraries identical except for their N terminal azide or alkyne click handle were blocked in 596 milk in TBS The libraries were washed three times in TBS then developed with the BCIP NBT solution used in the methods section After 45 minutes about 5 of the beads in the alkyne library turned bright yellow indicating binding of the NBT substrate The azide library did not show this background substrate turnover binding and it was assumed that this was related to the sequencing issues with the alkyne libraries If the NBT substrate is somehow changing or appending to the propargylglycine amino acid it could explain why the sequences no longer appear as they should during screening 48 2 3 7 Typical Flow of Screening With a multi stage screening process now in place the some of the steps need to be conducted in a certain order to achieve the correct results The first step is the preclear This occurs before the anchor ligand sees the protein target and has a chance to form legitimate clicked hit peptides on bead These screens look for anything that binds to streptavidin alkaline phosphatase BCIP NBT and the anchor peptides Usually a screen begins with 300 500mg of library beads and 1 1096 are removed Typically any bead that has turned even the lightest shade of purple is removed in order to reduce the overall background as much as possible This means that any bead that passes through this stage o
28. buffer for one hour The beads were then 58 washed three times with BCIP buffer 100mM Tris Cl 150mM NaCl 1mM MgCl pH 9 0 and developed by adding 15mL BCIP buffer plus 13uL BCIP and 26uL NBT Two part system Promega After one hour the purple beads were removed by pipette and discarded The remaining library beads were incubated in NMP for four hours to remove trace purple precipitate from the BCIP NBT reaction then were washed five times with methanol five times with water five times with TBS and blocked overnight in 596 milk Product Screen Figure 3 2b Beads remaining from the preclear were washed three times with 1x TBS then incubated with 5 mL of a 100 nM dilution of the 33 mer epitope target in 0 596 milk for either 5 hours or 12 hours to allow for an in situ click reaction to occur The beads were then washed three times with 1x TBS and incubated for one hour with a 7M Guanadine HCl buffer pH 2 0 to remove all of the 33 mer epitope target that was not attached covalently to the beads These beads were then washed ten times with 1x TBS blocked for two hours in 596 milk then incubated for one hour with a 1 10 000 dilution of streptavidin alkaline phosphatase conjugate in 0 596 milk in TBS to detect for the presence of the 33 mer epitope target clicked to a bead The beads were washed three times with a high salt TBS buffer then let shake in high salt buffer for one hour Afterwards the beads were again washed three ti
29. column Phenomenex 2 2 4 Typical Screening Protocol for Fluorescent Dye labeled Protein Target Detection Hit beads in the initial OBOC screens were detected via a fluorescent probe attached to the protein target of interest The target protein was labeled using an Alexa Fluor 647 Microscale Protein Labeling Kit following all manufacturer s instructions The activity of the target enzymes was then tested before screening to ensure that the dye label did not disturb function or folding Screens were conducted using a OBOC library of 5 amino acid long peptides composed of the D isomers of 19 naturally occurring amino acids no Cys for stability reasons 100mg of dried library was weighed for screening 280 000 unique sequences 4296 sampling of sequence space and swelled in 1xTBS buffer 25mM Tris 150mM NaCl 10mM MgCl pH 7 5 containing 0 0596 NaN 0 1 BSA and 0 196 Tween 20 TBSTBNaNs The library was then blocked for one hour in this buffer then 50nM protein in 1 5mL TBSTBNaNs was added the screen wrapped in foil to protect the light sensitive dye label and incubated overnight on a 180 shaking arm In the morning the buffer containing the protein was drained from the beads which were then washed three times with TBSTBNaNs three times with TBS 0 196 Tween 20 TBST then three times with 1xTBS The beads were then dried on a vacuum and spread to a monolayer on approximately 10 clean microscope slides for about 10mgs of beads
30. into proteins This tRNA recognizes the amber stop codon and should insert the amino acid in only that location creating a new amino acid tRNA combination that can be encoded into proteins Chapter 5 discusses the ongoing development of a screening technology that combines the in situ click screen advantages of the OBOC process with the rapid screening of large libraries characteristic of biological display systems For this project a phage display library containing azidophenylalanine for use in in situ click chemistry screening has been made and is being used to develop a PCC agent These phage libraries can be screened in place of the OBOC peptide libraries described in previous chapters for the more rapid development of PCC agents 1 4 References 1 Hanash S M Baik C S Kallioniemi O Emerging molecular biomarkers blood based strategies to detect and monitor cancer Nature reviews Clinical oncology 2011 8 3 142 50 2 Yu J Kane S Wu J Benedettini E Li D Reeves C Innocenti G Wetzel R Crosby K Becker A Ferrante M Cheung W C Hong X Chirieac L R Sholl L M Haack H Smith B L Polakiewicz R D Tan Y Gu T L Loda M Zhou X Comb M J Mutation Specific Antibodies for the Detection of EGFR Mutations in Non Small Cell Lung Cancer Clinical Cancer Research 2009 15 9 3023 3028 3 Rusling J F Kumar C V Gutkind J S Patel V Measurement of biomarker prot
31. ivdae Pra Lys Ns yleaf Pra Lys Ns yksy 98 Figure 4 9 Full ELISA curves of Anchor Biligand and Triligand sssssssse 99 Figure 4 10 Point ELISA of Triligand binding to Akt1 and Akt2 eessesesssss 99 Figure 4 11 PH Domain membrane binding in the presence of each ligand 100 Figure 4 12 Expanded Inhibition Assay cccccscccccsssneceesseeeceeseeeecesseeeecesseeeeceeseeeeeseseeaeens 100 Figure 5 1 Azido phenyl alanine 0 cccccccecesssneecesseeeeceeeeeeeceeeeeeecseceneecsseeeaeeeseeeaeesseenaeens 103 Figure 5 2 Mirror image phage display technique c ccccccsscscesecscsseescsseecseeseeecseeeeesees 104 Chapter 5 Table 5 1 Primers for AmpR Switch ssssssssesses seen nna 107 Figure 5 3 pAC DHPheRS 6TRN Plasmid esee nnne 108 Figure 5 4 Distribution of random nucleotides sesseeeeeee 112 Figure 5 5 Distribution Of amino acids ssessssssseseeeeeeeee nennen enne 113 Figure 5 6 Location of G6PD Mutations in protein eeesssseseeeeeeneeeenenenen enne 113 Figure 5 7 Amino Acid Sequence of Exons 1 and 2 of G6PD sese 114 Figure 5 8 Crystal Structure of G6PD 1QKI cccsecssccesssecssseecseeesseeessssecseeessaeessaaeessnees 115 Table 5 3 Pr
32. live cells To demonstrate target binding in live cells HEK 293T cells were transfected to express GFP tagged E17K or GFP tagged WT PH Domain proteins The yleaf ligand was then labeled with both a Tat cell penetrating peptide and a Cy5 dye Figure 3 5 The combination of the GFP label on the protein and the Cy5 label on the dye permitted the use of multi color fluorescence microscopy for interrogating any spatial registry between the two 80 fluorescent labels Live HEK 293T cells expressing these GFP tagged proteins were exposed to varying concentrations of the modified yleaf ligand for one hour The cells were then thoroughly washed with PBS to equilibrate the concentration and fixed for fluorescence microscopy measurements GFP Protein Anchor PEG TAT Cy5 Overlay I gt 2 2 z Figure 3 18 Images of Anchor Ligand in GFP tagged WT and E17K PH Domain The green fluorescence shows the equivalent expression of the WT and Mut proteins in cells The pink anchor ligand is distributed throughout almost all of the E17K expressing proteins but shows only background binding to the WT expressing cells Confocal microscopy images of the two differentially expressing Akt1 PH Domain cells showed a consistent level of expression between the GFP WT PH Domain and GFP E17K PH Domain However the level of the PCC agent retained by the cells was substantially different Figure 3 18 Nearly all of the cells expressing th
33. mAbs are made by injecting a small portion of the protein of interest containing the mutation the epitope into an animal and screening for an immune response that has the desired selectivity 9 This approach can yield an antibody that exhibits focused binding to the specific designated area of the protein surface An all chemical strategy for targeting PCC agent development against epitopes near phosphorylates sites was developed recently For that approach an approximately 30 amino fragment representing the phosphorylated epitope of interest was synthesized and a metalloorganic Zn chelator was utilized to bind to the phosphate group and present an azide near that site That epitope was then screened against a large 1 million element one bead one compound OBOC library of 5 mer alkyne presenting peptides Hits were defined as those compounds that bound to the synthesized epitope and that were coupled to that epitope through a triazole linkage PCC Agents with high selectivity for the epitope and the full protein and with affinities as low as 19nM were developed The bulk of my thesis work focuses on the generalization of the epitope targeting strategy by directly substituting an alkyne click handle into the chemically synthesized peptide epitope around the E17K residue of Akt1 of interest Chapter 3 describes how this technique was used to develop a 5 mer PCC agent selective for the E17K mutant Akt1 protein This PCC agent was able to be
34. one hour The beads were then washed three times with a high salt TBS then incubated on the shaking arm for one hour with the high salt buffer They were then washed three times with BCIP buffer and developed as previously Hit beads turned purple and were removed and washed in NMP for four hours to decolorize then guanidine HCl to denature and remove and remaining protein Anti protein gt dell I nd Protein Protein Target Target Protein Target Anti Mouse IgG Figure 2 3 Typical Antibody Detected Target Screen The library is incubated with the protein target which is detected via antibodies conjugated to alkaline phosphatase The screen is developed with BCIP NBT and hit beads turn purple 2 2 8 Typical Screening Protocol for a Preclear Swelled library beads 250 500mg were blocked overnight in 5 w v dried non fat milk in 1x TBS then washed with 1x TBS three times The beads were incubated with a uM solution of any anchor peptide or small molecule for one hour then washed 3x with 1xTBS Five milliliters of either a 1 10 000 dilution of streptavidin alkaline phosphatase conjugate in 0 5 milk in TBS or an anti biotin antibody were added to the beads and incubated with shaking at room temperature for one hour If the anti biotin antibody was used a secondary antibody conjugated to alkaline 34 phosphatase was then incubated with the library for 1 hour after it was washed three times in 1xTBS The beads w
35. or mutant PH Domain 61 3 27 Point ELISAs with Anchor Ligand and 33 mer Epitope Epitope Targeting Verification The 33 mer epitope used in screening was resynthesized without the alkyne click handle and with a 6 His tag as an orthogonal tag to the biotin on the anchor ligand This tag was added after a PEGs on the N terminus of the peptide and was made and purified as was previously described The mutant fragment had an expected m z of 5160 72 observed MALDI TOF MS m z for M H of 5161 61 The WT fragment has an expected m z of 5161 72 and an observed MALDI TOF MS for M H of 5162 78 Q For these assays 100nM Biotin HN Z HO RCM PEG yleatPra Figure 33 was P Mos ut e Ta immobilized for one hour on a Neutravidin coated ELISA plate Figure 3 3 Biotin PEG yleaf Pra Anchor ligand As analyzed by MALDI TOF MS expected m z 1298 62 observed M Na 1319 89 Pierce The plate was blocked in 5 BSA in 1xTBS for one hour then again overnight at room temperature The immobilized anchor was then incubated with either 14M or 100nM wildtype 33 mer epitope or 14M or 100nM E17K mutant 33 mer epitope for one hour The plate was washed three times with 1xTBS 0 196 Tween 20 and tapped dry The epitope was then detected by a 1 1 000 dilution of an anti his mouse mAb ab18184 Abcam for one hour washed as above and then detected with 1 10 000 dilution of an anti mouse HRP conjugate
36. probing the library for beads that bind to the target the library can be searched additionally for the presence of the in situ click product a completely complementary screen Once an anchor ligand has been discovered the next step in the in situ screening process Figure 2 1 involves the clicking of a new peptide ligand onto this anchor ligand In order to accomplish this the anchor peptide is appended with a click handle and pre incubated with the target protein and then both are incubated with the OBOC library This step searches for a library peptide that binds in close proximity to the anchor peptide on the surface of the protein target and will click onto the anchor if held in position long enough This click reaction covalently attaches the anchor peptide onto the library bead By first appending the anchor peptide with a biotin tag the presence of the anchor peptide on bead or the ability of this library candidate to click to the anchor can be probed independently of the presence of the target on bead These screens involve harsh denaturing wash steps that ensure that everything not covalently attached 44 to the library will be removed and not detected by either the streptavidin conjugated to alkaline phosphatase or an anti biotin antibody These detection agents will bind to the biotin label on the anchor that will only be present after a covalent reaction has occurred and can therefore detect which library members
37. prompted the consideration of further developing this PCC Agent into a compound capable of blocking the E17K PH Domain interaction with its PIP3 substrate The yleaf anchor peptide itself did not exhibit evidence of inhibition Figure 4 11 It was reasoned that a similarly targeted but bulkier PCC Agent might serve as a steric blocker of the PH Domain PIP3 interaction To this end two cycles of iterative in situ click chemistry screens as described in Chapter 2 were executed in order to develop the yleaf ligand into a biligand and then a triligand which was capable of successfully blocking this binding interaction This showed that these larger PCC Agents could serve as highly selective inhibitors of E17K Akt1 by blocking binding of the Pleckstrin Homology Domain of Akt1 to the PIP3 substrate 4 2 Materials and Methods 4 2 1 Screen for Biligand Peptide The anchor determined above yleaf was scaled up with a biotin on the N terminus for detection a PEGs linker between the biotin and the peptide and a d propargylglycine Pra on the C terminus as the in situ click handle Biotin PEGs yleaf Pra Screens were performed using a library with 10096 Met coupled at the C terminus for potential MALDI TOF TOF sequencing The library consisted of a comprehensive 5 mer containing 18 unnatural D amino acids excluding Met and Cys due to stability reasons The N terminus of the library was appended with an azide click handle with a 4 carbon cha
38. screening procedures including phage titering scaling up and sequencing as well as preparation of materials such as buffers PEG NaCI solution and top agar adopted from the NEB Ph D Phage Display Library System manual for M13KE unless otherwise noted The library from Antibody Design Labs was produced in a naturally suppressing strain of E coli TG1 that inserts Glu or E at the site of amber codon This library cannot be used for click screening as there is no azide amino acid but can be used for target screening to find peptide 116 sequences that bind to the G6PD epitope The target screening must be completed first also because approximately 3596 of this phage pool contains no insert or naked phages Naked phages have a significant selection advantage over those that would require the amber suppression The target screen is designed therefore to enrich for phage containing the library insert and remove the naked phage from the phage pool before incorporation of azidophenylalanine is performed The TentaGel beads containing the target and scrambled epitopes are stored in the form of 50 v v slurry in 1 1 ethanol water solution One hundred pL each slurry of the target and scrambled epitopes were washed with 1 mL Tris buffered saline TBS 25mM Tris HCl 150mM NaCl 10mM MgCl with 0 1 96 Tween 20 TBST then blocked with 1mL of 5 w v bovine serum albumin BSA in TBS for one hour at room temperature An antiscreen was perf
39. sequence The 13 insert containing plaques were then sequenced to ensure that each one contained an insert As can be seen in Table 5 4 only 11 of the 13 hits contained one clean sequence The rest appeared to have multiple sequences and may have had some naked phage contamination and were thus eliminated from our pool of potential hits Therefore out of this target screen 11 of the amplified stocks that contained inserts Table 5 4 were pooled to create a focused library of phage that are known to bind to the target This focused library has the added advantage of containing no naked phage so it is the ideal library to be used to test the conditions for the azidophenylalanine incorporation It will also be used for the subsequent focused library click screen with the target to test the in situ click on a phage library 123 Table 5 4 Hits from 13 Insert Containing Phages Figure 5 13 m mI IH 1 D EREGEREREBEBESEREN Pe Panter Ps fe De Po m orema masaesae Dm pem s Te ESTEE T ERECGERISEREREBEREN Po omer fw fof whe wf Po fame fT eps fa lwp p pee fe fv Ee 1e ele le Pre orce rapes o ee E CC p pee DT DES Le faa 5 4 Conclusions The difficulties associated with the original library itself have delayed the testing of the described technology though a roundabout solution to that problem has been discovered The focused library is currently undergoing testing as the proof of concept for the click phage screening Futur
40. standard assays measure a deficiency by performing enzymatic tests on blood samples measuring the amount of converted NADPH per unit of blood Unfortunately patients who have recently undergone a hemolytic event causing a mass death of old red blood cells show a false normal test This is due to the higher than normal prevalence of young red blood cells which express a higher G6PD copy number than mature red blood cells compensating for the reduced activity of the enzyme caused by the mutation The goal of this project is to develop a capture agent that universally detects G6PD in all of the possible mutant forms in order to capture the protein to a chip where the concentration and the activity of the G6PD in the blood can be measured simultaneously Such a diagnostic test can normalize the G6PD activity to protein copy number as opposed to activity per unit of blood resulting in much fewer false positives and faster treatment of malaria This combination test 106 should help reduce the number of false normal blood test results allowing for significant progress toward the eradication of malaria 52 Materials and Methods 521 Preparation of Plasmid for Incorporation of Azidophenylalanine and Amp Resistant Gene The plasmid pAC DHPheRS 6TRN Figure 5 3 containing the coding sequences for Methanococcus jannaschii amber suppressor tRNATyr MjtRNA and the mutant M jannaschii tyrosyl tRNA synthetase MjTyrRS was a gift from Dr Zhiwen
41. to grow for 5 hours centrifuged at 4500 rpm to remove the cells and the top 8096 of the supernatant was collected and precipitated with 1 6 volume of PEG NaCI overnight at 4 C The mixture containing the precipitated phage was centrifuged at 14 000 rpm for 15 minutes The pellet was dissolved in 200 uL TBS and spun down again at 14 000 rpm to remove cellular debris The total number of recovered phages was Azss Az23 6x10 estimated before titering by measuring the absorbance at nd wWirions m number of bases virion Figure 5 9 Formula for Estimation of Phage Concentration and using the formula in Figure 5 9 from the Antibody 269 nm and 320 nm with a NanoDrop spectrophotometer Design Laboratories website where the vector size was set to 7200bp for M13KE 119 5 2 9 Optimized Phage Library Click Screening Conditions The click phage screens were performed on the library containing the azidophenylalanine after the incorporation step These screens were performed exactly as the target screen except that the phage library was incubated with the target on resin overnight at room temperature to allow sufficient time for the click reaction to occur A diagram of this screen is seen in Figure 5 10 a oe om PME Ub eec Library re serine iabomd unbound 1 e m edade meakai from beads p Precleared Phage Library Scrambled off target epitope on bead p as situ Boss E Acid Acd strip
42. tryptic fragment was located This provided four potential fragment candidates that were all located near the 33 mer 64 epitope in the PH domain of the protein Next every MALDI peak in the labeled sample was analyzed by subtracting the weight of the dye label and comparing it to a potential tryptic fragment One other fragment was identified using this method and corresponded to the doubly labeled peak of one of the previously identified labeled fragments These results confirmed multiple previous experiments done using LC MS techniques that proved not strong enough to fragment the tryptic peptides into individual amino acids These tryptic peptide samples were then analyzed by MALDI TOF TOF MS to identify the exact amino acid that contained the dye label Only YFLLK was able to be successfully fragmented and the TOF TOF confirmed that the tyrosine was the label containing amino acid This confirms the results seen in the original publication that only Y H and E nucleophilic amino acids are labeled using this technique The remaining tryptic fragments all contain at least one of these amino acids with the doubly labeled fragment containing two The labeling sites were then plotted onto a Pymol image that combined the Akt1 protein PDB ID 3096 and the E17K PH Domain PDB ID 2UZR with the N terminal GST tag PDB ID 1UA5 that was present on the full length protein from SignalChem that was used in these labeling assays This Pymol made f
