StemPro EZChek Human Tri-Lineage Multiplex PCR Kit
Contents
1. Pedersen R Pera M F Piekarczyk M S Pera R A Reubinoff B E Robins A J Rossant J Rugg Gunn P Schulz T C Semb H Sherrer E S Siemen H Stacey G N Stojkovic M Suemori H Szatkiewicz J Turetsky T Tuuri T van den Brink S Vintersten K Vuoristo S Ward D Weaver T A Young L A and Zhang W 2007 Characterization of human embryonic stem cell lines by the International Stem Cell Initiative Nat Biotechnol 25 803 816 Bhattacharya B Cai J Luo Y Miura T Mejido J Brimble S N Zeng X Schulz T C Rao M S and Puri R K 2005 Comparison of the gene expression profile of undifferentiated human embryonic stem cell lines and differentiating embryoid bodies BMC Dev Biol 5 22 Chamberlain J S Gibbs R A Ranier J E Nguyen P N and Caskey C T 1988 Deletion screening of the Duchenne muscular dystrophy locus via multiplex DNA amplification Nucleic Acids Res 16 11141 11156 Henegariu O Heerema N A Dlouhy S R Vance G H and Vogt P H 1997 Multiplex PCR critical parameters and step by step protocol Biotechniques 23 504 511 Junying Yu T J 2006 Embyonic Stem Cells Regenerative Medicine Chapter 1 National Institutes of Health Bethesda MD Murphy C L and Polak J M 2002 Differentiating embryonic stem cells GAPDH but neither HPRT nor beta tubulin is suitable as an internal standard for measuring RNA leve2. 500bp nie s AFP 400 bp 300 bp 2 ACTC1 315 bp 200bp SOXi 202 bp 100bp MEME 16 Troubleshooting Problem Cause Solution Clogged RNA Incomplete e Follow protocol guidelines for each Spin Cartridge homogenization sample type and amount a ai e Clear homogenate and remove any Becher a s particulate or viscous material by ethanol addition i centrifugation and use only the supernatant for subsequent loading on to the RNA Spin Cartridge e Completely disperse any precipitate that forms after adding ethanol to the homogenate Low RNA Incomplete lysis e Ensure that 10 ul of 2 yield and mercaptoethanol was added per 1 ml homogenization of RNA Lysis Solution Perform all steps at room temperature unless directed otherwise Decrease the amount of starting material used Poor quality of starting material Be sure to use fresh sample and process immediately after collection or freeze the sample at 80 C or in liquid nitrogen immediately after harvesting Ethanol not added Be sure that ethanol was added to Wash to Wash Buffer II Buffer II as directed on page 7 Incorrect elution e Add RNase free water and perform conditions incubation for 1 minute before centrifugation To recover more RNA perform a second elution step Continued on next page 17 Troubleshooting Continued Problem Cause Solution RNA RNA e Use
3. Human Tri Lineage EZChek Human Primer Mix is provided at a concentration of 10 uM in Tri Lineage DNase RNase free water Volume is provided to Primer Mix perform 100 20 ul PCR reactions Store at 20 C non frost free Component StemPro EZChek Human Tri Lineage Primer 100 ul Mix 10 uM Continued on next page vi Contents and Storage Continued Primer The StemPro EZChek Human Tri Lineage Primer Mix Sequences contains the following PCR primers in a proprietary optimized format Number Size Oct4 P Reverse CATAGCCTGGGGTACCAAAATGGGG NM 001134 400 bp GAAATGACTCCAGTAAACCCTGGTG NM 005159 Forward CATCCTGACCCTGAAGTATCCCATC pee vii Accessory Products Additional Products The products listed in this section may be used with the StemPro EZChek Human Tri Lineage Multiplex PCR Kit For more information refer to our Web site www invitrogen com or call Technical Service see page 20 Item Quantity Catalog no AccuPrime Pfx SuperMix 200 Reactions 12344 040 RNase H 30 units 18021 014 RNase AWAY Reagent 250 ml 10328 011 DNase I Amplification Grade 100 units 18068 015 BG01V hOG Cells Variant hESC hOct4 GFP 2 x 10 cells R7799 105 Reporter Cells StemPro EZPassage Disposable Stem Cell 10 tools 23181 010 Passaging Tool StemPro hESC SFM 1kit A10007 01 bFGF full length REC HU 100 ug PHG0261 P Mercaptoethanol 50ml 21985 023 Collagenase Typ
4. No warranty is granted for products beyond their listed expiration date No warranty is applicable unless all product components are stored in accordance with instructions Invitrogen reserves the right to select the method s used to analyze a product unless Invitrogen agrees to a specified method in writing prior to acceptance of the order Invitrogen makes every effort to ensure the accuracy of its publications but realizes that the occasional typographical or other error is inevitable Therefore Invitrogen makes no warranty of any kind regarding the contents of any publications or documentation If you discover an error in any of our publications please report it to our Technical Service Representatives Invitrogen assumes no responsibility or liability for any special incidental indirect or consequential loss or damage whatsoever The above limited warranty is sole and exclusive No other warranty is made whether expressed or implied including any warranty of merchantability or fitness for a particular purpose Continued on next page 23 Purchaser Notification Continued Limited Use Label License 5 Invitrogen Technology 24 The purchase of this product conveys to the buyer the non transferable right to use the purchased amount of the product and components of the product in research conducted by the buyer whether the buyer is an academic or for profit entity The buyer cannot sell or otherwise transfer a
