Tet-Off® Advanced Inducible Gene Expression Systems
Contents
1. Vill Developing a Tet Off Advanced Cell Line continued Protocol 2 4 weeks Protocol 2 3 days C Protocol Creating a Stable Tet Off Advanced Cell Line from Your Target Cell Line 1 Plate target cells at a density appropriate for your transfection method After 12 24 hr transfect them with the pTet Off Advanced Vector by your preferred method NOTE Using an alternative Tet Off Advanced expression vector requires that a linear selection marker hygro mycin or puromycin be cotransfected along with the vector plasmid Use a vector to marker molar ratio of 20 1 i e 20 fold less marker than plasmid A different marker must be used when transfecting the TRE based expression vector in Section IX When transfection is complete reseed the transfected cells in 10 cm plates in complete culture medium Use the plating density for your cell line that is optimal for G418 selection Appendix B Allow cells to divide twice 24 48 hr then add G418 at the selection concentration that is optimal for your cell line For most cell lines this is usually 400 500 pg ml Replace medium with fresh complete medium plus G418 every four days or more often if necessary Cells that have not taken up the plasmid should begin to die after 5 days Avoid passaging the cells a second time since replating cells under selection may result in plates containing too many colonies for effective colony isolation After 2 weeks G418 resistant colonies s2. User Manual Tet Off Advanced Inducible Gene Expression Systems User Manual O Clontech United States Canada 800 662 2566 Asia Pacific 1 650 919 7300 Europe 33 0 1 3904 6880 Japan 81 0 77 543 6116 Cat Nos many Clontech Laboratories Inc PT3945 1 101612 ATakara Bio Company 1290 Terra Bella Ave Published October 2012 Mountain View CA 94043 Technical Support US E mail tech clontech com www clontech com Tet Off Advanced Inducible Gene Expression Systems User Manual Table of Contents bk AERO CCE OM cdc Eege ee 3 As SUMMIT ALY EE 3 B Elements of Tet Off Advanced Induction ccscesssssssssseeecseecseseesceececeecececeececeeceeesceeeaeeeaecesaeeeeaeeeeaeees 3 C Benefits of the Tet Advanced Expression Systems cecsssssssescsseseesecsseeeeseeseseseeeeseeeaeeeteceeseeetesasaeeeeees 4 Dy Doxycycline is scscssihssscasssiausacassaxbusais ie axosvacevceroncacastedencevs ead acess cans aceseateveatentatasteren cave itaued aus dE Ee 4 IL List of System Components EEN 5 Ill Additional Materials Required ccc ccc eee eecceeeesneesesceeesseeevesseeeseeoesesneeeeseeseseeenenaes 5 IV Protocol e EE 7 Ay General Cell Culture acsssesdctiissietescseacdesisieachsncavcia EET YAE EE E TETEK 7 B Establishing the Tet Off Advanced System in Target Cell 7 V Plasmid Propagation and Vector Construction NENNEN 8 A General Molecular Biology Technique Seriene sasa esoe staves tiene a ee S 8
3. Press NY B Plasmid Propagation amp Construction of Your pTRE Tight Vector 1 To ensure that you have a renewable source of plasmid DNA transform each of the plasmids provided into a suitable E coli host strain e g Stellar Electrocompetent Cells Cat No 636765 See the specific Vector Information Packet supplied with each vector for further DNA propagation details 2 For plasmids to be used in cloning grow a sufficient culture volume of transformed bacteria and purify the plasmid DNA using an appropriate NucleoBond Xtra or NucleoSpin kit see www clontech com or an equivalent purification method 3 Using standard cloning techniques and appropriate directional restriction sites clone your GOI cDNA fragment in the multiple cloning site MCS of pTRE Tight or your TRE based vector of choice see Ap pendix A You may also use Clontech s In Fusion technology such as the In Fusion HD Cloning System Cat No 639648 In Fusion allows PCR products to be easily cloned without restriction enzyme digestion or ligation into any linearized vector To use In Fusion you must synthesize PCR primers that are specifi cally designed for this purpose For more information see the In Fusion HD Cloning System User Manual 4 Perform a midi or maxi scale plasmid DNA preparation for each plasmid that will be transfected into target cells For guaranteed transfection grade plasmid DNA we recommend using NucleoBond Xtra Midi Plus or Max
4. The system is established in target cells by sequentially transfecting them with the provided vectors and selecting stable cell lines Target cells that express the Tet Off Advanced transactivator and that also contain an integrated TRE based expression vector e g pTRE Tight will express high levels of your GOI when cultured in the absence of the antibiotic doxycycline Dox Figure 1 B Elements of Tet Off Advanced Induction Based on the original tetracycline Tc regulated transcriptional transactivators described by Gossen amp Bujard 1992 and Gossen et al 1995 Tet Off Advanced is a modified transactivator protein that is optimized for expres sion in mammalian cells and which demonstrates higher sensitivity and fidelity than previous versions Urlinger et al 2000 The inducible promoter P provides for very low basal expression and tightly controlled induction e The Tet Off Advanced transactivator The pTet Off Advanced vector constitutively expresses the tetracy cline controlled transcriptional transactivator Tet Off Advanced Urlinger et al 2000 This engineered protein consists of the E coli TetR protein fused to three minimal F type activation domains derived from the herpes simplex virus VP16 protein Baron et al 1997 Triezenberg et al 1988 In the absence of Dox Tet Off Advanced binds to the etO sequences in P and activates high level transcription from this inducible promoter Transcription is turned of
5. 200 400 and 800 pg ml For puromycin add the drug at 0 1 0 2 5 5 0 7 5 and 10 0 ug ml 2 For G418 incubate the cells for 5 10 days or until all cells are dead Examine the dishes for viable cells every two days Replace the selective medium every four days or more often if necessary until the optimal concentration is determined 3 For puromycin incubate the cells 4 7 days Replace medium after 2 days to remove dead cells Appendix C Using pTRE Cycle Vectors to Rapidly Control Protein Levels A Summary Clontech s pTRE Cycle vectors allow precise rapid control of inducible expression by using a multi tiered approach that combines the powerful transcriptional control of the Tet Advanced System with the controlled protein destabi lization of the ProteoTuner System Transcriptional control of your GOI is achieved with Dox while the stability of your protein is controlled with the ProteoTuner ligand Shield1 Cat No 631037 With this combination it is possible to rapidly and completely eliminate your expressed protein from cells by adding Dox and removing Shield1 and have it reappear by removing Dox and adding Shield1 The pT RE Cycle vectors possess the following two key features The Dm Promoter provides tight bidirectional control of transcription mediated by Tet Advanced transac tivators e The ProteoTuner destabilizing domain DD allows the stability of a protein of interest to be precisely con trolled by