43. used as a drop in antibody replacement for the detection of this single amino acid mutation in various assays It was also possible to render this agent cell membrane permeable and this allowed it to be used as a focused imaging agent in live cell experiments Chapter 4 describes the expansion of this PCC agent into a biligand and then a triligand through the use of iterative in situ click chemistry in order to make a bulkier PCC agent The final triligand PCC agent is capable of blocking the binding of the mutant protein to its substrate at the cell membrane 21 rendering it inactive and demonstrating the ability of these PCC agents to serve as targeted therapeutics LN In Situ Click Screening Using Azide Containing Phage Display Libraries Peptide screening technology has expanded incredibly in the past ten years since the inception of the PCC agent project Using the protein catalyzed click screens described above PCC agents have been developed against only small chunks or epitopes of proteins and various PCC agents that have shown to be unique inhibitors and activators of Akt kinase 5 molecular imaging agents detection agents for anthrax suitable as third world detection agents for HIVP as well as the single amino acid point mutation specific E17K agents The OBCC libraries have their drawbacks however The physical size of the library limits the number of total sequences that can be screened A full library usually contai
44. was considered a hit dye labeled fragment and colored blue in the table There were no more new peaks seen using this method than were discovered by looking for peaks that grew in from the unlabeled MALDI to the labeled MALDI The labeled sites seen in this MALDI TOF experiment were all seen previously in at least 2 LC ESI MS experiments attempting to identify the labeled region Table 3 1 Excel Table of Tryptic Fragment Analysis MALDI Peak Peak Corresponding Peak dye Expected Digest Area P M 1 Fragment 1053 15 500 78 1051 6349 499 265 4296 69 1 5151 1090 15 537 78 1114 6007 562 2307 5813 86 24 4507 1118 11 565 74 1114 6007 562 2307 12649 91 3 5093 1142 16 589 79 1132 6993 580 329 4217 63 9 4607 1179 14 626 77 1173 6565 621 287 4393 2 5 4835 1194 14 641 77 1201 732 649 362 5139 51 7 592 1202 16 649 79 1201 732 649 362 4103 69 0 428 1234 66 682 29 1234 7826 682 4126 8193 47 0 1226 YFLLK 1300 08 747 71 1303 7273 751 3573 6445 8 3 6473 1302 09 749 72 1303 7273 751 357 4496 81 1 6373 1308 09 755 72 1303 7525 751 3825 5926 62 4 3375 1320 57 768 2 1320 7691 768 3991 7886 31 0 1991 EGWLHK 1440 11 887 74 1447 8246 895 4546 6406 74 7 7146 1475 16 922 79 1477 9158 925 5458 10131 17 2 7558 1493 13 940 76 1477 9158 925 5458 9276 21 15
45. 0x excess of the appropriate biotinylated ligand to streptavidin binding sites in 200 uL 1x TBS or plain buffer for the blank Ligand binding was done for one hour at room temperature and then resin was washed three times with 1x TBS Resin was blocked with 1x TBS with 596 BSA for two hours The anchor coated resin was then incubated with either wildtype or mutant expressed PH domain protein overnight 16 hours in cold room 4 C Protein was spun out of tubes and the resin was washed three times with high salt TBS then incubated for five minutes in the high salt buffer The resin was then washed three times with the 1x TBS buffer and spun out to dry completely Fifty uL of denaturing SDS gel loading buffer with 1096 B mercaptoethanol was added to the sample s and they were incubated at 95 C for ten minutes to denature from the resin The gel loading buffer was spun out of the Spin X tubes and the samples were run on an Any KD BioRad Premade Gel under denaturing conditions Gel was transferred to nitrocellulose membrane blocked for one hour in 596 milk 4 C and western blotted Proteins were detected using rabbit polyclonal anti Akt1 antibody ab64148 Abcam and an anti rabbit HRP conjugated secondary anti body Cell Signaling then developed with West Pico Chemilluminescent substrate Pierce Relative protein band sizes were analyzed to compare binding between the anchor candidates and were used to determine selectivity for either wildtype
46. 7K fragment over the WT across a 100 nM 1 uM concentration range Figure 3 11 further demonstrating the binding of this ligand to the specific epitope of interest and providing additional validation of the epitope targeting strategy Hi WT epitope B E17K epitope Fraction Bound 1 M 100 nM Figure 3 11 ELISA Assay Verification of Epitope Targeting The WT and E17K 33 mer fragments were incubated with the yleaf anchor immobilized on an ELISA plate preference for the E17K fragment is demonstrated Strong 3 3 4 Ligand Selectivity Protein is labeled Figure 3 12 Ligand Directed Labeling Diagram modified from Tsukiji et al9 The anchor red with the Cy5 dye pink attached through an electrophilic tosyl group The reaction with nucleophilic side chains on the protein can indicate where the ligand is binding These sites can be confirmed through trypsin digestion and MS 76 Ligand Directed Labeling Experiment to Confirm Epitope Targeting and The selectivity of the yleaf anchor ligand was further verified using the directed labeling technique reported by Tsukiji et af The approach yields information relative to the binding location of the ligand on the protein target For this method a payload is attached to the N terminus of the targeting yleaf ligand through an electrophilic tosylate linker Upon ligand binding to the protein target the payload is transferred onto the protein through a nucleo
47. ATG CTT AAT CAG TGA GGC ACC TAT CTC AGC G Based on the previous work by Tian et al nine point mutations were introduced into the mutant MjTyrRS gene to change its substrate specificity from DOPA to azidophenylalanine E25K L32T S67A N70H E107N D158P 1159L L162Q and Q167A All mutagenesis reactions were carried out using QuikChange Kit Stratagene according to the manufacturer s instructions Table 5 2 lists the primers used in the order of performed reaction Each QuikChange reaction was independently verified for the correct sequence and the final plasmid was completely sequenced to ensure correctness The resulting final plasmid was named pAC AzPherS 6TRN 108 Psti 3968 bp EcoRI 3365 bp Ndel 3044 bp pAC DHPheRS 6TRN 5760 bp EcoRI 2 bp NgoMIV 2779 bp NgoMIV 2425 bp NgoMIV 2265 bp Nhel 584 bp Sall 2147 bp Sphi 20S8 bp Sacll 833 bp NgoMIV 1897 bp Xbal 1426 bp BamHI 1871 bp Re bp Nhel 1725 bp Figure 5 3 pAC DHPheRS 6TRN Plasmid Plasmid for the incorporation of Azidophenylalanine Red boxes are the six copies of the M jannaschii tRNATyrCUA Green indicates the synthetase Blue is the Amp resistant gene and the pink is the Chloramphenicol resistant marker containing an amber codon used to indicate successful incorporation 109 Table 5 2 Primers used for the DOPA Azidophenylalanine Synthetase QuikChange Reactions The number in the primer name indicates the order
48. Cleanup Electrical Procedures Available Do not pause on error Event Log Cart Input Blk Test Cart Reagent Blk Test Bottle Change Cartridge Leak Test Procedure r Status Cartridge B Leak Test Cartridge C Leak Test Name Pres amp Temp Cartridae N eak Test Remaining Start Test Stop Test Step of J Function Number Manual Control Test Procedure Sequencer Status Sequence Methods Name Total Time Cycles amp Procedi Remaining Gradients Pun Pause Hold Jump Step Sequencer Status Idle WIPFEFPFEPF B CONNECTED Non Secure Mode Figure A 5 Leak Test Procise Software Screen A 2 7 Pressure Errors Clogged Lines Overpressure errors on the Edman can sometimes be related to a clogged line Use the error message to try to find the line that might be clogged The line can either be replaced by new line from stocks in the spare parts drawers or flushed clear with methanol
49. Cocktail of Thermally Stable Chemically Synthesized Capture Agents for the Efficient Detection of Anti Gp41 Antibodies from Human Sera PLoS ONE 2013 8 10 e76224 4 Stenman U H Leinonen J Zhang W M Finne P Prostate specific antigen Seminars in Cancer Biology 1999 9 2 83 93 5 Coin l Beyermann M Bienert M Solid phase peptide synthesis from standard procedures to the synthesis of difficult sequences Nature protocols 2007 2 12 3247 56 6 Nag A Das S Yu M B Deyle K M Millward S W Heath J R A Chemical Epitope Targeting Strategy for Protein Capture Agents The Serine 474 Epitope of the Kinase Akt2 Angewandte Chemie International Edition 2013 52 52 13975 13979 7 Procise Protein Sequencing System http tools lifetechnologies com content sfs manuals cms 041125 pdf accessed May 1 8 Lee S S Lim J Tan S Cha J Yeo S Y Agnew H D Heath J R Accurate MALDI TOF TOF sequencing of one bead one compound peptide libraries with application to the identification of multiligand protein affinity agents using in situ click chemistry screening Anal Chem 2010 82 2 672 9 9 Sobek D J Aquino C Schlapbach D R Analyzing the Properties of Fluorescent Dyes Used for Labeling DNA in Microarray Experiments In BioFiles Simga Aldrich Online 2011 Vol 6 3 10 Millward S W Henning R K Kwong G A Pitram S Agnew H D Deyle K M Nag A Hein J L
50. DNA sequencing DNA sequencing is currently an expensive and time consuming route to take for mutation screening especially as most patients need to be screened for mutations before the proper course of their treatment is even decided Antibodies can provide a faster route for mutation detection and treatment monitoring as there are methods currently in place for their use as rapid point of care diagnostics These diagnostic tests also provide information about the levels of protein expression in a body something that cannot be tested through sequencing which can be used to monitor the response level of a patient to a certain treatment potentially detecting ineffective 19 medications immediately after they are given In a diagnostic setting such binders can be used to assay for the mutant protein within diseased tissues and thus potentially provide clinical guidance for treatment decisions A more ambitious application is the development of drugs that can selectively inhibit mutant proteins and thus avoid those toxic side effects that stem from the inhibition of the wild type WT variants that reside in non diseased tissues Patients on therapies targeted very specifically to the mutations characteristic of their disease could show significant improvements without the toxic side effects that stem from of the inhibition of the healthy wild type versions of these proteins A relevant example is compound CO 1686 which is an a epiderm
51. Development of Protein Catalyzed Capture PCC Agents with Application to the Specific Targeting of the E17K Point Mutation of Akt1 Thesis By Kaycie Marie Deyle In Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy California Institute of Technology Pasadena CA 2014 Defended May 19 2014 2014 Kaycie Marie Deyle All Rights Reserved There is no passion to be found playing small in settling for a life that is less than the one you are capable of living Nelson Mandela To give anything less than your best is to sacrifice the gift Steve Prefontaine Abstract This thesis describes the expansion and improvement of the iterative in situ click chemistry OBOC peptide library screening technology Previous work provided a proof of concept demonstration that this technique was advantageous for the production of protein catalyzed capture PCC agents that could be used as drop in replacements for antibodies in a variety of applications Chapter 2 describes the technology development that was undertaken to optimize this screening process and make it readily available for a wide variety of targets This optimization is what has allowed for the explosive growth of the PCC agent project over the past few years These technology improvements were applied to the discovery of PCC agents specific for single amino acid point mutations in proteins which have many applications in cancer detectio
52. GDAFGQSDT and was synthesized on TentaGel resin using D amino acids in order to use the mirror image phage display technique to produce a D amino acid peptide to bind to the L G6PD protein The synthetic target epitope was appended with propargylglycine Pra residue at the N terminus providing an alkyne click handle A scrambled epitope also made of D amino acids Pra GDAHSFQDTLOF was synthesized on TentaGel as well to be used in a preclear antiscreen step for the library The target and scrambled target on TentaGel resin will allow the phage library to click onto the permanently immobilized target so that very harsh washing conditions can be used to remove all but the covalently bound phages These peptide sequences were tested for their correctness and purity via Edman degradation sequencing MAEQVALSRTQVCGILREELFQGDAFHQSDTH Figure 5 7 Amino Acid Sequence of Exons 1 and 2 of G6PD The amino acids highlighted in red indicate frequently mutated positions and the residues in black are generally conserved 115 Figure 5 8 Crystal Structure of G6PD 1QKI This mutant G6PD in complex with NADP indicates that the unstructured regions encoded by exons 2 and 3 bottom right in red not entirely present in structure are far from the active site of the protein Capturing the protein at this location should not affect enzyme activity 5 2 6 Optimized Phage Library Target Screening Conditions General protocols for phage library
53. Green L G Grynszpan F Radi Z Carlier P R Taylor P Finn M G Sharpless K B Click Chemistry In Situ Acetylcholinesterase as a Reaction Vessel for the Selective Assembly of a Femtomolar Inhibitor from an Array of Building Blocks Angewandte Chemie International Edition 2002 41 6 1053 1057 12 Millward S W Henning R K Kwong G A Pitram S Agnew H D Deyle K M Nag A Hein J Lee S S Lim J Pfeilsticker J A Sharpless K B Heath J R Iterative in situ click chemistry assembles a branched capture agent and allosteric inhibitor for Akt1 Journal of the American Chemical Society 2011 133 45 18280 8 13 Pfeilsticker J A Umeda A Farrow B Hsueh C L Deyle K M Kim J T Lai B T Heath J R A Cocktail of Thermally Stable Chemically Synthesized Capture Agents for the Efficient Detection of Anti Gp41 Antibodies from Human Sera PLoS ONE 2013 8 10 e76224 14 Farrow B Hong S A Romero E C Lai B Coppock M B Deyle K M Finch A S Stratis Cullum D N Agnew H D Yang S Heath J R A Chemically Synthesized Capture Agent Enables the Selective Sensitive and Robust Electrochemical Detection of Anthrax Protective Antigen ACS Nano 2013 7 10 9452 9460 15 Nag A Das S Yu M B Deyle K M Millward S W Heath J R A Chemical Epitope Targeting Strategy for Protein Capture Agents The Serine 474 Epitope of the Kinase Akt2 An
54. Immunoprecipitation Pull down Assays for Binding Affinity 59 3 2 7 Point ELISAs with Anchor Ligand and 33 mer Epitope Epitope Targeting Vetification s tie etate teet beta e ee ite viet as eh Pavan eh Aas 61 3 2 8 HPLC Detected Immunoprecipitation Pull down Assays Epitope Targeting delent EE ME 62 3 2 9 Ligand Directed Tosyl Labeling Experiments ccccsessssecececessesenteceeeeseessessaaeens 62 3 2 10 Details of the MALDI TOF Analysis of Tryptic Peptide Fragments 64 3 2 11 Images of Anchor Ligand in HEK 293T Cells Expressing PH Domains 67 3 3 Results and Discussion teret Dr ette tere rete e reete ere pene een 69 3 3 1 In situ Click Epitope Targeted Screening Strategy for E17K PH Domain Specific Ligand 69 3 3 2 CD Spectroscopy of 33 mer Target Peptide Epitope cccssssccccecesessssteeeeeeeees 72 3 3 3 Verification of the Epitope Targeting Strategy ccccsccccccecessesssseceeeeseessesnaees 73 3 3 4 Ligand Directed Labeling Experiment to Confirm Epitope Targeting and Ligand SelectiVIt yt aM et ele eter ot rud t AM las WOM mus SUM am 76 3 3 5 In Cell Imaging nn RERO Re ER ERDI Pee one 79 3 4 Geo EA S TRENT T che IR 81 3 5 Acknowledgenients ci eet e aeter eed RE E De auae 81 3 6 Mu T 82 Chapter 4 iR eee ede ed ee ee 83 4 1 WAEFO DUCTION EC 84 4 2 Materials and Methods ccsessceesseceesceeeeceesesneecsaeceeaa
55. L BCIP 13 uL NBT This detection cocktail was mixed with the library beads which were poured into a large polystyrene dish for visualization of the color change under an optical microscope Hit library members appear as dark purple among the normally clear beads Figure 2 6 and are removed using a pipet They are washed stripped and sequenced as above 32 2 2 6 Typical Screening Protocol for an Anti Screen The library beads typically 250 500mg swelled in 1xTBS were blocked 2 hours to overnight in 596 milk in 1XTBS washed three times with 1x TBS then incubated with an off target protein in 0 596 milk in 1xTBS for one hour on the shaking arm at room temperature The beads were washed three times with 1x TBS then incubated with the anti off target protein alkaline phosphatase conjugated antibody in 0 596 milk for one hour at room temperature The antibody used here must be the same antibody used in the target screen in order to ensure that the library members that bind to this antibody are removed and not mistaken for hits The library resin was then washed three times with high salt buffer and let shake for one hour in high salt at room temperature before being washed three times with BCIP buffer 100mM Tris Cl 150mM NaCl 1mM MgCl pH 9 0 and developed by adding 15mL BCIP buffer plus 13uL BCIP and 26uL NBT The beads that turned purple bound to both mutant and wildtype protein or to the detection antibodies and were discarded The b
56. MS experiments that were conducted with a biotin and not Cy5 labeling arm which therefore have a different labeled mass that this is a site that can be labeled In attempting to zoom in for the monoisotopic mass we see a broad peak with no clearly identifiable mass peak unlike all of the other peaks in the spectrum which showed the distribution of masses very clearly This led us to believe that we are in fact seeing this peak labeled in the MALDI especially since this site was seen as labeled by the ESI and that the MALDI spectra is showing an overlap of the trypsin peak with the labeled fragment The ESI labeling experiments were done using the biotin labeling arm so this mass did not overlap with trypsin in these experiments which confirms this We just cannot exactly call this mass in the MALDI due to the similarity of this peak to that of trypsin 3 2 11 Images of Anchor Ligand in HEK 293T Cells Expressing PH Domains a Kus Hal Hal T X 3 P o Figure 3 5 yleaf PEG TAT Cy5 The yleaf anchor ligand red was appended with a TAT cell penetrating peptide blue and a Cy5 dye pink separated by a PEG5 linker black MALDI TOF MS expected m z 2937 72 observed m z 2937 83 These experiments were designed to visualize the dye labeled anchor ligand in cells overlapping with the GFP labeled PH Domain proteins For this reason the yleaf anchor ligand was synthesized with an N terminal PEGs TAT YGRKKRRQR
57. R and Cy5 dye Figure 3 5 GFP 68 tagged protein DNA was also cloned as described above HEK 293T cells were grown in DMEM media supplemented with 1096 FBS both Invitrogen 100x non essential amino acid solution Sigma and PenStrep antibiotic Invitrogen Once the cells reached 80 confluency they were treated with trypsin to remove from the plate and split into a 12 well flat bottom cell culture plate with a D poly lysine BD coverslip at approximately a 5096 confluency in 1mL total volume The cells were allowed to attach to the coverslips for approximately 24 hours then were transfected to express either wildtype GFP PH domain or E17K mutant GFP PH domain proteins using XtremeGene HD transfection agent at a ratio of 3 1 transfection agent to DNA Several wells were left untreated as no protein blanks The cells were given 24 hours to express protein They were then serum starved for one hour in DMEM media prepared as above but without the FBS After one hour the Cy5 labeled anchor was added to the wells to a final concentration of 50nM As the HEK 293T cells express endogenous Akt1 protein this level was adjusted to give the lowest background signal possible The protein blank cells were also incubated with 50nM of the yleaf anchor to ensure that binding was due to the presence of the E17K mutant protein A blank of PEGs TAT Cy5 was also added to wells expressing either wildtype or E17K mutant to ensure that ligand binding was due to th
58. WR PR EE surround the anticipated binding site of the NDGTFIGYKIERIPQDVDQR EAPLNNFSVAQCQLMK TER PRIPNTFIIRICLOWTTVIERITFHVETPEER yleaf ligand A thorough search of the entire EEWTTAIDTVADGERIKIGEEEEMDFR SGE PRIGSAG MALDI spectra was conducted to identify Figure 3 16 Trypsin Digested Sequence of PH Domain Protein The red dashed lines show where the trypsin cuts are located The fragments highlighted in red are the ones that showed labels and the amino acids colored in cyan are the ones containing the labels the large protein but none were found any other labeled fragments anywhere on Thus this labeling experiment demonstrates that only sites around the expected N terminal binding site of the yleaf ligand are labeled confirming the very specific binding of the peptide ligand at the site directed by the epitope targeted in situ click screening process 79 Figure 3 17 Compiled Crystal Structure of Fully Labeled Protein The cyan amino acids labeled in cyan are all clustered immediately around the pink 33 mer fragment of the blue PH Domain No labeled sites were found in any other part of the large fusion protein 3 3 5 In Cell Imaging Live cell based assays can provide a demanding environment for demonstrating the selectivity of the yleaf PCC agent to the E17K Akt1 In addition they also can demonstrate the value of a small epitope targeted ligand relative to a similarly targeted antibody since antibodies cannot enter
59. Zhang at Santa Clara University This plasmid was originally designed for the site specific incorporation of 3 4 dihydroxy L phenylalanine DOPA its mutant MjtRNA recognizes TAG as a codon and the mutant MjTryRS recognizes DOPA as a substrate It also harbors a tetracycline resistance selection marker Since the host E coli strains used for the phage production and in subsequent studies carry a Tet marker in their F episomes the Tet gene in this plasmid was first replaced with a beta lactamase Amp gene for ampicillin selection to be compatible with the antibiotic resistance of the host Nine point mutations based on the description by Tian et al were then introduced into the MjTyrRS synthetase so that the resultant synthetase recognizes the azidophenylalanine amino acid instead of the DOPA To perform the Tet gt Amp switch the Amp gene was amplified from a pET 3a plasmid by polymerase chain reaction PCR using the primers shown in Table 5 1 The PCR product and the original Tet containing suppression plasmid were digested with Hindlll and Eagl and ligated to produce slow growing colonies on an LB agar plate supplemented with 100 Ug mL ampicillin Final clones were confirmed by DNA sequencing Laragen 107 Table 5 1 Primers for AmpR Switch Primer Sequence Hind bla 5 GCG AAG CTT TAA TGC GGT AGT TTA TCA CAG TTA AAT TGC TAA CGC AGT CAG GCA CCG TGT ATG AGT ATT CAA CAT TTC CGT GTC GCC C Eag bla 3 ATA CGG CCG TTA CCA
