Home

PCR-Select cDNA Subtraction Kit User Manual

1. CDNA Subtraction Kit User Manual Cat No 637401 PT1117 1 PR732188 Published 16 April 2007 PCR Select cDNA Subtraction Kit User Manual Table of Contents 1 Introduction Il List of Components Ill Additional Materials Required IV PCR Select cDNA Subtraction Protocols A General Considerations B RNA Preparation and Handling First Strand cDNA Synthesis Second Strand cDNA Synthesis Rsa Digestion Adaptor Ligation First Hybridization Second Hybridization PCR Amplification V of Results and Troubleshooting Guide Analysis of ds cDNA Synthesis Products Analysis of Rsa Digestion Analysis of Ligation Analysis of PCR Products E PCR Analysis of Subtraction Efficiency F Hybridization Analysis of Subtraction Efficiency gt VI Differential Screening of the Subtracted Library VII References Appendix A Suppression PCR Appendix B Adaptor and Primer Sequences Clontech Laboratories Inc www clontech com 11 12 12 12 13 14 15 16 20 21 22 27 27 28 29 32 33 37 40 41 44 45 Protocol No PT1117 1 Version No PR732188 PCR Select cDNA Subtraction Kit User Manual Table of Contents continued List of Figures Figure 1 Overview of the PCR Select procedure 5 Figure 2 Schematic diagram of PCR Select cDNA subtraction Figure 3 Preparing adaptor ligated tester cDNAs for hybridization and PCR 17 Figure 4 Positiv
2. 9 A uonoes YNA peyesgns eui jo BujueeJos 104 si 191591 Se Se 19 S9 2 1 5 puooes g Jaued pepuejur INOA s uonoedqns BU Y umoys se y eq ISNW YNA 181881 5 017U09 pue YN Je1ueuuniedxe jUSsJeyIp uoee e t YNA 19158 uoe3 YOd pue uonezipuqAu 410 SYNQ 191591 2 ainbi4 C N uonezipiiqAy puosas uonezipuqAy uonezipugAu puooag se vN 2 ejosnui ppy vNa3 ppv aaup Se PPV gebeten 5 oy uonezipugAy 1514 uonezipigAu 1514 uonezipuqAu 1514 uonezipuugAu 3514 uonezipligdy 3514 uonezipugAu 1514 aaup se se se se Se J8AU se e osnui ejejeys ejosnui 5 ppy 1 vNd3lppv 1 VNd9 ppv Ad PPV FAN PPV A 1591 1591 1591 1591 1591 uoneBr uoneDr uone A A A A ULIS uz 10 depy 10 depy sone yz 101depy brian yz o abr 0
3. 0 ajebr 01 01 a aein 01 0 9 04009 19158 23 dais pasedaid 2 7 104002 19159 esy JA des ul pe1edeJg 9 10 4002 191591 yz 101depy uz 101depy 5 Joydepy uc 101depy j01depy YUM e YUM e XHN e e 2 I E 2 2 l 2 1 1 1 291591 191591 19152 C 19158 19159 VU sel isabip esy wor 3A 9915 uasa J 103523 YNGI je3ueuriadx3 NOILOVULENS TOHLNO NOILOVYULENS 3SU3A3H NOIL VYLANS quvMuod 17 Clontech Laboratories Inc www clontech com Protocol No PT1117 1 Version No PR732188 PCR Select cDNA Subtraction Kit User Manual IV PCR Select cDNA Subtraction Protocols continued sequences that are specific to sample 1 and the reverse subtracted cDNA contains sequences that are specific to sample 2 Even if you are only interested in sequences specific to sample 1 the reverse subtracted cDNA can be used for differential screening Section VI To perform subtractions in both directions you will need to prepare tester cDNA corresponding to each of your poly RNA samples You
4. pH 8 0 PCR amplification e 501 100 ul 100 ul e 10 ul PCR Primer 1 10 uM Nested PCR primer 1 10 uM Nested PCR primer 2R 10 uM PCR Control Subtracted cDNA Control reagents 5 ul 5 ul e 50 e 50 Control Poly RNA 1 ug ul from human skeletal muscle Control DNA 3 ng ul Hae IlI digested bacteriophage X174 DNA G3PDH 5 Primer 10 uM G3PDH 3 Primer 10 uM These primers will amplify human mouse and rat species G3PDH genes General reagents e 201 100 ul 400 ul 1 ml Clontech Laboratories Inc 10 dNTP Mix 10 mM each dATP dCTP dGTP dTTP 20X EDTA Glycogen Mix 0 2 M EDTA 1 mg ml glycogen NH OAc 4 M sterile HO Protocol No PT1117 1 Version No PR732188 www clontech com PCR Select cDNA Subtraction Kit User Manual Ill Additional Materials Required The following reagents are required but not supplied Hae III digest of bacteriophage fX174 We recommend New England Biolabs DNA size markers Cat Nos N3026S amp N3026L 0 5 ml PCR reaction tubes We recommend 0 5 ml reaction tubes Cat No N801 0737 or N801 0180 80 Ethanol amp 96 Ethanol Phenol chloroform isoamyl alcohol 25 24 1 Chloroform isoamyl alcohol 24 1 50 PCR enzyme mix We recommend our Advantage cDNA Polymerase Mix Cat No 639105 also provided in Advantage cDNA PCR Kits Cat Nos 639101 amp 639102 The proto
5. a Aliquot 1 ul of each diluted cDNA i e each subtracted sample from Step IV H 9 and the corresponding diluted unsubtracted tester control from Step 10 into an appropriately labeled tube b Aliquot 1 ul of the PCR control subtracted cDNA into an appropriately labeled tube 2 Prepare a Master Mix for all of the primary PCR tubes plus one additional tube For each reaction planned combine the reagents in Table IIl in the order shown TABLE PREPARATION OF THE PRIMARY PCR MASTER MIX Reagent Per Rxn 7 rxn Mix sterile H O 19 5 ul 156 0 ul 10X PCR reaction buffer 2 5 ul 20 0 ul dNTP Mix 10 mM 0 5 ul 4 0 ul PCR Primer 1 10 uM 1 0 ul 8 0 ul 50 Advantage cDNA Polymerase Mix 0 5 ul 4 0 yl Total volume 24 0 ul 192 0 ul For each additional experimental cDNA prepare Master Mix for one additional reaction 3 Mix well by vortexing and briefly centrifuge the tube 4 Aliquot 24 ul of Master Mix into each ofthe reaction tubes prepared in step 1 5 Overlay with 50 yl of mineral oil 6 Incubate the reaction mix at 75 C for 5 min in a thermal cycler to extend the adaptors Do not remove the samples from the thermal cycler Protocol No PT1117 1 www clontech com Clontech Laboratories Inc Version No PR732188 PCR Select cDNA Subtraction Kit User Manual IV PCR Select cDNA Subtraction Protocols continued Note This step fills in the missing strand of the adaptors see Figure 2 thus creating
6. Suppression subtractive hybridization the technology that all of our PCR Select kits are built upon was originally described by Diatchenko et al 1996 The following selected articles found within the above references list contain published experimental data obtained using PCR Select technology Cao et al 2004 Jeong et al 2004 Knaup et al 2004 Lian et al 2004 Norton et al 2004 Pan et al 2004 For a more comprehensive listing of PCR Select citations please visit our web site at http www clontech com clontech citations index shtml Protocol No PT1117 1 www clontech com Clontech Laboratories Inc Version No PR732188 PCR Select cDNA Subtraction Kit User Manual Appendix A Suppression PCR Melt at 94C Anneal at 68C Adaptor primer nut aaa IL synthesis No primer binding pan like structure suppresses PCR CNET Figure 10 Suppression PCR The PCR Select cDNA adaptors are engineered to prevent undesirable amplification during PCR by means of a method called suppression PCR U S Patent No 5 565 340 Siebert et al 1995 Suppression occurs when complementary sequences are present on each end of a single stranded cDNA During each primerannealing step the hybridization kinetics strongly favor over annealing ofthe shorter primers the formation of a pan like sec ondary structure that prevents primerannealing Occasionally when a primer anne
7. Add enzymes to reaction mixtures last and thoroughly mix by gently pipetting the reaction mixture up and down Do not increase the amount of enzyme or concentration of DNA in the reactions as these have been carefully optimized Although not required we recommend that you add a 3 P dCTP to the first strand synthesis reaction to help quantify cDNA yield determine efficiency of DNA precipitation and troubleshoot cDNA synthesis B RNA Preparation and Handling 1 General precautions Intact pure poly A RNA is essential forthe synthesis of high quality cDNA To avoid RNA contamination and degradation as well as minimize the presence of RNases use the following precautions wear gloves to prevent RNase contamination from your hands and Clontech Laboratories Inc www clontech com Protocol No PT1117 1 12 Version No PR732188 PCR Select cDNA Subtraction Kit User Manual IV PCR Select cDNA Subtraction Protocols continued use aerosol free pipette tips for dispensing small volumes or sterile disposable pipettes for larger volumes 2 RNA isolation See Farrell et al 1993 or Sambrook et al 2001 for procedures Whenever possible the total RNA samples being compared should be purified side by side using the same reagents and protocol This practice reduces the likelihood of false positives 3 RNA analysis After total and poly A RNA isolation examine RNA integrity by electrophoresing samples on a denaturing
8. PCR cycles 12 12 12 12 12 19 M M C o 0 Figure 9 Southern blot analysis of PCR Select subtraction Tester cDNA was prepared fromT cell hybridomas KMlIs 8 3 5 1 that were treated with anti T cell receptor antibody Driver cDNA was prepared from untreated cells PCR products were run on a 2 096 agarose gel transferred to a nylon membrane and hybridized with radiolabeled probes for housekeeping genes The number of cycles used for 1 and 2 PCR amplification is indicated M DNA size markers Panel A Southern blot hybridized with a G3PDH probe This blot is an example of high background with a significant amount of bands corresponding to background A designates true bands while B and C are bands resulting from two different types of background Panel B Southern blot hybridized with an a tubulin probe Unlike the blot in Panel A this blot exhibits clean bands with much lower background Protocol No PT1117 1 www clontech com Clontech Laboratories Inc Version No PR732188 PCR Select cDNA Subtraction Kit User Manual VI Differential Screening of the Subtracted Library In mostcases the PCR Select cDNA Subtraction Kit method greatly enriches for differentially expressed genes nevertheless the subtracted sample will still contain some cDNAs that correspond to mRNAs common to both the tester and driver samples Although this background may depend some what on the quality of RNA purification and performance of th
9. PCR Select cDNA subtraction First cDNA is synthesized from 0 5 2 ug of poly A RNA generated from the two types of tissues or cells being compared The tester and driver cDNAs are digested with Rsa a four base cutting restriction enzyme that yields blunt ends The tester cDNA is then subdivided into two portions and each is ligated with a different cDNA adaptor The ends of the adaptor do not contain a phosphate group so only one strand of each adaptor attaches to the 5 ends of the cDNA The two adaptors have stretches of identical sequence to allow annealing of the PCR primer once the recessed ends have been filled in See Appendix B for detailed sequences of the primers and adaptors Two hybridizations are then performed In the first an excess of driver is added to each sample of tester The samples are then heat denatured and allowed to anneal generating the type a b c and d molecules in each sample Figure 2 The concentration of high and low abundance sequences is equalized among the type a molecules because reannealing is faster forthe more abundant molecules due to the second order kinetics of hybridization see Nucleic Acid Hybridization ed by James amp Higgins At the same time Clontech Laboratories Inc www clontech com Protocol No PT1117 1 Version No PR732188 PCR Select cDNA Subtraction Kit User Manual Introduction continued cDNA synthesis Tester and driver ds cDNA are prepared from the two mRNA
