Applied Biosystems Prism 377 Achieving Better Results User Bulletin
Contents
1. A rtisan Artisan Technology Group is your source for quality TecmoogyGroup new and certified used pre owned equipment FAST SHIPPING AND SERVICE CENTER REPAIRS WE BUY USED EQUIPMENT DELIVERY Experienced engineers and technicians on staff Sell your excess underutilized and idle used equipment TENS OF THOUSANDS OF at our full service in house repair center We also offer credit for buy backs and trade ins IN STOCK ITEMS www artisantg com WeBuyEquipment 7 EQUIPMENT DEMOS HUNDREDS OF InstraV ea REMOTE INSPECTION LOOKING FOR MORE INFORMATION MANUFACTURERS Remotely inspect equipment before purchasing with Visit us on the web at www artisantg com 7 for more our interactive website at www instraview com information on price quotations drivers technical LEASING MONTHLY specifications manuals and documentation RENTALS ITAR CERTIFIED SELDE RA Gr tia Contact us 888 88 SOURCE sales artisantg com www artisantg com User Bulletin ABI PRISM 377 DNA Sequencer December 7 1999 updated 03 2001 SUBJECT Achieving Longer High Accuracy Reads on the 377 Sequencer About This Bulletin Longer sequencing read lengths are now possible on the ABI PRISM 377 DNA Sequencer by using a revised buffer and gel system with a water run in protocol for focusing the sample at loading Gels are analyzed using a new long read basecaller and the ABI PRISM DNA Sequencing Analysis software In This Bulletin This user bullet2. user does not comply with the information It also indicates a potentially hazardous situation that could result in minor or moderate injury to the user WARNING This word informs the user that serious physical injury or illness to the user or other persons could occur if these required precautions are not taken DANGER Indicates an imminently hazardous situation that if not avoided will result in death or serious injury WARNING CHEMICAL HAZARD Some of the chemicals used with Applied Biosystems instruments are potentially hazardous and can cause injury illness or death Read and understand the material safety data sheets MSDSs provided by the chemical s manufacturer before you store handle or work with any chemicals or hazardous materials Minimize contact with and inhalation of chemicals Wear appropriate personal protective equipment when handling chemicals e g safety glasses gloves or clothing Consult the listing in the MSDS Do not leave chemical containers open Use only with adequate ventilation Check regularly for chemical leaks or spills If a leak or spill occurs follow the manufacturer s cleanup procedures as recommended on the MSDS Comply with all local state provincial or national laws and regulations related to chemical storage handling and disposal You can order free additional copies of MSDSs for chemicals manufactured or distributed by Applied Biosystems using the contact
3. Instrument and the Samples for Gel Electrophoresis Inserting the Comb To insert the comb and perform the plate check and Performing the Plate Check Step Action 1 Pull the casting comb out of the gel and clean the sample loading region of all gel fragments IMPORTANT All gel fragments must be removed from the gel loading region prior to inserting the sharks tooth comb Insert the sharks tooth comb or a paper comb Make sure that only water is present in the comb region IMPORTANT When inserting a paper comb the comb region of the gel must be dry This is because the paper comb is compressed when dry making it easy to slide the comb in The comb then swells in the presence of liquid The part numbers for the Single Use Shark s Tooth combs are listed below Comb Size Part Number 36 lane 0 18 mm 4309451 48 lane 0 18 mm 4309453 64 lane 0 18 mm 4309455 96 lane 0 33 mm 4309457 Mount the gel in the cassette and place it on the instrument Perform a plate check Prepare the Buffer To prepare the buffer chambers Chambers i Step Action 1 Rinse the upper and lower buffer chambers with deionized water Note The purpose of this step is to remove any residual buffer that may be present in the chamber If you are switching from TBE to TTE gels or TTE to TBE gels you will need to do this rinse Achieving Longer High Accuracy Reads on