60. able 2 2 but also introduced a hidden source of noise into the screens The presence of several different antibodies and a new detection agent in the screen itself provided more off target sources of library binding This was conclusively demonstrated by Steve Millward while screening for an Akt capture agent He developed a biligand using the standard in situ click chemistry technique with antibody development and proceeded to test the affinity of this ligand via SPR The SPR was set up to immobilize an anti FLAG antibody the same used in screening to the flow cell in order to capture the much less stable Akt protein that might 41 not survive the required EDC NHS coupling step A blank flow cell of only Anti FLAG antibody without Akt was used as a chip blank The data from these SPRs is seen in Figure 2 7 The sensorgram on the right shows binding to the Akt as to be expected but the sensorgram from the blank flow cell on the left shows an identical signal In conjunction with data not shown from the anchor ligand that has almost no binding to the anti FLAG flow cell we can conclude that the biligand is actually binding to the anti FLAG antibody present in both of those flow cells and not to the desired Akt target protein It is only logical that we would see hits of peptide sequences that bind to these antibodies because the presence of the detection antibody bound to a library bead would show BCIP precipitation exactly like th
61. absence of the small satellite parent mass corresponding to the same sequence plus glycine or alanine In order to sequence the library hit by MALDI TOF TOF the bead is first treated with cyanogen bromide in order to cleave the peptide from the bead at the methionine amino acid It can then be dissolved in MALDI matrix and spotted onto the plate The peptide parent peak is first discovered using MALDI TOF then is fragmented again in order to break it up into smaller amino acid ions These ions can be analyzed using standard peptide MS techniques to determine the sequence 36 2 3 Results and Discussion 2 31 Screening via Fluorescent Dye labeled Protein Target Detection The initial OBOC peptide screening strategies developed by Heather Agnew relied on a fluorescent dye labeled protein in order to detect hit binding The target protein of interest was labeled with a dye and any library beads that bound to the target were detected on a GenePix microarray reader As seen in Figure 2 4 the TentaGel library beads also auto fluoresce meaning that all screens conducted in this fashion were highly subjective and the hit quantity depended entirely on the gain settings of the microarray AlexaFluor 647 was also the only dye that was used as the beads auto fluoresce Figure 2 4 Image of Hit Beads on GenePix the least in the range of this dye These hits were mostly Microarray Scanner The bright white beads are saturating the fluorescen
62. acteristic of cationic peptide labels t The labeled digest YFLLK could be fragmented and indicated the presence of the dye on the Y amino acid Figure 3 15 This is consistent with the original literature on the labeling technique which showed that Y E and H amino acids are the nucleophiles that can be labeled The other labeled Akt1 fragments that were identified contain at least one of these amino acids One fragment contains two such amino acids and in fact there were MALDI peaks corresponding to the masses of both the singly and doubly 78 labeled fragments Figure 3 16 shows the location of the labeled fragments in the PH Domain sequence as well as the amino acids that should contain the label Abs Int 1000 a _ Y Ks hs M F M wi 1235 704 863 840 y5 147 282 52 y1 1217 611 l b5 ye 1189 252 373 440 a5 Y 520 608 ait ye 1 400 600 800 1000 1200 1400 m z Figure 3 15 MALDI TOF TOF Cy5 Dye Labeled YFLLK Fragmentation The YFLLK Cy5 Labeled trypsin fragment analyzed by MALDI TOF TOF MS The fragments shown above demonstrate that the Cy5 dye is on the Y amino acid which corresponds to the results found by authors of the original technique The labeling sites were then mapped on a composite crystal structure of GST PDB ID 1UAS and Akt E17K Akt PDB ID 3096 E17K PDB ID 2UZR Figure 3 17 All labeled sites DIONE WES EKKIK T
63. agarose pull downs Inhibition was indicated by a decrease in the amount of PH Domain that was pulled down by the resin Expanded inhibition blots with either wildtype of E17K mutant protein were performed in a similar fashion Twelve tubes of 20uL of PIP3 agarose were washed three times with 1x TBS 2ug of either wildtype or mutant PHD GFP protein 234nM in 200uL 1xTBS were pre incubated for 30 minutes with differing concentrations of triligand 0 1eq 23 4nM 1eq 234nM 10eq 2 34uM 100eq 23 4uM and 1000eq 234uM The protein and triligand solutions were then incubated with the PIP3 resin for 2 hours at room temperature The resins were washed eluted and blotted as per all PH Domain western blots 94 2 3 Results and Discussion dT Biligand Development It was hypothesized that a similarly targeted but bulkier PCC Agent might serve as a steric blocker of the PHD PIP3 interaction To this end two cycles of iterative in situ click chemistry screens were designed to develop the yleaf ligand into a biligand and then a triligand To identify the biligand the first iterative cycle Figure 4 2 the yleaf ligand was modified to present an alkyne at the C terminus and a PEGs biotin group at the N terminus Figure 4 1 This modified ligand called an anchor ligand was then co incubated with an alkyne presenting OBOC library and the unmodified E17K PHD Successful hits are those in which the E17K PHD promotes the click coupling of the an
64. al growth factor receptor EGFR inhibitor specific for the T790M point mutation associated with certain non small cell lung carcinomas That drug which is currently in clinical trials is designed to minimize the toxicities such as skin rash that can appear when WT EGFR is targeted since WT EGFR is expressed throughout the healthy tissues in the body A challenge of drug targeting a single point mutation is that the mutation may not be directly associated with a binding pocket The presence of a binding pocket is traditionally required for small molecule inhibitor development as is serves as a thermodynamic sink that can attract binders This requirement does not hold for antibodies and in fact several examples of monoclonal antibodies directed against epitopes containing single amino acid mutations do exist However antibodies do not readily enter the living cells that can harbor the mutated proteins and so mutation selective antibodies are typically only used as diagnostic reagents for staining fixed cells or tissues Thus there is a need for an approach that can identify small molecules that can be generally targeted against epitopes containing single amino acid point mutations to allow for the rapid detection and assessment of tumor status and can also potentially be developed into cell 20 penetrant inhibitors Our approach is inspired by the technique for developing an epitope targeted monoclonal antibody mAb Such
65. an alkyne click handle on the most proximal side chain residue to the E17K mutation Following chromatographic purification and characterization via mass spectrometry HPLC and circular dichroism the modified epitope was ready for screening A single generation in situ click screen can yield ligands with a high selectivity for the Figure 3 6 Design of Screening Target Epitope PH Domain green with highlighted screening target epitope pink The epitope was designed to target Hits from such a screen Surround the E17K mutation shown in blue The amino acid in position 19 was substituted with a propargylglycine Pra alkyne containing amino acid yellow for focusing the site of the in situ click screen are those library elements that are covalently coupled to the synthetic epitope through a triazole linkage The in situ click reaction itself is low yielding but the biotin handle on the synthetic epitope permits enzymatic 70 amplification of those hit beads using a colorimetric streptavidin linked alkaline phosphatase assay The basic screening strategy is shown in Figure 3 2 Out of the 1 5 million library members that were screened against the alkyne containing 33 mer E17K PH Domain fragment only 21 beads 0 001496 showed the presence of the covalently coupled epitope These beads were sequenced using Edman degradation Table 3 2 Table 3 3 The hits were segregated based on their hydrophobicity and sequence homology
66. and 0 5mL DIEA for three times for 10 minutes each time then washed with NMP FMOC Propargylglycine Otbu Pra was clicked onto the Lys Ns on the 2 ligand by incubating 2 equivalents of the Pra amino acid with 2 equivalents of Cul and 2 equivalents of ascorbic acid with 1 equivalent of azide on the resin in 2096 piperidine NMP for 3 89 hours The resin was washed five times with 4 mL of a chelating solution consisting of 1g sodium diethyldithiocarbamate in 20mL NMP and 1mL DIEA The anchor was then built onto the 2 ligand on bead and an N terminal PEGs biotin tag were added Assays were performed exactly as for the anchor ligands except for two key differences The biligand assays were performed using 6ug of GST tagged PHD protein instead of the untagged PHD that was used in the anchor pull downs The pull downs were also conducted out of 196 serum in 1x TBS as opposed to just 1x TBS This is a much more demanding assay that tests not only the affinity but also the selectivity of the ligands because they need to be able to bind to their target protein in a very complex medium The performance of the biligand candidates in this challenging assay indicates that they have little off target interactions with a multitude of other proteins and would perform well in the condition in which they will need to be detecting these ligands in cells and out of cell lysates o i pes uet 8 5 M Figure 4 3 Lys N3 yleaf Tz yksy PEGs
67. and for helping to mold me into the person am today To my husband Casey who has been there for every day of this journey cheering me on through the best days while reminding me that there is more to life during the worst Major thanks for being a constant source of support and laughter and for ensuring that we were always well stocked with ice cream and wine Next must thank my advisor Jim Heath for his well timed guidance throughout the course of my six years in his lab greatly appreciate the ability to explore and learn on my own and at my own pace being roped in only when necessary Thank you for showing me that nothing in science is impossible if you can think about it the right way and for ensuring that we always had more than enough funding to do the best possible work To my committee Dennis Doughtery Doug Rees and John Bercaw greatly appreciate the guidance and direction that you have provided throughout the years Your insightful questions and candid advice have expanded my range as a scientist To my previous mentors Carl LeBlond and LeRoy Whinnery thank you for taking a raw student under your wings and vi turning her into a scientist and to Dr LeBlond thank you for instilling in me a love for organic chemistry and science in general To LeRoy your constant support throughout all of the years in which have known you has meant more to me than you will ever know must next thank my colleagues in and around t
68. and screen were analyzed by their hydrophobicity and sequence homology using principal component analysis Clusters circled in green indicate clustered regions and the cyan circles indicate the peptide that was selected and scaled up as a possible biligand sequence The potential biligand sequences that were tested are yleaf ywrl yleaf yksy yleaf rdyr and yleaf hyrw where yleaf is the anchor ligand and the indicates the location of the triazole linkage 96 Table 4 1 Hit Sequences from Biligand Screen NN poc go fi Lane Description Wildtype PHD Protein E17K Mutant PHD Protein 1 Positive Control 15 02 3 4 5 46 2 3 X amp g amp 7 Blank no ligand yleaf anchor yleaf hryw yleaf rdyr yleaf yksy yleaf ywrl Figure 4 6 Pull down Assay Results for Biligand Candidates Note that all of the biligand candidates improve upon the binding of the anchor ligand but yleaf yksy shows the greatest signal in binding the E17K protein and the lowest in binding the WT protein This biligand was chosen as the candidate biligand and carried on to triligand screening 97 4 3 2 Triligand Development Once a candidate biligand has been identified it is then similarly modified to form a new anchor ligand Figure 4 3 which is then similarly screened Figure 4 4 to identify a triligand There were only 3 hit sequences from this triligand screen and one sequence was not able to be called due to low signa
69. any of the peptides used in these experiments Blake Farrow graphed several of the images in GraphPad and fitted the curves 4 6 References 1 Chong C R Janne P A The quest to overcome resistance to EGFR targeted therapies in cancer Nat Med 2013 19 11 1389 1400 2 Mahadevan D Powis G Mash E A George B Gokhale V M Zhang S Shakalya K Du Cuny L Berggren M Ali M A Jana U Ihle N Moses S Franklin C Narayan S Shirahatti N Meuillet E J Discovery of a novel class of AKT pleckstrin homology domain inhibitors Molecular Cancer Therapeutics 2008 7 9 2621 2632 3 Hiromura M Okada F Obata T Auguin D Shibata T Roumestand C Noguchi M Inhibition of Akt kinase activity by a peptide spanning the betaA strand of the proto oncogene TCL1 The Journal of biological chemistry 2004 279 51 53407 18 102 Chapter 5 Extending OBOC in situ Click Chemistry into a Phage Display System Bacteriophage M13 n sc me Gar enm N3X3X X3X4Xs 103 SL Introduction 5 1 1 Azide Containing Phage Display Libraries Recent advances in chemical biology have made it possible to incorporate unnatural amino acids into recombinant proteins Schultz et al has shown that through the use of amber suppression azide containing amino acids can be incorporated at specific Figure 5 1 Azido phenyl locations into the plll coat protein on an M13 phage The goal
70. at appeared to be binding to the surface of the protein and not just to the dye Focused screens were also Position X used in order to hone in on target 6 binding peptide sequences The m focused libraries used in these screens m m i h w q a t were designed based on histograms of AB N gt o c o 3 o o Lu Amino Acid the amino acids that were seen at each Figure 2 5 Histogram of Position X2 in PSA Screens The hits from multiple PSA screens were pooled and analyzed This sample chart library position meaning X1 gt Xs as shows the frequency of an amino acid at position X2 in the library and is used to synthesize the focused library seen in Figure 2 2 after the removal of the dye label background sequences As can be seen in Figure 2 5 in this particular PSA screen there were only six amino acids that were seen at position 2 so only these six amino acids were built into the focused library at position 2 This reduction in total amino acids present in each position allowed for the synthesis of a much smaller library that could be oversampled in each screen to permit a more thorough sampling of the sequence space Only about 100mg of beads were usually screened but 100mg could frequently oversample the sequence space of a focused library compared to that of naive libraries where less than half of the space was sampled Due to this increase in sequence space sampling focused libraries were genera
71. bated with 92 the blocked plate for one hour washed three times with 1xTBST 0 5 BSA and tapped dry then detected with a 1 10 000 dilution of an HRP conjugated anti GST ab The plate was again washed three times with 1xTBST and tapped dry It was developed with a 1 1 solution of TMB substrate and development was stopped with 1M H2SO and read on a plate reader The curves were plotted by normalizing the signal by the blank wells and were fitted by a Hill function in GraphPad using a common saturation and slope Bmax 1 466 0 03 h 0 7383 0 025 4 2 5 Point ELISA Assays for Triligand Binding to Akt1 and Akt2 Wildtype and E17K Mutant Proteins These assays were conducted to test the binding of the triligand to the off target Akt2 wildtype and mutant proteins For this assay all samples were taken in triplicate for statistical purposes Triligand peptide was first immobilized onto Neutravidin ELISA plates Pierce for one hour A scrambled anchor peptide eflya was used as the no ligand blank as the GST proteins have significant background binding to a blank Neutravidin plate The plates were then blocked with 596 BSA overnight Protein was laid down on the plate at a concentration of 100nM for samples wells and the blank scrambled peptide wells GST protein alone Abcam was also incubated with the triligand and scrambled peptide as a control The proteins were incubated for one hour then washed three times with 1xTBST The prot
72. ble 2 4 demonstrated binding to the PSA protein in either ELISA assays or SPR even though the anchor ligand by itself was still able to bind indicating that all of the parts of the assays were working The secondary ligands themselves also did not show any binding to the PSA protein independent of the anchor ligand These ligand sequences from the click screen however were very homologous indicating that they were all binding in the same place which was somewhere they could click onto the anchor peptide It would be impossible to see that level of similarity in the hit sequences otherwise Unfortunately during the screening process the anchor ligand itself is present in ten times higher quantity than the protein target and can also bind to the library beads It was hypothesized therefore that the anchor ligand itself bound to those library sequences tightly enough to catalyze the click product that was detected in the final screen This scenario would 46 explain why the biligands showed no binding to the protein the anchor could no longer even bind to the target with another ligand potentially blocking those binding sites It also explains why the secondary ligands showed no affinity for PSA They were not ligands that bound to the target and wouldn t have an affinity for it To counter this effect a new screening step was added at the beginning of the process to remove all of the library peptides that bound to the anchor ligand be
73. calculated from this readout using the number of residues in the fragment 33 and the concentration in mg mL 0 5 for the folded sample or 0 25 for the denatured sample since it was diluted with Guanadine HCI using the equation Asmr AA residue x concentration mg mL x Il The spectra were graphed by plotting this number against the wavelength 3 2 4 Screen for Initial Anchor Ligand Peptide Screens were performed using a library containing 10096 Met coupled at the C terminus for potential MALDI TOF TOF sequencing The peptide library was a comprehensive 5 mer containing 18 unnatural D amino acids excluding Met and Cys due to stability reasons The N terminus consisted of an azide click handle with varying carbon chain lengths 2 carbon 4 carbon and 8 carbon for in vivo click with the Pra on the target 33 mer epitope fragment Screens were completed using with 300mg of dried library beads swelled at least six hours in 1x TBS 25mM Tris Cl 150mM NaCl 10mM MgCl pH 7 5 buffer Preclear Figure 3 2a Swelled library beads were blocked overnight in 596 w v dried non fat milk in 1x TBS then washed with 1x TBS three times Five milliliters of a 1 10 000 dilution of streptavidin alkaline phosphatase conjugate in 0 596 milk in TBS was added to the beads and incubated shaking at room temperature for one hour The beads were washed with a high salt TBS buffer 1x TBS with 750mM NaCl three times then let shake in high salt
74. ce and are picked using a light microscope meaning that the images considered hits above the background TentaGel auto fluorescence from the microarray had to be used as a map to guide the bead picker to the correct clear bead on a slide of thousands This process was highly inefficient requiring up to an hour to pick each individual hit bead These picked hits were always imaged again on the GenePix to ensure that each bead that had been selected was a highly fluorescent bead indicating that the correct one had been chosen based on the map It was possible to use a COPAS automatic bead sorter to separate out the hit beads though one was not available at Caltech The sequences from a typical fluorescent target screen are shown in Table 2 1 The hits were generally dominated by the positively charged residues arginine and lysine This overwhelming charged signal is most likely due to the overall 3 charge on the AlexaFluor 647 37 dye which is attracting the positively charged amino acid sequences and creating a significant level of noise in the final hits Most screens had to be run many times in order to find enough quality hit sequences meaning ones that did not contain almost exclusively arginine and lysine residues because of this high background Generally a hit that contained 3 or more positively charged amino acids was considered background and removed from the pool One screen rarely yielded more than a handful of hits th