10. Protocol No PT1117 1 Version No PR732188 PCR Select cDNA Subtraction Kit User Manual IV PCR Select cDNA Subtraction Protocols continued 12 Mix well by vortexing and briefly centrifuge 13 Aliquot 24 ul of Master Mix into each reaction from step 10 14 Overlay with 1 drop of mineral oil 15 Immediately commence thermal cycling GeneAmp DNA GeneAmp Thermal Cycler 480 PCR Systems 2400 or 9600 10 12 cycles 10 12 cycles 94 C 30 sec 94 C 10 sec 68 C 30 sec 68 C 30 sec 720 15 min 720 15 16 Analyze 8 ul from each reaction on a 2 0 agarose EtBr gel 1X TAE buffer See Section V D for expected results 17 Store reaction products at 20 C The PCR mixture is now enriched for differentially expressed cDNAs In addition differentially expressed transcripts that varied in abundance in the original mRNA sample should now be present in roughly equal proportions Refer to Sections V D and V E Figure 6 shows the results of a successful control subtraction experiment with cDNA made from the skeletal muscle poly A RNA We strongly recommend that you perform a subtraction efficiency test as shown in Figures 7 and 8 The uncloned subtracted mixture is an ideal hybridization probe for screening libraries of genomic DNA full length cDNA YAC BAC or cosmid clones Diatchenko et al 1996 For all other applications you should clone the products to make a subtracted cDNA libr
11. binding sites for the PCR primers 7 Immediately commence thermal cycling GeneAmp DNA GeneAmp Thermal Cycler 480 PCR Systems 2400 or 9600 27 cycles 94 C 25 sec 94 C 30 sec 27 cycles 66 C 30 sec 94 C 10 sec 72 0 15min 66 C 30 sec e 72 1 5 min 8 Analyze 8 ul from each tube on a 2 0 agarose EtBr gel run in 1X TAE buffer See Section V D for expected results Alternatively you can set these 8 pl aliquots aside and run them on the same gel used to analyze the secondary PCR products step 16 9 Dilute 3 ul of each primary PCR mixture in 27 ul of H O If applicable thisdiluted primary PCR productisused in the PCR Select Differential Screening Kit procedure 10 Aliquot 1 ul of each diluted primary PCR product mixture from Step 9 into an appropriately labeled tube 11 Prepare Master Mix for the secondary PCR reactions plus one additional reaction by combining the reagents in Table IV in the order shown TABLE IV PREPARATION OF THE SECONDARY PCR MASTER MIX Component Per Rxn 7 rxn Mix sterile 18 5 ul 148 0 ul 10X PCR reaction buffer 2 5 yl 20 0 ul Nested PCR primer 1 10 uM 1 0 ul 8 0 ul Nested PCR primer 2R 10 uM 1 0 ul 8 0 ul dNTP Mix 10 mM 0 5 ul 4 0 ul 50 Advantage cDNA Polymerase Mix 0 5 ul 4 0 ul Total volume 24 0 ul 192 0 ul For each additional experimental cDNA prepare Master Mix for one additional reaction Clontech Laboratories Inc www clontech com
12. denatured driver Anneal Fill in the ends a ED e EE a E m E e M EH M Add primers Amplify by PCR no amplification b b noamplification linear amplification and e exponential amplification Although there is a primer binding sequence on both ends of the type e molecules the shorter overall homology at the two ends effectively negates the suppression PCR effect except for very short molecules See Appendix A for more details on suppression PCR Clontech Laboratories Inc www clontech com Protocol No PT1117 1 6 Version No PR732188 PCR Select cDNA Subtraction Kit User Manual Introduction continued type a molecules are significantly enriched for differentially expressed sequences while cDNAs that are not differentially expressed form type c molecules with the driver During the second hybridization the two primary hybridization samples are mixed together without denaturing Now only the remaining equalized and subtracted ss tester cDNAs can reassociate and form new type e hybrids These new hybrids are ds tester molecules with different ends which correspond to the sequences of Adaptors 1 and 2R Fresh denatured driver cDNA is added again without denaturing the subtraction mix to further enrich fraction e for differentially expressed sequences After filling in the ends by DNA polymerase the type e molecules the differentially ex
13. of each ligated cDNA from Sec IV F e g theTesters 1 1 and 1 2 into 200 ul of HO 2 Combine the reagents in Table V in four separate tubes TABLE V SETTING UP THE LIGATION ANALYSIS REPEAT FOR EACH EXPERIMENTAL TESTER cDNA amp THE CONTROL SKELETAL MUSCLE cDNA Tube ul Component 1 2 3 4 Tester 1 1 ligated to Adaptor 1 1 1 Tester 1 2 ligated to Adaptor 21 1 1 G3PDH 3 Primer 10 uM 1 1 1 1 G3PDH 5 Primer 10 uM 1 1 PCR Primer 1 10 uM 1 1 Total volume 3 3 3 3 Use the same set up for Tester 2 1 and 2 2 3 1 and 3 2 3 Prepare a Master Mix forall ofthe reaction tubes plus one additional tube For each reaction planned combine the reagents in Table VI in the order shown TABLE VI PREPARATION OF THE LIGATION ANALYSIS PCR MASTER MIX Component Per Rxn 4 rxn Mix sterile H O 18 5 ul 92 5 ul 10X PCR reaction buffer 2 5 ul 12 5 ul dNTP Mix 10 mM 0 5 ul 2 5 ul 50X Advantage cDNA Polymerase Mix 0 5 ul 2 5 ul Total volume 22 0 ul 110 0 ul Protocol No PT1117 1 www clontech com Clontech Laboratories Inc Version No PR732188 PCR Select cDNA Subtraction Kit User Manual V Analysis of Results amp Troubleshooting Guide contin kb Figure 4 Positive control skeletal muscle ds cDNA before Lane 1 and after Lane 2 Rsa I di gestion cDNA was synthesized as described in the protocol using the human skeletal muscle control poly A RNA included in t
14. samples under comparison Sections IV C amp IV D Rsa digestion Tester and driver cDNA are separately digested to obtain shorter blunt ended molecules Section IV E Adaptor ligation Two tester populations are created with different adaptors Driver cDNA has no adaptors Section First hybridization Differentially expressed sequences are equalized and enriched Section IV G Second hybridization Templates for PCR amplification are generated from differentially expressed sequences Section IV H First PCR amplification Only differentially expressed sequences are exponentially amplified by Suppression PCR Section 7 Second PCR amplification Background is reduced Differentially expressed sequences are further enriched Section IV I Figure 1 Overview of the PCR Select procedure The cDNA in which specific transcripts are to be found is referred to as tester and the reference cDNA is referred to as driver If you have used the Super SMART PCR cDNA Synthesis Kit for cDNA synthesis you should begin with the Adaptor Ligation Step Section IV F shown above Protocol No PT1117 1 www clontech com Clontech Laboratories Inc Version No PR732188 5 PCR Select cDNA Subtraction Kit User Manual es Tester Tester Adaptor 1 Driver cDNA Adaptor 2R in excess NI E First hybridization Second hybridization a b c d Mix samples Add fresh
15. should also perform a control subtraction Panel C In Step 2 below you will prepare tester cDNA for this control subtraction by mixing the control skeletal muscle cDNA with 174 III DNA As illustrated in Figure 3 three separate adaptor ligations must be performed for each experimental tester cDNA and the control skeletal muscle tester cDNA Each cDNA is aliquotted into two separate tubes one aliquot is ligated with Adaptor 1 Tester 1 1 2 1 and 3 1 and the second is ligated with Adaptor 2R Tester 1 2 2 2 and 3 2 After the ligation reactions are set up portions of each tester tube are combined so that the cDNA is ligated with both adaptors unsubtracted tester control 1 c 2 c and 3 c Each unsubtracted tester control cDNA serves as a positive control for ligation and later serves as a negative control for subtraction Note Through the rest of the procedure itis helpful to label tubes using the nomenclature described in this User Manual Labeling tubes of intermediate products with the appropriate step number in which they were created may prove helpful as well Referring to Figure 3 will help you keep track of the multiple samples Adaptors will not be ligated to the driver cDNA 1 Dilute 1 ul of each Rsa l digested experimental cDNA Step IV E 19 with 5 ul of sterile H O If you have used the Super SMART PCR cDNA Synthesis Kit to prepare your cDNA use the purified Rsa I digested cDNAs from the Super SMART pr
16. 1 1 2 site Adaptor 1 5 CTAATACGACTCACTATAGGGCTCGAGCGGCCGCCCGGGCAGGT 3 3 BGGCCCGTCCA 5 PCR primer 1 5 CTAATACGACTCACTATAGGGC 3 5 TCGAGCGGCCGCCCGGGCAGGT 3 Nested PCR primer 1 Eagl Eae Rsal 1 2 site Adaptor 2R 5 CTAATACGACTCACTATAGGGCAGCGTGGTCGCGGCCGAGGT 3 T7 Promoter 3 GCCGGCTCCA 5 5 AGCGTGGTCGCGGCCGAGGT 3 Nested PCR primer 2R Control Primers G3PDH 5 Primer 5 ACCACAGTCCATGCCATCAC 3 G3PDH 3 Primer 5 TCCACCACCCTGTTGCTGTA 3 Figure 11 Sequences of the PCR Select cDNA synthesis primer adaptors PCR primers and Control Primers When Adaptors 1 and 2R are ligated to Rsa 1 cDNA the Rsa site is restored Protocol No PT1117 1 www clontech com Clontech Laboratories Inc Version No PR732188 5 PCR Select cDNA Subtraction Kit User Manual Notes Notice to Purchaser Clontech products are to be used for research purposes only They may not be used for any other purpose including but not limited to use in drugs in vitro diagnostic purposes therapeutics or in humans Clontech products may not be transferred to third parties resold modified for resale or used to manufacture commercial products or to provide a service to third parties without written approval of Clontech Laboratories Inc The purchaser of this product is entitled to utilize the reagents contained herein to practice the PCR Select methods for research purposes Reproduction amplification modi
17. 1 www clontech com Clontech Laboratories Inc Version No PR732188 35 PCR Select cDNA Subtraction Kit User Manual V Analysis of Results amp Troubleshooting Guide contin subtracted unsubtracted amp amp amp 8 8 8 8c amp M 1 2 3 4 5 6 7 8 M Cycle No 18 23 28 33 18 23 28 33 kb o W O U Figure 7 Reduction of G3PDH abundance by PCR Select subtraction Tester cDNA was prepared from human testis poly At RNA Driver cDNA was prepared from a mixture of poly A RNA samples prepared from 10 different human tissues PCR was performed on the subtracted Lanes 1 4 unsubtracted Lanes 5 8 secondary PCR product with the G3PDH 5 and 3 primers included in the kit Lanes 1 amp 5 18 cycles Lanes 2 amp 6 23 cycles Lanes 3 amp 7 28 cycles Lanes 4 amp 8 33 cycles Lane M marker end forms during the second hybridization see Introduction amp Figure 2 only about 10 000 of these target molecules are present in 1 ul of diluted subtracted cDNA If one such molecule representing G3PDH mRNA happens to be present G3PDH abundance will not appear to decrease If you see reduction of G3PDH abundanceintheindependent PCR amplified subtracted cDNA it indicates that this random event did occur Asapositive controlforthe enrichmentofdifferentially expressed genes repeat the procedure above using PCR primers for a gene known to be expressed in the tester RNA butnotinthedriver RNA This cDNA shoul