5. RNase free pipet tips with aerosol degraded contaminated barriers with RNase e Change gloves frequently e Swipe automatic pipettes with RNase AWAY solution after washing RNA Spin Cartridge with Wash Buffer I Improper e If not processed immediately quick handling of freeze tissue immediately after harvesting sample from and store at 80 C or in liquid nitrogen harvest until lysis e Frozen samples must remain frozen until RNA Lysis Solution was added e Perform the lysis quickly after adding RNA Lysis Solution Inhibition of Presence of Traces of ethanol from the Wash Buffer II can downstream ethanol in inhibit downstream enzymatic reactions enzymatic purified RNA Discard Wash Buffer II flow through Place the reactions RNA Spin Cartridge into the Wash Tube and centrifuge the spin cartridge at maximum speed for 2 3 minutes to completely dry the cartridge Presence of salt in Use the correct order of Wash Buffers for purified RNA washing Always wash the cartridge with Wash Buffer I followed by washing with Wash Buffer II Bands in gel Suboptimal DNA We recommend using AccuPrime Pfx appear weak polymerase used SuperMix as described on page 13 Note that or faint in PCR the DNA polymerase must be capable of amplifying five distinct targets in a single reaction Procedural error in first strand Repeat the procedure being careful to follow each step Be careful to include the Annealing cDNA synthesis
6. below Upon receipt store each item as detailed below Component Shipping Storage PureLink Micro to Midi Total Room Room RNA Purification System temperature temperature SuperScript III First Strand Dry ice 20 C non Synthesis SuperMix frost free StemPro EZChek Human Tri Dry ice 20 C non Lineage Primer Mix frost free PureLink Two boxes of the PureLink Micro to Midi Total RNA Micro to Midi Purification System are provided Components are listed M P P Total RNA below Sufficient reagents are provided to perform 100 Purification isolations 50 isolations per box x 2 Store reagents at room System temperature RNA Lysis Solution 125 ml x 2 Wash Buffer I 50mlx2 Wash Buffer II 15mlx2 RNase Free Water 15ml x2 50x2 50x2 50x2 RNA Spin Cartridges with collection tubes RNA Wash Tubes RNA Recovery Tubes Continued on next page Contents and Storage Continued SuperScript III Two boxes of SuperScript III First Strand Synthesis First Strand SuperMix are provided Sufficient reagents are provided Synthesis to perform 100 reactions 50 reactions per box x 2 Store SuperMix all components at 20 C non frost free SuperScript III RNaseOUT Enzyme Mix 100 pl x 2 2X First Strand Reaction Mix contains 500 ul x 2 10 mM MgCh and 1 mM each dNTP Annealing Buffer 50 pl x 2 Oligo dT 50 uM 50 pl x2 Random hexamers 50 ng ul 50 pl x 2 StemPro One vial of StemPro EZChek
7. developed in research by the buyer in which this product or its components was employed provided that neither this product nor any of its components was used in the manufacture of such product If the purchaser is not willing to accept the limitations of this limited use statement Invitrogen is willing to accept return of the product with a full refund For information on purchasing a license to this product for purposes other than research contact Licensing Department Invitrogen Corporation 1600 Faraday Avenue Carlsbad California 92008 Phone 760 603 7200 Fax 760 602 6500 Email outlicensing invitrogen com References Adewumi O Aflatoonian B Ahrlund Richter L Amit M Andrews P W Beighton G Bello P A Benvenisty N Berry L S Bevan S Blum B Brooking J Chen K G Choo A B Churchill G A Corbel M Damjanov L Draper J S Dvorak P Emanuelsson K Fleck R A Ford A Gertow K Gertsenstein M Gokhale P J Hamilton R S Hampl A Healy L E Hovatta O Hyllner J Imreh M P Itskovitz Eldor J Jackson J Johnson J L Jones M Kee K King B L Knowles B B Lako M Lebrin F Mallon B S Manning D Mayshar Y McKay R D Michalska A E Mikkola M Mileikovsky M Minger S L Moore H D Mummery C L Nagy A Nakatsuji N O Brien C M Oh S K Olsson C Otonkoski T Park K Y Passier R Patel H Patel M