6. 48 hrs 6 Expand the culture as needed Note The appropriate selective antibiotic s should be added to the medium after 48 72 hr in culture Maintain stable and double stable Tet Cell Lines in complete culture medium containing a maintenance concentration G418 and or hygromycin as appropriate Typically this is 100 ug ml for each drug Clontech Laboratories Inc www clontech com Protocol No PT3945 1 ATakara Bio Company Version No 101612 9 Tet Off Advanced Inducible Gene Expression Systems User Manual VI Culturing Premade Tet Cell Lines continued C Protocol Freezing Tet Cell Line Cultures Once you have started growing a Tet System cell line either a premade one from Clontech or one of your own cell lines prepare frozen aliquots to ensure a renewable source of cells 1 2 3 4 Trypsinize the desired number of flasks or plates Pool cell suspensions together count cells and calculate total viable cell number Centrifuge cells at 100 x g for 5 min Aspirate the supernatant Resuspend the pellet at a density of at least 1 2x10 cells ml in freezing medium Freezing medium can be purchased from Sigma Cat Nos C6164 amp C6039 or freeze cells in 70 90 FBS 0 20 medium with out selective antibiotics and 10 DMSO Dispense 1 ml aliquots into sterile cryovials Freeze slowly 1 C per min For this purpose you can place the vials in Nalgene cryo containers Nalgene Cat No 5100 and freeze at
7. 80 C overnight Alternatively place vials in a thick walled styrofoam con tainer at 20 C for 1 2 hr Transfer to 80 C and freeze overnight Remove vials from the cryo containers or styrofoam containers the following day and place in liquid nitrogen storage or ultralow temperature freezer 150 C for storage Two or more weeks later plate a vial of frozen cells to confirm viability Vil Luciferase Induction in the CHO AA8 Luc Tet Off Control Cell Line A Testing Luciferase Induction Before you develop your own Tet Off Advanced System we strongly recommend that you perform a Dox dose response curve using the CHO AA8 Luc Tet Off Cell Line This premade double stable Tet Off pTRE Luc cell line exhibits gt 1000 fold induction of luciferase when Dox is removed from the culture medium In addition to provid Protocol 2 3 days ing a hands on experience with a Tet Off system this experiment 1 calibrates the effective concencentration of your Dox i e full supression of gene expression is generally obtained with 10 100 ng ml Dox and 2 verifies that your tissue culture medium and serum are free of tetracycline contamination Luciferase induction in the CHO AA8 Luc Tet Off cell line is highly reproducible If induction is significantly lower than 1000 fold it is possible that your serum is contaminated with Tc B Protocol Inducing Luciferase Expression in CHO AA8 Luc Tet Off Cell Line 1 After thawing and est
8. B Plasmid Propagation amp Construction of Your pTRE Tight Mector 8 VI Culturing Premade Tet Cell Lines Aen 9 A Characteristics of Tet Gell Lines ss cce vesehvesevesetiiuacseseteovsesastshavhcvaevssabvevarveuetbese cutee eavaceavaceavncadlecauuneduents 9 B Protocol Starting Tet Cell Cultures from Frozen brocks 9 C Protocol Freezing Tet Cell Line Cultures smissu a n EES 10 VII Luciferase Induction in the CHO AA8 Luc Tet Off Control Cell Line een 10 A Testing Luciferase Induction eseu ienis enea ean ra E e EEE EEEE EEEE E E i 10 B Protocol Inducing Luciferase Expression in CHO AA8 Luc Tet Off Cell Line 10 VIII Developing a Tet Off Advanced Cell Line ccccceceeeessseeeeeeseeeeeeeeeecneeeeeeesneeeeeesssneeeenes 11 As SUMMA ane a a R Eege E E AEE 11 B Protocol Pilot Testing Tet Based Induction in Target Cell 11 C Protocol Creating a Stable Tet Off Advanced Cell Line from Your Target Cell Line wee 12 D Protocol Testing Your Tet Off Advanced Clones for Induerton cececessesseseeserseseecsenseeeeeetseeeeees 12 IX Developing the Double Stable Tet Off Advanced Inducible Cell Line E 13 A Functional Testing of pTRE Tight GOI in the Tet Off Advanced Cell Line wo 13 B Protocol Creating the Double Stable Tet Off Advanced Inducible Cell Line 13 C Protocol Screening Your Panel of Double Stable Tet Off Advanced Inducible Cell Lines 00 14 X References vives cccicccescssccccccevscecsstasscccestes see cesteveic
9. C in the dark Use within one year E Luciferase Assay A method for assaying luciferase expression is required when testing induction in the CHO AA8 Luc Tet Off Control Cell Line or when using the pTRE Tight Luc vector to screen Tet Off Advanced clones Use any standard luciferase assay system and luminometer E Tetracycline Free Fetal Bovine Serum FBS for Target Cell Culture Many lots of bovine sera are contaminated with tetracycline Tc or Tc derivatives which can affect basal expression or inducibility in Tet Systems Figure 2 It is critical that the FBS used for cell culture not interfere with Tet responsive expression e Tc contaminants will diminish the performance of Tet Off Advanced based systems by reducing fold induc tion e These problems can be eliminated by using a Tet System Approved FBS Cat Nos 631101 amp 631106 from Clontech These sera have been functionally tested in our Tet Systems and found to be free of contaminating Tc activity 15 x 10 10x 10 Fold induction 5x 10 Tet System Other commercially Approved FBS available FBS Figure 2 Tetracycline activity in bovine sera The CHO AA8 LucTet Off Control Cell Line was grown in media prepared with different lots of FBS Average uninduced expression level 0 21 RLU n 21 S D 0 07 maximum expression levels varied from 123 to 3 176 RLU Protocol No PT3945 1 Version No 101612 6 www clontech com Clontech Laboratories Inc ATak
10. Off Advanced Inducible Cell Lines Test individual double stable clones for expression of your GOI in the absence and presence of 100 ng ml Dox Be sure to wash and passage the cells as described in Ensuring Induction in a Tet Off Advanced System page 11 Protocol 2 3 Choose clones that generate the highest overall induction and lowest basal expression i e highest fold induction days 1 For each clone to be tested seed an aliquot of cells in a single well of a 6 well plate Use culture medium containing 100 ng ml Dox The cells in this stock plate will be propagated depending upon the results of the screening assay 2 Distribute the remaining cells from each clone among at least 4 wells of a tissue culture plate 24 96 wells using the plating protocol for removing residual Dox from the culture Induced cells no Dox should be tested against uninduced 100 ng ml Dox cells using duplicate wells for each condition 3 Add Dox to the appropriate wells and incubate the cells for 48 hr 4 Harvest the cells and use an assay specific for your GOI to quantify the expression of your GOI 5 Select clones with the highest fold induction for propagation and further testing 6 Freeze stocks of each promising clone as soon as possible Protocol No PT3945 1 www clontech com Clontech Laboratories Inc Version No 101612 ATakara Bio Company 14 Tet Off Advanced Inducible Gene Expression Systems User Manual X References Y