4. in the ABI PRISM 377 Collection Software The module file is modified such that it runs under constant power instead of constant voltage For additional information about modifying the module refer to the ABI PRISM 377 DNA Sequencer User s Manual P N 4307614 Step Action 1 Launch the ABI PRISM 377 Data Collection Software Choose New from the File menu and click on the Sequence Run icon Select Seq Run 48E 1200 from the Run Module pop up menu 2 3 4 Click the page graphic to the right of the Run Module pop up menu In the dialog box that appears change the settings to those shown below Settings for Seq Run 48E 1200 Electrophoresis Yoltage Collection Time Hours Electrophoresis Current m Gel Temperature C Electrophoresis Power W Laser Power mw CCD Offset CCD Gain EEE Note The Collection Time can range from 13 to 18 hours depending on the amount of data that you need to collect Note If you have worked out alternative parameters for CCD Offset and CCD Gain on your instrument use these values to increase signal strength Click Save Copy in a Enter a name for the new module i e Seq Run 48E 1200 LR b Select the Modules Folder in the 377 Collection Software c Click Save Achieving Longer High Accuracy Reads on the 377 Sequencer Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Preparing the
5. information below To order MSDSs Then Over the Internet Use www appliedbiosystems com techsupport a Select MSDS Search button b Enter keywords or partial words or a part number or the MSDS s Documents on Demand index number c Select Search d Select the Adobe Acrobat symbol to view print or download the document or check the box of the desired document and delivery method fax or e mail By automated telephone Use Documents on Demand service from any country By telephone in the United Dial 1 800 327 3002 then press 1 States Achieving Longer High Accuracy Reads on the 377 Sequencer Page 5 of 16 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com To order MSDSs Then By telephone from Canada If you want ordering instructions in Then dial 1 800 668 6913 and English Press 1 then 2 then 1 again French Press 2 then 2 then 1 By telephone from any other See a list of our Regional Sales Offices country For chemicals not manufactured or distributed by Applied Biosystems call the chemical manufacturer Page 6 of 16 Achieving Longer High Accuracy Reads on the 377 Sequencer Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Preparing the Buffer and Pouring the Gel Reagents Required The following reagents are required
6. 40 750 760 770 730 730 00 10 20 30 UENS le an ME val tt ht a OT GOGCt AGAGGCA TOCCA A TCE TTTAGCCGTTC CGGGTGGG4ATTCCT 00 0 TCAA TT AGG Q TTT AA TAA OC GTTC CTT GGAGGTC AA TTCCTG AATE ATGTTTT OSC TC TTTA0G Te TOAAG TOOT GST ad POS TCALIC A TTAGTT AAAS TAA TACC TGC AC CAC ACCCA TTAATATCTC TACT GUGA TIC ACC TGA TIO 2404 TIGGT GCCATTT COATS CO TAGTATAT COCCGST GATT Ta Gat TT TOT ACTOTTAAQAAC TTT A 930 1000 1010 1020 1030 1040 1060 1040 1070 1030 1030 1100 1110 1140 1170 1180 Achieving Longer High Accuracy Reads on the 377 Sequencer Page 3 of 16 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Requirements for Achieving Longer Reads Summary of This procedure requires the following Requirements Chemistries to Use Resuspension and Loading Volumes of Page 4 of 16 4 ev 4 4 4 4 Using a water run in loading protocol Using a 48 cm well to read length gel Using 2X Tris TAPS EDTA TTE running buffer in the upper buffer chamber Pouring a 4 25 PAGE PLUS gel made with 1 2X TTE Using 1X TTE running buffer in the lower buffer chamber Modifying and saving the Seq Run 48E 1200 run module Loading minimal sample volumes e g 0 5 uL on a 96 lane gel Analyzing data using the LR 377 Basecaller v3 3 1b2 Longer gel reads can be achieved using any of the chemistries including ABI Prism BigDye Terminator Cycle Sequencing Ready Reactio
7. d Basecaller v3 3 1b2 To obtain this software see Downloading Required Software on page 1 Conduct Data Refer to the ABI PRism DNA Sequencing Analysis Software version 3 4 User s Manual Analysis P N 4306158 for instructions on how to analyze data from a sequencing run Expected Data Data collected using this protocol will have larger base spacing values than gels run according to traditional protocols Base spacing using this protocol is 14 15 Base spacing using traditional protocols is 9 11 Achieving Longer High Accuracy Reads on the 377 Sequencer Page 13 of 16 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com rtisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com rtisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Copyright 2001 Applied Biosystems For Research Use Only Not for use in diagnostic procedures ABI PRISM and its design and Applied Biosystems are registered trademarks of Applera Corporation or its subsidiaries in the U S and certain other countries ABI and BigDye are trademarks of Applera Corporation or its subsidiaries in the U S and certain other countries All other trademarks are the sole property of their respective owners Applied Biosystems vast distribution and service network composed of highly trained support and applications perso