18. 3 and 7 PCR control subtracted cDNA The PCR control subtracted cDNA provides a positive PCR control and containsa successfully subtracted mixture of Hae Ill digested X174 DNA We recommend that you also perform a standard PCR control i e the positive control template in the Advantage cDNA PCR Kit to verify that your enzyme is performing efficiently Clontech Laboratories Inc www clontech com Protocol No PT1117 1 22 Version No PR732188 PCR Select cDNA Subtraction Kit User Manual IV PCR Select cDNA Subtraction Protocols continued Notes e All cycling parameters were optimized on GeneAmp DNAThermal Cycler 480 and GeneAmp PCR Systems 2400 9600 Cycling parameters for other thermal cycler machines may require optimization e fyoudonotuseAdvantagecDNA Polymerase Mix youcanuselaqDNApolymerasealone however 3 5 more cycles will be needed in the primary and secondary PCR steps You mustalso use a hot start for more information see Section IV A OurTaqStart Antibody Cat Nos 639250 amp 639251 also included in the cDNA Polymerase Advantage Mix No 639105 worksbest Alternatively youcanperformhotstartasfollows 1 Prepare the primary PCR Master Mix withoutTaq Polymerase 2 Mix PCR samples and heat the reaction mix to 75 C for 1 min 3 Quickly add the necessary amount ofTaq polymerase 4 Incubate the reaction at 75 C for 5 min 5 Perform PCR as described in step 8 below 1 Prepare the PCR templates
19. Davis M M Cohen D l Nielsen E A Steinmetz M Paul W E and Hood L 1984 Cell type specific cDNA probes and the murinelregion thelocalization and orientation ofAd alpha Proc Natl Acad Sci USA 81 7 2194 2198 Diatchenko L Chenchik A and Siebert 1998 Suppression subtractive hybridization A method for generating subtracted cDNA libraries starting from poly A total RNA In RT PCR Methods for Gene Cloning and Analysis Eds Siebert amp Larrick J BioTechniques Books MA pp 213 239 Diatchenko L Lau Y F C Campbell A P Chenchik A Moqadam Huang B Lukyanov S Lukyanov K Gurskaya N Sverdlov E D amp Siebert P D 1996 Suppression subtractive hybridization A method for generating differentially regulated or tissue specific probes and libraries Proc Natl Acad Sci USA 93 12 6025 6030 Duguid J R amp Dinauer M C 1990 Library subtraction of in vitro cDNA libraries to identify differentially expressed genes in scrapie infection Nucleic Acids Res 18 9 2789 2792 Endege W O Steinmann K E Boardman L A Thibodeau S N amp Schlegel R 1999 Representative cDNA libraries and their utility in gene expression profiling BioTechniques 26 3 542 550 Farrell Jr R E 1993 RNA Methodologies A Guide for Isolation and Characterization Academic Press San Diego CA Gurskaya N G Diatchenko L Chenchik A Siebert P D K
20. PT1117 1 32 Version No PR732188 PCR Select cDNA Subtraction Kit User Manual V Analysis of Results amp Troubleshooting Guide contin should resemble Figure 6 A few additional bands may appear The experimental subtracted samples usually appear as smears with or without a number of distinct bands a If you do not observe X174 Hae Ill bands in the PCR control subtracted mixture you must optimize the PCR conditions b If you can clearly see X174 Hae III bands in your unsubtracted skeletal muscle control it is likely that either the yield of your cDNA synthesis is very low or you losta majority of your skeletal muscle cDNA during phenol chloroform extraction or ethanol precipitation Ifyou obtain the expected 174 Ill bands in the PCR control subtracted mixture but not in your skeletal muscle control subtraction e g smear or random size bands it is likely that your subtraction was not optimal One of the most likely explanations is poor ligation efficiency For troubleshooting see Section V C d Ifthe ligation efficiency is high verify your protocol and repeatthe subtraction Problems during hybridization are uncommon e If you cannot see a product after 12 cycles use 3 additional cycles and analyze by gel electrophoresis Add cycles sparingly as too many cycles can increase background f In a successful subtraction the banding pattern of your unsubtracted cDNA ligated with both adaptors unsu
21. R Primer 1 should be aboutthe same intensity as the PCR product amplified using two gene specific primers G3PDH 3 and 5 Primers If the band intensity for these PCR products differs by more than 4 fold your ligation was less than 25 complete and will significantly reduce subtraction efficiency If you are working with mouse rat cDNA the PCR product amplified using the G3PDH 3 Primer and PCR Primer 1 will be 1 2 kb instead of 0 75 kb for human cDNA rat and mouse G3PDH cDNAs lack an Rsa restriction site However if you are working with human cDNA which does contain the Rsa I site and you observe this 1 2 kb band along with a band of the expected size your cDNA is not fully digested If there is a significant amount of this undigested product you should repeat the Rsa digestion If the above analysis shows poor ligation efficiency it is likely that either your cDNA was contaminated by undesired salt during a precipitation step or second strand synthesis was inefficient Therefore we recommend that you repeatthe PCR Select procedure starting with First Strand cDNA Synthesis Section IV C Figure 5 Typical results of ligation efficiency kb analysis The results shown here are for human sam ples if you are working with mouse or rat samples the PCR product amplified using the G3PDH 3 Primer and PCR Primer 1 Lane 3 will be 1 2 kb instead of 0 75 kb Lane 1 PCR products using Tester 1 1 1 3 Adaptor 1 ligated as t
22. aboratories Inc unless noted otherwise Clontech is a Takara Bio Company 02007 Clontech Laboratories Inc www clontech com Protocol No PT1117 1 Version No PR732188
23. als andis extended the newly synthesized strand will also havethe in vertedterminal repeats andform another pan like structure Thus during PCR nonspecific amplification is efficiently suppressed and specific amplifica tion of cDNA molecules with different adaptors at both ends can proceed normally The 5 ends ofAdaptors 1 and 28 have an identical stretch of 22 nt Primary PCR therefore requires only one primer for amplification eliminating the problem of primer dimerization Lukyanov et al 1995 Furthermore the identical sequences on the 3 and 5 ends of the differentially expressed molecules introduces a slight suppression PCR effect Since these identical sequences are the same length as PCR Primer 1 the suppression effect becomes sig nificant only for very short cDNAs under 200 nt because the formation of pan structures for shorter molecules is more efficient Lukyanov et al 1995 Thus longer molecules are preferentially enriched balancing the inherent tendency of the subtraction procedure to favor short cDNA frag ments These shorter fragments are more efficiently hybridized amplified and cloned than longer fragments Clontech Laboratories Inc www clontech com Protocol No PT1117 1 Version No PR732188 PCR Select cDNA Subtraction Kit User Manual Appendix B Adaptor and Primer Sequences cDNA synthesis Rsd Hiha Mi rimer 5 TTTTGTACAAGCTT N N 3 Srf T7 Promoter Notl Sr Smal
24. arting material To use experimental cDNA generated with the Super SMART Kit you should begin with the Adaptor Ligation Step Section IV F However it is highly recommended that you perform the PCR Select control cDNA synthesis and subtraction described in Section IV C Please note that cDNA generated using the SMART PCR cDNA Library Construction Kit Cat No 634901 is not compatible with the PCR Select cDNA Subtraction Kit Once differentially expressed cDNAs have been identified with the PCR Select method the SMART RACE cDNA Amplification Kit Cat No 634914 and Marathon Ready cDNAs many provide excellent tools for rapidly cloning the corresponding full length cDNAs Chenchik et al 1996 For more information see Related Products Section VIII Clontech Laboratories Inc www clontech com Protocol No PT1117 1 8 Version No PR732188 PCR Select cDNA Subtraction Kit User Manual Il List of Components Store RNA at 70 C Store 4X Hybridization buffer at room temperature Store all other reagents at 20 C Thiskitincludes enough reagents for seven cDNA syntheses For best results use2 ug of poly A RNA per reaction differentially expressed cDNAs for rare transcripts may be lost during subtraction if less poly AF RNA isused The seven cDNA syntheses are equivalentto six complete subtraction experiments and one control assuming the cDNA from each synthesis is used for tester and driver in separate experiments for i
25. ary The cDNAs can be directly inserted into a T A cloning vector Alternatively site specific cloning can be performed using the Not also Sma Xma site on Adaptor and the Eag site on Adaptor 2R Blunt end cloning requires use of the Rsa site at the adaptor cDNA junction For further analysis of your subtracted library several options are available Differential screening Our PCR Select Differential Screening Kit Cat No 637403 contains the necessary reagents for differential screening along with controls For more information about differential screening see Section VI and the PCR Select Differential Screening Kit User Manual PT3138 1 Northern analysis You may confirm the expression pattern of individual clones Protocol No PT1117 1 www clontech com Clontech Laboratories Inc Version No PR732188 25 PCR Select cDNA Subtraction Kit User Manual using Northern blot analysis In our experience the percentage of clones in the subtracted librarythatcorrespondsto differentially expressed mRNAs varies considerably from as high as 95 Diatchenko etal 1996 to a mid range of 40 60 Gurskaya etal 1996 von Stain etal 1997 and aslowasb596 Diatchenkoetal 1998 Werecommendthatyourandomly pick 10 20 clones from the subtracted library for use as probes on Northern blots Iffewerthantwo clones are confirmed as differentially expressed genes you should perform the differential screening procedure describe
26. btracted tester control 1 c should be different from the banding pattern of your experimental subtracted DNA samples Figure 6 E PCRAnalysis of Subtraction Efficiency Either PCR this Section or hybridization analysis Section V F can be used to estimate the efficiency of subtraction by comparing the abundance of known cDNAs before and after subtraction Ideally this is done with both a non differentially expressed gene e g a housekeeping gene and with a gene known to be differentially expressed between the two RNA sources being compared PCR provides a quicker test than hybridization analysis The test described below uses the G3PDH primers provided with the kit to confirm the reduced relative abundance of G3PDH following the PCR Select procedure Note that these G3PDH primers can only be used for human mouse and rat genes For other species you will need to design suitable primers Not all housekeeping gene transcripts are subtracted evenly Although G3PDH is subtracted very efficiently in most tissues and cell lines there are some exceptions including skeletal muscle and heart For this reason we do not recommend the use of G3PDH abundance Protocol No PT1117 1 www clontech com Clontech Laboratories Inc Version No PR732188 33 PCR Select cDNA Subtraction Kit User Manual V Analysis of Results amp Troubleshooting Guide contin to analyze subtraction in the skeletal muscle control Most other housekeeping gen
