Home

iPLEX Software Guide.book

1. The wells of each 96 well plate are mapped horizontally across the 384 well plate to illustrate the mapping of wells A1 A2 and A3 of 96 well plate 1 are indicated here by arrows eece0 0 0000000 0 000000000000 The wells of the 96 well plates are mapped to every other well in every other row The mapping of wells for 96 well plate 1 begins with well A1 of the 384 well plate The mapping for 96 well plate 2 eeo 000000000 0 e009000000000 begins with well A2 The mapping for 96 well plate 3 begins with e00000000000 well B1 And the mapping for 96 well plate 4 begins with well B2 5999 wes eue 96 well plate 1 Well A1 4 9 Oo 0 0000202090208 6 6 6 OO 606060000000059 6 6 6 6 6 9 O6 6 6 G6 OG oo 0806 6 66 6 6 6 6 6 6 OO 6 6606000000069 96 well plate 2 384 well plate 96 well plate 3 0060000000000 0060000000000 Note The 96 well plates and 384 well plate are not i o shown to scale The 96 well plates are depicted 095 6 6060600906 on duced size of the 384 well plate for 0600000000000 purposes
2. 02000 cece eee eee 6 Exiting AssayEditor lt p esee REEL eR AKESA RESIA 6 To exit AssayEditor llli 6 Navigating AssayEditor 0 0 eh 7 The Navigation Tree 1 ce tees 7 Assay Group tab s sepes eet ex es EE eee Aes 7 To view items on the Assay Group tab 000 0c eee aes 7 To rename items on the Assay Group tab 2000000 ee ee 7 The Work Window esssee n 8 Details taD os nos Ee s AE ROO eh RR RO tla de GARS 8 Edit Assay tab sd R2 ERG Ux NE ob Rd Eee E EE 8 Edit Group tab zasada pna a a a c e deena cee san ay ERE RAS 8 Importing ASSAYS sis sensisse eed nd desea ed dons eidem d een bees 8 To import assays liess rn 8 Searching for Assays liiis eee 10 To search for assays 0 2 eee 10 Creating and Editing Assays 0 00 c eee eee 10 Creating ASSAYS siao cri areae caa e aa E a a a aE A a a aa eee 10 To create a new assay ee ee 10 Adding Items to the Expected Peaks Grid 0000 cena 11 To add probe sequence and sequence mass n annann nnn nnn 11 To add analytes seri cocainei aaa a a a iaa A aa e ees 12 To add contaminants 0 0 00 12 Copying and Pasting Items in the Expected Peaks Grid 12 Deleting Items from the Expected Peaks Grid 0000005 12 Adding Genotype Calls 0 0 0 0 c ce tees 12 To specify homozygous calls lille 13 To specify heterozygous c
3. j IRRA EG eet ee NE aly iei TTA IBAGCTIT GIATG uri BROGICTGCCATCTAG AC AGCAC B UNS AG BEC AC C T GGCATCT IGAATCGACTC A G AG JACGCTGAATCGA A 134 AC UTITCGCGCTTA IBOTIC T GGCATCT E ACTCA n ITO GCO aa ONERE di DAATCGAS ATG CICTGGCATCTAG SGTATGACI T A G NE WIGAATCGACTCA Arica ce GAATCGAI tei V TITCGCGCTTA GTIC T JGGCATCT i IMGAATCGACTCA EOTGAATCGA OTACA GCA IATGAC G C G PA GC GG T AG GCTT GATGGCTT MeeRGIGGITAGACCT 1 GjATG BA TIG IBIGAC G C ESSEN B ENGIBTATG AC T A G Let WEGTIC T GGCATCT EG JA JGAATOGACTCA 20 MEN INGIG v a ACCC GAATCGA Tuy RAG i COSI Noc E CACGT C T GGCATCT PTAJ CAAT CGACTCA lA Fc Ud CCTGAATCGA Ver Ney ee eh C C1C EN GcoGT ud JOTTGATGGCTI my CIGG TAGACCT T GJATG MAJ mice MOG TOTGGCATCTAG BETTAC AGCAGC MATGAC T AJG GETTA ac INOGT C T GGCATCT STAT TAC BEER WBIG C T JOACCCTGAATCGA Joc a TAG B TITCGCGCTTA REP GC ENO ply GORATCT OM Bor ACA AGC SATGAC G CIG erect TAG IOTTGATGGCTT E Us TAGACOT T G ATG GAT G BGMGGTICTGGCATCTAG i p OTACA A BETAGOC CGT C T GGCATCT MassARRAY Typer 3 4 Software User s Guide for iPLEX and hME Document Number 11546 Doc 11546 R03 CO 060094 June 30 2006 Dear Customer Thank you for purchasing MassARRAY from SEQUENOM This software was created specifically for use with the MassARRAY system and has been quality control tested to provide the most sta
4. 000 cect es 31 To selecta plate sese eed ke Re OR X CX ad debe Kos e o 32 To select an individual well 00 0000 cece eee eee 32 To select a contiguous group of wells 02 0000 e eee 32 To select a non contiguous group of wells 220055 32 Creating Plates 0 ccc tte tees 33 Creating Plates with the New Plate Dialog Box 4 33 To create a new plate 0 00 ee 33 Creating Plates using Templates 0 0 0 0 cece een eee eee 33 Creating Templates 000 0 cece eee 33 Creating Plates Using Templates 0 0 0 0 cece eee eens 35 To create a plate using a template 22000 cee eee 35 Creating Plates via Assay Groups 0000 e eee eee eee 36 To create plates via assay QrOUPS 0 0000 ee eee 36 Creating Samples 0 00 c eects 37 To create a new sample group 00 eee 37 Sample Order and Applying Sample Groups 0000 eae 39 Doc 11546 RO3 CO 060094 iii MassARRAYS Typer 3 4 Software June 30 2006 User s Guide for iPLEX and hME To specify the sample direction 0 0000 eee eee eeees 39 Sample Order 000 cece le 39 Empty ROW ouo eoru eee xS bes g Seba Repeater eee ee eee 40 Repeated Samples 0 0 0 cece eect lees 40 Importing Sample Names and Descriptions from Microsoft Excel 41 To import sample names and descriptions from Microsof
5. TyperAnalyzer window Click Plate Data The Plate Data tab shows a results table of genotype calls for the plate wells Plate Data 08 Example of Dominik SBEID20305 7DNAs GT 3cycles D30405 semifinallN RC OF CHP3 RECALL 359012 8 Recal 33 0 resi ults SAMPLE D CALL ASSAY ID WELL POSITION DESCRIPTION CALIBRATION MAX sHFT Rasters table 25 con GA 150342 A02 B Moderate On 31799 1 1 26 cont G 151288 A02 A Conservative On 080363 1 1 27 com GT 160195 AD2 A Conservative On 055684 1 1 28 coni CG 174545 A02 B Moderate on 465471 1 2 I cT 174550 402 E User Call on azaz 30 coni G 188453 A02 B Moderate On 621691 1 31 cont G 193815 A02 A Conservative On 186999 1 1 32 coni c 196941 A02 A Conservative On 213753 1 1 33 comi A 198182 A02 amp Conservative On 345351 1 1 d gt Use Plate Data Tex Well Data All calls are listed Note that both calls and no calls are listed MassARRAY Typer 3 4 Software 82 Doc 11546 RO3 CO 060094 User s Guide for iPLEX and hME June 30 2006 Reviewing Processed Data with TyperAnalyzer Viewing Spectra 2 To view the spectrum for a call click the call i e row The spectrum appears in the spectrum display upper right area of the TyperAnalyzer window You can manually call a genotype i e you may choose the genotype yourself Right click the row and choose the genotype call you want to make See Plate Data Tab Options