11. com Protocol No PT3945 1 Version No 101612 5 Tet Off Advanced Inducible Gene Expression Systems User Manual lll Additional Materials Required continued E KL Attention B Antibiotics for Selecting Stable Cell Lines cont d e Hygromycin for selecting double stable Tet Off Advanced pTRE Tight cell lines transfected with the Linear Hygromycin Marker Hygromycin B is available from Clontech Cat No 631309 Concentration range for selecting stable cell lines 50 800 pg ml Maintenance of stable cell lines 100 pg ml e Puromycin for selecting double stable Tet Off Advanced pTRE Tight cell lines transfected with the Linear Puromycin Marker Puromycin is available from Clontech Cat Nos 631305 amp 631306 Concentration range for selecting stable cell lines 0 25 10 pg ml Maintenance of stable cell lines 0 25 pg ml C Transfection Reagents e Xfect is a novel highly efficient and versatile transfection reagent that forms biodegradable nanoparticles and produces superior transfection results for a wide variety of mammalian cell types Cat Nos 631317 amp 631318 e The CalPhos Mammalian Transfection Kit is a highly efficient calcium phosphate based transfection system Cat No 631312 D Doxycycline Doxycycline Cat No 631311 is needed for controlling expression of your GOI from the transfected pTRE Tight vector Dilute to 1 2 mg ml in HO Filter sterilize aliquot and store at 20
12. in transiently transfected cells fold induction levels are almost always lower in transient assays than in properly screened stable and double stable clonal cell lines For example the Saos 2 Tet Off Cell Line exhibits 40 fold induction in transient expression assays but stable clones can be isolated that exhibit 6 000 fold induction and have basal expression levels that are indistinguishable from control background expression Therefore an apparent low level of induction is not necessarily a true indication of the inducibility that can be ultimately attained in a particular cell line Ensuring Induction in a Tet Off Advanced System Residual Dox that remains bound to cells or the extracellular matrix can prevent full gene induction in Tet Off Systems Rennel amp Gerwins 2002 Cells that have been maintained in the off state with l 10 100 ng ml Dox should be passaged as follows e Wash the cells on the plate 2X with PBS before trypsinizing o Attention e After trypsinizing and collecting the cells wash them in suspension 1X with PBS and plate in fresh medium without Dox e 3 6 hr after plating the cells and after they have reattached to the substrate wash them on the plate 1X with PBS and add fresh medium with or without Dox Clontech Laboratories Inc www clontech com Protocol No PT3945 1 ATakara Bio Company Version No 101612 11 Tet Off Advanced Inducible Gene Expression Systems User Manual
13. Shield1 Below is a brief outline of the steps needed to perform protein cycling studies We strongly recommend that you consult this Tet Off Advanced Systems user manual and the ProteoTuner Systems User Manual PT4039 1 for detailed protocols describing the independent aspects of these technologies B Screening for Highly Inducible Clones 1 Create and select double stable pTet Off Advanced pT RE Cycle GOI clonal cell lines see Section IX When testing these clones for induction remove Dox if present and add Shield1 50 1000 nM and com pare to cells treated with 100 ng ml Dox and without Shield1 2 Select a clone that has high GOI expression without Dox with Shield1 and very low basal expression with Shield1 alone This ensures that you have the tightest control of transcription Protocol No PT3945 1 Version No 101612 18 www clontech com Clontech Laboratories Inc ATakara Bio Company Appendix C Tet Off Advanced Inducible Gene Expression Systems User Manual Using pTRE Cycle Vectors to Rapidly Control Protein Levels C Performing a protein cycling experiment 1 Expression ON Using the double stable pTet Off Advanced pTRE Cycle GOI clone as selected in Step A induce expression by removing Dox and adding Shield1 Dox is effectively removed by the following treat ment a Wash the cells on the plate 2X with PBS Trypsinize and collect the cells wash them in suspension 1X with PBS and plate in fresh medium
14. ablishing the CHO AA8 Luc Tet Off Cell Line maintain it in the off state by includ ing 100 ng ml Dox in the culture medium To ensure full induction passage the cells using the following method a Wash the cells on the plate 2X with PBS before trypsinizing b After trypsinizing and collecting the cells wash them in suspension 1X with PBS Plate 5 x 104 cells ina volume of 2 3 ml of complete culture medium without Dox into the wells of 2 3 6 well culture plates c 3 6 hr after plating the cells and after they have reattached to the substrate wash them on the plate 1X with PBS and add fresh medium without Dox Test Dox in duplicate or triplicate wells at final concentrations of 0 1 x 10 0 1 1 0 10 and 100 ng ml Allow the cells to grow for 48 hr Assay each sample for luciferase activity using any standard luciferase assay Plot your results and compare to Figure 4 page 8 Protocol No PT3945 1 Version No 10 101612 www clontech com Clontech Laboratories Inc ATakara Bio Company Tet Off Advanced Inducible Gene Expression Systems User Manual VIII Developing a Tet Off Advanced Cell Line A Summary The first step in establishing the Tet Off Advanced Inducible Expression System is creating a Tet Off Advanced stable cell line that 1 expresses the Tet Off Advanced transactivator 2 demonstrates high levels of P induc tion and 3 exhibits low basal expression from P This Tet Off Advanced cell l
15. aliquots of your Tet Off Advanced cell line s B Protocol Pilot Testing Tet Based Induction in Target Cells While many cell backgrounds have been shown to support Tet based expression control Tet systems have not been tested in all cell lines Performing a transient expression assay with pTet Off Advanced and pTRE Tight Luc pro a vides a quick indication of how well the Tet Off Advanced System will work in your target cell line Transfected cells days are cultured in the absence of Dox to induce expression of luciferase from pTRE Tight Luc 1 Using conditions and transfection methods appropriate for your cell line cotransfect duplicate wells of cells in 6 well plates with pTet Off Advanced and pTRE Tight Luc Use several different Tet Off TRE vector ra tios e g at 1 1 1 5 and 5 1 to ensure that a functional induction system is attained in the transfected cells 2 When transfection has been completed replace the transfection medium with fresh culture medium Add Dox 0 01 1 0 pg ml to one of the duplicate wells for each vector ratio being tested leave the second well untreated to achieve full induction of luciferase If multiple wells are available for each ratio test a range of Dox concentrations 3 After 12 24 hr of treatment with Dox harvest the cells and assay for luciferase activity Compare Dox cells to Dox induced cells to determine fold induction NOTE Due to the very high plasmid copy numbers contained