27. cell death by genistein in K562 cells Activation of thymidine kinase 1 Cell Res 14 4 295 302 Kellogg D E Rybalkin I Chen S Mukhamedova N Vlasik T Siebert P amp Chenchik A 1994 TaqStart Antibody Hotstart PCR facilitated by a neutralizing monoclonal antibody directed against Taq DNA polymerase BioTechniques 16 6 1134 1137 Knaup K X amp Roemer K 2004 Cell type specific regulation of calmodulin 2 expression by mutant p53 FEBS Letters 569 1 3 70 74 Lian Z Liu J Li L Tufan N L Wu M C Wang H Y Arbuthnot Kew M amp Feitelson M A 2004 Human S15a expression is upregulated by hepatitis B virus X Mol Carcinog 40 1 34 46 Lukyanov K A Launer G A Tarabykin V S Zaraisky A G amp Lukyanov S A 1995 Inverted terminal repeats permit the average length of amplified DNA fragments to be regulated during preparation of cDNA libraries by polymerase chain reaction Anal Biochem 229 198 202 Lukyanov K A Matz M V Bogdanova E A Gurskaya G amp Lukyanov S A 1996 Molecule by molecule PCR amplification of complex DNA mixtures for direct sequencing An approach to in vitro cloning Nucleic Acids Res 24 2 2194 2195 Matz M Lukyanov S Bogdanova E Diatchenko L amp Chenchik A 1999 Amplification of cDNA ends based on template switching effect and step out PCR Nucleic Acids Res 27 11 1558 1560 Norton P A Reis H M Pri
28. col contained inthis User Manual was optimized using this mix which was developed for long and accurate PCR amplification of cDNA Barnes 1994 Cheng et al 1994 The 50X mix contains KlenTaq 1 DNA Polymerase an exo minus N terminal deletion ofTaq DNA polymerase a proofreading polymerase andTaqStart Antibody for automatic hot start Kellogg et al 1994 Alternatively Taq DNA polymerase alone can be used but 3 5 additional thermal cycles are needed in both the primary and secondary PCR steps Note that these additional cycles may increase background lowering the percentage of differentially expressed clones in your subtracted library Note If you do not use Advantage cDNA Polymerase Mix we highly recommend using TaqStart Antibody Cat Nos 639250 amp 639251 manual hot start or hot start with wax beads to reduce levels of nonspecific DNA synthesis 10X PCR buffer Usethe 10X reaction buffer supplied with your DNA polymerase or mix included with the Advantage cDNA Polymerase Mix Cat No 639105 and the Advantage cDNA PCR Kits Cat Nos 639101 amp 639102 dNTP Mix for PCR 10 mM each dATP dCTP dGTP dTTP e 50X TAE electrophoresis buffer 242g Tris base 571 ml Glacial acetic acid 372g Naj EDTAe2H O0 Add H O to 1 L For 1XTAE buffer dilute 50X stock solution 1 49 with H O Protocol No PT1117 1 www clontech com Clontech Laboratories Inc Version No PR732188 11 PCR Select cDNA Subtraction Kit User Ma
29. cted library is hybridized with for ward and reverse subtracted cDNA probes Lukyanov et al 1996 Wang amp Brown 1991 To make the reverse subtracted probe subtractive hy bridization is performed with the original tester cDNA as a driver and the driver cDNA as a tester Clones representing mRNAs that are truly differentially expressed will hybridize only with the forward subtracted probe clones that hybridize with the reverse subtracted probe may be considered background This approach requires one additional step be fore they can be used as probes the forward and reverse subtracted probes must undergo restriction enzyme digestion to remove the adap tor sequences Despite their small size these adaptors cause a very high background when the subtracted probes are hybridized to the subtracted cDNA library Our PCR Select Differential Screening Kit Cat No 637403 contains ev erything needed to generate subtracted and unsubtracted cDNA probes to screen your subtracted cDNA library This ensures a good ratio of signal to background in your Northern analyses For more details please see the PCR Select Differential Screening Kit User Manual PT3831 1 and our web site at www clontech com Clontech Laboratories Inc www clontech com Protocol No PT1117 1 40 Version No PR732188 PCR Select cDNA Subtraction Kit User Manual VII References Barnes W M 1994 PCR amplification of up to 35 kb DNA with high fidelity and high
30. d become enriched during subtraction The difference in the number of cycles required for equal amplification of the corresponding PCR product in subtracted and unsubtracted samples indicates the efficiency of your subtraction 5 cycles corresponds roughly to a 20 fold cDNA enrichment Because of the equalization that occurs during subtraction the level of enrichment will depend on the initial abundance of each differentially expressed gene as well as the difference in abundance of each gene in tester and driver Differentially expressed genes that are presentin low abundance inthe tester CDNA will be enriched more than differentially expressed genes that are present in high abundance Clontech Laboratories Inc www clontech com Protocol No PT1117 1 Version No PR732188 PCR Select cDNA Subtraction Kit User Manual Notes Do not use PCR primers that amplify a cDNA fragment that contains an Rsa restriction site between the PCR priming sites e Certain sequences may not rehybridize or be amplified while other cDNA fragments from the same cDNAs are dramatically enriched Hubank amp Schatz 1994 Wang amp Brown 1991 Hybridization analysis may provide more information about some cDNA fragments that appear to be lost Hybridization Analysis of Subtraction Efficiency Dot or Southern blot analysis of subtracted and unsubtracted unsubtracted tester control 1 c secondary PCR products with different genes as probes is help
31. d above to eliminate false positives Virtual Northerns If you lack sufficient poly A RNA for standard Northern blot analysis youcan create Virtual Northern blots which yield similar information Endege et al 1999 To make a Virtual Northern blot use the Super SMART PCR cDNA Synthesis Kit Cat No 635000 to generate SMART cDNA from your total or poly A sample Then electrophorese the SMART cDNA on an agarose EtBr gel denature it insitu andtransferitonto nylon membrane For more information on Super SMART cDNA synthesis technology andVirtual Northern blots please see Chenchik et al 1998 and visit our web site at www clontech com Clontech Laboratories Inc www clontech com Protocol No PT1117 1 26 Version No PR732188 PCR Select cDNA Subtraction Kit User Manual V Analysis of Results amp Troubleshooting Guide A Analysis of ds cDNA Synthesis Products 1 General recommendations a To monitor the progress and yield of cDNA synthesis perform first second strand cDNA synthesis with your experimental sample andthe control skeletal muscle polyA RNA provided We recommendthat you monitorthe cDNA synthesis and purification by including a 3 P dCTP in the first strand reaction mixture b Usehigh quality poly A RNA The yield of ds cDNA depends onthe RNA quality 2 ug of the Control poly A RNA from skeletal muscle will typically produce about 2 ug of ds cDNA Similar amounts 1 2 ug are typically
32. dentifying up and down regulated cDNAs ina particular system Enough PCR reagents are provided for 50 primary and 100 secondary PCRs Refer to Appendix B for detailed adaptor and primer sequences First strand synthesis 7 ul ReverseTranscriptase 20 units ul e 10 cDNA Synthesis Primer 10 uM e 200 ul 5X First Strand Buffer 250 mM Tris HCI pH 8 5 40mM MgCl 150 5 mM Dithiothreitol Second strand synthesis e 28ul 20X Second Strand Enzyme Cocktail DNA polymerase I 6 units ul RNase 0 25 units pl E coli DNA ligase 1 2 units ul e 200 ul 5X Second Strand Buffer 500 KCI 50 mM Ammonium sulfate 25 MgCl 0 75 mM 100 mM Tris HCI pH 75 0 25 mg ml BSA e 141 T4DNA Polymerase 3 units ul Endonuclease digestion e 300 ul 10X Rsa I Restriction Buffer 100 mM Propane HCl pH 7 0 100 mM MgCl 1mM DIT e 12 Rsal 10units ul Protocol 1117 1 www clontech com Clontech Laboratories Inc Version No PR732188 9 PCR Select cDNA Subtraction Kit User Manual ll List of Components continued Adaptor ligation e 21 ul 200 ul e 301 e 301 Hybridization 200 ul e 1 4 ml T4 DNA Ligase 400 units ul contains 3 mM ATP 5X DNA Ligation Buffer 250mM Tris HCI pH 78 50mM 10mM 0 25 mg ml BSA Adaptor 1 10 uM Adaptor 2R 10 uM 4X Hybridization Buffer Dilution buffer pH 8 3 20mM HEPES pH 6 6 20mM Naci 0 2mM
33. dividual clones indeed represent differentially expressed genes This istypically accomplished by probing Northern blots with randomly selected subtracted clones However this method can be time consuming and inefficient especially when two closely related RNA populations are being Figure 2 facing page Schematic diagram of PCR Select cDNA subtraction Type e molecules are formed only if the sequence is upregulated in the tester cDNA Solid lines represent the Rsa l digested tester or driver cDNA Solid boxes represent the outer part of the Adaptor 1 and 2R longer strands and corresponding PCR primer 1 sequence Clear boxes represent the inner partofAdaptor 1 andthe corresponding Nested PCR primer 1 sequence Shaded boxes represent the inner part of Adaptor 2R and the corresponding Nested PCR primer 2R sequence Protocol No PT1117 1 www clontech com Clontech Laboratories Inc Version No PR732188 PCR Select cDNA Subtraction Kit User Manual Introduction continued compared a situation in which the subtracted library is likely to contain a significant number of false positives Differential screening of the subtracted library before undertaking Northern blot analysis helps to eliminate false positives and saves time and effort Such screening of subtracted cDNA libraries can be performed using the Clontech PCR Select Differential Screening Kit Cat No 637403 Dot blot arrays of clones from the subtracted library can be hybrid
34. e any precipitate 1 For each of the experimental and skeletal muscle subtractions combine the reagents in Table in 0 5 ml tubes in the order shown Clontech Laboratories Inc www clontech com Protocol No PT1117 1 20 Version No PR732188 PCR Select cDNA Subtraction Kit User Manual IV PCR Select cDNA Subtraction Protocols continued TABLE SETTING UP THE FIRST HYBRIDIZATION REPEAT FOR EACH EXPERIMENTAL TESTER cDNA amp THE CONTROL SKELETAL MUSCLE cDNA Hybridization Sample 1 2 Component Tester 1 1 Tester 1 2 Rsa I digested Driver cDNA IV E 18 1 5 ul 1 5 ul Adaptor 1 ligated Tester 1 1 IV F 9 1 5 ul Adaptor 2R ligated Tester 1 2 IV F9 1 5 ul 4X Hybridization Buffer 1 0 ul 1 0 ul Final volume 4 0 ul 4 0 ul Use the same setup for Tester 2 1 and 2 2 3 1 and 3 2 2 Overlay samples with one drop of mineral oil and centrifuge briefly 3 Incubate samples at 98 C for 1 5 min in a thermal cycler 4 Incubate samples at 68 C for 8 hr Samples may hybridize for 6 12 hrs Do not let the incubation exceed 12 hours H Second Hybridization The two samples from the first hybridization are mixed together and fresh denatured driver DNA is added to further enrich for differentially expressed sequences New hybrid molecules are formed which consist of differentially expressed cDNAs with different adaptors on each end Important Do not denature the primary hybridization samples at this sta
35. e control skeletal muscle ds cDNA before and after Rsa digestion 30 Figure 5 Typical results of ligation efficiency analysis 31 Figure 6 Typical results of control skeletal muscle subtraction analysis 34 Figure 7 Reduction of G3PDH abundance by PCR Select subtraction 36 Figure 8 Enrichment of a differentially expressed gene and reduction of an abundant housekeeping gene in Jurkat cells 37 Figure 9 Southern blot analysis of PCR Select subtraction 39 Figure 10 Suppression PCR 44 Figure 11 Sequences of the PCR Select cDNA synthesis primer adaptors PCR primers and Control Primers 45 List of Tables Table I Setting up the ligation reactions 19 Tablell Setting up the first hybridization 21 Table Ill Preparation of the primary PCR Master Mix 23 Table IV Preparation of the secondary PCR Master Mix 24 TableV Setting up the ligation analysis 29 Table VI Preparation of the ligation analysis PCR Master Mix 29 Protocol No PT1117 1 wwweclontech com Clontech Laboratories Inc Version No PR732188 3 PCR Select cDNA Subtraction Kit User Manual Introduction Subtractive hybridization is a powerful technique that enables researchers to compare two populations of mRNA and obtain clones of genes that are expressed in one population but not in the other Although there are several different methods the basic theory behind subtraction is simple First both mRNA populations are converted into cDNA we refer to the cDNA