75. chased from Anaspec 2 2 2 Peptide Library Construction Peptides and peptide libraries were synthesized by hand until the summer of 2009 when they were then XX X4X X synthesized on a Titan 357 split and mix automated peptide Figure 2 2 OBOC Peptide Library synthesizer Aapptec via standard FMOC SPPS coupling constructed on TentaGel Resin Where X is comprised of all of the naturally occurring D amino acids except Cys and Met chemistry using 908m TentaGel S NH beads Libraries contain 18 D stereoisomers of the natural amino acids minus cysteine and methionine unless otherwise stated at each of five randomized positions and an azide or alkyne in situ click handle At least a five fold excess of beads is used when synthesizing libraries to ensure efficient oversampling of each sequence Amino acid side chains are protected by TFA labile protecting groups that are removed all at once following library synthesis 30 223 Bulk Peptide Synthesis Bulk synthesis of peptide sequences was performed using standard FMOC SPPS peptide chemistry on either the Titan 357 automated peptide synthesizer AAPPTEC or a Liberty 1 microwave peptide synthesizer CEM Corporation The typical scale was 300mg on Rink Amide Resin unless otherwise noted Peptides were cleaved from the beads with side chains deprotected using a 95 5 5 ratio of TFA H20 TES The peptides were purified on a prep scale Dionex U3000 HPLC with a reverse phase C18
76. chor ligand onto a library peptide and those hits are detected by screening for the formation of this clicked product Figure 4 2 Those hits are candidate 2 ligands Table 4 1 As with the discovery of the anchor ligands the biligand hits are clustered according to their hydrophobicity and sequence homology using principle component analysis These hits cluster into groups as seen in Figure 4 5 and unique clusters are circled Hits from these different clusters thus representing the sequence diversity of the screen were chosen to be scaled up and tested for both affinity and selectivity to the E17K mutant PH Domain protein For testing the 2 ligand candidates are appended to the yleaf anchor ligand via a Cu l catalyzed 1 4 triazole to mimic the triazole formed by the protein target during the screen to form a biligand The biligand candidates are then subjected to immunoprecipitation assays pull down to identify a candidate biligand in a manner that is similar to what was done to identify the original yleaf ligand Figure 4 6 The biligand in lane 6 in Figure 4 6 yleaf yksy shows the highest affinity for the E17K mutant protein while still maintaining the selectivity over the wildtype protein This sequence was chosen as the biligand 95 random 011912 PHD Mut Bilig2 vnvk A l fi l l l a 3 2 4 0 1 2 3 4 Figure 4 5 Clustering of Biligand Sequence Ligands by AA Similarity Hit sequences from the bilig
77. d therefore the PCR will show nothing if the insert is not present Primer Name Sequence M13gV 5 GTC AGG GCA AGC CTT ATT CAC TG Psi 3 GCG TAA CGA TCT AAA GTT TTG TCG Thrombin 3 CGA ACC ACG CGG AAC CAG AC 118 5 2 8 Incorporation of Azidophenylalanine into Phage Libraries The TOP10 F cells transformed with the suppressor plasmid pAC AzES 6TRN were streaked from a glycerol stock on an LB agar plate supplemented with ampicillin 100 ug mL and tetracycline 12 5 ug mL A single colony was inoculated into LB broth with appropriate antibiotics and grown overnight at 37 C The starter culture was diluted 100 fold into 20mL of LB 12 5 ug mL Tet 100 ug mL Amp and allowed to grow for two hours at 37 C to early log phase ODeoo 0 1 A stock solution of azidophenylalanine was freshly prepared by dissolving 8 mg of amino acid in 250 uL of DMSO and 250 uL of acidic water pH 2 0 The entire volume of the stock azidophenylalanine solution was added to the culture to achieve the final concentration of 2 mM For a control culture with no amino acid only the 250 uL DMSO and 250 uL pH 2 0 water are added The cultures were then allowed to grow for additional one hour before the phage stock was added For the target screen hits the entire 1 2 mL phage elution was added to the growing culture For the previously amplified library phage amounts of 100 times the library diversity were added The phage culture was then allowed
78. d goat pAb Abcam for one hour The plate was once again washed and developed with a 1 1 TMB substrate KPL for 15 minutes To graph the data the blank epitope and antibodies binding to plate with no anchor ligand present was subtracted from the triplicate sample values The fraction bound was found by setting the highest value to 100 and normalizing the rest accordingly The triplicate values were then graphed with their error bars and the p values were calculated by GraphPad using a two way ANOVA test 62 did HPLC Detected Immunoprecipitation Pull down Assays Epitope Targeting Verification Pull down assays with the biotinylated anchor and his tagged 33 mer epitope were performed to verify epitope targeting As with the full protein assays the biotinylated anchor ligand was incubated for one hour with 50uL of streptavidin agarose slurry that had been washed three times with 1xTBS The anchor ligand was washed out and the resin was blocked for an hour in 5 BSA in 1xTBS Two hundred uL of a 50uM solution of his tagged 33 mer epitope in 1xTBS was added to the blocked resin and this was incubated overnight 16 hours at 4 C Because small peptide fragments like the 33 mer epitope are difficult to transfer to and detect on the nitrocellulose membrane as for a traditional Western blot the amount of binding in these assays was detected via HPLC In order to do this the bound 33 mer peptide fragments were washed three times with 1xTBS 0
79. e investment that was devoted to screening This huge reduction in noise now meant an instant reduction in the number of screens that needed to be run and sequenced in order to see homology The colorimetric hit visualization also permitted larger numbers of beads to be screened much faster so the overall number of library sequences that were sampled went up even though fewer screens were run One BCIP NBT developed screen could sample the same number of beads as up to five different fluorescent screens in less 40 time as all of the hits could be picked in the time it used to take to pick one With this increase in both sampled sequence space and in the overall signal to noise seen in the sequences hit quality and screening speed improved dramatically in a much shorter overall time Table 2 2 Screens from Sample Antibody Amplification Screen Using BCIP NBT Protein Detection Screen was performed against unlabeled PSA detected with PS2 mouse mAb anti PSA antibody and anti mouse AP secondary antibody with BCIP NBT readout n g m e d e t q m d w t d e m S e d d t a n d e e n y d p e G n m d d e d V i f e n d a e i n e V e f G e e h d a y d e t a t i w n m e y d d S d d e a G e n t i d 23 3 Introduction of an Anti screen The antibody development technique dramatically improved the quality of hit peptides by visual inspection Table 2 1 versus T
80. e libraries for azidophenylalanine incorporation should be built using a phage vector that is out of frame so that the insert is required in order to correctly synthesize the plll coat protein This will entirely eliminate the problem with the naked phage and the complicated screening strategies will no longer be as important 124 5 5 Acknowledgements This ongoing work is being done in conjunction with Dr Aiko Umeda JingXin Liang performed the background research on the G6PD deficiency in malaria and assisted in the selection of the screening target 5 References 1 Wang L Xie J Schultz P G EXPANDING THE GENETIC CODE Annual Review of Biophysics and Biomolecular Structure 2006 35 1 225 249 2 Tian F Tsao M L Schultz P G A phage display system with unnatural amino acids J Am Chem Soc 2004 126 49 15962 3 3 Funke S A Willbold D Mirror image phage display a method to generate d peptide ligands for use in diagnostic or therapeutical applications Molecular BioSystems 2009 5 8 783 786 4 Schumacher T N M Mayr L M Minor D L Milhollen M A Burgess M W Kim P S Identification of d Peptide Ligands Through Mirror Image Phage Display Science 1996 271 5257 1854 1857 5 Liu J Modrek S Gosling R D Feachem R G A Malaria eradication is it possible Is it worth it Should we do it The Lancet Global Health 2013 1 1 e2 e3 6 Domingo G J Satyagraha A W
81. e made in large quantities entirely by robots making the scale up cheap and robust They are also highly stable agents that can be used in a variety of assays removing the need for the gold standard antibodies in a variety of protein detection techniques The iterative in situ click screen to develop a capture agent starts with the discovery of a peptide ligand that binds to a protein target through the use of OBOC library screening Once a peptide has been discovered labeled the anchor peptide itis appended with a click handle and screened again against the protein in the presence of a new OBOC library that contains the opposing click handle as seen in Figure 2 1 When a library member binds to the surface of the protein in close proximity to the anchor ligand and is held in place through a high affinity for the protein target a click reaction between the anchor and library bound ligand can occur without the use of the Cu l catalyst The addition of this new ligand the secondary ligand forms a biligand in complex with the original anchor This selection technique allows the protein target itself to catalyze the formation of the peptide ligands that bind to it with the highest affinity and selectivity This iterative process can be performed as many times as necessary to produce a ligand with the desired affinity and specificity for the target and serves as the basis for the iterative in situ click chemistry technique for protein catalyzed cap
82. e mutant protein show some level of capture agent retention and demonstrate co localization of Figure 3 19 Image Demonstrating Co Localization of y la GFP tagged PH Domain proteins capture agent and GFP PH Domain protein Figure I 3 19 The GFP WT cells however show very low levels of capture agent retention and do not 81 seem to have any co localization of the two These measurements demonstrate the selectivity of the E17K capture agent for its target within the demanding environment of live cells 3 4 Conclusions The in situ click focused epitope screen for capture agent development presents a rapid strategy for discovering peptide ligands that bind to any site of interest on a protein surface This method is not limited to conserved binding pockets post translational modifications or structured regions of proteins By only accepting hits wherein the target epitope catalyzed the formation of a covalent bond it was ensured not only that the candidate ligands bound to the site of interest but that they also bound tightly and in an exact orientation so that this triazole could form In this way the in situ click screen became not only a screen for ligand affinity but also for ligand specificity The peptide hits developed using this method are very specific for the exact location on the protein where the click reaction was centered The PCC Anchor yleaf developed using this technique has demonstrated the ability to det
83. e presence of the target protein A new screening step was needed that would remove the signal seen from the binding of these other proteins used in the screening process AntiFLAG M2 AntiFLAG M2 Akt Biank Subtracted Sensorgrams Figure 2 7 SPR Data from Akt Biligand Data from Steve Millward s Akt Biligand Capture Agent An anti FLAG antibody was immobilized onto an SPR chip via standard EDC NHS coupling techniques It was used to capture a FLAG tagged Akt protein for testing As seen from the figure on the left the capture agent bound equally as well to the flow cell immobilized with only Anti FLAG antibody supposed to be the chip blank as to the one on the right that also contained immobilized Akt indicating that the biligand s affinity actually stems from the Anti FLAG antibody and not the Akt protein target Around this time there was interest in developing capture agents for proteins containing post translational modifications such as phosphorylations or glycosylations It was hypothesized that hits specific for a post translational modification could be discovered by screening against the protein target containing the modification then anti screening against the protein target with 42 the post translational modification removed since everything else in the screen would be identical Figure 2 8 These screens entailed first target screening as per usual antibody detection screen
84. e presence of the yleaf anchor After a one hour incubation with the peptide the cells were washed once in serum starved media then incubated thirty minutes in serum starved media to wash out any excess peptide During this time the cells were also treated with 10pg of Hoescht 33342 dye to stain the nuclei After the thirty minute period one well of each wildtype or mutant protein with peptide was activated with PDGF for 10 minutes The cells were then washed twice with cold PBS buffer fixed with 1096 Neutral Buffered Formalin Solution Sigma and glued onto microscope slides Images were taken on a Zeiss LSM 510 Meta NLO with Coherent Chameleon confocal microscope A 40x Plan apochromat lens was used The laser 69 intensity and gain were fixed for all pairs of images between wildtype and mutant samples to ensure that the differences seen were not artificially created 2 3 Results and Discussion CM In situ Click Epitope Targeted Screening Strategy for E17K PH Domain Specific Ligand Using FMOC SPPS peptide synthesis techniques a peptide epitope representing residues 1 32 of the E17K PH Domain of Akt1 was synthesized From the crystal structure PDB ID 2UZR these residues form a B sheet around the E17K mutation blue The epitope fragment was appended with an N terminal PEGs biotin to serve as a detection handle when screening This manual synthesis of the epitope allowed for an I19Pra substitution Pra propargylglycine to provide
85. eads that remained clear after this step were picked and washed with guanidine HCl to remove any bound proteins The off target protein can be a different version of the target such as a wildtype protein when detecting for a mutation or a protein lacking a certain domain or post translational modification of interest such as a phosphorylation site or glycosylation Anti screens can also be designed to clear against any number of interferents such as whole human serum to remove any generally sticky peptide sequences For these anti screens the antibody used for detection is an anti whole human serum antibody followed by a secondary alkaline phosphatase conjugated antibody 33 2 2 7 Typical Target Screening Procedure During a Multi Step Screen Figure 2 3 The library beads were blocked in 596 milk in 1x TBS for two hours to overnight They were then washed three times with 1x TBS The target protein and anchor peptide or small molecule targeting agent were pre incubated in 3 5mL of 0 596 milk in an approximately a 10 1 ratio ensuring the same concentration of anchor peptide used in the preclear This solution was added to the blocked library beads and incubated for either 5 hours or overnight to allow an in situ click reaction to occur In the morning the beads were washed three times with 1x TBS then incubated with the same dilution of an anti target alkaline phosphatase conjugated antibody that was used in the anti screen in 0 596 milk for
86. eaf ligand binding to the E17K mutation relative to the WT epitope Figure 3 10 As an assay control another candidate ligand that in initial testing did not exhibit preferential E17K binding to the full protein lane 4 Figure 3 8 was tested and yielded consistent results to the full protein pull down assays Figure 3 8 The first immunoprecipitation assays demonstrated that the anchor bound selectively to the full protein and these HPLC detected pull downs confirm that the binding and the selectivity are due to the interaction between the anchor and 33 mer epitope 75 yleaf E17K 33mer eefef E17K 33mer yleaf WT 33mer blank E17K 33mer Figure 3 10 HPLC detected Immunoprecipitation Assay for Epitope Targeting Verification The HPLC traces show the quantity of the 33 mer fragment that was pulled down in the assay The anchor ligand yleaf pulls down the most E17K 33 me r and the least WT 33 mer The amount of pull down by the eefef discarded anchor candidate demonstrates the validity of the assay This corroborates what was seen in the full protein pull downs in Figure 3 8 The selectivity of the yleaf peptide for the E17K 33 mer epitope was also tested in an ELISA assay format For these assays the WT or E17K 33 mer peptide fragments were captured using the PEG biotin modified yleaf ligand immobilized on a Neutravidin coated plate The yleaf ligand exhibited significant selectivity for the E1
87. ecseeeeesaeeeeaaeceeaaessaeeeeaaeeeeaaesenaeeens 84 4 2 1 Screen for Biligand Peptide esses nnne nnne 84 4 2 2 Streptavidin Agarose Immunoprecipitation Pull down Assays to Test Biligand Candidates Figure 4 6 ccs cccssscccseccsssceessssecsescesceecesneessenecsnecesscsecsensessateneceessensessetaness 88 4 2 3 Screen for Triligand Peptide eerte mets 90 4 2 4 Full ELISA Curves for Ligands essere 91 4 2 5 Point ELISA Assays for Triligand Binding to Akt1 and Akt2 Wildtype and E17K M tant Protelris cete eir o te eo bad tae et de Ra 92 4 2 6 PIP3 Agarose Inhibition Assays neesiana a eai e a iea 93 4 3 Res lts aAnd Discussion etre a a e a aaa aa ids 94 4 3 1 Biligand D VElOPMEN ccccccccsssssssesecccecsssesnaecececsseeseesaeeeeecesseseeaeaeeeeesessessaaees 94 4 3 2 Triligand Development esses iin eiae aaka i aiaeei 97 4 3 3 Inhibition ASSays E E AEE ER ecto laine 100 4 4 CONCLUSIONS eei a a e nh eee t d bei 101 4 5 Acknowledgemnients eie deett enean A a egeat es ein dvede te adio 101 4 6 hi e 101 Chapter Sasien ioe ia aucem Pee aded e uen 102 5 1 IntrOQUCtiOni tere pr tee eret e ee er aee gene e Rente Dr etes 103 5 1 1 Azide Containing Phage Display Libraries eeeeeeeeeenene nnne 103 5 1 2 Mirror Image Phage Display cssssscccccscsssesesecececscessesesaeeeeeesseesesnsaeeeeeeeseeeees 104 5 1 3
88. ect the E17K mutant PH Domain in conditions ranging from simple assays in buffer to complex imaging experiments in cells Assays validating the peptide peptide binding of the epitope target and the yleaf anchor ligand also highlight the exquisite selectivity of this ligand for the E17K mutation This technology provides an ideal solution for the discovery of selective ligands to an area of interest on a protein surface and demonstrates the ability to produce agents capable of distinguishing even the slightest change in protein structure a single point mutation 3 5 Acknowledgements The labeling and imaging experiments shown were done with Blake Farrow Steve Millward and Aiko Umeda assisted with the protein expression and cell culture Ying Qiao Hee and Jeremy Work made many of the peptides used in these experiments Bert Lai performed the 82 MALDI TOF TOF sequencing of the tryptic fragments Jost Vielmetter Angela Ho and Sravya Keremane of the Protein Expression Center were indispensable in the expression of these proteins Felicia Rusnak and Jie Zhou performed the trypsin digests and LC MS for the protein labeling experiments The advice from Mona Shahgholi on MS techniques and experimental set up was essential to the success of the labeling experiments 3 6 References 1 Testa J R Tsichlis P N AKT signaling in normal and malignant cells Oncogene 2005 24 50 7391 3 2 Vivanco l Sawyers C L The phosphatidylinosi
89. ed bottom Proteins Aces iege te spectre ee ee e teste ttd 77 Figure 3 16 Trypsin Digested Sequence of PH Domain Protein seeeseeeeee 78 Figure 3 17 Compiled Crystal Structure of Fully Labeled Protein ussssssse 79 Figure 3 18 Images of Anchor Ligand in GFP tagged WT and E17K PH Domain 80 Figure 3 19 Image demonstrating co localization of Cy5 sesseseeeeeeee 80 xiii Chapter 4 Figure 4 1 Biotin PEGS yleaf Pra sueeseessesseeeee seen ennemi ena 85 Figure 4 2 Screening Strategy for Biligand Determination seseeeeees 88 Figure 4 3 Lys Ns3 yleaf Tz yksy PEGs Biotin essssseseeenenennennnn n 89 Figure 4 4 Screening Strategy for Triligand Determination eese 91 Figure 4 5 Clustering of Biligand Sequence Ligands by AA Similarity 95 Table 4 1 Hit Sequences from Biligand SCreen ccccccccsscecsesseceesesneeeesenaeeeeseaeeeeeenaeeseeeaaes 96 Figure 4 6 Pulldown Assay Results for Biligand Candidates esses 96 Table 4 2 Hit Sequences from Triligand Screen esseeseeseeeeeee enne 97 Figure 4 7 ELISA assays for affinity and selectivity of triligand candidates 97 Figure 4 8 Structure of final triligand
90. ed study we compared the amount of E17K and WT PHD binding relative to the amount of added triligand This assay shows significant selective inhibition by around 10 of the E17K mutant relative to the WT Wildtype E17K Figure 4 12 Expanded Inhibition Assay The wildtype or E17K mutant PH Domains were incubated with varying amounts of triligand The wildtype protein shows very little reduction in binding until 1000x triligand to protein The E17K PH Domain however shows a significant drop in binding almost immediately 101 4 4 Conclusions The epitope targeting strategy allowed for such selective targeting of the E17K mutant PH Domain that selectively blocking the oncogenic activation of this protein was the logical next step Bulking up the original anchor into a triligand covered more of the PH Domain PIP3 binding pocket therefore blocking PIP3 binding By ensuring that the triligand maintained its selectivity for the E17K mutant PH Domain the ligand demonstrates significantly reduced interference with the wildtype PH Domain protein The blocking of the E17K protein binding to the cell membrane demonstrates the ability of this click focused epitope screening technology to produce not only selective binding agents but also potential therapeutics that could show significantly decreased toxic side effects due to the reduction in off target and healthy cell interactions 4 5 Acknowledgements Ying Qiao Hee and Jeremy Work made m
91. ed to run the set cartridges and cycles A 1 2 Most of the solvents used are purchased from somewhere other than Applied Biosystems Solvents and mixed in house See Table A 1 for details When refilling solvents the bottle should be screwed on until you hear three Clicks Over tightening can damage the assembly such as the R1 bottle To loosen or tighten this bottle you must first push up hard on the rachet assembly to hold it in place while you screw or unscrew the bottle Table A 1 Solvent Compositions Letter Name Composition HPLC Solvents B2 Acetonitrile in Isopropanol 9 1 Acetonitrile Isopropanol A3 THF in water 3 596 THF in water 100uL stock Na2PO4 1mL 196 Acetone 10mL Buffer premix 20uL TFA Machine Solvents R1 PITC in Heptane 2 5mL PITC in 50mL heptane R2B N methyl piperidine MeOH H20 R3 TFA neat purchased from Sigma R4A 25 TFA in Water DTT 12 5mL TFA in 37 5mL water with 0 01 DTT 32uL 1M stock R5 Acetonitrile with 0 000196 DTT S1 N heptane purchased from Sigma S2B Ethyl Acetate 450mL Ethyl Acetate with 225uL 1M DTT S3 N Butyl Chloride purchased from Sigma S4B 20 Acetonitrile in water 20 Acetonitrile in water Stocks Na2POA stock 2g in 15mL 3 5 THF in water 1M DTT stock 0 231g in 1 5mL Ethyl acetate or water A 1 3 Ordering Table A 2 Parts and Chemicals Commonly Ordered from Applied Biosystems Part Chemical Part Numb