6. 4 Click OK to save your changes and close the dialog box or Apply to apply your changes and continue customizing Customizing Colors You can customize colors in the Spectrum or Plot Cluster displays Graph Attributes Desk Foreground Desk Background Shadow Color Graph Foreground Graph Foreground Table Foreground Table Background To customize colors 1 Right click on either the Spectrum Cluster Plot or Histogram pane 2 Inthe Customization dialog box click on the Color tab 3 Select an attribute below then click on a color Graph Attributes Desk Foreground Desk Background Shadow Color Graph Foreground Graph Foreground Table Foreground Table Background 4 Click OK to save your changes and close the dialog box or Apply to apply your changes and continue customizing MassARRAY Typer 3 4 Software 112 Doc 11546 R03 CO 060094 User s Guide for iPLEX and hME June 30 2006 Reviewing Processed Data with TyperAnalyzer Logging Debug Messages Customizing Styles You can assign styles to the subsets created on the Subsets tab include the color point type and line type To customize colors 1 Right click on either the Spectrum Cluster Plot or Histogram pane 2 Inthe Customization dialog box click on the Style tab 3 To change the color click on a color 4 From the Point Type drop down box choose a point type 5 From the Line Type drop down box choose a line type 6 Click OK to save
7. To add a new sample enter its name and optional description in a blank row Note If you do not want to save the changes you made click Exit to close the Edit 2 6 Sample Group dialog box and return to the PlateEditor window When you are done making changes click Save Click Exit to return to the PlateEditor window To edit a sample group 1 2 MassARRAY Typer 3 4 Software User s Guide for iPLEX and hME In the PlateEditor click the Sample tab If necessary expand the tree list to find the sample group you want Click the plus symbol next to a node to view its contents Click the sample group to highlight it Then right click the sample group and choose Edit Sample Group The Edit Sample Group dialog box appears iw Rm Group Id Test Sampleld Description jal f Europe West Asia North Africa South 1 2 3 5 a 7 8 9 10 Edit Sample Group dialog box 44 Doc 11546 R03 CO 060094 June 30 2006 Defining Plates Deleting a Sample Group If a message similar to the following appears click OK to dismiss it PlateEditor It exists on a plate that has already been run X Sample CMBIST98 004 cannot be modified The message can appear for two reasons either the plate has already been run or at least one plate uses samples from the sample group you want to edit Note You cannot edit the samples in a sample group if a plate currently uses samples from that
8. To save the current window layout From the Options menu select Layout gt Save Layout To reset the window layout to the default layout From the Options menu select Layout gt Reset Layout To load a saved layout e From the Options menu select Layout gt Load Layout This removes temporary layout changes Any unsaved changes to the currently displayed layout will be lost when the program quits unless Automatically Save Layout is set to True in the Configuration program To add menu items to the tool bar 1 Click the Down arrow on the right edge of the tool bar and select Add or Remove Buttons Customize 2 Inthe Customize dialog box find the menu item and drag it to the tool bar For example to add the Selection Type command to the tool bar select Commands View Selection Type and drag it to the tool bar 3 To remove an item from the tool bar drag it back to the Customize dialog box You can customize the following aspects of the Spectrum Cluster Plot and Histogram displays e Title and subtitles e Plot axis and style Fonts and colors To customize the title or subtitles 1 Right click on either the Spectrum Cluster Plot or Histogram pane 2 Inthe Customization dialog box click on the General tab 3 To change the title enter a new title in the Main Title text box 4 To modify the subtitle enter a new title in the Sub Title text box 5 Click OK to save your changes and cl
9. Defining Plates Applying Sample Groups Using 4 96 to 1 384 Mapping
10. Doc 11546 R03 CO 060094 93 MassARRAY Typer 3 4 Software June 30 2006 User s Guide for iPLEX and hME Reviewing Processed Data with TyperAnalyzer Viewing Cluster Graphs FREQUENCYINFO Allelotyping only This part lists allele frequency information Example of FREQUENCYINFO FREQUENCY FREQUENCY UNCERTAINTY FREQUENCYINFO 16273 100000 0 526177 0 011341 part of assay details 6617 300000 0 473823 0 011341 T Note When acquiring spectra an Expected Average Standard analyzer attempts to acquire five spectra for each sample Relative mass of a Relative error of all fr n mat re the av r peak frequency frequency died Mn d ida 5 ea age astimat estimates requency found in the five spectra The standard error of the frequency 1 0 means 100 estimates is the standard error of the frequencies from all five spectra ASSAY ID SAMPLE ID DESCRIPTION 6273 100000 O analyte CAGAACACTTAGCACCCCA 6617 300000 O Probe C11 48170 P CAGAACACITAGCACCO AC 5999 900000 Calibrated 1 000000 i 0 177160 O 5999 900000 5 926464 h 0 286040 O 6273 100000 115 235081 i 1 000000 O 6304 100000 4 233089 2 200810 0 209770 O 6617 300000 105 226049 56 737394 1 000000 O 5999 900000 66 594350 45 111770 268 733247 O 6273 100000 1108 321627 17 961267 282 752209 Peaks are identified by mass E 6304 100000 y 43 494948 275 282209 To find which allele a peak O 6617 300000 946 17 028181 268 523247 repr