8. g room temperature The eluate contains the purified total RNA Proceed to Analyzing RNA Yield and Quality next page Continued on next page Isolating Total RNA Continued Determining RNA Yield Expected Yield Determining RNA Quality Quant iT Kits Quant iT RNA assays from Invitrogen provide a rapid sensitive and specific fluorescent method for RNA quantitation Each kit contains a state of the art quantitation reagent and a pre made buffer to allow quantitation using standard fluorescent microplate readers fluorometers or the Qubit Quantitation Fluorometer See page viii for ordering information Visit www invitrogen com naprep for more information UV Absorbance 1 Dilute an aliquot of the purified total RNA in RNase free water i e elution buffer 2 Blank the UV visible spectrophotometer using RNase free water then scan the sample at 260 nm 3 Calculate the yield of RNA using the formula Total RNA yield ng pl A o x 40 constant for RNA in ng pl x dilution factor For example if the A2 is 0 2 and the total RNA has been diluted 1 50 then 0 2 x 40 ng pl x 50 400 ng ul Typical yield for hESCs and hECs harvested as described previously is 300 800 ng pl If the concentration is below 200 ng pl we recommend resuspending the RNA pellet in a lower volume e g 5 20 ul before proceeding to cDNA synthesis The quality of the purified total RNA can be analyzed using a bioanal
9. 5 ml microcentrifuge tubes on ice Treatment 2 Addtoeach tube the following solutions Component Volume RNA sample 1 ug x ul 10X DNase I Reaction Buffer 1 ul DNase I amplification grade 1 U pl 1 ul DEPC treated water to 10 ul Note To work with larger amounts of RNA scale up the reaction including volume linearly 3 Incubate tubes for 15 minutes at room temperature Inactivate the DNase I by the addition of 1 ul of 25 mM EDTA solution to the reaction mixture Heat for 10 minutes at 65 C The RNA sample is ready to use in reverse transcription prior to amplification 5 Store RNA samples at 70 C 20 Product Qualification Product Qualification The PureLink Micro to Midi Total RNA Purification System and SuperScript III First Strand Synthesis SuperMix are qualified as described in the Certificate of Analysis CofA for each product available on our website by product lot number at www invitrogen com cofa Note that the lot number is printed on the box for each product The StemPro EZChek Human Tri Lineage Primer Mix is qualified by OD and mass spectrometry analysis 21 Technical Service Web Visit the Invitrogen Web site at www invitrogen com for Resources e Technical resources including manuals vector maps and sequences application notes MSDSs FAQs formulations citations handbooks etc e Complete technical service contact information e Access to t
10. Buffer when adding primers and template for optimal yield RNase Maintain aseptic conditions to prevent RNase contamination contamination RNaseOUT is included in the Enzyme Mix to inhibit RNases 18 Continued on next page Troubleshooting Continued Problem Cause Solution Unexpected PCR primers are This kit has been tested using hESCs and bands appear amplifying hECs grown on Murine embryonic in lanes sequences from fibroblast MEF feeder cells We have feeder cells verified that the primers in this kit will not amplify sequences from these feeder cells If you are using other feeder cells prepare a feeder cell only reaction to check for amplified products If products are evident culture hESCs and hECs under feeder free conditions before testing Contamination by genomic DNA Prior to cDNA synthesis treat RNA preparation with DNase I Amplification Grade Cat no 18068 015 as described on page 20 19 Appendix DNase Treatment of RNA Introduction This section provides instructions for treating total RNA with DNase I to digest genomic DNA You do not have to perform a DNase I treatment before starting the cDNA synthesis if you isolated RNA using the protocol described in Isolating Total RNA page 6 If you are using RNA from other sources you may need to perform a DNase I treatment to digest genomic DNA DNase 1 Setup RNase free 0
11. Ethanol Preparing RNA Lysis Solution with 2 Mercapto ethanol Some of the PureLink Micro to Midi Total RNA Purification System buffers contain hazardous chemicals Both the RNA Lysis Solution and Wash Buffer I contain guanidine isothiocyanate This chemical is harmful if it comes in contact with the skin or is inhaled or swallowed Always wear a laboratory coat disposable gloves and goggles when handling solutions containing this chemical Do not add bleach or acidic solutions directly to solutions containing guanidine isothiocyanate or sample preparation waste Guanidine isothiocyanate forms reactive compounds and toxic gases when mixed with bleach or acids Solutions containing ethanol are considered flammable Use appropriate precautions when using this chemical Always wear a laboratory coat disposable gloves and eye protection when handling buffers Dispose of the buffers in appropriate waste containers Before using the Wash Buffer II for the first time add 60 ml of 96 100 ethanol directly to the bottle Check the box on the Wash Buffer II label to indicate that ethanol was added Prepare the amount of RNA Lysis Solution needed for the purification procedure fresh for each use by adding 1 v v 2 mercaptoethanol Add 10 ul of 2 mercaptoethanol to each 1 ml of RNA Lysis Solution Continued on next page Isolating Total RNA Continued Cell Lysis Binding Washing and Elution After ha