92. ee S S Lim J Pfeilsticker J A Sharpless K B Heath J R Iterative in situ click chemistry assembles a branched capture agent and allosteric inhibitor for Akt1 Journal of the American Chemical Society 2011 133 45 18280 8 Chapter 3 Development of a PCC Agent Selective for the E17K Mutant Akt1 Protein 52 2 1 Introduction Sui The E17K Mutation in the Pleckstrin Homology Domain of Akt1 Akt1 kinase plays a critical role in the PI3K signaling pathway the activation of which is closely linked to tumor development and cancer cell survival The phosphorylation of regulatory amino acids Ser474 and Thr308 on Akt occur through the localization of Akt to the cell membrane through its membrane binding Pleckstrin Homology Domain PH Domain These phosphorylations activate the Akt protein which can then activate many other downstream signaling pathways The recently discovered E17K mutation in the PH Domain of Akt1 results in an increased affinity for the phosphatidylinositol 3 4 5 trisphosphate PtdIns 3 4 5 P3 or PIP3 substrate at the cell membrane Figure 3 1 This switch from a negatively charged glutamic acid to a positively charged lysine amino acid in the PIP3 binding pocket causes this mutant protein to have a four times higher affinity for the PIP3 substrate This increased affinity causes the Akt1 to be bound to the cell membrane and hence activated four times longer than in healthy wildtype cells Consequen
93. ein was then detected with 1 10 000 anti GST mouse mAb Fisher MA4 004 for one hour washed three times with 1xTBST and developed with a 1 1 mixture of TMB substrate for ten minutes The samples were plotted by subtracting the blanks and averaging the sample wells The highest signal was considered 100 binding and the other samples were normalized accordingly 93 4 2 6 PIP3 Agarose Inhibition Assays PIP Agarose beads Echelon were used to detect for the inhibition of PH Domain binding to its substrate PIP3 upon incubation with the anchor candidate peptide ligands To test the inhibition of each of the ligands anchor biligand and triligand 20uL of resin slurry was added to each of four tubes and washed three times with 1x TBS Protein 2ug 234nM of E17K mutant was pre incubated for one hour at room temperature with either DMSO no peptide ligand blank anchor biligand or triligand at 2 38uM 10x in relation to protein in 200uL of 1x TBS For the control mutant PH Domain was incubated with 1x TBS and 1uL DMSO to mimic the ligand conditions These protein samples were then added to PIP3 agarose in a Spin X tube and incubated at room temperature for two hours The resin was washed three times with 1x TBS with 0 2596 IGEPAL CA 630 spun out to dry completely then denatured with 50uL 3x SDS gel loading buffer for 10 min at 95 C The gel loading buffer was spun out of the resin and detected via western blot as per the streptavidin
94. eins for point of care early detection and monitoring of cancer Analyst 2010 135 10 2496 2511 4 Borrebaeck C A Antibodies in diagnostics from immunoassays to protein chips Immunology today 2000 21 8 379 82 5 Kodadek T Reddy M M Olivos H J Bachhawat Sikder K Alluri P G Synthetic molecules as antibody replacements Accounts of chemical research 2004 37 9 711 8 6 Edwards P J LaPlante S R Peptides as Leads for Drug Discovery In Peptide Drug Discovery and Development Wiley VCH Verlag GmbH amp Co KGaA 2011 pp 1 55 7 Sun N Funke S A Willbold D Mirror image phage display Generating stable therapeutically and diagnostically active peptides with biotechnological means Journal of Biotechnology 2012 161 2 121 125 23 8 Lam K S Lebl M Krchnak V The One Bead One Compound Combinatorial Library Method Chemical Reviews 1997 97 2 411 448 9 Agnew H D Rohde R D Millward S W Nag A Yeo W S Hein J E Pitram S M Tariq A A Burns V M Krom R J Fokin V V Sharpless K B Heath J R Iterative In Situ Click Chemistry Creates Antibody like Protein Capture Agents Angewandte Chemie International Edition 2009 48 27 4944 4948 10 Kolb H C Finn M G Sharpless K B Click Chemistry Diverse Chemical Function from a Few Good Reactions Angewandte Chemie International Edition 2001 40 11 2004 2021 11 Lewis W G
95. ence Ligands by AA Similarity Hit sequences from the anchor screen were segregated based on their hydrophobicity and sequence homology using principal component analysis Circled clusters indicate regions where a peptide was selected and scaled up as a possible anchor sequence The potential anchor sequences that were tested are dqntr ypwve eefef yleaf and elnhy Streptavidin agarose immunoprecipitation assays Figure 3 8 were used to probe for the ability of the anchor candidates to recognize and bind to the proteins in buffer One ligand 72 candidate showed a distinctively stronger binding to the E17K protein relative to the WT seen in Lane 5 This peptide sequence yleaf Figure 3 3 was carried forward for additional investigations Two out of the four other candidates though also showed a preference for the E17K mutant protein One candidate showed a preference for the WT protein and one candidate showed no strong binding to either fragment This result was to be expected because it is possible for a ligand to bind to the fragment in a way that is not directly accessible on the surface of the full protein It can also be hypothesized that the three fragments that showed a preference for the E17K fragment bound at or around the site of the mutation and the peptide that shows binding to the WT protein must bind away from the mutation Lane description wt PHD 1 Blank no ligand protein 2 Biotin dqntr Biotin
96. ening Core Technology seeeseeeeeee 28 Figure 2 2 OBOC Peptide Library cc cccccsscscccsssscccrsssccccesssccccrssseccarssssccerseseccerenseecarsseeeeareees 29 Figure 2 3 Typical Antibody Detected Target Screen sess 33 Figure 2 4 Image of Hit Beads on GenePix microarray scanner ssccccesssceceesteeeeeesneeeeeees 36 Figure 2 5 Histogram of Position X2 in PSA Screens sssssssseeeeeeeeeneeeee enne 37 Table 2 1 Screens from Sample Target Screen Using Fluorescent Protein Detection 38 Figure 2 6 Image of Hit Bead Developed with BCIP NBT eene 39 Table 2 2 Screens from Sample Antibody Amplification Screen Using BCIP NBT Protein Detection onean 40 Figure 2 7 SPR Data from Akt Biligand Data from Steve Millward s Akt biligand capture agent RR 41 Figure 2 8 Sample Anti Screen Step ssssssssssesee eene enne enne enne enne 43 Table 2 3 PSA Screening Statistics esee enne enne nnne nennen 44 Table 2 4 PSA Hit Bead Sequences from Product Screen ccccccccsssssssecececesessessaeeeeeeeseesees 44 Figure 2 9 Sample Product Screening Step sessssssssseeeee eee 45 Figure 2 10 Sample Preclear Screening Step enne 46 Chapter 3 Figure 3 1 PH Domain Binding Pocket Changes upon E17K Mutation
97. er Premix Buffer Concentrate 100mL 401446 R5B Acetonitrile n Acetylcysteine 40 mL 4340966 Seal Cylinder Head 200240 Seal 5mm Micro Pump 201399 Procise Cartridge Seals 50 pk 401611 PTH C18 Column 0 8mm x 250mm 401882 PTH Amino Acid Standards 4340968 R2C N Methylpiperidine in isopropanol 4310689 butanol water 9mm TFA Filters 401111 Table A 3 Parts and Chemicals Commonly Ordered from Sigma Aldrich Part Chemical Part Number Ethyl Acetate CHROMASOLV Plus 99 996 650528 4L Phenyl Isothiocyanate 78780 Heptane CHROMASOLV Plus 99 9 650536 4L 2L Chromasolve N Butyl Chloride for HPLC 34958 2L Trifluoroacetic Acid 9996 reagent plus T6508 1L A 1 4 Contacting AB 128 The number to call to place a service call with Applied Biosystems is 800 831 6844 press 4 then 1 Our serial number is 4CLO00092 Ask for service on the instrument and get a reference number for the call Type this onto the purchase order and have the purchasing department fax it to 650 554 2193 Include a description of the problem on the purchase order 129 A 1 5 Idle machine The machine should never be left completely idle or the column can dry out and will need to be replaced If the machine is not running press the Manual button on the front of the pumps It should turn the pumps on to 5uL min at 50 B and the bottom of that window will change to say
98. ere washed three times with 1x TBS then incubated with a 1 4 000 dilution of Anti His Alkaline Phosphatase conjugated antibody in 0 596 milk for one hour at room temperature They were then washed three times with high salt buffer and let shake for one hour in high salt at room temperature before being washed three times with BCIP buffer and developed as previously The beads that turned purple bind to both mutant and wildtype protein or to the anti his antibody and were set aside The beads that remained clear were picked and washed with guanidine HCl to remove any bound proteins and blocked in 596 milk overnight Product Screen Figure 5d The beads specific for the mutant PH domain were washed three times with 1x TBS They were then incubated with a 1 10 000 dilution of Streptavidin Alkaline Phosphatase conjugate in 87 0 596 milk for one hour The beads were washed three times with high salt TBS then let shake for one hour with high salt buffer before being washed three times with BCIP buffer and developed as previously The beads that turned purple contained the anchor peptide covalently bound to the bead and had formed a protein catalyzed in situ click reaction These beads were collected and stripped with guanidine HCl for one hour washed ten times with water and sequenced via Edman degradation as per the anchor candidate hits There were 22 total hit beads 88 Precleared Library K XQX XaXsN5_ steptaviin D 2
99. ere washed with a high salt TBS buffer three times then were left to shake in high salt buffer for one hour The beads were then washed three times with BCIP and developed as for the anti screen After one hour the purple beads were removed by pipette and discarded The remaining beads were incubated in NMP 4 hours to remove trace purple precipitate from the BCIP NBT reaction then were washed five times with methanol five times with water five times with TBS and blocked overnight in 596 milk 2 2 9 Typical Screening Protocol for a Click Product Screen The beads that pass through the target and anti screen were washed three times with 1x TBS They were then incubated with a 1 10 000 dilution of either streptavidin alkaline phosphatase conjugate or anti biotin antibody whichever was used in the preclear in 0 596 milk for one hour The beads were washed three times with high salt TBS then let shake for one hour with high salt buffer before being washed three times with BCIP buffer and developed as previously The beads that turned purple contained the anchor peptide covalently bound to the bead and had formed a protein catalyzed in situ click reaction These beads were collected and stripped with guanidine HCl for one hour washed ten times with water and sequenced via Edman degradation 2 2 10 Peptide Sequencing Strategies The OBOC peptide library sequencing method most commonly used by Caltech is Edman degradation This process involve
100. erly or could have been lost in the multiple steps of the experiment since the quantities of phage used were very small Also there are no other bands present in the gel which would indicate nonspecific azide incorporation in other proteins in the phage This suggests that the incorporation of 121 azidophenylalanine is specific to the plll protein where amber codon is introduced and that peptides containing azidophenylalanine at a precise location can be displayed on the phage surface 5 3 3 Phage Library Screening Conditions and Results The original phage library produced by Antibody Design Labs contained about 35 naked phage determined by titering followed by plaque PCR and cannot be directly carried onto the azidophenylalanine incorporation The high prevalence of naked phage in the library complicates the subsequent azidophenylalanine incorporation as the rapidly infecting naked phages that do not require suppression of the amber codon have a significant growth advantage Figure 5 12 Click It Kit Visualization of Azide in pill Coat Protein The band seen above corresponds to 65kDa the known running mass of the plll protein over the properly inserted phages and can overwhelm the relatively slow synthesis of azidophenylalanine containing phages by amber suppression For this reason the traditional phage display screening methods target screens searching only for binding of the library component to the targe
101. es containing the alkyne were no longer able to be successfully sequenced via any method Edman degradation or MALDI TOF TOF The Edman spectra were entirely blank indicating that the amino acid 47 residues were probably not cleaving from the beads and the MALDI TOF TOF was unable to identify a parent peak that contained the fixed alkyne amino acid The alkyne containing amino acid was the N terminal residue the first residue that needed to cleave via Edman and anything modifying this amino acid would affect the cleavage It was hypothesized that the BCIP NBT developing solution was modifying these amino acids which was confirmed by the use of C terminal alkyne libraries Even after undergoing four screening steps the libraries still sequenced correctly using Edman degradation up to the alkyne amino acid These same library hits though were not able to be sequenced using MALDI TOF TOF Because the TOF TOF would be greatly affected by an unknown change to an amino acid it was assumed that the alkyne was somehow being modified during these screening steps For this reason azide containing libraries are now always used when undergoing more than three screening steps unless a C terminal alkyne library with Edman degradation sequencing is appropriate It was also noticed that the libraries that contained a propargylglycine seemed to have more difficult preclears meaning more purple hits to remove than the libraries that contained the Lys N3
102. f the backflush and the solvent should now be detected The run can now be restarted A 2 3 HPLC Bottle Runs Dry Sometimes the HPLC solvent bottles run dry and this is not as easily fixed as the machine bottles First the HPLC bottles need to be refilled Then the pump must be purged manually using the buttons on the front of the pumps Push the function key for purge then select the pump to be purged When the purge is complete push Manual on the front of the pump to turn the pumps on to free running The pumps should be allowed to run freely until bubbles are no longer coming from the end of the column as seen in the waste line If the machine is needed immediately the flow rate can be turned up to move this process along faster Everything should be done to minimize the times that these bottles are allowed to run dry so that the pumps are not pumping dry and the column does not dry out SN PROCISE Manual Control File Edit Sequencer Help PROCISE edem ABOUT Event Log Bottle Change Pres amp Temp Manual Control Test Procedure Sequence Methods Cycles amp Procedures i Gradients Functions Cartridge 133 AS Goose x MODEL INFORMATION oe Controls Additional Valves Continuous Run C Timed Run Elapsed Time Active Valves Cartridge Function Load 53 Cart sm loop Load S3 Cart Ig loop Vent S3 3 FlushS3 Del X1 Cart t
103. f the screening process has remained clear The next step is the target and click catalyzed screen The beads that remained clear in the preclear are incubated with the target of interest and the anchor ligand overnight for a click reaction to occur These beads are then probed for the presence of target Any bead bound to target will turn purple and passes through to the next stage of screening Even though the on bead click has occurred during this screen probing for the click product occurs at a later stage The hits from the target screen are then decolorized and incubated with an off target protein or proteins Any library bead that binds and turns purple in this screen demonstrates off target interactions with other proteins and is removed from the pool At the end of this screen only beads that remain entirely clear are kept Even slight purple can indicate undesirable interactions and background binding and are removed from the pool of hits The final screening stage probes for the presence of the clicked product on bead After harsh denaturing and washing conditions the beads are probed for the presence of biotin These beads will turn purple only if biotin is linked to the bead which is only possible if the in situ click reaction was successful These purple hits have proven to have no affinity to the screening agents in the preclear an affinity for the target but not off target interactions in the target and anti screens and then ha
104. ffer pH 2 0 for 10 minutes in order to ensure that all thrombin cleaved peptides were removed previously and that only naked phage remain The 1mL of acid eluent was removed from the beads and neutralized with 150 uL of 1 M Tris pH 9 1 Both the thrombin cleavage and acid bump eluents are titered to determine the number of phages eluted in each step 5 Testing Phage Plaques for Library Inserts The titered phage from a library or final eluent of a screen can be rapidly assessed for the presence of library inserts by plaque PCR before sequencing each individual clone from titered plaques The first two primers listed in Table 5 3 were designed by Antibody Design Labs to recognize the DNA sequence on the M13KE phagmid on the either side ofthe cloning site allowing the screening for the presence of insert based on the increased size of the PCR product compared to the one from a naked phage The last PCR primer is an alternate 3 primer designed to recognize part of the insert DNA sequence and therefore a positive PCR reaction only occurs when the template phage contains the insert and not with a naked phage At each stage of the screening process plaques were picked and plaque PCR was performed to determine the percent of naked phage Table 5 3 Primers for Colony PCR of Inserts The first two primers show a slightly heavier PCR band if the insert is present The last primer is an alternate 3 primer designed to sit inside the insert an
105. fore the anchor ligand even saw the target protein Figure 2 10 These screens still detect the biotin label on the anchor ligand and the detection with streptavidin or anti biotin in this preclear step eliminates the need to use these detection agents in the anti screen The preclear screens generally remove 1 1096 of the library beads depending on the library and also reduce the percentage of beads that need to be removed in the anti screen Precleared Library C CX X X4X Xs Anti bioti BCIP C CX1XX X 4X5 Alkaline Phosphatase Biligand N3 e Biligand N3 Biotin Biotin 4p Anti biotin AP and Biligand Binders Figure 2 10 Sample Preclear Screening Step The library is incubated with an anchor or biligand which is then detected with an anti biotin alkaline phosphatase conjugated antibody or streptavidin and developed with BCIP The purple beads from this screen bind to either the initial ligand or the detection antibody 2 36 Use of Alkyne Versus Azide Libraries Throughout the course of technology development certain seemingly trivial details become important For the OBOC screens different libraries and slightly different conditions produced vastly different results The first issue with the propargylglycine alkyne containing amino acids surfaced initially after the addition of multiple stages to the screening process After undergoing more than three rounds of screening washing and denaturing the librari
106. free running This low flow of solvent keeps the solvents moving and the column wet A 1 6 Settings These are our common settings for the machine in the off chance that something is lost or rest and needs to be reprogrammed These are also the settings used for all of the amino acid sequencing in this thesis pum Tw PROCISE Sequence Methods E PROCISE SsveneeMetnods m r Stating Temperatures Injector Optimization cLC PTH Standards cLC Catig tt 5 D EZET Casto E H Mb RunGiadent cLC nto 5 PulsedLiquid cLC Full s pines EX ELO Table A 4 PulsedLiquid cLC Method PROCISE Pressure and Temperature P RO C SE Pressures and Temperatures f Pressure psi Set Actual Rl Regixe1 25 5 R2 Regisa2 08 08 R3 Registos fe 1 52 3 Regdso4 17 7 Cartridge Dry_Reguste5 35 B5 R4 54 X3FlskDry Reguao8 30 BO FlaskBubbe Regua 18 13 Loadinector Regulator 10 08 10 Main Tank B Figure A 1 Temperature and Pressure Settings 130 131 SW PROCISE Gradients File Edit Sequencer Help lt 3 MODEL INFORMATION Gradient Gradients Max Pressure i Prepare Pump cLC Full Gradient Min Pressure joo gt Full Gradient 0 Target Pressure Beso B2 28 0 psi psi Normal 1 cLC R User Defined Gradient Template Target Time a Data Collection Time Cum Volume A Cum Volume B elei3
107. gewandte Chemie International Edition 2013 52 52 13975 13979 16 Mardis E R A decade s perspective on DNA sequencing technology Nature 2011 470 7333 198 203 17 Chong C R Janne P A The quest to overcome resistance to EGFR targeted therapies in cancer Nat Med 2013 19 11 1389 1400 18 Tjin Tham Sjin R Lee K Walter A O Dubrovskiy A Sheets M St Martin T Labenski M T Zhu Z Tester R Karp R Medikonda A Chaturvedi P Ren Y Haringsma H Etter J Raponi M Simmons A D Harding T C Niu D Nacht M Westlin W F Petter R C Allen A Singh J In vitro and In vivo Characterization of Irreversible Mutant Selective EGFR Inhibitors that are Wild type Sparing Molecular Cancer Therapeutics 2014 19 Capper D Zentgraf H Balss J Hartmann C von Deimling A Monoclonal antibody specific for IDH1 R132H mutation Acta neuropathologica 2009 118 5 599 601 20 Capper D Preusser M Habel A Sahm F Ackermann U Schindler G Pusch S Mechtersheimer G Zentgraf H von Deimling A Assessment of BRAF V600E mutation status by immunohistochemistry with a mutation specific monoclonal antibody Acta neuropathologica 2011 122 1 11 9 21 Marschall A L J Frenzel A Schirrmann T Sch ngel M Dubel S Targeting antibodies to the cytoplasm mAbs 2011 3 1 3 16 22 Rondon I J Marasco A W Intracellular AntibodiesS Intrabodies For