11. In most cases when generating an Allelotype or Allelotype Correction report you should generate the report on the experiment containing the four chips Allele frequency estimates will be based on statistical analyses done on the data from all four chips You may generate an Allelotype or Allelotype Correction report on an individual chip but the frequency estimates will be based only on the data from one SpectroCHIP Doc 11546 R03 CO 060094 107 MassARRAY Typer 3 4 Software June 30 2006 User s Guide for iPLEX and hME Reviewing Processed Data with TyperAnalyzer Generating Reports E Customer Allelotype Correction Report El Customerl Allelotype Report El Project Assay Type Count Report Platel Best Call Probability Report zi Call Probability Report E Chipl Description Count Report 1 Gene Expression Report 2 Genotype Area Report Genotype Cluster Report Plate Definition Report T pe Plate Result Report 5 7 Caution 8 Do not select anything above Chip3 the plate level This would 10 A report generated on select chips under different 11 Plate2 will include data plates Generating a report on 12 from chips 1 12 chips under different plates E Plate3 does not create valid report data Report options for plates Generating a Genotype report on multiple chips is equivalent to generating a Genotype report individually for each chip and app
12. The results table lists a single call for each well position For a given well position the call that is listed is the one with the highest score amongst all the experiments on the plate Note You may see several calls for the same well position highlighted in red This happens if the calls from the experiments do not correspond that is if there are different genotype calls for the same well position from the experiments In this case all calls from all experiments are listed for the well position in question You can sort the results table on any column by clicking the column s header at the top of the table The rows of the table are sorted on the column you select in ascending order To view only the no calls On the toolbar click the No Calls button E3 To view the no calls for all experiments on a plate If you have multiple experiments that is MassARRAY analyzer or analyzer compact reads on a plate you can view all the no calls for all experiments on the plate To do so complete the following steps 1 In the left pane which lists customers projects plates and experiments select a plate Then right click the selected plate and choose Show All NOCalls for plate name gt where plate name is the name of the plate you right clicked The results table lists all no calls from all experiments on the plate Since all no calls from all experiments are listed you may see multiple no calls for the same
13. the intensity of the peak You can leave the Call Information Dialog dialog box open and click another well to view information about it 3 When you are done close the Call Information Dialog dialog box by clicking x in the upper right corner Filtering the You can control which columns are shown in a results table by hiding individual columns Results Table or groups of columns When you hide a column it is simply hidden from view You can easily switch back to showing the column Doc 11546 RO3 CO 060094 125 MassARRAY Typer 3 4 Software June 30 2006 User s Guide for iPLEX and hME Reviewing Processed Data with Genotype Analyzer Filtering the Results Table To hide or show columns 1 Onthe View menu select Display Fields Dialog The Data Field Display dialog box appears Data Field Display Calibration Status Show Specified Hide All lv CALIBRATION M MASS SHIFT r Frequency Analysis Show Specified Hide All IV Frequency Uncertainty IV Frequencies Peak Areas Peak Area Errors Fractional Unextended Primer Peak Area Iv Fractional Pausing Peak Area lv RASTERS General Iv SAMPLE ID iv CALL Iv ASSAY ID Iv wELL POSITION ENTRY OPERATOR Cancel Selecting which columns to display iv DESCRIPTION 2 Select which columns to display Note Calibration Data Applies to both genotyping and allelotyping experiments Allelotyping Data Columns that appear in additio
14. 2 inconsistent oligonucleotide concentration and 3 different desorption ionization behavior in MALDI The Primer Adjustment report creates an Excel file xls that indicates how to adjust the volume of the primer mixture for each assay in a multiplex For information on multiplexing see the application note Multiplexing the homogeneous MassEXTEND Assay available at www sequenom com For all the assays in a well the one with the highest signal to noise ratio SNR receives a score of 1 Scores for the other assays in the multiplex are calculated relative to this score For any assays in the well that fall below 45 0 45 the primer volume needs to be adjusted The FRAC ADD column in the Excel file lists the amount of oligonucleotide to add to the mixture Adjusting MassEXTEND Primer Mixes For best multiplexing results the concentrations of hME primers should be adjusted to even out peak heights intensities in the mass spectrum This adjustment must be done prior to preparing the hME reaction cocktail and processing the hME reaction Doc 11546 R03 CO 060094 143 MassARRAY Typer 3 4 Software June 30 2006 User s Guide for iPLEX and hME Primer Adjustment Report Note Adjusting MassEXTEND primer mixes requires the use of a SpectroCHIP9 bioarray Adjusting MassEXTEND primer mixes is critical to successful multiplexing An assay with a very low primer peak will systematically fail when applied to samples as part of a multipl