12. ds Harvesting Cells Introduction Amount of Cells Required Materials Needed Notes on Harvesting Cells This section provides instructions for harvesting hESCs and hECs If using cells from a culture vessel with a different surface area adjust volumes of reagents accordingly In general we recommend using 21 x 10 cells with this kit The kit was developed using cells grown in 6 cm tissue culture dishes and 6 well tissue culture plates though 12 well or 24 well plates may also yield sufficient numbers of cells The columns provided with the PureLink Micro to Midi Total RNA Purification System can handle sample volumes up to 1 x 108 cells You will need the following items in addition to the components provided in the kit e RNase free tubes 15 ml e RNase free pipette tips e Tabletop centrifuge e D PBS 1X liquid without calcium magnesium or phenol red e TrypLE Select 1X liquid e Always wear disposable gloves while handling samples and reagents to prevent RNase contamination e Work quickly during sample harvesting use RNase free dissection tools and containers scalpels dishes tubes etc and work on RNase free work surfaces use RNase AWAY Reagent e Perform all steps on ice unless noted otherwise e If you will be purifying total RNA from fresh samples keep samples on ice immediately after harvesting quickly proceed to sample lysis and homogenizaton e To freeze sampl
13. e IV 1g 17104 019 Geltrex 5 ml 12760 021 D PBS 1X liquid without calcium 500 ml 14190 144 magnesium or phenol red 1 000 ml 14190 136 TrypLE Select 1X liquid 500 ml 12563 029 Trypan Blue Stain 100 ml 15250 061 DNase I Amplification Grade 100 units 18068 015 BlueJuice Gel Loading Buffer 3x1ml 10816 015 Qubit Fluorometer 1 fluorometer 032857 Qubit Quantitation Starter Kit 1 fluorometer Q32860 4 assay kits Quant iT RNA Assay Kit 1 kit Q3310 40 TrackIt 100 bp DNA ladder 100 applications 10488058 PureLink Micro to Midi Total RNA 50 isolations 12183 018 Purification System SuperScript III First Strand Synthesis 50 reactions 18080 400 SuperMix viii Overview Kit Components Introduction Human embryonic stem cells RESCs and pluripotent human embryonal carcinoma stem cells hECs require continuous monitoring of their differentiation state and potential during early growth and maintenance Junying Yu 2006 This can be done using early differentiation markers The StemPro EZChek Human Tri Lineage Multiplex PCR Kit uses three early differentiation markers one pluripotency marker and a GAPDH control for characterizing hESCs and hEC cell populations under in vitro conditions This kit allows you to rapidly and reliably monitor the differentiation state and potential of hESCs or hECs using a convenient reverse transcription polymerase chain reaction RT PCR assay Us
14. er Mix 1ul Template cDNA from page 11 1 pl Prepare NTC reactions using the mix above but replacing the template cDNA with distilled water Transfer the reactions to a thermal cycler and run the following cycling program a Initial denaturation at 95 C for 2 minutes b 30 cycles of 95 C 30 seconds 60 C 30 seconds 68 C 1 minute c Final extension at 68 C for 5 minutes Maintain reaction at 4 C after cycling Samples can be stored at 20 C 13 Analyzing the Results Introduction Materials Needed Gel Analysis Note on Band Intensities 14 Following amplification run the PCR products on a gel to identify the bands You will need the following items in addition to the components provided in the kit e 2 agarose gel e Molecular weight marker with bands between 100 bp and 1000 bp e g the TrackIt 100 bp DNA Ladder 1 Load the 20 11 PCR reactions in separate wells of a 2 agarose gel 2 Iman adjacent lane load 20 pl of a molecular weight marker to estimate the size of the PCR products Load 20 ul of water into any empty wells Run the gel for 30 minutes Visualize bands on a UV transilluminator Use a gel imaging system to determine the intensities of the bands When studying differentiation markers on the gel note that band presence or absence is more important than band intensity SOXI in particular may appear quite faint due to the nature of neural stem cell differen