8. for making 10X TTE buffer and pouring a 4 25 for Making Buffer and Gel Preparing and Storing the 10X TTE Achieving Longer High Accuracy Reads on the 377 Sequencer Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com PAGE PLUS gel Material Source 10X TTE Teknova P N 0275 1L or or 4 Tris Bio Rad P N 1610719 TAPS acid Sigma P N T5130 Na EDTA Sigma P N ED2SS Ammonium persulfate Bio Rad P N 1610700 PAGE PLUS Amresco P N E562 TEMED Bio Rad P N 1610800 Urea Bio Rad P N 1610731 Water deionized Major laboratory supplier or Merck P N 1 15333 2500 The stock solution 10X TTE is 500 mM Tris base 500 mM TAPS and 10 mM Na EDTA WARNING CHEMICAL HAZARD Tris TAPS EDTA TTE May cause eye skin and respiratory tract irritation May be harmful if swallowed Consult the manufacturer s MSDSs for additional information Wear splash resistant safety goggles and appropriate chemical resistant clothing and gloves To prepare 1 liter of 10X TTE Step Action 1 Combine the following reagents in a 1 L beaker Reagent Quantity Tris 60 55 g TAPS acid 121 65 g Na EDTA 3 72 g Deionized water q s to 1L Mix well Optional Check the pH of the 10X TTE The pH should be 8 3 0 3 If the pH is not in this range then discard the buffer Note Store the 10X TTE at room temperatu
9. in describes the following topics Topic See Page Example Results Using This Protocol 2 Requirements for Achieving Longer Reads 4 Safety 5 Preparing the Buffer and Pouring the Gel 7 Preparing the 377 Data Collection Software 10 Preparing the Instrument and the Samples for Gel 11 Electrophoresis Analyzing the Data 13 Instrument This protocol is for use with all models and upgrades of the ABI PRISM 377 DNA Platforms Analyzer The well to read length of the plates must be 48 cm Downloading There are two software updates that you must have to analyze data using this Required Software protocol ABI PRISM DNA Sequencing Analysis Software version 3 3 or 3 4 These versions of DNA Sequencing Analysis Software can be obtained from our web site If you currently own version 3 0 or later of the software you can download a free update to the latest version www appliedbiosystems com techsupport 377 Long Read Basecaller v3 3 1b2 The basecaller should be downloaded and placed in the Sequencing Analysis folder To install the basecaller follow the directions located in the Read Me file www appliedbiosystems com techsupport gt Applied KS Biosystems Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Example Results Using This Protocol Longer Read This protocol if followed correctly can improve data resolution and increase the Lengths number
10. n Kit ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kit v2 0 ABI PRISM BigDye Primer Cycle Sequencing Ready Reaction Kit ABI PRism dRhodamine Terminator Cycle Sequencing Ready Reaction Kit To optimize your resuspension and loading volumes you may have to do a series of titrations and run gels to determine the best combination of signal strength and DNA resolution Refer to the appropriate chemistry protocol for recommendations about resuspension and loading volumes Optimal results are achieved when the amount of DNA per well is decreased and signal strengths are lt 500 relative fluorescent units RFUs IMPORTANT For 96 lane gels we recommend that you resuspend the DNA in 2 3 pL of loading buffer and load 0 5 pL of the sample onto the gel Achieving Longer High Accuracy Reads on the 377 Sequencer Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Safety Documentation User Attention Words Chemical Hazard Warning Ordering MSDSs Five user attention words appear in the text of all Applied Biosystems user documentation Each word implies a particular level of observation or action as follows Note This word is used to call attention to information IMPORTANT This word calls attention to information that is necessary for correct operation of the kit or instrument CAUTION This word informs the user that damage to the instrument could occur if the