15. Bad Assay Red No Alleles Blue User Call Cyan Genotypes and Peaks Different genotypes result in a different peak pattern in the spectrum The configuration of present and absent peaks is used to determine the genotype Calls In a good assay most calls can be made automatically Any genotype determinations that cannot be made No Calls require manual intervention See To manually call a genotype in the table on page 135 The goal of Typer is to have close to 100 accuracy on automatic calls made with conservative criteria It is required that you manually call the non call spectra Furthermore it is advisable to examine the automatic calls based on the Aggressive criterion The main function of Genotype Analyzer is to provide the interface to allow making these manual calls MassARRAY Typer 3 4 Software 118 Doc 11546 R03 CO 060094 User s Guide for iPLEX and hME June 30 2006 Reviewing Processed Data with Genotype Analyzer Using the Results Table Genotyping The following illustration shows the No Calls Notice the table includes reasons for the No Call status To view only the calls To view only the no calls Reasons for No Call status click the Called Only button Click the No Call button show in this field El Genotype Analyzer Plotz 021402 Expression Chip 021402 Experiment 1 File Edit Help a amp E3j 10 v uJ B E sechesv Max I f amp Methylation a Sequenom
16. Click on the Spectrum tab to make it active 2 From the File menu select Print Graph 3 In the Printing dialog box choose a printing style Color Monochrome or Mono Plus Symbol 4 Click Setup to set up the printer 5 Click OK to print the graph Exporting a Spectrum You can paste the spectrum to the Windows Clipboard for copying into another program such as Microsoft Word Excel or PowerPoint You can also save the spectrum to a file To copy a spectrum to the Clipboard 1 Right click the spectrum and select Export Dialog The Exporting assay name gt dialog box appears where assay name gt is the name of the assay 2 Under Export select the file format in which you want to copy the spectrum to the Clipboard Metafile is recommended for copying to the Clipboard Note Selecting Text Data Only copies text data values defining the spectrum graph For more information see To export spectrum graph data points on page 88 3 Under Export Destination select Clipboard 4 Optional If you need the spectrum in a specific size specify the size under Object Size Otherwise leave Object Size at No Specific Size Note Changing the size may distort the image if you do not change the width and height proportionally 5 Click Export An image of the spectrum is now available on the Windows Clipboard for pasting into any program that will accept pasting of a Windows metafile Doc 11546 R03 CO 060
17. Do not do anything until the task is completed Plate tab Click the Plate tab to show all the plates in the database organized by customer and project Select and highlight a Plate ID and right click the mouse A popup menu of options appears MassARRAY Typer 3 4 Software 30 Doc 11546 RO3 CO 060094 User s Guide for iPLEX and hME June 30 2006 Defining Plates Selecting Plates Selecting Plates Doc 11546 R03 CO 060094 June 30 2006 Assay tab Click the tab to make its information accessible The Assay tab includes all the assays defined using the Assay Editor Assay projects are organized into assay groups and within the assay groups are plexes and assays Highlight the assay that you want to apply to selected wells Right click and select Add to apply the assay See Assay and Sample Tree on page 46 One or more assays can be applied to the same well Sample tab Click the tab to make its information accessible The Sample tab shows all defined samples Plate Table This area displays the contents of each well shown in the plate layout Plate Layout This area displays each well Highlight one or more wells that you want to select This can be a single well a contiguous group of wells or a non contiguous group of wells If a group of wells are selected a window showing the assays and sample ID displays Plate Properties This area displays the selected plate with each well identified by the grid Highlight one or mo
18. Eana e 8 6 E 8 E61 8 E88 o z z xe x o m o o m lt E es Well Data Ls Plate Data eb date j Assay da cust Recall 3 3 0 12 iPLEX 03 08 2005 10 43 11 TOTAL 6048 CALL 5591 NOCALL 457 EJ E a a 2 Example of TyperAnalyzer window Allelotyping When allelotyping you can quickly determine which wells are polymorphic i e both alleles found and non polymorphic only one allele found TyperAnalyzer seqbm045 PLEX_allelotyping Allelotype 091605_CEPH_Pool_3x24plexes nested POOL1 2 9953 Deleted itens The spectrum for a well appears here Diagnostics Teut Hoyan D i fue eat d 4 Fiagreniahon Test Ansys of SpechoCHIP 4 hMCGenype i Traffic Light 208 jw lDMa d RE 1 234 678 1011121314151617 18192021 222324 ASSAY ID L SAMPLE ID l CALL OESCRIPTION PLEX aleloypina A a 100109 CEPPOOLL er 3chymorghic 8 R Bims mpoo AG 2 Pebymerpbie is mn rehwortic POOKY ia p A plate is shown with its Put r N E 1991 CEPHPOOLL GA i PO o wells color coded according EL ameo d Assay details POOLAS M E 222774 CEPHPOOLI cT Genotype i to call status polymorphic gs casou d appear here h Johana J Bara CEPPO Jue K non polymorphic Esos crPeoot reta s Kai L 2 3102 CEPHPOOLI TC J Polymcenhic Lon M E o3 CEPHPOOLI a J Polymorghic Matin s Eso CEPr