36. e particular subtraction it chiefly arises when very few mRNA species are differentially expressed in tester and driver In general a limited set of differentially expressed mRNAs and low quantitative difference in expression produces higher background evenif you obtain sufficient enrichment of differentially expressed cDNAs With high background picking random clones from the subtracted library for Northern blot analysis is extremely time consuming and inefficient We highly recommend that you perform differential screen ing before embarking on Northern blot analysis There are two approaches for differentially screening the subtracted library The first is to hybridize the subtracted library with 3 P labeled probes synthe sized as first strand cDNA from tester and driver Hedrick et al 1984 Sakaguchi etal 1986 Clones corresponding to differentially expressed mRNAs will hy bridize only withthe tester probe and not with the driver probe Although this approach is widely used ithas one major disadvantage only cDNA molecules corresponding to highly abundant mRNAs i e mRNAs which constitute more than about 0 2 of the total cDNA in the probe will produce detect able hybridization signals Wang amp Brown 1991 Clones corresponding to low abundance differentially expressed mRNAs will not be detected by this screening procedure The second approach bypasses the problem of losing low abundance sequences In this method the subtra
37. efly centrifuge the tubes 6 Incubate the tubes at 42 C for 1 5 hr in an air incubator Note Do not use a water bath or thermal cycler Evaporation can reduce the reaction mixture volume and therefore reaction efficiency 7 Place onicetoterminate first strandcDNAsynthesis and immediately proceed to Section D D Second Strand cDNA Synthesis Perform the following procedure with each first strand tester driver and the control skeletal muscle cDNA 1 Add the following components to the first strand synthesis reaction tubes containing 10 ul per rxn sterile HO 48 4 ul 5X Second Strand Buffer 16 0 ul dNTP Mix 10 mM 1 6 ul 20X Second Strand Enzyme Cocktail 4 0 ul 2 Mix contents and briefly spin The final volume should be 80 ul 3 Incubate at 16 C for 2 hr in water bath or thermal cycler 4 Add 2 ul 6 of T4 DNA Polymerase Mix contents well Clontech Laboratories Inc www clontech com Protocol No PT1117 1 14 Version No PR732188 PCR Select cDNA Subtraction Kit User Manual IV PCR Select cDNA Subtraction Protocols continued 10 11 12 13 14 15 16 17 18 19 20 Incubate at 16 C 30 min in a water bath or thermal cycler Add 4 ul of 20X EDTA Glycogen Mix to terminate second strand synthesis Add 100 ul of phenol chloroform isoamyl alcohol 25 24 1 Vortex thoroughly and centrifuge at 14 000 rpm for 10 min at room temperature to separate phases Careful
38. es are subtracted very efficiently from skeletal muscle and can therefore be used In general if the abundance Figure 6 Typical results of control skeletal muscle sub traction analysis The secondary PCR product of the subtracted skeletal muscle sample contains mostly DNA fragments corresponding to the 174 Ill digest The adaptor sequences on both ends of DNA fragments cause the mobility shift of these PCR products in comparison with original digested 174 DNA Lane M 174 DNA Hae Ill digest size markers Lane 1 Secondary PCR products of subtracted skeletal muscle tester cDNA with 0 2 174 Ill digested DNA Lane 2 Secondary PCR prod ucts of unsubtracted skeletal muscle tester cDNA ligated with both Adaptors 1 and 2R generated in Section IV F and containing 0 2 174 Ill digested DNA Samples are electrophoresed on a 2 agarose EtBr gel of G3PDH did not decrease significantly after subtraction you should check the abundance of other housekeeping genes such as a tubulin However in the control skeletal muscle subtraction experiment the agarose gel banding pattern of the X174 Hae III digest Figure 6 Lane 2 has already indicated whether or not subtraction was successful In certain instances a particular housekeeping gene is present at different levels in tester and driver poly RNA If the concentration of G3PDH message is even 2 fold higher in the tester sample G3PDH will not be effic
39. ese 5 5 ul samples of Rsa digested cDNA will serve as your experimental driver cDNA and your control skeletal muscle driver cDNA In the nextsection these samples will be ligated with adaptors to create your tester cDNAs for forward control and reverse if applicable subtractions 19 Check your Rsa I digested cDNA from Step 4 using agarose EtBr gel electrophoresis as described in Section V B Then proceed to Section IV F to finish preparing your experimental and control skeletal muscle tester cDNAs Adaptor Ligation Figure 3 shows the experimental flowchart for preparing adaptor ligated tester cDNA If you plan to perform differential screening of the subtracted library discussed in detail in Section VI you must perform subtractions in both directions for each tester driver cDNA pair The forward subtraction experiment shown in Figure 3A is designed to enrich for differentially expressed sequences present in poly A RNA sample 1 cDNA 1 tester but not poly A RNA sample 2 cDNA 2 driver Figure shows the reverse subtraction in which cDNA 2 serves as tester and cDNA 1 serves as driver The result is two subtracted cDNA populations the forward subtracted cDNA contains Clontech Laboratories Inc www clontech com Protocol No PT1117 1 16 Version No PR732188 PCR Select cDNA Subtraction Kit User Manual IV PCR Select cDNA Subtraction Protocols continued VNG YUM
40. fication reformulation or resale of the reagents provided in the kit is not permitted PCR Select cDNA Subtraction products are covered by U S Patent Nos 5 565 340 and 5 759 822 as well as pending foreign patent applications LIMITED LICENSE Use of this product is covered by one or more of the following US patents and corresponding patent claims outside the US 5 079 352 and 6 127 155 The purchase of this product includes a limited non transferable immunity from suit under the foregoing patent claims for using only this amount of product for the purchaser s own internal research No right under any other patent claim such as method claims in U S Patents Nos 5 210 015 5 487 972 5 994 056 and 6 171 785 and no right to perform commercial services of any kind including without limitation reporting the results of purchaser s activities for a fee or other commercial consideration is hereby conveyed by the purchase of this product expressly by implication or by estoppel This product is for research use only Diagnostic uses require a separate license from Roche Further information on purchasing licenses may be obtained by contacting the Director of Licensing Applied Biosystems 850 Lincoln Centre Drive Foster City California 94404 USA GeneAmp is a registered trademark of Roche Molecular Systems Inc licensed toThe Applied Biosystems Corporation Clontech Clontech logo and all other trademarks are the property of Clontech L
41. formaldehyde 1 agarose EtBr gel Intact total mammalian RNA typically exhibits two bright bands corresponding to ribosomal 28S and 18S RNA at 4 5 and 1 9 kb respectively with a ratio of intensities of 1 5 2 5 1 Mammalian poly A RNA appears as a smear from 0 5 12 kb with weak ribosomal RNA bands present The size distribution may be smaller 0 5 3 kb for nonmammalian species If your experimental RNA appears on an agarose gel smaller than expected e g no larger than 1 2 kb as a smear 1 2 kb and or the ratio of intensity of 285 to 18S observed is 1 1 your RNA may have been impure or degraded We suggest you test all RNA isolation reagents for the presence of RNase or other impurities If contamination is found you must prepare RNA again using fresh reagents if necessary If problems persist you may need to identify another source of tissue or cells such as our Premium Poly At RNAs see Related Products Section VIII Poor quality and or degraded RNA produces high background in the subtraction procedure and should not be used as starting material C First Strand cDNA Synthesis Perform this procedure with each experimental tester and driver poly At RNA and with the Control Poly At RNA from human skeletal muscle provided with the kit The skeletal muscle cDNA made in this section serves as control driver cDNA in later steps In Section mock tester cDNA is generated by adding a small amount ofthe Control DNA Hae IIl di
42. ful in evaluating the success of your subtraction As shown in Figure 8 the abundance of housekeeping cDNAs drops after subtraction while the abundance of known up regulated cDNAs rises 1 2 3 1 2 3 Figure 8 Enrichment of a differentially expressed gene and reduction of an abundant house keeping gene in Jurkat cells Tester cDNA was prepared from human Jurkat cells that were incubated with 2 ug ml phytohemagglutinin PHA and 2 ng ml phorbol 12 myristate 13 ac etate PMA for 72 hr Driver cDNA was prepared from untreated cells 15 ul of the secondary PCR products generated from unsubtracted tester cDNA unsubtracted driver cDNA and subtracted cDNA were electrophoresed on a 1 596 agarose gel 0 3 ug per lane transferred to nylon filters and hybridized with either an IL 2R probe Panel A or a G3PDH probe Panel B Lane 1 unsubtracted tester cDNA Lane 2 unsubtracted driver cDNA Lane 3 subtracted cDNA Gurskaya et al 1996 Protocol No PT1117 1 www clontech com Clontech Laboratories Inc Version No PR732188 PCR Select cDNA Subtraction Kit User Manual V Analysis of Results amp Troubleshooting Guide continued Although Southern blot analysis is a sensitive indicator of subtraction efficiency you may occasionally observe background bands of unpredicted sizes Two criteria should be applied to distinguish background from true bands i e bands that truly represent a subtracted gene First the inten
43. ge Also do not remove the hybridization samples from the thermal cycler for longer than is necessary to add fresh driver Repeat the following steps for each experimental tester cDNA and for the control skeletal muscle cDNA 1 Add the following reagents into a sterile tube per rxn Driver cDNA Step IV E 21 1 pl 4X Hybridization Buffer 1 ul sterile HO 2 yl 2 Place 1 ul ofthis mixture in a 0 5 ml microcentrifuge tube and overlay it with 1 drop of mineral oil 3 Incubate at 98 C for 1 5 min in a thermal cycler 4 Remove the tube of freshly denatured driver from the thermal cycler Use the following procedure to simultaneously mix the driver with hybridization samples 1 and 2 prepared in Section IV G seeTable Il This ensures that the two hybridization samples mix together only in the presence of freshly denatured driver Protocol No PT1117 1 www clontech com Clontech Laboratories Inc Version No PR732188 PCR Select cDNA Subtraction Kit User Manual IV PCR Select cDNA Subtraction Protocols continued a Set a micropipettor at 15 ul b Gently touch the pipette tip to the mineral oil sample interface of the tube containing hybridization sample 2 c Carefully draw the entire sample partially into the pipette tip Do not be concerned if a small amount of mineral oil is transferred with the sample d Remove the pipette tip from the tube and draw a small amount of air into the tip creating a slight air space below