16. ara Bio Company Tet Off Advanced Inducible Gene Expression Systems User Manual IV Protocol Overview PLEASE READ THESE PROTOCOLS IN THEIR ENTIRETY BEFORE STARTING Successful results depend on understanding and performing the following steps correctly A General Cell Culture This user manual provides only general guidelines for mammalian cell culture techniques Perform all steps involv ing cell culture using sterile technique in a tissue culture hood For users requiring more information on mammalian cell culture transfection and creating stable cell lines we recommend the following general reference e Culture of Animal Cells 5th Edition by R I Freshney 2005 Wiley Liss NY B Establishing the Tet Off Advanced System in Target Cells The general strategy for establishing the Tet Off Advanced System is shown in Figure 3 in which target cells are first transfected with pTet Off Advanced to create a stable cell line Once a suitable Tet Off Advanced cell line clone is identified the cell line is then stably transfected with your customized TRE based vector containing your GOI Transfect target cells with pTet Off Advanced Select for stably transfected cells N Pick 230 colonies clones expand and screen for inducibility Carry forward best clone Tet Off Advanced cell line a Gol Ei areas Tera ene SE J Hygromycin J cell line wi based vector an a linear marker Select for stably or puromycin tran
17. cveuevacaevsnceneceesuvvevonssveeesecevieesenesscceventiacceestnve sce 15 Appendix A Tet Vector Information 16 Appendix B Titrating Antibiotics for Selecting Stable Cell Lines ccccseceseeeeeenneeees 18 Appendix C Using pTRE Cycle Vectors to Rapidly Control Protein Levels 000 18 List of Figures Figure 1 Induction in the Tet Off Advanced Setem is iseoteseonesesnesedaesiisesi esi 3 Figure 2 Tetracycline activity in bovine setae c sssccie idee cestiecesaveace cscs Ee NENNEN 6 Figure 3 Establishing the Tet Off Advanced System in target cells cecssssseeseessseeensesseeeseseeeseseeeesataes 7 Figure 4 Doxycycline dose response curve for luciferase expression in the CHO AA8 Luc Tet Off Gonttol Gelb E 8 Figure 5 Map of p let Of Advanced sess itesgedegEtdEgul Ate 16 Figure 6 Map and MCS of PIRE Vight sssccsscesosceevseseseotsessesaseyossaventosunsovussseseis e R EEE ARESE 16 Figur 7 Mapof pI RE Tight Lucy A eeegsg ch sset e errue eierens eksera irae EEKE EEEE EEEE ESEESE 16 aE a E E E O E E ancien 17 Protocol No PT3945 1 www clontech com Clontech Laboratories Inc Version No 2 101612 ATakara Bio Company Tet Off Advanced Inducible Gene Expression Systems User Manual l Introduction A Summary The Tet Off Advanced Inducible Gene Expression System is a tightly regulated and highly responsive system that produces on demand robust expression of your gene of interest GOI in target cells
18. f Advanced Inducible Gene Expression Systems User Manual Appendix B Titrating Antibiotics for Selecting Stable Cell Lines Protocol 3 5 days A Protocol Titrating Antibiotics for Selecting Stable Cell Lines Prior to using G418 hygromycin or puromycin to select stably transfected cell lines it is necessary to titrate each selection agent to determine the optimal concentration for your target cell line Also the absolute activity of the antibiotic can vary from lot to lot With HeLa cells for example we have found 400 pg ml G418 and 1 0 pg ml puromycin to be optimal e For selecting stable cell lines with G418 or hygromycin use the lowest concentration that results in wide spread cell death in 5 days and kills all the cells within two weeks e Puromycin selection occurs more rapidly use a concentration that will kill all cells within 3 4 days e If possible test several plating densities versus each antibiotic concentration If cells become heavily confluent before they begin to die viable clones may be lost if they detach from the plate Also passaging cells while they are under selection is not recommended e IMPORTANT Lot to lot variations in potency exist for all selection drugs so each new lot of antibiotic should be titrated 1 For each antibiotic to be tested plate 2 x 10 cells in each well of a 6 well plate containing 3 ml of the appro priate complete medium plus increasing concentrations of G418 0 50 100
19. f by adding Dox to the culture medium The Tet Off Advanced coding sequence is fully synthetic and utilizes human codon preferences to increase its expression level and stability in mammalian cells e The Pigu inducible promoter This is an inducible promoter that controls transcription of your GOI The D COMposite promoter was originally developed as the P promoter in the laboratory of Dr H Bujard and consists of a modified Tet Responsive Element TRE containing 7 direct repeats of the ter operator sequence Zeit which is joined to a minimal CMV promoter Py te lacks binding sites for endog enous mammalian transcription factors so it is virtually silent in the absence of induction In the absence of Dox Tet Off Advanced binds tightly and specifically to Z GOI Figure 1 i and activates transcription of the downstream Tet Off Advanced min VP16 Transcription Pign Gene of interest Tet Off Advanced System Figure 1 Induction in the Tet Off Advanced System The Tet controlled transactivator Tet Off Advanced is a fusion protein derived from the E coli Tet repressor protein TetR which is joined to three minimal transcription activation domains from the HSV VP16 pro tein In the absence of doxycycline Dox Tet Off Advanced binds to the tetracycline response element TRE moa in Prig and produces high level transcription of the downstream gene of interest Clontech Laboratories Inc www clontech com Protocol N
20. h individually purchased cell line for specific information regarding its culture maintenance and drug resistance Detailed instructions for the use of these cell lines are available in the Tet Systems User Manual PT3001 1 and the Tet Cell Lines Protocol at a Glance PT3001 2 A complete listing of all avail able cell lines can be found at www clontech com B Protocol Starting Tet Cell Cultures from Frozen Stocks Important Frozen cells should be cultured immediately upon receipt or as soon as possible thereafter If culturing after shipping is significantly delayed decreased cell viability may result To prevent osmotic shock and maximize ss hs II survival follow the steps below to begi lture from fi ll 2 3 cell survival follow the steps below to begin a new culture from frozen cells days 1 Thaw the vial of cells rapidly in a 37 C water bath with gentle agitation Immediately upon thawing wipe the outside of the vial with 70 ethanol All of the operations from this point on should be carried out in a laminar flow tissue culture hood under strict aseptic conditions Unscrew the top of the vial slowly and using a pipet transfer the contents of the vial to a 15 ml conical centrifuge tube containing 1 ml of pre warmed medium without selective antibiotics e g G418 Mix gently 2 Slowly add an additional 4 ml of fresh pre warmed medium to the tube and mix gently 3 Add an additional 5 ml of pre warmed medium to the tube mix gentl