19. Genotyping on page 117 organized hereina w ca Using the Results Table Genotype Area on page 122 tree Click an priced m cn i i 02 re d 12 cea experiment to view fea ec its data For more 02 hME recalled sng bihME 32 87 information see _snig bihME 1_7 Finding and ii Selecting Data on feces Spectrum Display page 116 The spectrum for the currently selected well in the results table is shown here Initially only the results table is shown with no spectrum display Use the Spectrum Split tool to see the spectrum display For more information see Viewing Spectra on page 128 Mi HME evaluation amp Mi Jay amp Mi Jeff T Mb il Mi Kevin It Liyan Ii lorieta My martin 9 0 29 0 490 69 0 j iy Date Test 8 Project Ready M 11821 06 I 77 10 Count 318 10000 0 Genotype Analyzer Note There are slight differences in the way some Genotype Analyzer features work depending on whether you are viewing genotyping or allelotyping data Sections in this chapter applicable to only genotyping have Genotyping after their headings Sections applicable to only allelotyping have Allelotyping after their headings Sections applicable to both have plain headings with no analysis type indicated Doc 11546 R03 CO 060094 115 MassARRAY Typer 3 4 Software June 30 2006 User s Guide for iPLEX and hME Reviewing Processed Data with Gen
20. June 30 2006 Caution Before generating an Allelotype Correction report a skew correction file must contain skewing data which are applied to the allelotyping data If your skew correction file does not have skewing data for the assays applied to the plate you must add skewing data for those assays Skewing data for an assay is added to a skew correction file by generating a Genotype Area report on a genotype area plate on which the assay has been applied see Assay Type Count Report on page 139 The following table describes the additional columns of data included in an Allelotype Correction report An Allelotype Correction report contains the same information as an Allelotype report see Table 6 on page 137 plus these columns Table 7 Additional Columns in an Allelotype Correction Report Column Description Skew of Lower Mass Allele Frequency of the lower mass allele found by performing genotype area analysis on individual DNA sample this value is used to adjust the frequency of the lower mass allele in a pooled sample this value is taken from the skew correction file selected when the report was generated SKEW LOWMASS Skew of Higher Mass Allele Frequency of the higher mass allele found by performing genotype area analysis on individual DNA sample this value is used to adjust the frequency of the higher mass allele in a pooled sample this value is taken from the skew correction file selected when the repo
21. Typer 3 4 Software User s Guide for iPLEX and hME Reviewing Processed Data with Genotype Analyzer Generating Reports To generate a report 1 On the Project tab select the experiment on which you want a report Then right click the experiment again and select Generate Report Experiment Customer Note The organization of a tree sorted by project is In a genotyping or E E Allelotyping illustrated here For more information about selecting genotype area plate an ili Control Assays data in the tree see Finding and Selecting Data on experiment represents a B pe Conpwatog 1 Page 116 SpectroCHIP and a chip Plate gt zi amp 48170 ConbNA1 96 1 represents a MassARRAY Experiment PE amp 042602 1 1 analyzer run on the 1 SpectroCHIP Multiple chips Bz After selecting a chip right click it and represent multiple runs on Chip T 1 t Py p Generate Report for 3 select Generate Report for n where the same SpectroCHIP 4 042702 1 1 FA nis the chip number you selected j amp b 042902 1 1 GA J 48170 ConPooli 96 P Example of a tree Note The names used here are for illustration you should name your plates and chips according to a consistent convention that allows you to easily identify their contents You can generate a report On customer multiple chips under the E Allelotyping Mi Control Assays Show All Calls For 0
22. and hold down the left mouse button 2 Drag the cursor across and down to cover the wells you want to select As you drag the selected wells turn grey 3 Release the left mouse button The wells remain selected To select a non contiguous group of wells 1 Select the first well or group as explained in the preceding instructions 2 Press and hold down the Ctrl keyboard key 3 Click additional wells You can also click and drag to select more than one additional well 4 Onceallthe wells are selected release the Ctrl key and left mouse button MassARRAY Typer 3 4 Software 32 Doc 11546 R03 CO 060094 User s Guide for iPLEX and hME June 30 2006 Defining Plates Creating Plates Creating There are three ways to create plates Plates Using the New Plate Dialog box See Creating Plates with the New Plate Dialog Box below for instructions e From a template file See Creating Plates using Templates on page 33 for instructions e By selecting an assay group See Applying Sample Groups on page 49 for instructions Creating Plates with the New Plate Dialog Box To create a new plate 1 On the Plate tab select the customer and project in which the new plate will be stored 2 Right click a project name and choose New Plate from the menu that appears OR click on the File menu and select New followed by New Plate The Create a New Plate dialog box appears Create New Plate Dialog The Plate ID