44. gested 174 to an aliquot of the skeletal muscle ds cDNA You shouldthen perform a complete control subtraction with these skeletal Protocol No PT1117 1 www clontech com Clontech Laboratories Inc Version No PR732188 13 PCR Select cDNA Subtraction Kit User Manual IV PCR Select cDNA Subtraction Protocols continued muscle tester and driver cDNAs in parallel with your experimental subtraction The control subtraction allows you to estimate both the yield and size distribution of synthesized ds cDNA 1 For each tester driver and the Control Poly A RNA from human skeletal muscle combine the following components in a sterile 0 5 ml microcentrifuge tube Do not use a polystyrene tube per rxn poly A RNA 2 ug 2 4 yl cDNA Synthesis Primer 10 uM 1 ul For the control synthesis add 2 ul of the skeletal muscle control poly RNA If needed add sterile to a final volume of 5 yl Mix contents and spin briefly in a microcentrifuge 2 Incubate at 70 C for 2 min in a thermal cycler 3 Cool on ice for 2 min and briefly centrifuge 4 Add the following to each reaction per rxn 5X First Strand Buffer 2 ul dNTP Mix 10 mM each 1 ul sterile H O 1 ul AMV Reverse Transcriptase 20 units ul 1 ul To monitor the progress of the cDNA synthesis dilute 1 ul of a32P dCTP 10 mCi ml 3 000 Ci mmol with 9 ul of H5O and substitute 1 ul of this diluted label for the component above 5 Gently vortex and bri
45. haspekov G L Lukyanov K A Vagner L L Ermolaeva O D Lukyanov S A and Sverdlov E D 1996 Equalizing cDNA subtraction based on selective suppression of polymerase chain reaction Cloning of Jurkat cell transcripts induced by phytohemaglutinin and phorbol 12 myristate 13 acetate Anal Biochem 240 1 90 97 Hara E Kato T Nakada S Sekiya S amp K 1991 Subtractive cDNA cloning using oligo dT 4 latex and PCR isolation of cDNA clones specific to undifferentiated human embryonal carcinoma cells Nucleic Acids Res 19 25 7097 7104 Hedrick S M Cohen D Il Neilson E A amp Davis M M 1984 Isolation of cDNA clones Protocol No PT1117 1 www clontech com Clontech Laboratories Inc Version No PR732188 PCR Select cDNA Subtraction Kit User Manual VII References continued encodingT cell specific membrane associated proteins Nature 308 5955 149 153 Hubank M amp Schatz D G 1994 Identifying differences in mRNA expression by representa tional difference analysis of cDNA Nucleic Acids Res 22 25 5640 5648 Identifying T cell signaling molecules with the Clontech PCR Select cDNA Subtraction Kit July 1996 Clontechniques XI 3 32 33 James B D amp Higgins S J 1985 Nucleic Acid Hybridization IRL Press Ltd Oxford Jeong M H Jin Y H Kang E Y Jo W S Park H T Lee J D Yoo Y J amp Jeong S J 2004 modulation of radiation induced
46. he kit Lane M DNA size markers 4 Mix well by vortexing and briefly centrifuging 5 Aliquot 22 ul of Master Mix into each of the reactions from step 6 Mix well by vortexing and briefly centrifuging Overlay with 50 ul of mineral oil 8 Incubate the reaction mix at 75 C 5 min in a thermal cycler to extend the adaptors Do not remove the samples from the thermal cycler Note This step fills in the missing strand of the adaptors see Figure 2 thus creating binding sites for the PCR primers 9 Immediately commence thermal cycling GeneAmp DNA GeneAmp Thermal Cycler 480 PCR Systems 2400 or 9600 20 cycles 94 C 30 sec 94 C 30 sec 20 cycles 65 C 30sec 94 C 10 sec 68 2 5 65 30 sec 68 2 5 min Clontech Laboratories Inc www clontech com Protocol No PT1117 1 Version No PR732188 PCR Select cDNA Subtraction Kit User Manual V Analysis of Results amp Troubleshooting Guide contin 10 Analyze 5 ul from each reaction on a 2 0 agarose EtBr gel run in 1X TAE buffer Typical results are shown in Figure 5 If you cannot detect a product after 20 cycles perform 5 additional cycles and analyze by gel electrophoresis Additional PCR cycles may be necessary as G3PDH expression varies among tissues its abundance in skeletal muscle is relatively high As shown in Figure 5 the PCR product using one gene specific primer G3PDH 3 Primer and PC
47. he template and the G3PDH3 1 1 Primer and PCR Primer 1 Lane 2 PCR products using Tester 1 1 Adaptor 1 ligated as the template and 0 6 the G3PDH 3 and 5 Primers Lane 3 PCR products using Tester 1 2 Adaptor 2R ligated as the template and the G3PDH 3 Primer and PCR Primer 1 Lane 4 9 3 PCR products usingTester 1 2 Adaptor 2R ligated as the template and the G3PDH 3 and 5 Primers 2 agarose EtBr gel Lane M X174 DNA Hae III digest size markers Protocol No PT1117 1 www clontech com Clontech Laboratories Inc Version No PR732188 PCR Select cDNA Subtraction Kit User Manual V Analysis of Results amp Troubleshooting Guide contin Alternatively if you have an insufficient quantity of RNA to resynthesize cDNA you can reprecipitate the remaining aliquots of each Rsa I digested experimental and control cDNA you should have 4 5 ul remaining from Step IV E 21 Add 2 5 ul of 4 M NH4OAc and 20 ul of 9596 ethanol to each cDNA sample and follow the procedure of Section IV E from Steps 14 21 before repeating the adaptor ligation procedure We do not recommend reprecipitation as a primary troubleshooting solution for adaptor ligation failure because the recovery of cDNA may be inefficient resulting in a low subtraction efficiency D Analysis of PCR Products 1 Agarose EtBr gel electrophoresis of primary PCR Perform your primary PCR side by side with the PCR control subtracted cDNA With the PCR control subtrac
48. iently subtracted out If you perform subtraction in both directions see Section IV F and have unsubtracted tester control for both the subtraction and the reverse subtraction the PCR analysis of subtraction efficiency will indicate if there is any difference in G3PDH abundance in the two cDNA samples being compared If this is the case choose another housekeeping gene as a control for subtraction efficiency Clontech offers a number of RI PCR Control Amplimer Sets for housekeeping genes that can be used as positive controls for your studies These include human mouse and rat Control Amplimer Sets for amp actin and G3PDH see Related Products 1 Dilute the subtracted and unsubtracted unsubtracted tester control 1 and 2 secondary PCR products 10 fold in H O The Clontech Laboratories Inc www clontech com Protocol No PT1117 1 Version No PR732188 PCR Select cDNA Subtraction Kit User Manual V Analysis of Results amp Troubleshooting Guide contin concentration of subtracted and unsubtracted product should be roughly equal 2 Combine the following reagents in 0 5 ml microcentrifuge tubes in the order shown Rxn 1 Rxn 2 Diluted subtracted cDNA 2 PCR product 1 0 ul Diluted Unsubtracted tester control 1 c 1 0 ul 2 PCR product G3PDH 3 Primer 10 uM 1 2 ul 1 2 ul G3PDH 5 Primer 10 uM 1 2 ul 1 2 ul sterile HO 22 4 ul 22 4 ul 10X PCR reaction buffer 3 0 ul 3 0 ul dNTP Mix 10 mM 0 6 yl 0 6 u
49. ized with labeled probes from either tester or driver populations and those that are recognized by the tester probe and not by the driver probe are confirmed to be differentially expressed For more details please see the Clontech PCR Select Differential Screening Kit User Manual PT3138 1 To maximize the sensitivity of the Clontech PCR Select Differential Screening Kit two subtractions should be performed the original intended subtraction forward subtraction and a reverse subtraction in which tester serves as the driver and the driver as tester For additional information about differential screening see Section VI Using the Super SMART PCR cDNA Synthesis Kit If your starting material is limited the Super SMART PCRcDNA Synthesis Kit Cat No 635000 can be used to total RNA samples for use with the PCR Select cDNA Subtraction Kit Matz et al 1999 and Chenchik et al 1998 When total RNA is used for cDNA synthesis by conventional methods ribosomal RNAis transcribed along with the poly A fraction even if synthesis is oligo dT primed If cDNA generated in this manner is used with the PCR Select cDNA Subtraction Kit the excess of ribosomal RNA coupled with a low concentration of cDNA corresponding to the poly A fraction can cause inefficient subtractive hybridization cDNA generated using the Super SMART PCRcDNA Synthesis Kit can be directly used for PCR Select subtraction even if total RNA is used as st
50. l 50 Advantage cDNA Polymerase Mix 0 6 ul 0 6 ul Total volume 30 0 ul 30 0 ul 3 Mix by vortexing and briefly centrifuging 4 Overlay with one drop of mineral oil 5 Use the following thermal cycling program 18 cycles 94 C 30sec 60 30sec 68 C 2 min 6 Remove 5 ul from each reaction and place it in a clean tube Put the rest of the reaction back into the thermal cycler for 5 additional cycles 7 Repeat step 6 twice i e remove 5 ul after 28 and 33 cycles 8 Examine the 5 ul samples i e the aliquots that were removed from each reaction after 18 23 28 and 33 cycles on a 2 096 agarose EtBr gel Figure 7 shows an example of G3PDH reduction in a successfully subtracted mixture Forthe unsubtracted cDNA you should see a G3PDH product after 18 23 cycles depending on the abundance of G3PDH in the particular cDNA For reference in skeletal muscle and heart poly A RNA G3PDH is extremely abundant With your subtracted samples you should detect a product at 5 15 cycles later If you do not observe a decrease in G3PDH abundance in the subtracted sample repeat the PCR amplification Section IV I Perform two independent primary and secondary PCRs and check G3PDH abundance in both During the first hybridization step of the subtraction procedure equalization of the ss tester molecules takes place As a result a very low concentration of cDNA molecules with different adaptors on each Protocol No PT1117
51. llowing reagents per rxn ds cDNA 43 5 ul 10X Rsa Restriction Buffer 5 0 ul Rsa I 10 units ul 1 5 ul 2 Mix by vortexing and briefly centrifuge 3 Incubate at 37 C for 1 5 hr Protocol No PT1117 1 www clontech com Clontech Laboratories Inc Version No PR732188 15 PCR Select cDNA Subtraction Kit User Manual IV PCR Select cDNA Subtraction Protocols continued 4 Set aside 5 ul of the digest mixture to analyze the efficiency of Rsa digestion as described in Section V B 5 Add 2 5 ul of 20X EDTA Glycogen Mix to terminate the reaction 6 Add 50 ul of phenol chloroform isoamyl alcohol 25 24 1 7 Vortex thoroughly and centrifuge at 14 000 rpm for 10 min at room temperature to separate phases 8 Carefully collect the top aqueous layer and place in a fresh 0 5 ml tube 9 Add 50 ul of chloroform isoamyl alcohol 24 1 10 Repeat steps 7 and 8 11 Add 25 ul of 4 M NH OAc and 1875 yl of 95 ethanol Note Proceed immediately with precipitation Do not store tubes at 20 C Prolonged exposure to this temperature can precipitate undesired salts 12 Repeat step 7 13 Remove the supernatant 14 Gently overlay the pellets with 200 ul of 80 ethanol 15 Centrifuge at 14 000 rpm for 5 min 16 Carefully remove the supernatant If you labelled with 32 dCTP check for the pellet using a Geiger counter 17 Air dry the pellets for 5 10 min 18 Dissolve the pellet in 5 5 ul of HO and store at 20 C Th