21. he drug concentration optimal for your cell line Appendix B Continue drug selection until colonies are visible and all untransfected cells have died Avoid passaging the cells a second time since replating cells under selection may result in plates containing too many colonies for effective colony isolation Colonies should be visible in 2 4 weeks When colonies are large enough to transfer use cloning cylinders or disks to isolate large healthy colonies and transfer them to individual plates or tissue culture wells Harvest as many clones as feasible so that at least 30 clones are available for testing Suspension cultures must be cloned using a limiting dilution tech nique Culture the clones in medium containing maintenance concentrations of G418 and either hygromycin or puromycin and 100 ng ml Dox When they have grown sufficiently test the clones for induction as de scribed in Section C Note Working with mixed polyclonal populations of transfected cells rather than selecting for single clones can affect the consistency of induction due to the possible outgrowth of poorly inducing clones as the cells are passaged Clontech Laboratories Inc ATakara Bio Company www clontech com Protocol No PT3945 1 Version No 101612 13 Tet Off Advanced Inducible Gene Expression Systems User Manual IX Developing the Double Stable Tet Off Advanced Inducible Cell Line C Protocol Screening Your Panel of Double Stable Tet
22. hin 30 minutes after Dox is removed from the culture medium In contrast other mammalian systems often exhibit slow induction up to several days incomplete induction compared to repressor free controls and low overall induction often no more than 100 fold Other systems may also require high nearly cytotoxic levels of inducer reviewed by Gossen et al 1993 Yarronton 1992 Highest absolute expression levels Maximal expression levels in the Tet Systems can be higher than expression levels obtained from the CMV promoter or other constitutive promoters For example Yin et al 1996 reported that the maximal level of luciferase expression in HeLa Tet Off cells transiently transfected with pTRE Luc is 35 fold higher than that obtained with HeLa cells transiently transfected with a plasmid expressing luciferase from the wild type CMV promoter Well characterized effector In contrast to effectors used in other systems such as ecdysone Dox is inex pensive well characterized and yields highly reproducible results Dox binds with high affinity to Tet Off Advanced and is essentially nontoxic at the effective concentrations Note Tet Off Systems respond to tetra cycline and Dox while Tet On Advanced Systems respond only to Dox and not to Tc Gossen amp Bujard 1995 Promoter activation is superior to repression Repression based systems require very high levels of repres sor to ensure 100 occupancy of the regulatory sites and fully shu
23. hould begin to appear When the colonies are large enough to transfer use cloning cylinders or disks to harvest i e pick large healthy colonies and transfer them to individual plates or tissue culture wells Isolate as many clones as fea sible so that at least 30 clones are available for testing Suspension cultures must be cloned using a limiting dilution technique Culture the clones in a maintenance concentration of G418 100 200 ug ml When they have grown suf ficiently proceed with testing the clones for induction as described in Section VIII D D Protocol Testing Your Tet Off Advanced Clones for Induction 1 For each clone to be tested seed 1 3 of the total into a single well of a 6 well plate The cells in this stock plate will be propagated depending upon the results of the screening assay Divide the remaining 2 3 of the cells between duplicate wells of a second 6 well plate Allow the cells to ad here overnight and transfect each well with pT RE Tight Luc using the amount of DNA appropriate for your preferred transfection method When transfection is complete replace the transfection medium with fresh culture medium and add 100 ng ml Dox to one of the duplicate wells while leaving the second well Dox free to achieve full induction Incubate the cells with Dox for 48 hr Assay for luciferase activity and calculate fold induction e g Dox RLU Dox RLU Select clones with the highest fold induction fo
24. humans Clontech products may not be transferred to third parties resold modified for resale or used to manufacture commercial products or to provide a service to third parties without prior written approval of Clontech Laboratories Inc Your use of this product is also subject to compliance with any applicable licensing requirements described on the product s web page at http www clontech com It is your responsibility to review understand and adhere to any restrictions imposed by such statements Clontech the Clontech logo Cal Phos In Fusion ProteoTuner Stellar Tet Off Tet On and Xfect are trademarks of Clontech Laboratories Inc All other marks are the property of their respective owners Certain trademarks may not be registered in all jurisdictions Clontech is a Takara Bio Company 2012 Clontech Laboratories Inc This document has been reviewed and approved by the Clontech Quality Assurance Department Clontech Laboratories Inc ATakara Bio Company www clontech com Protocol No PT3945 1 Version No 101612 19
25. i Plus Kits Cat Nos 740412 10 and 740416 10 For rapid production of endotoxin free transfec tion grade plasmid DNA use NucleoBond Xtra Midi EF Plus or Maxi EF Plus Kits Cat Nos 740422 10 and 740426 10 Sequencing the GOI Insert in pTRE Tight Following cloning of pTRE Tight GOI plasmid the insertion junctions should be confirmed by sequencing Specific primers for pTRE Tight are e Forward primer 5 X AGGCGTATCACGAGGCCCTTTCGT 3 located at 2577 2600 e Reverse primer 5 TATTACCGCCTTTGAGTGAGCTGA 3 located at 683 660 NOTE Do not use the pTRE or pI RE2 Sequencing Primers These primer sets are incompat ible with pTRE Tight CHO AA8 Luc Tet Off Control Cells a 1 Luciferase activity arbitrary units 8 log transformed T T T T T d 001 m A 1 10 100 1000 Doxycycline ng ml Figure 4 Doxycycline dose response curve for luciferase expression in the CHO AA8 Luc Tet Off Control Cell Line Protocol No PT3945 1 www clontech com Clontech Laboratories Inc Version No 101612 ATakara Bio Company 8 Tet Off Advanced Inducible Gene Expression Systems User Manual VI Culturing Premade Tet Cell Lines A Characteristics of Tet Cell Lines Clontech premade Tet System Cell Lines such as the CHO AA8 Luc Tet Off Control Cell Line have been devel oped and functionally tested for use with Tet expression systems and a wide variety of Tet and TRE based vectors See the Certificate of Analysis of eac