23. eeecoecc c0 00600 8 eeoecc 0 060000 8 ee SS 96 well plate 4 In Typer you can apply samples to a plate in the manner depicted above by having a separate sample group represent each of the 96 well plates and then applying the sample groups using the 4 96 to 1 384 mapping option See the following instructions MassARRAY Typer 3 4 Software 50 Doc 11546 RO3 CO 060094 User s Guide for iPLEX and hME June 30 2006 Defining Plates Applying Sample Groups Using 4 96 to 1 384 Mapping To apply a sample group using the 4 96 to 1 384 mapping Note The 4 96 to 1 384 mapping should be used only with sample groups containing 96 samples Additionally the samples should be applied to only 384 well plates l In the Plate tab select a plate For more information about selecting a plate see Selecting Plates on page 31 Click the Samples tab 3 Inthe Samples tables tree click the sample group you want to apply El Sample Tables B sample SampleGroup ne P Sample groups are the H S rupta third level of the tree E Sample Samples tables tree In the Properties pane select Horizontal 5 In the Properties pane set 4 96 gt 1 384 Mode to True Note If a check mark already appears next to 4 96 1 384 Map Sample Group do not select it It is already selected selecting it again would de select it 6 Determine from which well you want to start applying the samples Yo
24. on page 89 for information Note When you manually call a genotype the call will be noted as a user call even if you change it back to the original call Viewing The spectrum display shows the spectrum of the currently selected well call or assay Spectra TyperAnalyzer seqbm045 Dominik SBE 020305 7DNA s GT 3cycles 030405 semifinallNI RC OF CHP3 RECALL 359012 6 4 Customer a Customer Project Plate E pt A 4pt_calibrant Beatrice BrianG Carmen Chemistry Christiane amp David Deleted Items Diagnostics Test Dom misc Dominik Empty amp Eunice Fragmentation Tests FT Analysis of SpectroCk Genset AIM spectrum B Histogram George george2 Traffic Light 00 Eel Data Guy 12 3 45 6 7 8 9 101112131415 16 17 18192021 22 23 24 ASSAY ID SAMPLE_ID hMC Genotype a sim mgmeoe 150342 coni GA AC Johanna B E 1 coni G AC a P c coni GT B deus E cont ca AC ii Mum c Methylation j coni 9 ing Michael H coni AC Monitoring i coni AC Palsson 3i coni AC Phil K 199461 conl B ping L 208596 conl AC Pintool Test M ul 222774 cont Dic PrimerSet3 v N e lt gt lt gt P tss Well Data Ese Plate Data ToS pate L Assay dh cust Ready Recall 3 3 0 12 iPLEX 03 08 2005 10 43 11 TOTAL 6048 CALL 5591 NOCALL 457 Sample TyperAnalyzer window Viewing the Spectrum from a Well When yo
25. B or C as described in Appendix A of the iPLEX Application Guide Pipette 1 uL of the primer mix into a well of a microplate and add 24 uL nanopure water to obtain a 360 nM dilution of the primer mix referred to as a primer mix sample Repeat steps 1 and 2 for each multiplex to generate a microplate containing primer mix samples for all of the multiplexes Add 3 mg Clean Resin to each well of the microtiter plate MTP using the dimple plate Note Do not add any water The existing dilutions of the primer mix samples are appropriate Dispense the primer mix samples to a SpectroCHIP using standard dispensing conditions for iPLEX reaction products It is recommended you dispense to two pads per primer mix For instructions on operating the Nanodispenser see the MassARRAY Nanodispenser User s Guide and the iPLEX Application Guide Note If the entire SpectroCHIP is not used you may keep it for future use in MassARRAY Typer 3 4 Software User s Guide for iPLEX and hME adjusting iPLEX primer mixes Use only those pads on the SpectroCHIP that have not been used before you cannot reuse previously spotted pads Store SpectroCHIPs in their original packaging in a desiccator SpectroCHIPs may be stored for one week maximum 142 Doc 11546 R03 CO 060094 June 30 2006 Primer Adjustment Report 6 Acquire spectra from the SpectroCHIP For instructions on acquiring spectra see Chapter 4 Acquiring Spectra on
26. Change Call menu Printing a Cluster Plot Graph To print a Cluster Plot graph 1 Click on the Cluster Plot pane to make it the active pane 2 From the File menu select Print Graph 3 In the Printing dialog box choose a printing style Color Monochrome or Mono Plus Symbol 4 Click Setup to set up the printer 5 Click OK to print the graph Doc 11546 RO3 CO 060094 101 MassARRAY Typer 3 4 Software June 30 2006 User s Guide for iPLEX and hME Reviewing Processed Data with TyperAnalyzer Viewing Histogram Graphs Viewing Histogram graphs provide information about the distribution of calls made for each assay Histog ram on a chip Use the histogram graph in conjunction with the cluster graph and the spectrum Graphs graph to analyze assays To view a histogram graph 1 2 In the navigation tree select a chip Then click a well to select it Click the Histogram tab The histogram for the selected well appears Calls per A LM Homo H HM Homo Histogram pane Click a color bar on the graph The spectrum graph in the Spectrum pane is updated to show peaks for the selected assay The Cluster Plot pane displays a graph of the assay you selected on the histogram The data point representing the selected assay is circled in white on the cluster graph If there are more than 24 assays in the well drag the scroll bar along the bottom of the pane to view subsequent assays If there are few