52. lontechniques Inthe Southern blot probed with G3PDH PanelA bandAis considered to be a true band because it meets both criteria its intensity increased in proportion to the number of PCR cycles and its molecular weight shifted slightly downward after secondary PCR In contrast the other bands can be attributed to background because they do not meet the criteria The three bands B in the subtracted fraction probably represent PCR products that were highly enriched in the subtracted library and cross hybridized with the G3PDH probe simply because of their abundance The probe also cross hybridized with the molecular weight marker C which contains no G3PDH DNA but is also present in excess These bands may also result from partial homology of the PCR primers to gene specific sequences In contrast the Southern blot probed with a tubulin Panel B displays very little background all ofthese bands are most likely genuine results As evident from both blots exceeding 30 primary PCR cycles and 14 secondary cycles dramatically increases background Clontech Laboratories Inc www clontech com Protocol No PT1117 1 38 Version No PR732188 PCR Select cDNA Subtraction Kit User Manual V Analysis of Results amp Troubleshooting Guide continued Unsubtracted Subtracted Unsubtracted Subtracted 1 PCR cycles 23 26 29 32 23 26 29 32 30 30 1 PCR cycles 23 26 29 32 23 26 29 32 30 30 2 PCR cycles 12 12 12 12 12 19 2
53. lus one additional reaction per rxn sterile HO 3 ul 5X Ligation Buffer 2 ul T4 DNA Ligase 400 units ul 1 ul Note The ATP required for ligation is a component of theT4 DNA Ligase mix 3 mM initial 300 uM final 4 For each experimental tester cDNA and forthe control skeletal muscle tester cDNA combine the reagents inTable l in the order shown in 0 5 ml microcentrifuge tubes Pipet mixture up and down to mix thoroughly TABLE 1 SETTING UP THE LIGATION REACTIONS REPEAT FOR EACH EXPERIMENTAL TESTER cDNA amp THE CONTROL SKELETAL MUSCLE TESTER cDNA Tube Number 1 2 Component Tester 1 1 Tester 1 2 Diluted tester 2 yl 2 ul Adaptor 1 10 uM 2 yl Adaptor 2R 10 uM 2 yl Master Mix 6 ul 6 ul Final volume 10 ul 10 ul Use the same setup for Tester 2 1 and 2 2 3 1 and 3 2 5 In a fresh microcentrifuge tube mix 2 ul of Tester 1 1 and 2 ul of Tester 1 2 After ligation is complete this will be your unsubtracted tester control 1 c see Figure 3 Do the same for each additional experimental tester cDNA and the control skeletal muscle tester Protocol No PT1117 1 www clontech com Clontech Laboratories Inc Version No PR732188 PCR Select cDNA Subtraction Kit User Manual IV PCR Select cDNA Subtraction Protocols continued cDNA After ligation approximately 1 3 of the cDNA molecules in each unsubtracted tester control tube will bear two different adaptors Centrifuge briefly and incubate a
54. ly collect the top aqueous layer and place in a fresh 0 5 ml microcentrifuge tube Discard the inter and lower phases and dispose of them appropriately Add 100 ul of chloroform isoamyl alcohol 24 1 Repeat steps 8 and 9 Add 40 ul of 4 M NH OAc and 300 ul of 95 ethanol Note Proceed immediately with precipitation Do not store tubes at 20 C Prolonged exposure to this temperature can precipitate undesired salts Vortex thoroughly and centrifuge at 14 000 rpm for 20 min at room temperature Carefully collect the supernatant If you labelled with a 32P dCTP check for the pellet using a Geiger counter Overlay the pellet with 500 ul of 80 ethanol Centrifuge at 14 000 rpm 10 min Remove the supernatant If you labelled with a P dCTBP check for the pellet using a Geiger counter Air dry the pellet for about 10 min to evaporate residual ethanol Dissolve precipitate 50 ul of sterile H O Transfer 6 yl to a fresh microcentrifuge tube Store this sample at 20 C until after Rsa digestion for agarose gel electrophoresis to estimate yield and size range of ds cDNA products synthesized see Section V A E RsaI Digestion Perform the following procedure with each experimental ds tester and driver cDNA as well as with the control skeletal muscle cDNA This step generates shorter blunt ended ds cDNA fragments which are optimal for subtraction and required for adaptor ligation in Section F 1 Add the fo
55. mple and or control cDNA is not reduced after Rsa l digestion repeat the phenol chloroform extraction ethanol precipitation and digestion steps Optional To determine if a sample is completely digested remove a small sample of DNA at 60 and 80 min Compare the samples on an agarose gel If the DNA size distribution for both samples is identical digestion has progressed to completion Clontech Laboratories Inc www clontech com Protocol No PT1117 1 28 Version No PR732188 PCR Select cDNA Subtraction Kit User Manual V Analysis of Results amp Troubleshooting Guide contin C Analysis of Ligation We recommend that you perform the following PCR experiment to verify that at least 25 of the cDNAs have adaptors on both ends This experiment is designed to amplify fragments that span the adaptor cDNA junctions ofTesters 1 1 and 1 2 See Section IV E You should also perform this analysis on your adaptor ligated control skeletal muscle cDNA 3 1 and 3 2 and if doing the reverse subtraction with your second experimental tester cDNA 2 1 and 2 2 The G3PDH primers in this control experiment will work for human mouse and rat genes For other species you will need to design suitable primers Note We recommend that you also include a standard PCR control such as the positive control template in the Advantage cDNA PCR Kit Cat Nos 639101 amp 639102 to verify that your enzyme is performing efficiently 1 Dilute 1 ul
56. nce S Larkin J Pan J Liu J Gong O Zhu M amp Feitelson M A 2004 Activation of fibronectin gene expression by hepatitis B virus x antigen J Viral Hepat 11 4 332 341 Pan J Clayton M amp Feitelson M A 2004 Hepatitis B virus x antigen promotes transforming growth factor beta1 TGF beta1 activity by upregulatin of TGF beta1 and downregulation of alpha2 macroglobulin J Gen Virol 85 Pt 2 275 282 PCR Select Differential Screening Kit April 1997 Clontechniques XII 2 18 19 Sakaguchi N Berger C N amp Melchers 1986 Isolation of cDNA copy of an species expressed in murine pre B cells EMBO J 5 9 2139 2147 Sambrook J amp Russell D W 2001 Molecular Cloning A Laboratory Manual 3rd Edition Cold Spring Harbor Laboratory Cold Spring Harbor NY Sargent T D amp Dawid B 1983 Differential gene expression in the gastrula of Xenopus laevis Science 222 4620 135 139 Siebert P D Chenchik A Kellogg D E Lukyanov K A amp Lukyanov S A 1995 An improved method for walking in uncloned genomic DNA Nucleic Acids Res 23 6 1087 1088 Clontech Laboratories Inc www clontech com Protocol No PT1117 1 Version No PR732188 PCR Select cDNA Subtraction Kit User Manual Vil References continued Wang Z amp Brown D D 1991 A gene expression screen Proc Natl Acad Sci USA 88 24 11505 11509 Specific References for PCR Select Technology
57. nual IV PCR Select cDNA Subtraction Protocols PLEASE READ ENTIRE PROTOCOL BEFORE STARTING A General Considerations Wear gloves to protect RNA and cDNA samples from degradation by nucleases The cycling parameters in this protocol have been optimized on the Gene Amp DNA Thermal Cycler 480 and GeneAmp Systems 2400 9600 Optimal parameters may vary with different thermal cyclers polymerase mixes and templates If you use the PCR Select Differential Screening Kit Cat No 637403 to differentially screen your samples before performing Northern blot analysis you will need to perform two subtractions your original intended subtraction forward subtraction and a reverse subtraction in which tester serves as driver and driver as tester For more information about differential screening see Section VI and the PCR Select Differential Screening Kit User Manual PT3831 1 A hotstart MUST beusedto reduce nonspecific DNA synthesis during the setup ofthe PCR We recommend using eitherTaqStart Antibody Kellogg et al 1994 or manual hot start D Aquila et al 1991 This protocol was optimized using ourTaqStart V Antibody individually available as Cat Nos 639250 amp 639251 also included in our Advantage cDNA Polymerase Mix Cat 639105 To resuspend pellets and mix reactions gently pipet them up and down and centrifuge the tube briefly to deposit contents at the bottom Mix phenol chloroform extractions by vortexing
58. obtained from high quality experimental poly A RNAs You should analyze the efficiency of cDNA synthesis and Rsal digestion by agarose gel as shown in Figure 4 next page 2 Troubleshooting of ds cDNA synthesis a If agarose gel analysis indicates that the yield of your experimental ds cDNA is low in comparison with the ds cDNA produced from the skeletal muscle poly A RNA but the size distribution is similar you may still use your cDNA However it is highly likely that you may have lost some low abundance differentially expressed sequences Alternatively you may repeat the synthesis using a higher concentration of poly A RNA for first strand cDNA synthesis Protocol No PT1117 1 www clontech com Clontech Laboratories Inc Version No PR732188 21 PCR Select cDNA Subtraction Kit User Manual V Analysis of Results amp Troubleshooting Guide contin b If your experimental ds cDNA appears on an agarose gel as a smear lt 1 2 kb the RNA may have been impure or degraded Electrophorese the RNA used as starting materialon a denaturing formaldehyde 1 agarose EtBr gel Intact total mammalian RNA typically exhibits two bright bands corresponding to ribosomal 28S and 18S RNA at 4 5 and 1 9 kb respectively with a ratio of intensities of 1 5 2 5 1 Mammalian poly A RNA appears as a smear from 0 5 12 kb with weak ribosomal RNA bands present The size distribution may be smaller 0 5 3 kb for nonmammalian species If y
59. ocedure for this dilution 2 Prepare your control skeletal muscle tester cDNA a Dilute the 174 Ill Control DNA with sterile H O to a final concentration of 150 ng ml b Mix 1 ul of control skeletal muscle cDNA Step 19 with 5 ul of the diluted X174 Hae Ill Control DNA 150 ng ml This is your control skeletal muscle tester cDNA It contains 0 296 Hae Ill digested 174 DNA each fragment corresponds to about 0 0296 of the total cDNA After subtraction of the skeletal muscle tester cDNA against the skeletal muscle driver cDNA the primary bands produced inthe final PCR should correspond to these control fragments Clontech Laboratories Inc www clontech com Protocol No PT1117 1 18 Version No PR732188 PCR Select cDNA Subtraction Kit User Manual IV PCR Select cDNA Subtraction Protocols continued If you have used the Super SMART PCR cDNA Synthesis Kit to prepare your cDNA you should repeat Step 2 above using the human placenta cDNA from the Super SMART procedure as described in the Super SMART cDNA Synthesis Kit User Manual PT3656 1 For the rest of the PCR Select protocol you should analyze the control human placenta cDNA in parallel with the control skeletal muscle cDNA Prepare your adaptor ligated tester cDNA 3 Prepare ligation Master Mix by combining the following reagents in a 0 5 ml microcentrifuge tube To ensure that you have sufficient Master Mix prepare enough for all ligations p