26. ine will be subsequently trans fected with your customized pTRE Tight GOI vector which will ultimately enable your target cells to express your GOI when the cells are treated with Dox For best results we suggest that you use a high efficiency transfection method such as Clontech s Xfect Cat No 631317 or CalPhos Mammalian Transfection Kit Cat No 631312 and optimize the transfection conditions for your target cell type Parameters to be optimized include initial plating density transfection time plating den sity for drug selection G418 concentration for selection etc Once G418 selection has been completed we recommend that you isolate as many clones colonies as possible in Section VIII C Step 7 In general isolate and expand enough colonies to be able to zest at least 30 clones Note that not all picked colonies will survive isolation and expansion While it is possible to identify an optimal clone by screening fewer than 30 clones our experience has shown that testing this many clones yields a high rate of success and will prevent significant delays Your panel of Tet Off Advanced cell line clones should be screened by transiently transfecting them with pTRE Tight Luc to test for high induction and low basal expression of luciferase activity When you have identified a clone that demonstrates ideal induction characteristics proceed to Section IX to develop the double stable Tet Off Advanced inducible cell line Be sure to freeze
27. mation Clontech offers a wide variety of inducible expression vectors designed for use with Tet Expression Systems Figure 8 Visit www clontech com for a complete list of currently available vectors The vectors below are supplied with the Tet Off Advanced Gene Expression System Cat No 630934 EcoRI Aol 767 Tet Off Advanced tTA2 Neo pTet Off BamHl Advanced oe Gen 7 1 kb poya LJ Hindlll 1988 BamHI 4212 Xhol 4200 Figure 5 Map of pTet Off Advanced For a complete vector description refer to the enclosed pTet Off Advanced Vector Information Packet PT3845 5 MCS 323 411 Pvul 1985 pTRE Tight 2 6 kb 323 GAATTCGAGCTCGGTACCCGGGGATCCTCTAGTCAGCTGACGCGT EcoRI Kent BamHI Pvull Mlul 368 Smal GCTAGCGCGGCCGCATCGATAAGCTTGTCGACGATATCTCTAGA Miel Eagl Cal Hindili Sall EcoRV Xbal Xho Not Arel Figure 6 Map and MCS of pTRE Tight For a complete vector description refer to the enclosed Vector Information Packet PT3720 5 Luciferase pTRE Tight Luc 4 2 kb sv40 poly A Figure 7 Map of pTRE Tight Luc Protocol No PT3945 1 www clontech com Clontech Laboratories Inc Version No 101612 ATakara Bio Company 16 Tet Off Advanced Inducible Gene Expression Systems User Manual Appendix A Tet Vector Information D Tet Advanced Transactivator Plasmids Vectors that express the Tet On Advanced regulator for inducible gene expression in the pre
28. mp Bujard H 1993 Control of gene activity in higher eukaryotic cells by prokaryotic regulatory elements Trends Biochem Sci 18 471 475 Gossen M Bonin A L Freundlieb S amp Bujard H 1994 Inducible gene expression systems for higher eukaryotic cells Curr Opin Biotechnol 5 516 520 Gossen M amp Bujard H 1992 Tight control of gene expression in mammalian cells by tetracycline responsive promoters Proc Natl Acad Sci USA 89 5547 5551 Gossen M amp Bujard H 1995 Efficacy of tetracycline controlled gene expression is influenced by cell type Bio Techniques 89 213 215 Gossen M amp Bujard H 2002 Studying gene function in eukaryotes by conditional gene inactivation Annu Rev Genet 36 153 73 Gossen M Freundlieb S Bender G Muller G Hillen W amp Bujard H 1995 Transcriptional activation by tetracycline in mammalian cells Science 268 1766 1769 Harkin D P Bean J M Miklos D Song Y H Truong V B Englert C Christians F C Ellisen L W Maheswaran S Oliner J D amp Haber D A 1999 Induc tion of GADD45 and JNK SAPK dependent apoptosis following inducible expression of BRCA1 Cell 97 575 586 Rennel E amp Gerwins P 2002 How to make tetracycline regulated transgene expression go on and off Anal Biochem 309 79 84 Sambrook J Fritsch E E amp Maniatis T eds 2001 Molecular Cloning A Laboratory Manual Cold Spring Harbor Laboratory Press Cold Sp
29. o PT3945 1 ATakara Bio Company Version No 101612 3 Tet Off Advanced Inducible Gene Expression Systems User Manual l Introduction continued C Benefits of the Tet Advanced Expression Systems The Tet Off Advanced System produces very high maximal expression coupled with extremely low basal promoter activity to yield very high induction levels that are both highly sensitive and concentration dependent Advantages over other inducible mammalian gene expression systems are listed below Extremely tight regulation In the absence of induction in the presence of Dox the Tet Off Advanced transactivator shows virtually no residual binding to the TRE in D Thus basal expression is extremely low and often undetectable Highly specific The TetR portion of the Tet Off Advanced transactivator binds very specifically to the tetO target sequences of D and does not activate off target cellular genes This high degree of specificity may be due in part to the prokaryotic nature of these components acting within the context of a large eukaryotic genome lacking similar elements Harkin er al 1999 No pleiotropic effects Tc and Dox are prokaryotic antibiotics that have no known effects on eukaryotic cells when used at the concentrations required by the Tet Advanced Systems High inducibility and fast response times In properly screened clones maximal induction of the Tet Off Advanced System is often several thousand fold and can be detected wit
30. ou can access further information on Tet Systems products on our website www clontech com Clontech s Tet Systems were developed in cooperation with Dr Bujard and his colleagues at the Center for Molecular Biology in Heidelberg ZMBH and in Dr Wolfgang Hillen s laboratory at the University of Erlangen Germany Additional background information on Tet regulated gene expression systems and an extensive bibliography are available at the website maintained by TET Systems http www tetsystems com Please note that Clontech is not responsible for the information contained on this website Ausubel E M Brent R Kingdom R E Moore D M Seidman J G Smith J A amp Struhl K eds 1995 Current Protocols in Molecular Biology John Wiley amp Sons NY Baron U Freundlieb S Gossen M amp Bujard H 1995 Co regulation of two gene activities by tetracycline via a bidirectional promoter Nucleic Acids Res 23 3605 3606 Baron U Gossen M amp Bujard H 1997 Tetracycline controlled transcription in eukaryotes novel transactivators with graded transactivation potentials Nucleic Acids Res 25 2723 2729 Freshney R I 2005 Culture of Animal Cells 5th Edition Wiley Liss New York NY Freundlieb S Schirra Miiller C amp Bujard H 1999 A tetracycline controlled activation repression system with increased potential for gene transfer into mam malian cells J Gene Med 1 4 12 Gossen M Bonin A a