15. es place them immediately after harvesting in liquid nitrogen or on dry ice Keep frozen samples at 80 C or in liquid nitrogen until proceeding to sample lysis and homogenization Continued on next page Harvesting Cells Continued Note about Feeder Cells Harvesting Cells This kit has been tested using hESCs and hECs grown on Murine embryonic fibroblast MEF feeder cells We have verified that the primers in this kit will not amplify sequences from these feeder cells If you are using other types of feeder cells you may Culture cells under feeder free conditions before testing Prepare a control containing only feeder cells to identify any sequences from these feeders that may be amplified by the primers in this kit Pre warm TrypLE Select to 37 C Remove media from tissue culture dish and rinse cells once with D PBS 1X without calcium magnesium or phenol red Treat cells with 5 ml of pre warmed TrypLE Select and let stand for a few minutes Harvest cells and transfer to one or more 15 ml centrifuge tubes on ice Take 100 ul of cells and perform a trypan blue viable cell count Spin tube s containing cells in a tabletop centrifuge for 3 5 minutes at 100 x g to pellet the cells Discard the supernatant If proceeding directly to RNA isolation place samples on ice alternatively freeze samples on dry ice or liquid nitrogen and store in 80 C freezer Isolating Total RNA I
16. es of deletions mutations and polymorphisms or quantitative assays and reverse transcription PCR Henegariu et al 1997 Gene expression studies of undifferentiated hES cells show that Pou5f1 previously known as Oct4 is closely associated with the pluripotent state in both mES and hESCs It is essential for the development of the pluripotent inner cell mass ICM in human embryogenesis and is observed to be strongly down regulated upon differentiation At day 13 of hESC differentiation expression of the pluripotent genes is greatly reduced Bhattacharya et al 2005 In 7 day differentiated embryoid bodies EBs expression of AFP is strongly up regulated Adewumi et al 2007 AFP ACTCI and SOX1 markers can reliably detect the differentiation of hESCs into endoderm mesoderm and ectoderm lineages respectively These markers can be used for routine examination of differentiation in hESC cultures GAPDH has emerged as commonly used internal standard in ES cell derived gene transcription studies for normalizing mRNA levels in quantitative analysis Murphy amp Polak 2002 Continued on next page Introduction Continued Recommended AccuPrime PCR Enzyme Advantages of the Kit TM Pfx SuperMix is recommended for use with this kit It provides robust highly specific amplification in demanding multiplex PCR applications Ordering information is provided on page viii AccuPrime Pfx SuperMix includes recomb
17. he Invitrogen Online Catalog e Additional product information and special offers Contact Us For more information or technical assistance call write fax or email Additional international offices are listed on our Web page www invitrogen com Corporate Headquarters European Headquarters Invitrogen Corporation Invitrogen Ltd 1600 Faraday Avenue Inchinnan Business Park Carlsbad CA 92008 USA 3 Fountain Drive Tel 1 760 603 7200 Paisley PA4 9RF UK Tel Toll Free 1 800 955 6288 Tel 44 0 141 814 6100 Fax 1 760 602 6500 Tech Fax 44 0 141 814 6117 E mail tech_support Invitrogen com E mail eurotech invitrogen com Material Safety MSDSs Material Safety Data Sheets are available on our Data Sheets website at www invitrogen com msds MSDSs 22 Purchaser Notification Limited Warranty Invitrogen is committed to providing our customers with high quality goods and services Our goal is to ensure that every customer is 100 satisfied with our products and our service If you should have any questions or concerns about an Invitrogen product or service contact our Technical Service Representatives Invitrogen warrants that all of its products will perform according to specifications stated on the certificate of analysis The company will replace free of charge any product that does not meet those specifications This warranty limits Invitrogen Corporation s liability only to the cost of the product