108. have formed a click product Figure 2 9 Continuing the comparison with the Table 2 3 PSA Screening Statistics These hit bead statistics are taken from a screen against PSA The percent column indicates the percent of beads that passed from one stage of the screen to the next PSA screens from above only 7 of the 15 Beads Percent remaining beads after the anti screen showed Start 375 500 Target Screen 167 0 0496 the presence of a click product The other 8 Anti screen 15 996 Product Screen 7 4796 beads could very easily have been hits that would be a different anchor ligand a peptide ligand that is binding specifically to the target protein but is not close enough to the original anchor for a click to form The sequences from these hits shown in Table 2 4 are very nearly identical peptides and contrast sharply with the previously identified hits from the anti screen in Table 2 2 This indicates that the sequences are more than likely all binding very strongly to the exact same location and in close proximity to the anchor ligand allowing for the formation of the click product Table 2 4 PSA Hit Bead Sequences from Product Screen The product hits shown in Table 2 3 were sequenced There is an enormous sequence homology meaning that the same part of the target is being targeted The end of the last sequence and the 7th hit were lost due to machine error 3 X4 Xs lax P
109. he Heath group have had the sincere pleasure these past six years to work with the hands down smartest most capable and genuinely nicest lab mates have ever seen assembled You have all enriched my Caltech experience beyond measure and have encouraged me every single day to be better than ever thought possible A special thanks to Blake Farrow Jessica Pfeilsticker Aiko Umeda Steve Millward Heather Agnew and Bert Lai for being such capable and absolutely amazing people to work with not to mention some of my best friends would get my hands dirty again in a lab with any of you at any time To the rest of the capture agents group Rosemary Rohde JingXin Liang Arundhati Nag Samir Das Ryan Henning Joey Varghese and Mary Beth Yu thank you for being incredible lab mates and really helping to push our technology to the limits And to all of the Heath group members past and present for our interactions both personal and professional thank you for being there to both enhance my Caltech experience and keep me sane Alex Sutherland Min Xue Jing Yu Jing Zhou Wei Wei Jun Wang Kevin Kan Habib Ahmed Udi Vermesh Ophir Vermesh Slobadon Mitrovik Ann Cheung Kiwook Huang John Nagarah and Jen Kan Yu have met some of the best people I hope to ever have the pleasure of calling friends in this lab Life at Caltech ran so smoothly for me mostly due to the amazing support system in place around me cannot thank the people that make up that sy
110. he technology development discussed in this chapter has revolutionized how screening for PCC agents occurs and the robustness of these techniques has provided a solid foundation for the rapid discovery of a multitude of additional agents for a wide range of purposes 323 610 50 2 5 Acknowledgements The work described in this chapter was done in conjunction with Heather Agnew and Steve Millward The initial OBOC screening techniques used were developed by Heather and the colorimetric screening development was done by Steve The rest of the work described herein was performed in conjunction with both Heather and Steve as well as Arundhati Nag and Rosemary Rohde 25 References 1 Agnew H D Rohde R D Millward S W Nag A Yeo W S Hein J E Pitram S M Tariq A A Burns V M Krom R J Fokin V V Sharpless K B Heath J R Iterative In Situ Click Chemistry Creates Antibody like Protein Capture Agents Angewandte Chemie International Edition 2009 48 27 4944 4948 2 Farrow B Hong S A Romero E C Lai B Coppock M B Deyle K M Finch A S Stratis Cullum D N Agnew H D Yang S Heath J R A Chemically Synthesized Capture Agent Enables the Selective Sensitive and Robust Electrochemical Detection of Anthrax Protective Antigen ACS Nano 2013 7 10 9452 9460 3 Pfeilsticker J A Umeda A Farrow B Hsueh C L Deyle K M Kim J T Lai B T Heath J R A
111. hypothesized therefore that a better PSA detection test could be designed to measure this through the use of PCC agents and much of the screening strategies developed in this chapter were focused on the design of this agent Target protein Biligand 9eeec screen Triligand screen Figure 2 1 Iterative In Situ Click Screening Core Technology An anchor ligand that binds to the protein target can be appended with a click handle In the presence of the protein and a OBOC library appended with the opposite click handle the anchor can click onto the library to form a biligand The click only occurs when the anchor and library bead are held long enough on the protein surface so the protein selects ligands with high affinities and selectivities This process can be repeated as many times as necessary 28 29 2 2 Materials and Methods 2 2 1 Standard Materials All amino acids were purchased from Aapptec as the FMOC carboxylic acid with the standard TFA side chain protecting groups HATU 2 7 Aza 1H benzotriazole 1 yl 1 1 3 3 tetramethyluronium hexafluorophosphate and PEGs Fmoc NH PEGs CH2CH2COOH Fmoc 18 amino 4 7 10 13 16 pentaoxaoctadecanoic acid were purchased from ChemPep DIEA diisoproylethylamine TES triethylsilane and TFA trifluoroacetic acid were purchased from Sigma TentaGel beads were purchased as 901m S NH2 beads 0 29mmol g 2 86x10 beads g from Rapp Polymere Germany and Rink Amide resin was pur
112. i3 3 a a A Delete How Sequencer Status Idle CONNECTED Non Secure Mode Figure A 2 Normal1 cLC Gradient A 2 Troubleshooting A 2 1 Computer Errors Freezing or Not Saving Spectra The computer needs to be restarted frequently more so when people use the computer for other uses Try to restart the computer once a week to prevent the loss of spectra and keep people from using the computer for any other purpose especially while the machine is running If a computer error occurs or the computer or sequencer freeze shut down the computer and both the Procise machine and the pumps Turn them both back on and they should sync up properly and continue running 132 A 2 2 Machine Bottle Runs Dry When a bottle on the machine runs dry air bubbles can get into the lines and it will not be able to detect the solvent even after the bottle is refilled In order to fix this the line will need to be backflushed After the solvent bottle has been refilled go to the tab in the Procise software called Manual Control and find the solvent bottle that needs to be backflushed in either the Flask Functions tab or Cartridge Functions tab For example in Figure A 3 the Flask Function Backflush S3 is highlighted Once it is highlighted click execute on the bottom of the screen and watch the bottom of the hose in the solvent bottle until bubbles can be seen coming out Then press All Off to shut of
113. imers for Colony PCR of Inserts sesssssseeseeeeenenen enne enne 117 Figure 5 9 Formula for estimation of phage concentration eese 118 Figure 5 10 Phage Click Screening Strategy sssssseseeeeeeeneeeen enne 119 Figure 5 11 Test of azide incorporation in COli ccccccccesseeceesseeeceeseeeecesseeeeceeseeeeceeseeaeens 120 Figure 5 12 Click It Kit Visuablization of Azide in plil coat protein ssssse 121 Figure 5 13 Gel Image of Colony PCR ssssssssseseseeeeenee eene nnne nennen 122 Table 5 4 Hits from 13 Insert Containing Phages Figure 5 13 cccccccssecessteeeessteeeeeees 123 Appendix A Table A 1 Solvent Compositions eeeeeeee eese eese eerie entente nennen nnt tne tn enano sen nates tn stn e suau 128 Table A 2 Parts and Chemicals Commonly Ordered from Applied Biosystems 128 Table A 3 Parts and Chemicals Commonly Ordered from Sigma Aldrich 128 Table A 4 PulsedLiquid CLC Method sseesess eese eee 129 Figure A 1 Temperature and Pressure Settings eesssssseseeeeeeneennerenen nenne 130 xiv Figure A 2 Normal1 CLC Gradient c cccccsscccessencecesseececeeeeeeeceeseeeecesseeeecssseeaeesseeeaeeeseeaaeess 131 Figure A 3 Procise Screen for Backflushing a Line
114. in Lys Ns for in vivo click with the Pra on the anchor peptide 85 Screens were performed with 300mg of dried library beads swelled at least six hours in 1x TBS 25mM Tris Cl 150mM NaCl 10mM MgCl pH 7 5 buffer Q Preclear Figure 5a Swelled library beads Ju CC 2 were blocked overnight in 596 2 m ftr istas ru i e w v dried non fat milk in 1x TBS then washed with 1x TBS Figure 4 1 Biotin PEG5 yleaf Pra Biligand screens were performed using the yleaf anchor red with a PEG5 spacer black and a biotin tag blue MALDI TOF MS expected M Na 1319 62 observed 1319 89 three times The beads were incubated with a 7 15uM solution of the anchor peptide Biot PEGs yleaf Pra for one hour then washed three times with 1xTBS Five milliliters of a 1 10 000 dilution of streptavidin alkaline phosphatase conjugate in 0 596 milk in TBS was added to the beads and incubated with shaking at room temperature for one hour The beads were washed with a high salt TBS buffer 1x TBS plus 600mM NaCl three times then let shake in high salt buffer for one hour The beads were then washed three times with BCIP buffer 100mM Tris Cl 150mM NaCl 1mM MgCl pH 9 0 and developed by adding 15mL BCIP buffer plus 13uL BCIP and 26uL NBT to the beads in a 150mm polystyrene tray After one hour the purple beads were removed by pipette and discarded The remaining beads were incubated in NMP for four hours to remove trace
115. in Catalyzed Capture PCC Agent Development eio EIE IEEE uetus aimes EIU 26 2 1 2 Prostate Specific Antigen PSA esses enne enne enne 27 2 2 Materials and Methods ccessceesscceesceceeeceeeeneeesaececaceseeeeeesaeeeeaaeeeeeaesseeeesaeeeeaeeseneetens 29 2 2 1 Standard Materials cesi besssosiihcorcchesecoetvebewssehavevactvesdoetsbazasieccvass 29 2 2 2 Peptide Library Construction ccccccccccecessessssecececesessecneseeececseseseaaeeeeeesessseseaeees 29 2 2 3 Bulk Peptide Synthi sis i e ei m I RR RR ER EON NIS 30 2 2 4 Typical Screening Protocol for Fluorescent Dye labeled Protein Target Detection ERES 30 2 2 5 Typical Screening Protocol for Antibody Signal Amplification Target Only Screens M 31 2 2 6 Typical Screening Protocol for an Anti Screen esee 32 2 2 7 Typical Target Screening Procedure During a Multi Step Screen Figure 2 3 33 2 2 8 Typical Screening Protocol for a Preclear esee 33 2 2 9 Typical Screening Protocol for a Click Product SCr N ccccccccccessssestsseeeeeesseesees 34 2 2 10 Peptide Sequencing Strategies ccccsccccccecsssssssseceeececesseseeaececeesseesesenaeeeseesseesees 34 2 3 Results and Discussion eesis oeeaaeaii enne nennen entree en nennen nnne nnns inneren 36 2 3 1 Screening via Fluorescent Dye labeled Protein Target Detection
116. in situ click reaction near the mutated site The peptide fragment epitope sequence used in these studies was MSDVAIVKEGWLKKRGKY Pra KTWRPRYFLLKNDG This 33 mer fragment was capped with an N terminal biotin label for detection in the screen and was purified on a prep scale Dionex U3000 HPLC with a reverse phase C4 column Phenomenex MALTI TOF MS showed a peak for m z 4215 93 for the pure product expected m z 4219 9 3 2 3 CD Spectroscopy of 33 mer Target Peptide Epitope Lyophilized powder of the 33 mer biotin tagged target fragment that was used for screening was dissolved in 500uL of 1x PBS to a concentration of 0 5mg mL Concentrations were estimated by weight and confirmed by A280 measurement on a NanoDrop Experiments were performed using an Aviv 62 CD Spectrometer The machine was purged for 20 minutes with N3 then the 1xPBS blank in a 500uL 1cm cuvette was added and the machine was purged with N2 for another five minutes The spectra was acquired by taking three measurements minute from wavelengths 199 250nM The 33mer fragment sample was then added purged for 5 minutes and was measured exactly as the blank The 33mer cuvette was then removed and 500uUL of 57 7 0M Guanadine HCl pH 2 0 was added to denature the sample This spectra was acquired as above To work up the data the signal in AA from the sample was subtracted from the blank at each wavelength Then the mean residue molar circular dichroism A amp wa was
117. in which the QuikChanges were performed and the mutation is included in the name of the primer Primer Name Mutation Sequence 1 G73A Upper AGG AAG AGT TAA GAG AGG TTT TAA AAA AAG ATG AAA AGT CTG CTCT 1 G73A Lower AGA GCA GACTTT TCA TCT TTT TTT AAA ACC TCT CTT AAC TCT TCCT 2 G319A A321C U TTA AAG GCA AAA TAT GTT TAT GGA AGT AAC TTC CAG CTT GAT AAG GAT TAT ACA CTG 2 G319A A321C L CAG TGT ATA ATC CTT ATC AAG CTG GAA GTT ACT TCC ATA AAC ATA TTT TGC CTT TAA 3 T199G A208C U TGC TGG ATT TGA TAT AAT TAT ATT GTT GGC TGA TTT ACA TGC CTA TTT AAA CCA GAA AGG AG 3 T199G A208C L CTC CTT TCT GGT TTA AAT AGG CAT GTA AAT CAG CCA ACA ATA TAA TTA TAT CAA ATC CAG CA 4 C94A T95C T96C U GAG GTT TTA GAA AAA GAT GAA AAG TCT GCT ACC ATA GGT TTT GAA CCA AGT GGT AAA ATA CAT 4 C94A T95C T96C L ATG TAT TTT ACC ACT TGG TTC AAA ACC TAT GGT AGC AGA CTT TTC ATC TTT TTC TAA AAC CTC 5 _G472C_A473C_T474G_A475C_U GGT TGC TGA AGT TAT CTA TCC AAT AAT GCA GGT TAA TCC GCT TCA TTA TTT AGG CGT CGA TGT 5 G472C A473C T474G M75C L ACA TCG ACG CCT AAA TAA TGA AGC GGA TTA ACC TGC ATT ATT GGA TAG ATA ACT TCA GCA ACC 6 TA84C T485A U TAT CCA ATA ATG CAG GTT AAT GAT ATT CAT TAT CAA GGC GTC GAT GTT CAG G 6 T484C_T485A_L CCT GAA CAT CGA CGC CTT GAT AAT GAA TAT CAT TAA CCT GCA TTA TTG GAT A 7_C499G_A500C_U CAT TAT TTA GGC GTC GAT GTT GCG GTT GGA GGG ATG GAG C 7 C499G A500C L
118. ined from InvivoGen as a pUNO hAKT1 plasmid The DNA was mutated via QuikChange as before so that both a wildtype and E17K version were on hand The primers used to clone the DNA from this vector into a TOPO C terminal GFP mammalian vector Life Technologies were 5 AAGATGGGGATGAGCGACGTGGCT 3 5 TCCCCGACCGGAAGTCCATCTCCTC 3 Cloning into the TOPO vector was performed by following all of the manufacturer s recommended instructions Because the GST PH Domain proteins expressed in E coli were still not stable for long term storage this DNA was used to express the PH Domain in mammalian cells to test the storage suitability of this recombinant fusion protein The expressions were performed by transfecting a suspension culture of HEK 293 6E cells with XtremeGene HD by the Protein Expression Center at Caltech following their standard protocols These proteins were not purified 56 and were used as is out of cell lysates This protein was used in triligand pull down and inhibition assays and was still not stable for long term storage 3 2 2 Design and Synthesis of Epitope Targeting Anchor Target Peptide Epitope targeting for the point mutation of the PH Domain of Akt1 was accomplished by screening against a 33 mer peptide fragment derived from the N terminus of the PH Domain highlighted in Figure 3 6 that contained the E17K point mutation as well as a propargylglycine Pra alkyne click handle substitution I19 Pra for directing the
119. irror exclusively L amino acids and will therefore produce a peptide sequence that is susceptible L target D peptide L peptide D target Phage presented Cy YQ to protease cleavage In order to avoid this Figure 5 2 Mirror Image Phage Display Technique potential problem a technique called mirror image phage display Figure 5 2 has been developed In this technique an L amino acid phage library is screened against a target synthesized from D amino acids in order to find a D peptide that binds to the L target where the D target forms an exact mirror image of the L target Therefore screening against a mirror image of the target and reversing the stereochemistry of the hit peptide binder produces a D ligand that binds to the original L target With the epitope targeting strategy currently used for PCC agent discovery in the lab where a chemically synthesized portion of the protein is used as a target for screening it is trivial to prepare a D amino acid epitope for use in a mirror image phage display screen Using this technique an azide containing phage library can be screened in order to develop D amino acid PCC agents effectively converting the click screening so crucial to our success in PCC ligand discovery from an expensive and time consuming OBOC library method to a simpler quicker biological screening process 5 1 3 G6PD Capture for Malaria Eradication The Bill and Melinda Gates foundation is calling f
120. ith added azidophenylalanine as opposed to 0 108 with control This result indicates that the mutated MjTyrRS for azidophenylalanine is functional and incorporating azidophenylalanine amino acid into the amber stop codon of the protein It also indicates that the conditions used for this incorporation are sufficient to keep the background suppression without the unnatural amino acid to a negligible level 2 312 Test of Azidophenylalanine Incorporation into M13KE Phage After the successful incorporation of the azidophenylalanine amino acid into a protein in E coli the incorporation was tested using a small number of M13KE phage Figure 5 11 Test incorporation in e coli clones that contain representative display peptide sequences similar to the library that was designed for the subsequent in situ click screening The azidophenylalanine incorporation was performed using four phage clones individually and the presence of azide moiety in the collected phages was tested by clicking on an alkyne containing TAMRA dye using a Click It Kit Invitrogen This allowed for the fluorescence visualization of the dye labeled plll protein resolved by SDS PAGE As seen in Figure 5 12 there is one band across three of the four lanes corresponding to 65kDa or the running weight of the plll phage coat protein indicating that three of the four phage clones showed incorporation of the azidophenylalanine The fourth phage could have been incorporating improp
121. l and an irregular sequence seen in Table 4 2 Because there were only two valid hits from this screen both were scaled up and tested in a full curve ELISA assay Figure 4 7 The iryrn triligand showed significantly improved affinity for the E17K PH Domain but this benefit was offset by the drastic increase in affinity for the wildtype PH Domain The ivdae triligand maintains the selectivity seen in the anchor ligand and was chosen asthe triligand whose structure is shown in Figure 4 8 Table 4 2 Hit Sequences from Triligand Screen ivdae WT iryrn WT ivdae E17K iryrn E17K 1 0 0 5 Absorbance 0 0 10 100 1000 10000 Concentration nM 0 5 Figure 4 7 ELISA assays for affinity and selectivity of triligand candidates The iryrn triligand seen in red shows a significant affinity increase but loses much of the selectivity for the E17K mutant PH Domain triangles The ivdae maintains the selectivity and affinity of the anchor ligand and was carried forward as the triligand eyes H Ng N m 0 H o n o i oo 1 NH m N H o g N H i H ANN H H N N H o g oH SA H E H Figure 4 8 Structure of final triligand ivdae Pra Lys Ns yleaf Pra Lys Ns yksy H N H Nw H NH 98 Binding curves that compare the yleaf ligand with the biligand and triligand PCC agents are shown in Figure 4 9 Likely because the expanded binding site for these larger PCC agents
122. lly extended by one or two amino acid positions in the hopes that a slightly longer peptide would have a higher affinity 38 and selectivity for the protein target The screening was then repeated with the focused libraries and the same process for analyzing hits was repeated until the peptide sequences converged in sequence homology and produced a peptide ligand that showed near uM affinity for the protein target This convergence frequently required the use of two to three separate focused libraries with accompanying screening and sequencing The overall time required to determine one peptide ligand that bound to the target protein of interest could easily take more than six months These ligands also regularly bound in the range of low uM affinities which are generally considered to be fairly weak binders Table 2 1 Screens from Sample Target Screen Using Fluorescent Protein Detection This screen was performed against PSA protein labeled with AlexaFluor 647 dye Note the high prevalence of r and k positively charged amino acids See Figure 2 2 for a visualization of the X amino acid positions on bead Xx X2 Xs X4 Xs y r r r r r i f r r r f r a r r k r f m r r w r r r r w p r r w i r r r r f r r w r r f r i r S r r r r r r y t r r m r w r r k p r f y r r r r k w w k r r m r 39 2 3 2 Screening via Antibody Signal Amplification
123. lowing for the use of biologically stable D amino acids and azide alkyne click chemistry handles in the library The Sharpless group showed that the typical azide alkyne click catalyst Cu I speeds upthe reaction but is only barely necessary for it to occur and demonstrated the ability to replace this catalyst with the surface of a protein They took advantage of this to assemble small molecule inhibitors for proteins by breaking up known inhibitors into two components and assembling two libraries each one comprised of pieces similar to its original half of the inhibitor One of these libraries of molecules was appended with a click handle the other library with the opposite click handle When two click reactants bound tightly to the protein surface and in close enough proximity to each other the long dwell time of these reagents allowed for the click to occur without the use of Cu I In this way they were able to bring the two libraries which consisted of variations on the original inhibitor together and use the surface of the protein to assemble the best possible small molecule inhibitor We have adapted this technology to assemble 5 mer peptide sequences displayed on OBOC libraries using the surface of the target protein itself to catalyze a click reaction between peptides that bind tightly to this surface Hence we have termed these capture agents protein catalyzed capture PCC agents This strategy requires that the two compou