11. n numbered lanes Resume the prerun for 1 minute then cancel O oO A OIN If you are using a paper comb remove the comb Page 12 of 16 Achieving Longer High Accuracy Reads on the 377 Sequencer Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com To resuspend and load the samples and start the run continued Step Action 7 If you have a clear buffer chamber only remove 32 mL of deionized water from the upper buffer chamber IMPORTANT If the water is not removed the buffer chamber overflows This results in an incorrect buffer concentration and possible arcing 8 Add the following amount of 10X TTE carefully to the upper buffer chamber to get a final concentration of 2X TTE IMPORTANT Use the following amount only if you started with the volumes of water stated in Prepare the Buffer Chambers on page 11 If you have a Add To get White upper buffer chamber 120 mL of 600 mL of 2X 10X TTE TTE Note This chamber can hold a total volume of 600 mL Clear upper buffer chamber 132 mL of 660 mL of 2X 10X TTE TTE Note This chamber can hold total volume of 660 mL 9 Mix the contents of the upper buffer chamber 10 Start the run using the modified run module Analyzing the Data Software Required Conduct data analysis using the following DNA Sequencing Analysis software Long Rea
12. nnel reaches into 150 countries on six continents For international office locations please call our local office or refer to our web site at www appliedbiosystems com P N 4315153B Stock No 106UB 14 02 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com A rtisan Artisan Technology Group is your source for quality TecmoogyGroup new and certified used pre owned equipment FAST SHIPPING AND SERVICE CENTER REPAIRS WE BUY USED EQUIPMENT DELIVERY Experienced engineers and technicians on staff Sell your excess underutilized and idle used equipment TENS OF THOUSANDS OF at our full service in house repair center We also offer credit for buy backs and trade ins IN STOCK ITEMS www artisantg com WeBuyEquipment 7 EQUIPMENT DEMOS HUNDREDS OF InstraV ea REMOTE INSPECTION LOOKING FOR MORE INFORMATION MANUFACTURERS Remotely inspect equipment before purchasing with Visit us on the web at www artisantg com 7 for more our interactive website at www instraview com information on price quotations drivers technical LEASING MONTHLY specifications manuals and documentation RENTALS ITAR CERTIFIED SELDE RA Gr tia Contact us 888 88 SOURCE sales artisantg com www artisantg com
13. of bases called by the ABI PRisM DNA Sequencing Analysis Software Electropherogram An electropherogram showing data obtained using this protocol is shown below This Showing Longer electropherogram was generated using BigDye terminator chemistry on an Read Lengths ABI PRISM 377 DNA Sequencer with 96 Lane Upgrade GO A Caa 0 8 CTGG ACSC G TRAC 46 CTGTH AM CAGGATTTGCT TOC T4GC TOCCOA O OATH GCTAAGACATTGATGGGAATGGGAAAATCCCAAC CAC CCOA TAC AATaAC TGC CAC CA AAAG 10 20 0 0 o 40 70 0 3 100 110 120 130 AGC CGAC AGGATTAGGTTA AC GTAGG ASC TEGAGGTAGA MC AGCEGCASATTTCATCCCTGAGTATTCAGTTTGaATAGCE TGCTaAC TAGT TO TTC TTC CGC TTC CGGTAAGTCG tat dosis italia alta na sa aTTC p ne Te ace a a aa kN ER iar alas SE ee can RE ASTAR en E naaa a a a aha AC TA ee bc lab eet Laas re o oe Er ae ere ee buttet aa a Mnd 2GGG 20 re TTGTTAT bs Gaa paar CAGCCATCAACAAGC ca phot GTTGGATGCS TA GATAA AGCAATCCACAGAAATATCC C pe cTac et TACA TATTCTGTCE 500 B20 620 540 670 620 Page 2 of 16 Achieving Longer High Accuracy Reads on the 377 Sequencer Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com QUA AGGAACAATCA A A TAA QACA A A A 0T8 C TAGCAA GEC TACA1G24TC GGG CGIG1GTI24TAGCCARGGGTCAGCC TGAGCCGGTACA AT ATCT TCTT TAS ATAC CAGC TTG0G iC CATCAGC TAC C GGAGC TAGCAAGCCCAASGGCCCAATATATTCAGGGCAATCCGTTGCT GIG GACT GC GAA ATCT TCC GT TC TAGE CAA CAC DA ACCAGCACGCC CAC CGTCGCCCC AATCAGCATCAGGAT To 720 730 7
14. r absorbed through the skin It is extremely destructive to mucous membranes eyes and skin Inhalation can be fatal Always work in a fume hood Obiain a copy of the MSDS from the manufacturer Wear appropriate protective eyewear clothing and gloves 2 Add 25 uL of TEMED and swirl carefully to mix without introducing air bubbles WARNING CHEMICAL HAZARD TEMED is extremely flammable and can be very destructive to the skin eyes nose and respiratory system Keep TEMED in a tightly closed container Avoid inhalation and contact with the skin eyes and clothing Always work in a fume hood Obtain a copy of the MSDS from the manufacturer Wear appropriate protective eyewear clothing and gloves 3 Immediately pour the gel Wrap the gel in cellophane to prevent drying 5 Allow the gel to polymerize for 2 hours before using Achieving Longer High Accuracy Reads on the 377 Sequencer Page 9 of 16 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Preparing the 377 Data Collection Software Prerun Module Modify the Seq Run 48E 1200 Module Page 10 of 16 Overview Now that you have prepared the gel you will need to modify the Seq Run 48E 1200 run module The run module is located in the ABI PRISM 377 Data Collection Software Use the Seq PR 48E 1200 prerun module It is not necessary to modify the prerun module Modify the Seq Run 48E 1200 module