18. inant DNA polymerase from Thermococcus species KOD anti KOD antibodies thermostable AccuPrime proteins MgSOu dNTPs and stabilizers in a SuperMix formulation Takagi et al 1997 This highly processive enzyme is provided in an antibody bound form that is inactive at ambient temperatures The enzyme regains activity after the initial denaturation step at 94 C in PCR cycling providing an automatic hot start that increases specificity sensitivity and yield while allowing room temperature assembly Sharkey et al 1994 Thermostable AccuPrime proteins enhance specific primer template hybridization during every cycle of PCR Rapley 1994 AccuPrime Pfx SuperMix is supplied at 1 1X concentration to allow approximately 10 of the final reaction volume to be used for the addition of primer and template solutions The StemPro EZChek Human Tri Lineage Multiplex PCR Kit provides the following advantages e Detects markers for all three lineages and the undifferentiated state in one PCR reaction using a convenient multiplex RT PCR assay e Faster and requires smaller sample volumes than traditional characterization methods such as immunocytochemistry e Enables monitoring of the differentiation potential of cultured hESCs and hECs after test cultures have been allowed to differentiate e Contains reagents necessary to quickly isolate RNA and generate cDNA from hESCs and hECs for use in multiplex PCR Metho
19. ing the kit you first isolate total RNA from cells and then generate cDNA from the RNA using SuperScript III Reverse Transcriptase in a convenient supermix format You then amplify the markers noted above in a highly sensitive single tube multiplex PCR reaction using five different primer pairs Finally you run the results on an agarose gel to visualize the targets The StemPro EZChek Human Tri Lineage Multiplex PCR Kit contains the following components e The PureLink Micro to Midi Total RNA Purification System rapidly and reliably isolates high quality total RNA from your hESCs or hECs e SuperScript III First Strand Synthesis SuperMix provides high yields of first strand cDNA e StemPro EZChek Human Tri Lineage Primer Mix contains primers for detecting the following human genes in a multiplex PCR reaction Pou5f1 Oct4 marker for the pluripotent state of hESCs and hECs AFP endoderm lineage marker ACTCI mesoderm lineage marker SOXI ectoderm lineage marker GAPDH internal RNA standard for normalizing mRNA levels Continued on next page Introduction Continued Multiplex PCR Markers Used Multiplex polymerase chain reaction PCR is a variant of PCR in which two or more loci are simultaneously amplified in the same reaction Since its first description in 1988 Chamberlain et al 1988 this method has been successfully applied in many areas of DNA testing including analys
20. invitrogen StemPro EZChek Human Tri Lineage Multiplex PCR Kit Catalog no 23191 050 A10228 Version A 13 September 2007 Table of Contents Contents and SHARE oi as V Accessory Products etapa ete iae bes ie ice eaten viii Introduction lt lt lt neinitiati i ii n ah 1 Methods 2 1x2 12 edid iia ua apa data 4 Harvesting Cells iii ia aa taca mar 4 Isolating Total RNA 000 tas 6 CDNA Synthesis testet na eee aaa tav Multiplex PCR Amplification Analyzing the Results isi caca t p ca eds 14 Example Results ienasi an rapid 15 Troubleshooting 1 eis 17 A AAA A 20 DNase I Treatment of RNA ocooccncconononncnanonnconnnnnonnonanonncnnnonoronnnnnonnnnnnrnrcnanonncnnnn 20 Product Qualifications eterne eret e be rper id 21 Technical Service eter tri 22 Purchaser Notification ase cierra ree deep deoa rr var gegen aa oe 23 References de ERE ed LE 25 Contents and Storage Kit Configuration StemPro EZChek Human Tri Lineage Multiplex PCR Kit includes the following boxes providing material and reagents for 100 reactions For a detailed description of the contents see below and next page e PureLink Micro to Midi Total RNA Purification System e SuperScript III First Strand Synthesis SuperMix e StemPro EZChek Human Tri Lineage Primer Mix Shipping and The StemPro EZChek Human Tri Lineage Multiplex PCR Storage Kit is shipped as described
21. ls Tissue Eng 8 551 559 Rapley R 1994 Enhancing PCR amplification and sequencing using DNA binding proteins Mol Biotechnol 2 295 298 Sharkey D J Scalice E R Christy K G Atwood S M and Daiss J L 1994 Antibodies as thermolabile switches high temperature triggering for the polymerase chain reaction Biotechnology 12 506 509 Takagi M Nishioka M Kakihara H Kitabayashi M Inoue H Kawakami B Oka M and Imanaka T 1997 Characterization of DNA polymerase from Pyrococcus sp strain KOD1 and its application to PCR Appl Environ Microbiol 63 4504 4510 2007 Invitrogen Corporation All rights reserved For research use only Not intended for any animal or human therapeutic or diagnostic use 25 Notes 26 invitrogen Corporate Headquarters Invitrogen Corporation 1600 Faraday Avenue Carlsbad CA 92008 T 1 760 603 7200 F 1 760 602 6500 E tech_support invitrogen com For country specific contact information visit our web site at www invitrogen com