27. Conservative amp Michael 193915 cont A Conservative Monitoring 196941 cont A Conservative Palsson 198182 cont A Conservative Phi 199461 coni B Moderate ping 208596 coni A Conservative Pintool Test A 222774 coni D Low Probability Y PrimerSet3 ja gt Es Plate Data es Well Data date y Assay d Cust Recall 3 3 0 12 iPLEX 03 08 2005 10 43 11 TOTAL 6048 CALL 5591 NOCALL 457 Example of TyperAnalyzer window Be sure the correct Terminator Chemistry iPLEX or hME is displayed in the status bar If the incorrect chemistry is displayed the incorrect Terminator Chemistry may have been selected in the Chip Linker module MassARRAY Typer 3 4 Software 78 Doc 11546 R03 CO 060094 User s Guide for iPLEX and hME June 30 2006 Reviewing Processed Data with TyperAnalyzer Selecting an Experiment You can view an experiment in the following three ways Note e Customer e Assay Date While looking for an experiment you can use the and asterisk plus and minus keys on the numeric keypad of the keyboard to expand and collapse the whole tree or parts of it To select an experiment by customer At the bottom of the tree control box click the El Customer Customer tab E FA Ei Test123 4 Customer A Date S Assay d Customer Tree control tabs H 242 6 123 Data E Project 1 4 Project Customer tab 01 4 Plate Experiment 9 01 The illustration to the
28. Correction Report E Project Allelotype Report Plate gt i hil Assay Type Count Report T Chip Best Call Probability Report Report options for chips Experiment gt chip2 Call Probability Report 5 Description Count Report Chip gt E Gene Expression Report 7 Genotype Area Report 8 Genotype Cluster Report E Chip3 Primer Adjustment Report W Plate3 You can generate a report on multiple chips under the same experiment or plate The report will include data for all of the chips under the experiment or plate 2 customer Allelotype Correction Report T rana Allelotype Report Project Assay Type Count Report ii iie Best Call Probability Report For example a report generated E Chip Call Probability Report on experiment 2 will include data B Description Count Report from chips 5 6 7 and 8 57 Gene Expression Report 6 Genotype Area Report 7 Genotype Cluster Report 8 1 Plate Result Report E Chip3 Primer Adjustment Report E Plate3 Report options for experiments Allelotyping is typically done using four SpectroCHIPs The SpectroCHIPs are copies of each other the point of having four copies is to obtain more spectral data points on which to perform statistical analyses The data from each SpectroCHIP is stored in a chip under the same experiment So an experiment should have four chips under it one for each SpectroCHIP
29. Data with Genotype Analyzer Filtering the Results Table The Call Information Dialog dialog box appears m Call Information Dialog Calibration Spectrum Offset NSD Mass Resolution Probability E Call Information Dialog dialog box If necessary drag the Call Information Dialog dialog box to view the results table beneath it 2 Inthe results table click the row i e well about which you want information The Call Information Dialog dialog box shows information about the well you click See the following illustration Yes means calibrant was present on the SpectroCHIP and a cali bration spectrum was successfully acquired Level of confidence in the assay call expressed as Standard Calibration a probability error of offset applied to 1 0 means noise in the the spectrum 100 spectrum Example of the Call 5 ial Call Informatiori Dialog Information Dialog Wlibration Call Spectrum Yes Offset 0 931 Prob 1 000 d NSD 1 250 Height SNR Resolution Probability Area An alyte 127 753219 61 722059 738130526 1 000000 1241 123883 unextended primer and contaminant 7609 000000 0 000000 0 000000 804 104522 0 000000 0 000000 peaks a Expected Signal to noise Level of mass value ratio ratio of confidence that a of a peak peak height to peak is the actual Area under local noise expected peak the curve of expressed as a the peak Height along probability 1 0 the y axis i e means 100
30. Domink 021402 Expression 022 1 Charles 06 13 2008 f amp Michael SAMPLE D CALL ASSAY ID WELL POSITION DESCRIPTION CALIBRATION MASS SHFT RAST amp Monitoring 4 G7 99N 309 E e 308 Bad Spectrum f Palsson 2 C471 G7 89N33742 137 J04 1Bad Spectrum Yes 0 000000 0 000 f Phil amp ping amp Pintool Test 3 f PrimerSet3 f QATest A Rich H Rich test f Rick RE Rick2 f amp Sequenom i AF Study Mi Autoflex Testing Mi Brigitte Mi Desigi408_recall20 li Designer1408 recall Mi Domink E 021402 Expression 02192002 Exp con E 02202002 hME2pcr 02202002 recall 02212002 hME pooledPCR E 02212002 hME recalled E 030402 sng bihME 32 87 J 030502 sng bihME 1 7 8702dk_glycerals0z0 glycerol E alycerol8020_625pmoltest amp glycerol amp z test96plate Mi Eunice ft Grady Mr hamid Wi HME evaluation Mi Jay c ds THEE T x 93 Date Test Project J 10000 0 Ready M 5036 38 T 137 94 Count 2 Use the Called Only and No Call toolbar buttons to view the data that you want to work with To view only the calls e On the toolbar click the Called Only button n To view the calls for all experiments on a plate If you have multiple experiments that is MassARRAY analyzer or analyzer compact reads on a plate you can view all the calls for all experiments on the plate To do so complete the following steps 1 Inthe
31. E Grid Plex Show Hints Sample TyperAnalyzer A aea Navigation pane Settings pane To navigate to the settings you want to modify 1 In the left pane click a folder PlateEditor and TyperAnalyzer to open and view the configuration categories 2 Inthe left pane click on the configuration category you want to display the settings subcategories in the right pane A green arrow in front of the category name in the left pane means the category is currently selected Doc 11546 R03 CO 060094 147 MassARRAY Typer 3 4 Software June 30 2006 User s Guide for iPLEX and hME Configuring Plate Editor 3 Inthe right pane click on a subcategory to view the settings Click on the plus symbol of any item to display its contents Click on the minus symbol of any item to hide its contents Configuring You can configure general Plater Editor properties such as look and feel grid height Plate Editor allow NULL concentration values and set schema owner The following general settings can be configured e General properties including look and feel grid height allow NULL concentration values and set schema owner e Plex properties including plex colors plex layout and sample colors e Color of the samples displayed Configuring General Settings General settings apply to the Plate Editor as a whole General settings include e Look and feel e Property grid help height e NULL concentration value e Sc