15. re for up to 4 weeks Page 7 of 16 Preparing and To prepare a 48 cm well to read gel containing 4 25 PAGE PLUS gel 6 M urea and Pouring the Gel 1 2X TTE follow the instructions below Ingredient Quantity Urea 18g 40 PAGE PLUS 5 3 mL 10X TTE 6 mL Deionized water 21 5 mL 10 ammonium persulfate APS 250 pL TEMED 25 uL Total 50 mL To prepare and pour the gel Step Action 1 Prepare the glass plates as described in the ABI PRISM 377 DNA Sequencer User s Manual P N 4307164 Note Glass plates and all other gel pouring equipment must be ready for use prior to adding the polymerizing reagents to the gel solution Prepare the stock solutions listed in the table above Weigh out the urea and carefully transfer it to a stoppered graduated cylinder WARNING CHEMICAL HAZARD Urea can cause irritation to the skin eyes and respiratory tract Avoid inhalation and contact with skin eyes and clothing Always work in a fume hood Obtain a copy of the MSDS from the manufacturer Wear appropriate protective eyewear clothing and gloves Using a pipette add 5 3 mL of 40 PAGE PLUS and 6 0 mL of 10X TTE buffer to the cylinder CHEMICAL HAZARD PAGE PLUS Acrylamide is harmful if in contact with the skin or if swallowed Acrylamide may cause eye skin and respitory tract irritation It may also cause an allergic reaction Exposure may cause damage to the nervous sy
16. stem kidneys and reproductive system Acrylamide is a possible cancer and birth defect hazard Please refer to the manufacturer s MSDS for additional information Wear splash resistant safety goggles and appropriate chemical resistant clothing and gloves Add 21 5 mL of deionized water to bring the solution to a final volume of 50 mL Mix the contents thoroughly to dissolve the urea Filter the solution through a 0 2 um cellulose nitrate filter NIO a Degas for 2 5 minutes and transfer the solution to a wide mouthed container Note Degas time for all gels should be constant to ensure a reproducible polymerization rate for all gels IMPORTANT If the plates are not clean and mounted in the gel cassette or other device clean and mount them now before adding the polymerizing agents to your solution Page 8 of 16 Achieving Longer High Accuracy Reads on the 377 Sequencer Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com Polymerizing the Gel To polymerize the gel Step Action 1 Add 250 uL of freshly made 10 APS to the gel solution and swirl carefully to mix without introducing air bubbles Note Accuracy and reproducibility are important when making the 10 APS solution Significant variation in this reagent can produce changes in data quality WARNING CHEMICAL HAZARD Ammonium persulfate APS is harmful if swallowed inhaled o
17. the 377 Sequencer Page 11 of 16 Artisan Technology Group Quality Instrumentation Guaranteed 888 88 SOURCE www artisantg com To prepare the buffer chambers continued Step Action 2 Add deionized water to the upper buffer chamber in the following amounts If you have a Add White upper buffer chamber old model 480 mL of deionized water Clear upper buffer chamber new model 560 mL of deionized water 3 Add 1X TTE to the overflow line of the lower buffer chamber approximately 600 mL Note To make 600 mL of 1X TTE in a 1 L graduated cylinder combine 60 mL of 10X TTE with 540 mL of deionized water and mix well 4 Start the prerun and immediately pause it Note Once started and paused the module continues to bring the gel temperature up to 51 C No electrophoresis takes place 5 Rinse the loading region well a Take a 50 cc syringe of water with a needle on the end of it b Drag the needle along the glass ledge in front of the comb while dispensing the water IMPORTANT Be careful not to disturb the comb when rinsing the loading wells Resuspend and Load To resuspend and load the samples and start the run the Samples and Start the Run SteP Action 1 Resuspend and denature the samples as recommended by the protocol that you are following Load the odd numbered lanes Resume the prerun and pause it after 2 minutes Load the eve
Download Pdf Manuals
Related Search