22. ntroduction This section provides instructions for preparing total RNA from harvested hESCs and hECs Review the information in this section before starting Guidelines are provided for handling RNA handling system reagents and lysis and homogenization Materials You will need the following items in addition to the Needed components provided in the kit 2 mercaptoethanol 96 100 ethanol 70 ethanol in RNase free water Microcentrifuge capable of centrifuging 12 000 x 2 1 5 ml RNase free microcentrifuge tubes RNase free pipette tips Guidelines for Follow the guidelines below to prevent RNase Handling RNA contamination and maximize the RNA yield Use disposable individually wrapped sterile plasticware Use only sterile disposable RNase free pipette tips and microcentrifuge tubes Wear disposable gloves while handling reagents and RNA samples to prevent RNase contamination from the surface of the skin Change gloves frequently particularly as the protocol progresses from crude extracts to more purified material e g from Wash Buffer I to Wash Buffer II Always use proper microbiological aseptic techniques when working with RNA Use RNase AWAY Reagent for catalog number see page viii to remove RNase contamination from work surfaces and non disposable items such as centrifuges and pipettes used during purification Continued on next page Isolating Total RNA Continued Preparing Wash Buffer II with
23. rvesting the cells as described on page 5 proceed with the steps below Note For frozen samples thaw before proceeding 1 To the tube containing the cell pellet add 0 5 ml of RNA Lysis Solution prepared with 2 mercaptoethanol per 1 5 x 106 cells Note that one 6 cm tissue culture dish typically contains 2 5 x 106 cells 2 Pipetcells up and down or vortex until cells are disrupted 3 Transfer 0 5 ml aliquots of lysed cells to individual 1 5 ml RNAse free microcentrifuge tubes 4 Centrifuge tubes for 2 minutes at 12 000 x g room temperature 5 Add 0 5 ml 70 EtOH to each tube 6 Pipet suspension up and down 5 10 times 1 Transfer a 600 ul aliquot of cell lysis solution to an RNA Spin Cartridge inserted in a collection tube 2 Centrifuge for 15 30 seconds at 12 000 x g room temperature Discard flow through 3 Repeat Steps 1 2 until entire sample has been processed 4 Add 700 ul of Wash Buffer to the cartridge 5 Centrifuge for 15 30 seconds at 12 000 x g room temperature 6 Discard flow through and tube Place cartridge into clean 2 m1 RNA Wash Tube 7 Add 500 pl Wash Buffer II prepared with ethanol to cartridge and centrifuge for 15 30 seconds at 12 000 x g room temperature 8 Discard flow through Centrifuge for 1 minute to dry cartridge 9 Place cartridge into RNA Recovery Tube Add 40 ul of RNAse free water to cartridge 10 Let stand for 1 minute then centrifuge for 2 minutes at 12 000 x
24. s e PCR grade pipette tips AccuPrime Pfx SuperMix described on page 3 has been tested and is recommended for use with the primer mix provided in this kit See page viii for ordering information A protocol using this supermix is provided on the following page Other polymerases may achieve comparable results e PCR is a powerful technique capable of amplifying trace amounts of DNA take all appropriate precautions to avoid cross contamination e For multiple reactions you can prepare a master mix of the DNA polymerase and the component s common to all reactions e All steps are done on ice unless noted otherwise For all incubations thermocyclers were pre heated in advance All reagents are pre chilled frozen and thawed immediately prior to use Continued on next page Multiplex PCR Amplification Continued Multiplex PCR Amplification The following protocol uses AccuPrime Pfx SuperMix If you are using a different DNA polymerase follow the protocol provided with that enzyme scaling the volume of StemPro EZChek Human Tri Lineage Primer Mix accordingly No template controls NTCs We recommend setting up no template control NTC reactions to check for spurious amplification products 1 For a single reaction combine the following components in a PCR tube or well of 96 well PCR plate Component Single rxn AccuPrime Pfx SuperMix 18 pl StemPro EZChek Human Tri Lineage Prim
25. this product b its components or c materials made using this product or its components to a third party or otherwise use this product or its components or materials made using this product or its components for Commercial Purposes The buyer may transfer information or materials made through the use of this product to a scientific collaborator provided that such transfer is not for any Commercial Purpose and that such collaborator agrees in writing a not to transfer such materials to any third party and b to use such transferred materials and or information solely for research and not for Commercial Purposes Commercial Purposes means any activity by a party for consideration and may include but is not limited to 1 use of the product or its components in manufacturing 2 use of the product or its components to provide a service information or data 3 use of the product or its components for therapeutic diagnostic or prophylactic purposes or 4 resale of the product or its components whether or not such product or its components are resold for use in research For products that are subject to multiple limited use label licenses the most restrictive terms apply Invitrogen Corporation will not assert a claim against the buyer of infringement of patents owned or controlled by Invitrogen Corporation which cover this product based upon the manufacture use or sale of a therapeutic clinical diagnostic vaccine or prophylactic product