124. lus the weight of the linker and dye 1118 11 anti 1308 08 1493 13 1639 20 104520 11909 1179 14 1037 09 Ui hid 1 33 19 Neg 1a opo P1824 Yose 15 1194 1 iil 9 23 1499 13 1640 40 3ps 15 1568 04 042 45 435 1 495 10 abs 1047 14 ji oo o 1202 fe 359 00 498 11 oppos podio 2 02 201 8 1263 A 110112 1384 03 1517 07 1791 08 22 odg MA 132 1 1549 14 244 id c 1348 1 1444 t 5240 H jT 52 bil og id alob IM OM1571 06 dpi 1718 19 abel Mud y d 159998 ErP KWI EN M 967 i jo o I T 1708 33 9 659 76 5 2 a m en Un wa hes n 1 oi Kalih M 185487 1927 84 iO M Beth 3 Mass m z 2 E E B77 2763 1014 3636 65 2957 B6p 3110 1106 7821 ad7 3105 1030 3248 P aphan 1459 8335 1050 343 926 7554 ggd34t 1499 9892 Da25ond 5881 943528 Itgsa 7p 1142 7390 1305 8389 1h27 bea TNT p n 9017 j apt pads o48 761p pi Sea 1 us eee 1290 8233 hae 838 1565 9239 v Aly LE 1248780 4342 7628 4405 bod 501 9574 16 T i Ad h WW S 1649 8939 TON ner 1924 0245 9 rips 727 9160 187 8756 TA sb mel 16b ehh deze so e 1752 954p 1882 0407 0 1080 1310 1540 1770 2000 Mass m z Figure 3 14 Images of Labeled and Unlabeled MALDI TOF Spectra of Unlabeled top and Labeled bottom Proteins These peaks were then analyzed by MALDI TOF TOF MS to extract sequence information for the labeled regions of the protein All but one of the dye labeled peptides were difficult to fragment as is char
125. mes in BCIP buffer and developed as per the preclear Purple beads are removed from the screen via pipette and are considered hit beads These hits were incubated in the guanidine HCl buffer to remove attached streptavidin washed ten times with water and sequenced via Edman degradation on a Procise CLC 494 system from Applied Biosystems See Table 3 2 for the 5 hour sequences and Table 3 3 for the 16 hour overnight sequences 59 Precleared Library UC RTA serie D sueptavisin 9 a Alkaline Phosphatase iad EE Phosphatase Binders Precleared e cu Library Strip Peptide o 7 3 merTarget mer Target Streptavidin Alkal Peptide Phosphatase Hits Figure 3 2 Screening Strategy for Anchor Ligand Determination a Preclear Library beads are incubated with streptavidin alkaline phosphatase conjugate to remove any library beads that bind to this or the BCIP reagents b Product Screen Precleared library beads are incubated with the 33 mer target peptide containing an azide in situ click handle The fragment catalyzes triazole formation between the alkyne on the 33 mer target and the azide on beads that contain peptide sequences that bind specifically to the 33 mer in a close enough proximity to the alkyne substitution for a click reaction to occur without copper The unclicked peptide is then stripped from the beads and the remaining covalently attached 33 mer is detected by streptavidin alkaline phosphatase with BCIP development
126. metal screw 135 Figure A 4 Dip at Front of Spectra Indicative of Bad Pump Seal A 2 5 Baseline Errors Stretched Out Amino Acid Standards If the amino acid standards look very stretched out and are not completing by the end of the HPLC run or if the DPTU peak is shifting from cycle to cycle there is most likely a leak in the pumps This is a fairly easy fix which requires looking at all of the screws around the pumps One of them will more than likely have a ring of salt around it Wash the salt off and tighten the screw turn It should fix the spectra problems immediately A 2 6 Pressure Errors Change Bottle Seals Occasionally when the machine has difficulty adding a solvent it is due to a faulty rachet cap assembly or the part that the bottle screws into on the machine In order to test this go to the Test Procedure tab on the Procise software and select Leak test Scroll down to the appropriate bottle and try a leaktest If it fails but the bottle is screwed in tightly this assembly should be replaced See page 9 19 in the User Manual for details on this procedure Once this 136 assembly has been replaced the seal should no longer leak and the solvent delivery should function as normal RW PROCISE Test Procedure aea Fie Edit Sequencer Help PROCISE Test Procedure 7 AS depleted DUM d MODEL INFORMATION ABOUT Select a Test Fl Startup Idle Init Sensor E Shutdown
127. mon non ou Cleave phage clic Covalent phage phage hits from bead Target Epitope Precleared Library Amplify hits in On bead ecoli Another round of panning DNA isolation for sequencing Figure 5 10 Phage Click Screening Strategy a The phage library is precleared for TentaGel and sticky binders by preincubating the library with a scrambled epitope on resin b The phage are then incubated with the target overnight for a click to form washed extensively and eluted from the resin by thrombin cleavage for amplification in e coli or titering and sequencing 5 3 Results and Discussion 5 3 1 Test of Azidophenylalanine Incorporation into a Protein in E coli The first test was to determine whether and if so in which condition the suppressor plasmid pAC AzPheRS 6TRN created by the series of mutagenesis described in 5 2 1 is effective in incorporating azidophenylalanine into a recombinant protein in E coli in response to an amber codon Because the plasmid contains a chloramphenicol resistant marker Cm with an amber codon in its coding sequence CAT D112TAG this antibiotic resistance is only conferred upon successful suppression of amber codon to synthesize the full length protein When grown in the presence of chloramphenicol in a liquid medium only the culture containing the 120 azidophenylalanine amino acid was able to survive as seen in Figure 5 11 with measured ODs of 0 639 w
128. n and treatment Chapter 3 describes the use of a general all chemical epitope targeting strategy that can focus PCC agent development directly to a site of interest on a protein surface This technique utilizes a chemically synthesized chunk of the protein called an epitope substituted with a click handle in combination with the OBOC in situ click chemistry libraries in order to focus ligand development at a site of interest Specifically Chapter 3 discusses the use of this technique in developing a PCC agent specific for the E17K mutation of Akt1 Chapter 4 details the expansion of this ligand into a mutation specific inhibitor with applications in therapeutics Acknowledgements must start by thanking my family without whom would not be where am today My parents Ed and Diane have supported me in every way possible since the day was born You both have raised me and the world s best brothers both pretty incredible people Matt and Shawn to be like yourselves strong confident intelligent and hard working With the tools with which you have equipped me for this life anything is possible The closeness of my family astounds me and have the honor of saying that some of my best friends were destined to be a part of my life from birth To my immediately family but also my extended family including my grandparents Clarence and Mary Ann Badar and my vast network of aunts uncles and cousins thank you for always being there
129. nds are high affinity selective binders for the target that is acting as a catalyst because the click reaction does not occur without a long dwell time between the two agents PCC agents have been developed against a 18 number of protein targets and have been shown to exhibit a selectivity and affinity similar to those of monoclonal antibodies They also can be readily integrated into all standard protein assay formats Chapter 2 of this thesis describes the technology development process that was undertaken to optimize the screening stages for the production of high affinity ligands to targets of interest Optimizing the in depth screening procedure has allowed for the rapid expansion of this project in the past few years This detailed in situ azide alkyne click screening technology is now regularly used to develop peptide affinity agents that mimic the performance of antibodies 1 These affinity agents that maintain the stability of small molecules can be made to replace biological reagents 1 5 lowering the cost and increasing the robustness of detection assays 1 2 Epitope Targeting Strategies The detection of single amino acid point mutations in proteins is critical in the identification of specific patient populations that will respond to targeted therapies in the new era of personalized medicine The current techniques for mutation detection rely on either capture and measurement of these proteins through antibodies or on
130. ns up to 10 members only a portion of which are screened The library screening and hit picking methods are exceptionally time consuming and labor intensive hindering rapid peptide discovery The sequencing of OBOC libraries is also done by either Edman degradation or MALDI TOF TOF rendering the sequencing process expensive time consuming and reliant on expert knowledge Many of these drawbacks are also a huge barrier to entry in this field limiting the labs that would be able to assist in the advancement of the science PCC agents could be produced significantly faster and cheaper with library display technology that would combine the advantages of the OBOC product screening techniques and library design with the rapid screening and sequencing of genetically displayed libraries Recent advances in biology have made it possible to incorporate unnatural amino acids into the genetic code Schultz has shown that through the use of amber suppression azide containing amino acids can be incorporated in specific locations into the plll coat protein on an 22 M13 phage The Methanococcus jannaschii amber suppressor tRNATyr MjtRNA and the mutant M jannaschii tyrosyl tRNA synthetase MjTyrRS DNA can be contained in one plasmid that can be used to express these amber suppression tools in E coli In this system the mutant synthetase is used to attach the unnatural amino acid azidophenylalanine to the tRNA in vivo allowing for its incorporation
131. ntly pull the cylinder off of the post One of the pump seals that needs to be changed is the one on the end of the post It is frequently hard to remove and 134 can be sliced off or yanked with pliers The second pump seal is the ring inside of the metal part at the top of the cylinder pull this off to expose the seal To put the cylinder back onto the post do NOT just push If it is not aligned correctly this can damage the inside of the cylinder which cannot be replaced Use the metal alignment tool in the spare parts drawer This part has two pieces that come together to form a tunnel that fits onto the end of the cylinder through which you can slide the cylinder post Before doing this take a piece of Parafilm to cover the hole into the pump cylinder If one of the metal alignment pieces falls in it will be VERY difficult to remove Then while holding the metal pieces to the end of the cylinder align this with the post and apply steady but hard pressure to push the cylinder onto the post You will feel a click when it is on properly and it will not pull back off if you tug on it Then by tilting the cylinder back and forth pull off the metal alignment pieces then the Parafilm Use the purge function to pull this cylinder back down into the pump One that is in it will need twisted so that it aligns properly and slides into place There is a notch it must fit into Then the black ring can be screwed back on followed by the
132. of alanine amino acid to be incorporated in phage this project is to synthesize a randomized 7 amino acid phage display rary peptide library containing an azide amino acid at a fixed position coded by an amber stop codon TAG to translate the click product screening technology into a biological library screening and to demonstrate the use of resulting azide phage library in in situ click screening The 7 randomized amino acid library will dramatically increase the number of peptide sequences that can be panned in each screen For comparison a complete OBOC library of 5 amino acids is sampled in 660 mg of library beads To sample each sequence one time in a library the size of the 7 mer it would require 447g of beads a practically impossible task using our current methods In the phage display screen however it is trivial to completely oversample this 7 mer library 100 times in each screen a huge advantage of the biological display technique The strategies for discovering PCC agents with these libraries should be nearly identical to those previously developed for the OBOC click libraries except that a much greater sequence space can be sampled with each screen due to the physical size of the library and screening and sequencing steps can be performed significantly faster 104 5 1 2 Mirror Image Phage Display One of the disadvantages common to L target h Q phage display is that the library will contain m
133. om 200 210 nm could be due to the biotin label that has been attached to the fragment or be due to the absence of the rest of the protein causing random coiling or unfolding 33mer s Denatured 33mer Figure 3 9 CD Spectra of 33mer Epitope Fragment used in Screening The blue spectra indicates the 33mer target fragment that was used in screening the red indicates the denatured epitope 3 3 3 Verification of the Epitope Targeting Strategy The biotin modified yleaf peptide Figure 3 3 was subjected to a variety of binding assays against the synthesized WT and E17K 33 mer PH Domain fragments prepared without the biotin label and alkyne click handle These assays were instead labeled with an N terminal 6 His tag in 74 order to have an alternative detection handle to the anchor ligand First the yleaf peptide was used in immunoprecipitation assays to pull down either the WT or E17K mutant 6His tagged 33 mer peptide fragments as opposed to the full length proteins that were used to initially validate the candidates Typical immunoprecipitation assays involve western blotting to estimate the amount of protein binding but peptide fragments are too small to be consistently captured or quantified on a blot Because of this the amount of peptide epitope precipitated in these assays was quantified via injection onto an analytical HPLC These unique immunoprecipitation assays further confirmed preferential yl
134. op Del X1 Cart bottom Del X1 Cart sensor Flask Function 451 Del R4 Flask 152 Load R4 Flask sm loop 153 Load R4 Flask Ig loop 154 Vent R4 155 Flush R4 156 Backtlush R4 157 Del R4 Waste Del X1 Waste 161 Del R5 Flask Load X1 Cart sm loop 152 Load R5 Flask sm loop Load X1 Cart Ig loop Vent X1 Regulators 4 Active Reaction Func 153 Load R5 Flask la loop 164 Vent R5 Regulators Active Conversion Func Valves Sensor Sequencer Status Idle Figure A 3 Procise Screen for Backflushing a Line A 2 4 Valves Sensor All Off Execute HH wconnecten Baseline Errors Dip at front of Spectra Non Secure Mode A dip at the front of the spectra as seen in Figure A 4 causing difficulty in reading the amino acid sequence is a fairly common problem that indicates that the pump seals need to be changed In order to do this you must unscrew the grey metal screw going into the pump cylinder then unscrew the black ring around the top of the cylinder Remove the cylinder by using the purge function of the pumps to purge the pump you are working on and PUSH the cylinder out NEVER PULL the cylinder out it could damage the pumps which are nearly impossible to replace on this machine Once the cylinder has been pushed out fully and starts getting pulled back in push stop to keep it out Ge
135. or the eradication of malaria but this is a serious challenge that can only be addressed through the elimination of asymptomatic and chronic infections There exists currently a family of drugs the 8 aminoquinolines such as primaquine which can completely clear a person of infection termed a radical cure regimen and can thereby reduce the transmission of the disease Unfortunately people with a glucose 105 6 phosphate dehydrogenase G6PD deficiency the most common enzymatic deficiency in the world risk severe and life threatening reactions to the standard treatment with this medication which in turn requires a significantly different dosing method to effectively cure patients with a G6PD deficiency Therefore in order to successfully employ the primaquine radical cure strategy for malaria eradication effective methods to rapidly determine a patient s G6PD activity need to be developed immediately so that it is possible to administer the appropriate dose of the medication as quickly as possible The G6PD is found in red blood cells and assists in the formation of NADPH from NADP conferring protection from oxidative stress Deficiencies normally arise from mutations in the G6PD gene that produce proteins with less than optimal function reducing the overall enzymatic activity There are about 140 known mutations of this protein most of which are single base changes which can adversely affect the G6PD activity Current gold
136. oration into M13KE Phage Four phage clones with variable display sequences of Amber AHEATH Amber SHEATH Amber RHEATH Amber THEATH in M13KE phagemid were purchased from Antibody Design Labs M13KE phagemid also contains the lacZa gene for blue white plaque screening A naturally amber suppressing strain of E coli XL1 Blue was transformed with each individual clone and plated on LA agar plate supplemented with tetracycline 12 5 ug mL IPTG 50 ug mL and X gal 40 ug mL in top agar following the procedure described in Ph D Phage Display Libraries Manual New England Biolabs ref An overnight starter culture of E coli Top10 F transformed with pAC AzPheRS 6TRN was diluted 10 fold into 10 mL of LB supplemented with ampicillin 100 ug mL 111 and tetracycline 12 5 ug mL and grown at 37 C in the presence of 2mM azidophenylalanine for two hours A blue plaque from each individual clone was added to the culture from the fresh plates and cultures were further incubated for five hours The cultures were centrifuged at 4500 rpm to remove the cells and the phages were precipitated overnight at 4 C by collecting the top 8 mL of the supernatant and mixing it with 1 6 mL of 20 w v PEG 8000 in 2 5M NaCl PEG NaCl An alkyne labeled TAMRA dye was clicked onto the azide moiety on the azidophenylalanine containing phages using the Click It Kit Invitrogen according to the manufacturer s instructions and the resulting phages were resol
137. ormed by incubating the scrambled peptide resin with a phage screening solution containing 2 pL sterile filtered human serum 2 uL of the original library 75 x 10 total phages and 196 uL TBS for 30 minutes at room temperature The beads are spun down and the supernatant containing the phage that did not bind to the scrambled peptide is added to the target epitope resin and incubated for one hour at room temperature Extensive washes are performed to ensure that the least number of non specific and naked phages remain five times with TBST 30 minutes shaking in TBST five times with TBST five times with high salt TBS 2 5 M NaCl 30 minutes shaking in high salt TBS five times with high salt TBS five times with TBST five times with TBS 10 minute shaking with TBS five times with TBS and two times with CaCl thrombin buffer 1 mM CaCl in TBS The last wash step is retained and titered to ensure no phage are eluting The target beads are then incubated with 4 units of thrombin in 200 uL CaCl buffer for 24 hours at room temperature to elute hit phages This step should elute only the phages that have a thrombin cleavage tag After incubation the 200 uL of thrombin cleavage cocktail was removed from the 117 beads and the beads were washed five times with 200 uL TBS to remove all of the cleaved phages The washes were combined with the thrombin eluent The target beads are then acid bumped by adding 1mL of 0 2 M glycine HCl 1mg mL BSA bu
138. per slide The slides were imaged on a GenePix 31 Pro 5 1 microarray scanner at 635nm to view beads containing bound fluorescent protein target The dye saturated the color signal of the GenePix and the hit beads that were considered appeared white in a sea of red due to the background auto fluorescence of the TentaGel library Figure 2 4 These hit beads were then removed from the microscope slides using a needle stripped of protein with 7 5M pH 2 0 Guanadine HCl buffer rinsed in water and sequenced via Edman degradation on an Applied Biosystems Procise CLC 494 system 2 25 Typical Screening Protocol for Antibody Signal Amplification Target Only Screens 100mg of library beads were prepared washed and blocked for one hour as for the fluorescent detection screen The library was then incubated with about 50nM which differed slightly based on the exact screen of protein overnight at room temperature In the morning the library was washed five times with 1xTBS 0 1 BSA 0 1 Tween 20 1xTBSTB The primary anti protein target antibody was incubated with the library for 1 hour washed five times with the 1xTBSTB buffer then incubated with the secondary anti mouse alkaline phosphatase antibody for one hour The library was then washed five times with the TBSTB buffer three times five minutes each in high salt buffer 1xTBS 600mM NaCl and five times in 1xTBS The screen was developed with a two part BCIP NBT system 10mL TBS 26 u
139. philic Sn2 reaction with proximal nucleophilic amino acid side chains Figure 3 12 The protein can then be trypsin digested and the identity of the fragments containing the payload can be mapped on the protein spectrometry MS Thus the site of ligand binding can be estimated independent validation of the immunoprecipitation and ELISA binding assays discussed above For the assay yleaf was modified at the N terminus to contain a tosylate linker attached to a surface using mass The assay also serves as an Figure 3 13 Fluorescent Gel Image to Confirm Cy5 Labeling Lane 1 shows the control protein with no label and Lane 2 shows the labeled protein The large band corresponds to the labeled GST E17K Akt1 Cy5 dye molecule to enable easy identification of the labeled and digested protein fragments Figure 3 4 Akt1 E17K protein SignalChem was incubated with the Cy5 appended yleaf peptide A Glutathione S Transferase GST The labeling of the protein target was initially confirmed by visualization on a fluorescent gel reader 77 Figure 3 13 The labeled protein and an unlabeled control were then trypsin digested from the gel and were analyzed by matrix assisted laser desorption ionization time of flight MALDI TOF MS Figure 3 14 Five peaks appeared in the MS of the labeled protein that were not present in the unlabeled protein digests which all corresponded to an expected trypsin fragment p