31. portant information below We strongly recommend using Tet System Approved FBS Cat Nos 631101 amp 631106 for culturing target cells Cloning cylinders or discs for isolating colonies of adherent cell lines PGC Scientific Cat No 62 6150 40 45 or Cat No 62 6151 12 16 Cell Freezing Medium with or without DMSO Sigma Cat No C6164 or Cat No C6039 for freezing Tet Off Advanced cell lines and double stable Tet Off Advanced cell lines Optional B Antibiotics for Selecting Stable Cell Lines Prior to using antibiotics to select stable cell lines from your transfected cells determine the optimal selection con centration for each antibiotic as described in Appendix A For example the G418 concentration range for selecting stable HeLa cell lines is 400 500 pg ml However each new lot of any selection antibiotic should be titrated e G418 for selecting single stable Tet Off Advanced cell lines G418 is available from Clontech Cat No 631307 Note that the effective weight is approximately 0 7 g per gram of powder Make a 10 mg ml stock solution by dissolving 1 g of powder in approximately 70 ml of culture medium without supplements Filter sterilize and store at 4 C Concentration range for selecting stable cell lines 50 800 pg ml Maintenance of stable cell lines 100 pg ml Selection concentration e g HEK 293 HeLa cells 400 500 pg ml Clontech Laboratories Inc ATakara Bio Company www clontech
32. r propagation and further testing i e clones that exhibit gt 20 fold induction NOTE When testing clones via transient transfection you can expect lower fold induction levels than in double stable clones This is due to the far higher copies of the TRE containing plasmid present in transiently transfect ed cells compared to the copy numbers in stable cell lines Freeze stocks of each promising clone as soon as possible after expanding the culture Protocol No PT3945 1 Version No 12 101612 www clontech com Clontech Laboratories Inc ATakara Bio Company Tet Off Advanced Inducible Gene Expression Systems User Manual IX Developing the Double Stable Tet Off Advanced Inducible Cell Line A Functional Testing of pTRE Tight GOl in the Tet Off Advanced Cell Line Prior to establishing the double stable Tet Off Advanced cell line for your GOI your pTRE Tight GOI construct should be tested for functionality Transiently transfect your pT RE Tight GOI vector into one or more stable cell lines created in Section VIII D and test for GOI induction in the absence of Dox You will need an appropriate gene specific assay to test for induction For example e Western blotting or immunoprecipitation with an antibody to the GOI protein e RT PCR using GOI specific primers Be sure you can discriminate true RT PCR products from products derived from genomic DNA e Northern blotting with a GOl specific probe e Functional assay fo
33. r the GOI protein B Protocol Creating the Double Stable Tet Off Advanced Inducible Cell Line To generate the double stable Tet Off Advanced inducible cell line your customized pTRE Tight vector or any other TRE based vector is cotransfected along with the selection marker into your Tet Off Advanced cell line Protocol Stable transfectants are selected using hygromycin or puromycin 2 4 weeks 1 2 AN Attention Plate your Tet Off Advanced cell line at a density appropriate for your preferred transfection method Combine your customized pTRE Tight vector and either the Linear Hygromycin or Puromycin Marker at a ratio of 20 1 i e 20 fold less linear marker and transfect the Tet Off Advanced cells using your preferred method NOTE If the Linear Hygromycin Marker was used to create the Tet Off Advanced cell line you must cotransfect the Linear Puromycin Marker with the TRE based vector to create the double stable cell line When transfection is complete seed the transfected cells in 10 cm plates Use complete medium containing an appropriate maintenance concentration of G418 100 200 pg ml Include 100 ng ml Dox to prevent expression of the GOI Use the plating density for your cell line that is optimal for hygromycin or puromycin selection Appendix B Allow cells to divide twice 24 48 hr time will vary with cell line before adding hygromycin 200 400 ugi ml or puromycin 1 10 pg ml to the culture medium Use t
34. ries Inc ATakara Bio Company Tet Off Advanced Inducible Gene Expression Systems User Manual ll List of System Components Store frozen mammalian cell lines in liquid nitrogen 196 C Store all plasmids and Tet System Approved FBS at 20 C Tet Off Advanced Inducible Gene Expression System Cat No 630934 Package Contents 20 pl pTet Off Advanced Vector 0 5 pg ul 20 pl pTRE Tight Vector 0 5 pg pl 20 pl pTRE Tight Luc Vector 0 5 pg pl 40 pl Linear Hygromycin Marker 50 ng pl 1 ml CHO AA8 Luc Tet Off Control Cell Line 2 0 x 10 cells tube 50 ml Tet System Approved FBS Product Documents and Manuals available at www clontech com manuals Tet Off Advanced Inducible Gene Expression System User Manual PT3945 1 pTet Off Advanced Vector Information Packet PT3945 5 pTRE Tight Vector Information Packet PT3720 5 Visit www clontech com for a current list of products and cell lines available for the Tet Systems Ill Additional Materials Required A Mammalian Cell Culture Supplies Culture medium supplies and additives specific for your target cells Culture medium for the CHO AA8 Luc Tet Off Control Cell Line 90 Eagles Minimum Essential Me dium alpha modification 10 Tet System Approved Fetal Bovine Serum FBS 4 mM L glutamine 100 units ml penicillin optional 100 pg ml streptomycin optional 200 pg ml G418 and 100 pg ml hygro mycin Tetracycline free fetal bovine serum FBS see im
35. ring Harbor NY Triezenberg S J Kingsbury R C amp McKnight S L 1988 Functional dissection of VP16 the trans activator of herpes simplex virus immediate early gene expres sion Genes Devel 2 718 729 Urlinger S Baron U Thellmann M Hasan M T Bujard H amp Hillen W 2000 Exploring the sequence space for tetracycline dependent transcriptional activa tors Novel mutations yield expanded range and sensitivity Proc Natl Acad Sci USA 97 14 7963 7968 Yao F Svenjo T Winkler T Lu M Eriksson C amp Eriksson E 1998 Tetracycline repressor tetR rather than the tetR mammalian cell transcription factor fu sion derivatives regulates inducible gene expression in mammalian cells Hum Gene Ther 9 1939 1950 Yarronton G T 1992 Inducible vectors for expression in mammalian cells Curr Opin Biotechnol 3 506 511 Yin D X amp Schimke R T 1995 Bcl 2 expression delays drug induced apoptosis but does not increase clonogenic survival after drug treatment in HeLa cells Cancer Res 55 4922 4928 Yin D X Zhu L amp Schimke R T 1996 Tetracycline controlled gene expression system achieves high level and quantitative control of gene expression Anal Biochem 235 195 201 Clontech Laboratories Inc ATakara Bio Company www clontech com Protocol No PT3945 1 Version No 101612 15 Tet Off Advanced Inducible Gene Expression Systems User Manual Appendix A Tet Vector Infor