60. our RNA appears on an agarose gel smaller than expected e g no larger than 1 2 kb as a smear 1 2 kb and or the ratio of intensity of 28S to 18S observed is 1 1 these indicate that your RNA may have been of poor quality We suggest you test all RNA isolation reagents for the presence of RNase or other impurities If contamination is found you must prepare RNA again using fresh reagents if necessary If problems persist you may need to identify another source oftissue or cells such as our Premium Poly RNAs see Related Products SectionVIll Poor quality and or degraded RNA produces high background in the subtraction procedure and should not be used as starting material The optimal concentration of poly A RNA for first strand cDNA synthesis is 50 200 ug ml If you use a lower concentration of RNA the size distribution of cDNA products synthesized may be reduced B Analysis of Rsa Digestion Electrophorese 2 5 ul of undigested ds cDNA from Section IV D and 5 ul ofRsal digested cDNA from Section IV E on a 1 agarose EtBr gelin 1XTAE buffer side by side cDNA derived from poly A RNA appears as a smear from 0 5 10 kb Bright bands correspond to abundant mRNAs or rRNAs Size distribution may beonly 0 5 3 kb forsome RNA samples from nonmammalian species After Rsa digestion the average size is smaller 0 1 2 kb compared to 0 5 10 kb Typical results are shown in Figure 4 If the size distribution of your sa
61. pressed tester sequences have different annealing sites for the nested primers on their 5 and 3 ends The entire population of molecules is then subjected to PCR to amplify the desired differentially expressed sequences During this PCR type a and d molecules are missing primer annealing sites and thus cannot be amplified Due to the suppression PCR effect most type b molecules form a pan like structure that prevents their exponential amplification see Appendix A for more details Type c molecules have only one primer annealing site and amplify linearly Only type e molecules the equalized differentially expressed sequences with two different adaptors amplify exponentially Next a secondary PCR amplification is performed using nested primers to further reduce any background PCR products and enrich for differentially expressed sequences The cDNAs can then be directly inserted into a T A cloning vector Alternatively site specific cloning can be performed using the Not also Sma 1 site on Adaptor and the Eag site on Adaptor 2R Blunt end cloning requires use ofthe Rsalsite atthe adaptor cDNA junction This cloning allows identification of differentially expressed RNAs by sequence and or hybridization analysis Additionally the PCR mixture can be used as a hybridization probe to screen DNA libraries PCR Select differential screening Afterthe subtracted cDNA library has been obtained itisimportantto confirm that in
62. sity of true bands should increase proportionally to the number of PCR cycles used during subtraction Occasionally very intense bands will appear only in a fraction that was subjected to a high number of cycles i e gt 30 primary cycles of amplification Such bands should be considered background In addition a band sometimes may appear in one fraction but not in others These bands may be due to contamination or result from a random event that occurred during that particular PCR because of the very low concentration of target molecules present after subtractive hybridization The second criterion for true bands is that they should be amplified by both sets of primers primary and nested Since the products resulting from PCR with the nested primers are slightly smaller than those produced by the flanking primers true bands undergo aslight downward shift in molecular weight after secondary PCR amplification Figure 9 shows an example of the type of background that may be observed on Southern blots For this experiment PCR Select cDNA subtraction was performed with poly At RNA from stimulated and unstimulated T cell hybridomas i e with and without treatment with an antibody for the T cell receptor The efficiency of subtraction was assessed by Southern blot hybridization to a probe for G3PDH and a tubulin These data were kindly provided by Wong et al at Rockefeller University For details see the article in the July 1996 issue of C
63. t 16 C overnight Add 1 ul of EDTA Glycogen Mix to stop ligation reaction Heat samples at 72 C for 5 min to inactivate the ligase Briefly centrifuge the tubes Your experimental and control skeletal muscle Adaptor Ligated Tester cDNAs and unsubtracted tester controls are now complete 10 Remove 1 ul from each unsubtracted tester control 1 c 2 c 3 c and dilute into 1 ml of These samples will be used for PCR Section IV I 11 Store samples at 20 C Perform the ligation efficiency analysis described in Section V C prior to proceeding with the hybridizations on Section IV G Cc ow Oo First Hybridization Perform the ligation efficiency analysis SectionV C before proceeding with the hybridizations described below If your ligation was not efficient repeat the ligation step before proceeding any further In the following procedure an excess of driver cDNA is added to each tester cDNA samples are heat denatured and allowed to anneal The remaining ss cDNAs available for the second hybridization are dramatically enriched for differentially expressed sequences because non target cDNAs present in the tester and driver cDNA form hybrids Important Before you begin the hybridization allow the 4X Hybridization buffer to warm up to room temperature for at least 15 20 min Verify that there is no visible pellet or precipitate before using the buffer If necessary heat the buffer at 37 C for 10 min to dissolv
64. ted cDNA the major bands appearing after 27 cycles should correspond to the 174 Ill fragments This result should look similar to the skeletal muscle subtraction you performed however the correct 174 bands may appear only after secondary PCR The experimental primary PCR subtraction products usually appear as a smear from 0 2 2 kb with or without some distinct bands a If you cannot see any products after 27 cycles use 3 additional cycles and analyze by gel electrophoresis b IfyoucannotdetectPCR productsinthesubtracted orunsubtracted unsubtracted tester control 1 c samples nor PCR control subtracted mixture you must verify that your polymerase is working If the problem is not with your polymerase mix try optimizing the PCR cycling parameters in Step IV I 7 by decreasing the annealing and extension temperature in small increments each degree lower can dramatically increase the background A starting point is to reduce the annealing temperature from 66 C to 64 C and the extension temperature from 72 C to 71 C IfyoucandetectPCR products in the unsubtracted unsubtracted tester control 1 c samples but not in the subtracted sample perform additional cycles of secondary PCR 2 Agarose EtBr gel analysis of secondary PCR The patterns of secondary PCR products from the PCR Control Subtracted cDNA and from your skeletal muscle subtraction Clontech Laboratories Inc www clontech com Protocol No
65. that contains specific differentially expressed transcripts as tester and the reference cDNA as driver Tester and driver cDNAs are hybridized and the hybrid sequences are then removed Consequently the remaining unhybridized cDNAs represent genes that are expressed in the tester yet absent from the driver mRNA Although traditional subtractive hybridization methods have been successful in some cases they require several rounds of hybridization and are not well suitedforthe identification of raremessages Duguid amp Dinauer 1990 Hara et al 1991 Hedricketal 1984 Sargent amp Dawid 1983 and Davis etal 1984 The PCR Select cDNA Subtraction Kitis based on a unique method of selective amplification of differentially expressed sequences which overcomes the technical limitations of traditional subtraction methods Diatchenko et al 1996 Gurskaya et al 1996 Figure 1 presents a brief overview of the PCR Select procedure The entire procedure requires only 0 5 2 ug of poly A RNA takes 3 4 days and does not require physical separation of single stranded ss and double stranded ds molecules Duguid amp Dinauer 1990 Sargent amp Dawid 1983 and Hedrick et al 1984 Furthermore suppression PCR U S Patent No 5 565 340 described in Appendix A prevents undesirable amplification during enrichment of target molecules Molecular basis of PCR Select cDNA subtraction Figure 2 details the molecular events that occur during
66. the droplet of sample e Repeat steps b d with the tube containing the freshly denatured driver The pipette tip should now contain both samples hybridization sample 2 and denatured driver separated by a small air pocket f Transfer the entire mixture to the tube containing hybridization sample 1 g Mix by pipetting up and down 5 Briefly centrifuge if necessary 6 Incubate reaction at 68 C overnight 7 Add 200 ul of dilution buffer and mix by pipetting 8 Heat at 68 C for 7 min in a thermal cycler 9 Store at 20 C 1 PCR Amplification Differentially expressed cDNAs are selectively amplified during the two reactions described in this section Prior to thermal cycling the missing strands of the adaptors are filled in by a brief incubation at 75 C Step IV I 6 this creates the binding site for PCR Primer 1 see Figure 2 Inthe first amplification only ds cDNAs with different adaptor sequences on each end are exponentially amplified In the second amplification nested PCR is used to further reduce background and enrich for differentially expressed sequences A minimum of seven PCR reactions are recommended as described in Figure 3 1 forward subtracted experimental cDNA 2 unsubtracted tester control 1 c 3 reverse subtracted experimental cDNA 4 unsubtractedtester control forthe reverse subtraction 2 c 5 subtracted control skeletal muscle cDNA 6 unsubtracted tester control for the control subtraction
67. yield from X bacteriophage templates Proc Natl Acad Sci USA 91 6 2216 2220 Cao W Epstein C Liu H DeLoughery C Ge N Lin J Diao R Cao Long Zhang X Chen Y Busche S Wenck M Wong K Saltzman A G Tang Z Liu L amp Zilberstein A 2004 Comparing gene discovery from Affymetrix GeneChip microarrays and Clontech PCR Select cDNA subtraction a case study BMC Genomics 5 1 26 32 CapFinder PCR cDNA Synthesis Kit October 1996 Clontechniques XI 4 2 3 Chenchik A Moquadam amp Siebert P D 1996 A new method for full length cDNA cloning by PCR In A Laboratory Guide to RNA Isolation Analysis and Synthesis ed Krieg P A Wiley Liss Inc NY pp 273 321 Chenchik A Zhu Y Diatchenko L Li R Hill J amp Siebert P 1998 Generation and use of high quality cDNA from small amounts of total RNA by SMART PCR In RT PCR Methods for Gene Cloning and Analysis In RT PCR Methods for Gene Cloning and Analysis Eds Siebert P amp Larrick J BioTechniques Books MA pp 305 319 Cheng S Fockler C Barnes W M amp Higuchi R 1994 Effective amplification of long targets from cloned inserts and human genomic DNA Proc Natl Acad Sci USA 91 12 5695 5699 D Aquila R T Bechtel L J Videler J A Eron J J Gorczyca P amp Kaplan J C 1991 Maximizing sensitivity and specificity by preamplification heating Nucleic Acids Res 19 13 3749

PCR-Select cDNA Subtraction Kit User Manual

Contents

Download Pdf Manuals

Related Search

Related Contents