140. purple precipitate from the BCIP NBT reaction then were washed five times with methanol five times with water five times with TBS and blocked overnight in 596 milk Target Screen Figure 5b The clear beads remaining from the preclear were blocked in 596 milk in 1x TBS for two hours They were then washed three times with 1x TBS A pre incubated solution of E17K mutant 86 protein 715nM and anchor ligand 7 15uM in 3mL of 0 5 milk was added to the blocked library beads and incubated for either five hours or overnight to allow an in situ click reaction to occur In the morning the beads were washed three times with 1x TBS then incubated with a 1 4 000 dilution of an anti His Alkaline Phosphatase conjugated antibody Abcam in 0 596 milk for one hour The beads were then washed three times with a high salt TBS then incubated on the shaking arm for one hour with the high salt buffer They were then washed three times with BCIP buffer and developed as previously Hit beads turned purple and were removed and washed in NMP for four hours to decolorize then guanidine HCl to denature and remove and remaining protein The beads were then washed ten times with water and blocked in 596 milk overnight Off Target Anti Screen Figure 5c The beads from the target screen were washed three times with 1x TBS then incubated with the off target wildtype PHD protein in 0 596 milk for one hour on the shaking arm at room temperature The beads w
141. roup This method has been generalized by directly substituting an alkyne click handle into the chemically synthesized peptide epitope For this work the peptide represents the epitope of Akt1 containing the E17K mutation an attractive target due to the oncogenic nature of this mutation That target is subjected to an in situ click screen against an OBOC peptide library of 5 mers comprehensive in 18 amino acids each terminated in an azide presenting amino acid This generalized technique allows us to focus our PCC agent development to a location on the PH Domain that is adjacent to the E17K oncogenic mutation The approach yielded a 5 mer peptide that exhibited a 10 1 selectivity for E17K Akt1 relative to wild type WT We exploited the chemical flexibility and modularity of the PCC agent to append a dye and a cell penetrating peptide The resultant ligand could selectivity image the E17K Akt1 protein in live cells again with high selectivity relative to WT The technique for epitope targeting described herein provides a general approach for the synthesis of small molecule peptides that are capable of selectively distinguishing between WT and mutant proteins in cancer These small molecule peptides would be useful tools for disease detection assays as well as provide a path towards the inhibition of their target proteins 54 32 Materials and Methods oT Akt1 PH Domain Expressions Akt1 Pleckstrin Homology Domain DNA was purchased from DNA2 0
142. s to find all of the hit beads that have an affinity for the target These beads were then be stripped of their purple color and bound proteins and incubated with the off target protein that had the post translational modification removed Any purple hits from the anti screen were thrown out as not specific for the modification since they demonstrated binding in a screen that did not contain the site of interest This new screening step has the added benefit of removing all of the hits that also have an affinity for the antibodies or developing solution that was used in the screen An anti screen like this would have prevented the development of a biligand with an affinity for the anti FLAG antibody as these hits would have been detected in both the target and the anti target screen and would have been discarded The anti screen is an important step that is now incorporated into each screen that is run in the lab and is responsible for a significant reduction in background hits For example an anti screen that was run for the PSA protein eliminated 9196 of the hit beads from the target screen indicating that approximately 9196 of what was previously considered to be a target hit was just background For visualization purposes Table 2 3 this means that a screen run with 250mg of beads went from 167 hits down to 15 after this step This cut down on not only sequencing and hit analysis testing time but also eliminated the time that was usually spent
143. s treating a peptide with a free amine terminus with phenylisothiocyanate which reacts stoichiometricly with the N terminus of the peptide to form a phenylthiocarbamyl PTC peptide derivative This PTC derivative is then treated with TFA to cleave it off from the rest of the peptide leaving behind a new N terminus to react during the 35 next cycle Meanwhile the PTC amino acid is then analyzed via HPLC and the peak is compared to standards of all of the PTC amino acids in order to determine the residue One cycle per amino acid residue is performed and analyzed providing the sequence of the peptide on the hit library bead This method is slow but highly accurate and has been automated by Applied Biosystems into the Procise CLC 494 Automated Edman Degradation machine used by Caltech Hit peptide sequences can also be determined through MALDI TOF TOF MS For this method the library must be specially made The peptide must be attached to the library through a methionine amino acid and no other methionine can be present in the library The isobaric amino acids isoleucine and leucine lysine and glutamine are doped by anther amino acid in order to properly call the sequence by mass Glutamine is doped with a 6 molar equivalent of glycine and isoleucine is doped with a 7 molar equivalent of alanine While reading the mass of these amino acids on the MALDI any residue that has one of these amino acids can be distinguished by the presence or
144. stem and have allowed me to focus more on research and less on paperwork Elyse Garlock Joe Drew Carlos Rodriquez Cora Carriedo Ron Koen and Steve Gould to name a few also must thank Jost Vielmetter and his team at the Protein Expression Center PEC for being so amazingly helpful all of the time Felicia Rusnak and Jie Zhou at the Protein and Peptide Mass Analysis Lab PPMAL for all of their help vii and experimental input over the years And Mona Shahgholi for always be willing to chat and her advice and assistance with MS techniques and experiments There is sometimes a life outside of lab and mine was far richer for the people that were in it To Tim Mui thank you for being the world s greatest roommate running buddy and sounding board To Kristina Daeffler Chris Daeffler Renee Thomas Catrina Pheeney and Matthew Van Wingerden for always being up for a good game be it board or football or a good bottle of wine Both of these are better with friends To the Robinsons Diane Brent Katherine and Brenna for opening up your lives and your home and grill to Casey and me whenever we wanted or needed the company Your support has been indescribable these past few years and we consider you our extended family To my twin Joe Zewe for being never more than a phone call away and for always somehow knowing exactly what to say raise my phone shot of Jack to you sir To my soul mate and maid of honor Jessica Nichol
145. t of interest were used to minimize the number of naked phages present in the incorporation step The target screens eluted with thrombin cleavage were able to reduce the total amount of naked phage seen on titer plates to about 1896 Unfortunately when this pool of eluted target hits was amplified using a naturally suppressing E coli strain XL1 Blue this number rose to 8596 too high to use for any incorporation An enrichment strategy that can reduce the number of naked phage to a manageable level has yet to be achieved 122 5 3 4 Focused Library Screening Because the amount of naked phages cannot be reduced to a level that would allow for successful azidophenylalanine incorporation a focused library was designed from the insert containing hit phages isolated from a target screen Figure 5 13 shows a result from the plaque PCR that was Figure 5 13 Gel Image of Colony PCR This test for library insert shows only 3 naked phage lanes 2 4 and 6 Out of 16 plaques total not all shown on this gel 13 contained an insert and were used for the focused library containing inserts In this gel each lane represents a completed after a target screen to search for phages single hit clone and lanes 2 4 and 6 show naked phages as indicated by the PCR product of lower molecular weight The phage plaques that were tested in this PCR were also individually amplified in 1mL cultures in order to create a small pool of each
146. the pJExpress vector restriction enzyme digested and ligated overnight into a pGEX 4T 1 vector that attached an N terminal GST tag to the PH Domain protein BL21 DE3 pLys cells were transformed with the DNA confirmed correct via sequencing An overnight starter colony from each protein was grown in 5mL LB 100 ug mL Amp overnight 4mL of this starter culture was used to inoculate 500mL of LB Amp and grown to mid log phase The cultures were inoculated with 1mM IPTG and grown 55 5 hours at 28 C The cells were spun down for 10 minutes at 8 000 RPM and lysed with lysis buffer 1x TBS 1mM DTT 1mg mL Lysozyme 1 Triton X and left for 30 minutes on ice before flash freezing in liquid nitrogen Upon thawing on ice the lysate was sonicated for 5 minutes then centrifuged for 30 minutes at 10 000 RPM to remove cellular debris The supernatant was then purified on a HisPur Co column Pierce using the recommended protocol These GST tagged proteins were used to confirm the biligand binding via immunoprecipitation assays and for the triligand screens They were also used to obtain the full ELISA curves of all three ligands These proteins however were also not suitable for long term storage and needed to be re expressed for all assays The imaging experiments required that the PH Domain protein be expressed in mammalian cells and have a GFP tag for visualization Because of this Akt1 DNA with codons optimized for use in mammalian cells was obta
147. tly this deregulated recruitment of Akt1 to the cell membrane causes constitutive activation of the PI3K pathway which has been shown to be sufficient to induce leukemia in mice The oncogenic properties of the driving E17K single point mutation make it a target for specific detection and inhibition m SEN V arms v D aw Tyria Figure 3 1 PH Domain Binding Pocket Changes upon E17K Mutation a Interaction between Lys14 and Glu17 in binding pocket of wildtype PHD b repellent interaction between Lys14 and Lys17 in the binding pocket of the E17K mutant and c new hydrogen bonds to water with the E17K mutation in complex with the PIP3 substrate 3 53 Qui A General Strategy for Targeting Single Amino Acid Point Mutations in Proteins Targeting single amino acid point mutations in proteins is becoming a necessary step in the era of personalized medicine and methods for the detection of these mutant protein biomarkers are highly desirable for guiding treatment decisions Thus there is a need for an approach to identify small molecules that can be generally targeted against epitopes containing single amino acid point mutations and can also potentially be developed into cell penetrant inhibitors Previously a strategy was developed for targeting the phospho epitopes by chemically synthesizing the surrounding chunk of protein and focusing the site of the in situ click screen by attaching an azide click handle to a phosphate chelating g
148. tol 3 Kinase AKT pathway in human cancer Nat Rev Cancer 2002 2 7 489 501 3 Carpten J D Faber A L Horn C Donoho G P Briggs S L Robbins C M Hostetter G Boguslawski S Moses T Y Savage S Uhlik M Lin A Du J Qian Y W Zeckner D J Tucker Kellogg G Touchman J Patel K Mousses S Bittner M Schevitz R Lai M H T Blanchard K L Thomas J E A transforming mutation in the pleckstrin homology domain of AKT1 in cancer Nature 2007 448 7152 439 444 4 Rusling J F Kumar C V Gutkind J S Patel V Measurement of biomarker proteins for point of care early detection and monitoring of cancer Analyst 2010 135 10 2496 2511 5 Nag A Das S Yu M B Deyle K M Millward S W Heath J R A Chemical Epitope Targeting Strategy for Protein Capture Agents The Serine 474 Epitope of the Kinase Akt2 Angewandte Chemie International Edition 2013 52 52 13975 13979 6 Corr a D H Ramos C H The use of circular dichroism spectroscopy to study protein folding form and function African J Biochem Res 2009 3 5 164 173 7 Lee S S Lim J Tan S Cha J Yeo S Y Agnew H D Heath J R Accurate MALDI TOF TOF sequencing of one bead one compound peptide libraries with application to the identification of multiligand protein affinity agents using in situ click chemistry screening Anal Chem 2010 82 2 672 9 8 Towbin H Staehelin
149. trying to tease out signal from noise Focused screens were also no longer necessary as that step was designed to help enrich for signal eliminating a significant chunk of time necessary for developing a capture agent Current screening protocols have evolved significantly to include stringent anti serum anti screens in order to make capture agents that can function in the most complex mediums such as out of blood and in cells For these anti screens the decolorized target hit beads are 43 incubated with anywhere from 196 2596 human serum to remove even the marginally sticky peptides from the pool of potential candidates e T t eo D Specific Hits e e 27 x Off Target Human Serum Initial Hits Non specific Hits Figure 2 8 Sample Anti Screen Step The target hits are stripped of target decolorized and incubated with an off target or general interferent such as human serum The off target is detected with an off target antibody the target antibody should also be included if it is different and these purple beads are non specific binders which are removed The clear beads are specific for the target 2 3 4 Introduction of a Click Product Screen The in situ screening process has an inherent screening advantage that had not yet been exploited A covalently linked product is formed on the surface of the bead during the screen that can be detected separately from target binding This means that in addition to
150. ture PCC agent production After a PCC agent has been discovered using this technique the Cu l catalyst can be brought back in order to scale up the final click triazole containing product in high quantities 27 The technology as presented by Agnew et al provided a solid foundation for the construction of these PCC agents but the methods discussed in section 2 3 1 were time consuming and labor intensive making rapid ligand discovery very difficult After this BCAii proof of concept PCC agent was completed the next stage of technology development required an optimization of the techniques involved in order to increase the robustness and output of the overall process This chapter describes the transformation of the OBOC iterative in situ click technology into an efficient and robust technique 2 1 2 Prostate Specific Antigen PSA Prostate Specific Antigen PSA is a serum protease produced by the prostate The accurate detection of PSA levels in the blood can be a strong indicator of the presence of prostate cancer but this result is confounded by the elevated PSA levels also seen in Benign Prostate Hyperplasia BPH a non cancerous condition In serum PSA is partially in complex with o antichymotrypsin ACT with 60 9596 generally found as a PSA ACT complex while the rest of the PSA remains free It has also been discovered that the PSA ACT fraction is larger in prostate cancer whereas BPH has more PSA free in serum It was
151. uartz sample holders are VERY expensive and chip easily Do not drop them and be very careful when handling them Once the top sample holder is out there should be a used filter and cartridge seal that can be removed and thrown out A new cartridge seal is slid into the cartridge on top of the bottom sample holder that was left in place A new filter gets tapped into the groove in the top sample holder that was removed It can be gently tapped in place with tweezers The bead is placed onto this filter and the whole cartridge is then turned upside down with the bottom sample holder and cartridge seal held in place by a finger on each side of the cartridge and slid down on top of the top sample holder that has the bead on top Then the cartridge can be turned right side up the lid can be screwed back on and it can be placed back into its slot on the Edman The run is set up on the Procise software on the computer Each run should be set to use the PulsedLiquid cLC method unless a special one is required The cycles should be set to equal the number of desired amino acids plus 3 one warm up cycle one blank cycle and one standard cycle that run automatically All of the solvent bottles should be checked to ensure that the levels are appropriate for running the desired amount of cycles You can check the amount of each solvent required by clicking the button on the bottom of the screen 127 It will provide an amount in mL requir
152. using principal component analysis Figure 3 7 Based upon this analysis five ligands that represented the diversity of hits circled in Figure 3 7 were scaled up with a biotin tag and tested for binding to both E17K and WT full length PH Domain These hits were dqntr ypwve eefef yleaf and elnhy Here the lowercase sequence letters indicate that the amino acids that comprise the peptide are non natural D stereoisomers Table 3 2 Hit Sequences from Anchor Screen against 33 mer peptide epitope 5hr click screen Az2 G V e k f Az8 y h e w f Az4 i S e y e Az2 p h w k f Az8 d f Az4 a r S d f Az8 f k l t Az8 f e i q Az8 e e p d n f 71 Table 3 3 Hit sequences from Anchor screen against 33 mer peptide fragment 16hr screen Az4 e e f e f Az8 f e e a i Az2 e n h y Az2 h a r h q Az2 h e w V t Az4 n w y a w Az4 n V p n Az2 r r r f Az4 a n S k Az8 p a y h Az2 n r y V r Az8 y e a f Unsupervised Clustering of Sequenced Ligands by AA Similarity 9 random 081011 33merScree QFKWE Qt e v LPO ANK QU va e ee tur HARWQ LLL e 9 editi Mind a e Se vu wc UTI 2 i r ii Be y A 4 GGGGS ev O E a Oaar ee e DDDDD tHewr o s t e e e vesc 2e GVEKF g ug me bg e ee rale nsor A e Frm Figure 3 7 Clustering of Anchor Sequ
153. usion protein was used to approximate what the commercial protein looked like in solution and give an idea of the extent of the selectivity of this assay The concentration of labeling sites only surrounding the epitope demonstrate the exclusive binding of this ligand in solution 3 2 10 Details of the MALDI TOF Analysis of Tryptic Peptide Fragments All of the peaks from the MALDI TOF spectra of the labeled tryptic digests were analyzed for their potential to contain a dye label The MALDI spectra were manually calibrated to ensure the least possible error Each peak was then analyzed by zooming in on the spectra on the 65 computer and obtaining the exact mass for the monoisotopic peak which is recorded as MALDI peak in Table 3 1 below The mass of the dye 552 37g mol was subtracted from this peak and it was compared to the closest possible theoretical tryptic digest fragment Digest The expected mass of the digest plus the dye was calculated and subtracted from the observed mass MALDI peak and the absolute value of this difference was recorded in P M 1 The peak area was obtained from the MALDI data and added to the spreadsheet as Peak Area to allow for a cutoff 4500 of any peaks that looked to be within the noise Any peak below this value is shown in red italics and was not considered for this study Any peak that was within 0 196 of the mass of the expected digest mass was considered to be within error of the instrument
154. ve also shown involvement in the covalent click reaction The clear purple 49 clear purple pattern of hit detection also ensures that the beads are behaving properly at each stage in the process Screens following this pattern now have several produced high affinity ligands that are very selective to their target of interest This methodology has an incredibly high success rate that is only getting better as the process continues to grow and develop 2 4 Conclusions Over the past ten years in which the project has been in existence protein catalyzed capture PCC agents have proven to be highly effective detection agents that are incredibly stable and easy to synthesize These agents can be made almost entirely with robotics for ease of scale up and the capture agents are highly modular so the addition of labeling tags is trivial The exact chemical structures of each of these capture agents are known eliminating the batch to batch variability that is common with antibodies and can cause multiplexed assays to be expensive and difficult to produce A spin off company InDi Molecular is in place for commercialization of these agents PCC agents are also completely stable demonstrating no degradation upon incubation with mouse liver enzymes and full functionality after being stored at 65 C as a powder for weeks demonstrating their excellence for use in anything from clinical work to detection of diseases in third world countries T
155. ved by SDS PAGE The gel was then imaged on a Typhoon imager using the preset settings for TAMRA dyes 5 2 4 Synthesis of M13KE Azidophenylalanine Terminated 7 mer Random Library The peptide library was designed to have the following sequence when expressed on the surface of the plll coat protein of the M13KE phage A Amber X1X2X3X4XsX6X7 G L V P R G S plll protein The N terminus of the display sequence has a fixed alanine amino acid to provide a non charged spacer at the signaling peptide cleavage site to ensure proper expression of the azide incorporated final plll protein The amber codon the site of the azidophenylalanine incorporation follows the N terminal alanine and precedes then the randomized 7 mer amino acid region This library sequence is separated from the rest of the plll protein by a thrombin cleavage site LVPRGS to allow the enzymatic cleavage of a clicked phage hit from a matrix immobilized target The phage library was built by Antibody Design Labs using standard NNK codon where N encodes an equimolar amount of cytosine guanine thymine or adenine bases and K encodes only guanine or thymine By designing the library in this fashion some of the redundancy of the third codon as well as two of the three possible stop codons TAA and TGA are eliminated 112 The final DNA library contained about 7 65 x 10 total transformants and about 90 of that library contained inserts for a total sequence diversity of 6
Download Pdf Manuals
Related Search
Related Contents
TempTrend Sea Gull Lighting 31319-965 Installation Guide Optoma EP759 data projector Yamaha RS70 Owner's Manual PROGRESSIVE DISTRIBUTORS Télécharger la plaquette 保管用 取扱説明書 注意 警告 警告 注意 Copyright © All rights reserved.
Failed to retrieve file