26. tiation Example Results Example In the example below BGO1v stem cells and 14 day and 21 Results day EBs were analyzed using the StemPro EZChek BGO01v stem Human Tri Lineage Multiplex PCR Kit The gel shows that cells and Pou5f1 OcH expression was down regulated in the BGO1v 14 day and 21 EBs versus the stem cells while the differentiation markers day EBs AFP and ACTC1 were clearly induced in the EBs SOX1 was also induced most visibly in the 21 day EBs BGO1v 14 day 21 day Variant EBs EBs _ 1000 GAPDH 983 bp hd 4 J J s 850 a 650 Pou5f1 Oct 4 536 bp E 500 AFP 400 bp ey 400 ACTC1 315 bp Gan 209 SOX1 202 bp 200 100 Continued on next page 15 Example Results Continued Example In the example below BGO1v stem cells and an EB control Results EB sample were analyzed using the StemPro EZChek Human Control Sample Tri Lineage Multiplex PCR Kit The gel shows that Pou5f1 OcH expression was down regulated in the BGO1v EBs versus the stem cells In addition the differentiation markers AFP and ACTC1 were induced in the EB control sample Since the intensity of the SOX1 signal was relatively low DNA from SOX1 BAC was spiked into the cDNA from the 21 day EBs to generate a control sample with equal band intensities for all markers MW Neg BGO1v Embryoid Marker Contr Stem Body Control Cells Sample y 1000 bp GAPDH 983 bi 850bp _ w P o E Pou5f1 Oct4 536 bp
27. uperScript III First Strand Synthesis SuperMix kit 1 Mixand briefly centrifuge each component before use Preheat the thermal cycler to 65 C 2 Combine the following in a 0 2 ml PCR tube on ice Use the yield calculations on page 9 to determine the volume containing 1 ug of total RNA Component 1 pg total RNA n yl 50 ng pl random hexamers lul Annealing Buffer ll RNase DNase free water to 8 pl 3 Incubate in a thermal cycler at 65 C for 5 minutes and then immediately place on ice for at least 1 minute Collect the contents of the tube by brief centrifugation 4 Add the following to the tube on ice 2X First Strand Reaction Mix 10 ul SuperScript III RNaseOUT Enzyme Mix 2 ul 5 Vortex the sample briefly to mix and collect by brief centrifugation 6 Incubate 10 minutes at 25 C 7 Incubate 50 minutes at 42 C 8 Terminate the reaction at 85 C for 5 minutes Chill on ice 9 Addigl RNAse H and incubate at 37 C for 20 minutes Proceed to Multiplex PCR Amplification next page 11 Multiplex PCR Amplification Introduction Materials Needed Note on PCR Enzyme Guidelines for Performing PCR 12 This section provides instructions for amplifying cDNA using AccuPrime Pfx DNA Polymerase purchased separately in a multiplex PCR reaction You will need the following items e Ice bucket e Thermocycler e PCR enzyme AccuPrime Pfx SuperMix recommended e PCR grade microcentrifuge tube
28. yzer such as the Agilent 2100 bioanalyzer with an RNA LabChip Alternatively total RNA quality can be analyzed by agarose gel electrophoresis RNA isolated using the PureLink kit typically has a 28S to 18S band ratio of gt 1 5 RNA is judged to be intact if discreet 28S and 18S ribosomal RNA bands are observed cDNA Synthesis Introduction Materials Needed DNase I Treatment Guidelines for Handling RNA 10 This section provides instructions for synthesizing cDNA from total RNA using the components of the SuperScript III First Strand Synthesis SuperMix kit You will need the following items in addition to the components provided in the kit e Ice bucket e RNase H e Thermocycler e RNase free microcentrifuge tubes e RNase free pipette tips e Optional DNase I Amplification Grade DNase I treatment prior to cDNA synthesis is typically not required if you isolated RNA using the PureLink Micro to Midi Total RNA Purification System included with this kit If you are using RNA from other sources you may need to perform a DNase I treatment to digest genomic DNA Refer to the protocol DNase I Treatment of RNA in the Appendix page 20 Follow the standard guidelines for handling RNA as described on page 6 to prevent RNase contamination Continued on next page cDNA Synthesis Continued cDNA Synthesis Note that the following protocol uses the random hexamers provided with the S
Download Pdf Manuals
Related Search