36. sence of doxycycline Pomvie Tet On Adv Neo pTet On Advanced Cat Nos 630930 amp 631069 Powe A TeeOmAdv pTet DualON Cat No 631112 Vectors that express the Tet Off Advanced regulator for inducible gene expression in the absence of doxycycline ams Tet Off Adv Near pTet Off Advanced Cat Nos 630934 amp 631070 Powie ACTA pTet DualOFF Cat No 631113 E Tet Responsive Expression Vectors Vectors for the inducible expression of one or two genes of interest JE pTRE Tight Cat No 631059 Foo ires2 IK pTRE Dual1 Cat No 631114 g g pTRE Tight Bl Cat No 631068 Vectors for the inducible coexpression of a gene of interest and a fluorescent protein marker ES ees P pTRE Dual2 Cat Nos 631112 amp 631113 S pTRE Tight Bl ZsGreen1 Cat No 631067 g pTRE Tight BI AcGFP1 Cat No 631066 g pTRE Tight Bl DsRed Express Cat No 631065 Tet Responsive Expression Vectors with ProteoTuner Protein Control Vectors for the inducible coexpression of a gene of interest with protein destabilization control and a fluorescent protein marker 4 DD pTRE Cycle1 Cat No 631115 ppg pTRE Cycle2 Cat No 631116 ppg pTRE Cycle3 Cat No 631117 Figure 8 Tet System vectors For a complete list of vectors and their descriptions visit www clontech com Clontech Laboratories Inc www clontech com Protocol No PT3945 1 ATakara Bio Company Version No 101612 17 Tet Of
37. sfected cells selection Hyg Pur 4 Pick clones expand and screen or sort cells for GOI expression induced by Dox Target cell line containing a Tet Off Advanced Inducible Expression System GOI OFF Figure 3 Establishing the Tet Off Advanced System in target cells Target cells are transfected with the pTet Off Advanced plasmid and selected with G418 to generate a stable Tet Off Advanced cell line This cell line serves as the host for a TRE based expression vector which is transfected into the Tet Off Advanced cell line along with a linear selection marker Hyg or Pur After a second round of drug selection a stable cell line is produced which expresses high levels of the GOI in response to the withdrawal of doxycycline Dox Clontech Laboratories Inc ATakara Bio Company www clontech com Protocol No PT3945 1 Version No 101612 7 Tet Off Advanced Inducible Gene Expression Systems User Manual V Plasmid Propagation and Vector Construction A General Molecular Biology Techniques Only general information for propagating cloning and purifying plasmid vectors is provided below For users requiring detailed information on plasmid propagation and cloning we recommend the following laboratory refer ences Current Protocols in Molecular Biology ed by F M Ausubel et al 1995 John Wiley amp Sons NY e Molecular Cloning A Laboratory Manual ed by J Sambrook et al 2001 Cold Spring Harbor Laboratory
38. t off transcription The presence of high repressor levels also prevents rapid high level induction Yao er al 1998 For a more complete discussion of the advantages of transcription activation versus repression see Gossen e al 1993 The Tet On Advanced and Tet Off Advanced Expression Systems offer versatile expression control strat egies for transgenic mice The Tet System has become the de facto method of choice for generating reversibly inducible transgenic lines Gossen amp Bujard 2002 More than 280 mouse lines have been described that ex press Tet transactivator genes under the control of a variety of tissue specific promoters or that express target genes under control of Tet inducible promoters A list of these mouse lines can be found on the TET Systems website http www tetsystems com support transgenic mouse lines With its greatly increased sensi tivity to Dox the Tet On Advanced System brings additional advantages to the development of inducible transgenic mice This may be particularly helpful when control of gene expression in the brain is required as the presence of the blood brain barrier limits the concentration of Dox that can be attained in the brain D Doxycycline The doxycycline concentrations required for supression of the Tet Off Advanced Systems are far below cytotoxic levels for either cell culture or transgenic studies Protocol No PT3945 1 Version No 101612 4 www clontech com Clontech Laborato
39. without Dox b After the cells have reattached to the substrate gently wash them on the plate 1X with PBS and add fresh medium without Dox c Add 50 1000 nM Shield1 2 Expression OFF Remove the medium containing Shield1 by either passaging the cells or washing 3X with fresh complete medium containing 100 ng ml Dox Finally add medium containing Dox Protein levels should decline very rapidly 3 Expression ON Remove Dox and add Shield again Remove Dox as described in Step 1 In fact there are two options for control in Step C 2 e Rapid control Turn OFF by removing Shield only and not adding Dox Depending on mRNA stability this may result in a more rapid subsequent ON rate since high level transcriptional activity is maintained for Step 3 e Tightest control Turn OFF by removing Shield1 and adding Dox This will result in the lowest possible ex pression level of your protein of interest Contact Us For Assistance Customer Service Ordering Technical Support Telephone 800 662 2566 toll free Telephone 800 662 2566 toll free Fax 800 424 1350 toll free Fax 800 424 1350 toll free Web www clontech com Web www clontech com E mail orders clontech com E mail tech clontech com Notice to Purchaser Clontech products are to be used for research purposes only They may not be used for any other purpose including but not limited to use in drugs in vitro diag nostic purposes therapeutics or in
40. y Centrifuge at 100 x g for 5 min carefully aspirate the supernatant and GENTLY resuspend the cells in complete medium without selective antibiotics This method removes the cryopreservative and can be beneficial when resuspending in small volumes However be sure to treat the cells gently to prevent damaging fragile cell membranes 4 Mix the cell suspension thoroughly and add to a suitable culture vessel Gently rock or swirl the dish flask to distribute the cells evenly over the growth surface and place it in a 37 C humidified incubator 55 10 CO2 as appropriate for 24 hrs Vz Note For HEK 293 based cell lines we recommend using collagen coated plates or flasks for efficient cultur ing of frozen stocks Vessels coated with compounds other than collagen may also provide suitable growth substrates e g poly L lysine but only collagen has been tested at Clontech Once recovered the cells may be cultured directly on tissue culture plastic However if adherence is poor we recommend using only collagen coated vessels Note For Jurkat and other suspension cultures suspend cells at a density of no less than 2x10 cells ml 5 The next day examine the cells under a microscope If the cells are well attached and confluent they can be passaged for use If the majority of cells are not well attached continue culturing for another 24 hrs Note For HEK 293 based cell lines complete attachment of newly thawed cultures may require up to
Download Pdf Manuals
Related Search