32. For all other report types a Save As dialog box appears Skip to Step 4 Note To generate an Allelotype Correction report there must be a skew correction file containing heterozygous skewing factors for the assays applied to your plate Skew factors are saved to a skew correction file when you generate a Genotype Area report on genotype area experiments For more information see Skew Correction File on page 141 133 MassARRAY Typer 3 4 Software User s Guide for iPLEX and hME Reviewing Processed Data with Genotype Analyzer Generating Reports 3 Note It is recommended that you have only one skew correction file named SkewCorrectionFile located in the ReportTemplates folder However you may create and use other skew correction files To create a skew correction file select a folder type a name for the file and click OK The file will be created and the skewing factors from this Genotype Area report will be saved to it Selecting a skew correction file 4 Initially this dialog box shows the ReportTemplates folder You should not save your reports to this folder Select or create a different folder for your reports A default name is supplied for your report based on the experiment chip or plate you selected see right Edit or replace the name if you wish 5 In the Get User Input dialog box click the Browse button and select a skew correction file This is the file to which hetero
33. G551D R553X R560T S SNPH 1 v 5 mp Primer ACGTTGGATGGCATACTAAAAGTGACTCTC see lo Assay Project 3 Amp Primer ACATTGGATGCAGCASATGCTTGCTAGACC BgTemE31 Expected Peaks TYPE NAME SEQUENCE MASS Extend Primer UEP 1717 1G ggGCAAACTTGGAGATGTC 5892 80 Contaminant Analyte A GgGCAAACTTGGAGATGTCT 6219 94 ggGCAAACTTGGAGATGTCC 5140 03 Genotype Calls Analyte Call amp GA A MOM G IMM Edit Assay Edit Group Doc 11546 RO3 CO 060094 June 30 2006 Defining Assays Creating and Editing Assays 2 Click New On the Assay Group drop down list select an assay group into which the new assay will be added In the Assay ID box type a name for the new assay 5 Type a description for the assay Specify the contents of the assay See Adding Items to the Expected Peaks Grid on page 11 and Adding Genotype Calls on page 12 for instructions 7 Click SAVE to save the assay If the SAVE button is unavailable it means either no changes have been made to the assay or certain required data is missing Review the Edit Assay tab and make the necessary changes Adding Items to the Expected Peaks Grid Review the information in this section to add a probe sequence analytes contaminants sequence and sequence mass to the Expected Peaks grid Expected Peaks NAME SEQUENCE MASS Probe probe CGCAGCGATAGCAGC 4587 0 Contaminant Analyte A ANALYTE COCAGCGATAGCAGCA 4900 2 A
34. Goo D GG GUG OOOOOOE peres MN E is E Rich test F m RickC Test 6 Secor aen Aes ea Fa 7 d HL I sg Test20 wo oocecooeogeonoeeooooooo Ma ema E ET Ga Training 2 Ee a venez P x x 6 Ge 3 3 Ge Ge x xx xx e x we p 12P10_1P10_2PforJay i TESTE LL PUN rure SE ES eT RESET ETT SEE SDERIUE Select the assay you BEL want to apply to kroa specific wells Ly i Sona3578 305 lig orig6plex 30 20 amp Ga ucLaz amp a xian Wei lt a d Plate i Assay 4 Sample Ready NUM Friday June 10 2005 Assay Groups tab with an assay selected in the navigation tree 3 Apply selected plexes or individual assays to the appropriate wells More than one assay can be applied to the same well Note To apply a plex or an assay to the entire plate select all the wells and apply the plex or assay Highlight the target well s e In the navigation tree locate the plex or individual assay that you want to apply to one or more wells and click it e Back in the navigation tree right click the plex or individual assay and choose Add The selected plex or individual assay is applied to the wells and the wells change color 4 Click the Sample tab to make it active 5 Apply selected samples to the appropriate wells e Highlight the target wells e In the tree locate the sample that you want to apply to one or more wells and click it e Backin the navigation tree right click the plex or individual assay and cho
35. Hide All Applies to both genotyping CALIBRATION V MASS SHIFT and allelotyping experiments Frequency Analysis Show Specified Hide All IV Frequencies v Frequency Uncertainties Allelotyping Data V Peak Areas Peak Area Variants Columns that appear in M Fractional Unextended Primer Peak Area addition to general data for allelotyping experiments M Fractional Pausing Peak Area General v SAMPLE ID DN v CALL General Data v ASSAY ID v WELL POSITION Columns that appear for both V DESCRIPTION ENTRY OPERATOR genotyping and allelotyping experiments Cancel Selecting which columns to display 2 Select which columns to display Note The options under Frequency Analysis are not necessarily the column names instead they are the types of data in the columns Use the following illustration to match an option to a column Doc 11546 R03 CO 060094 103 MassARRAY Typer 3 4 Software June 30 2006 User s Guide for iPLEX and hME Reviewing Processed Data with TyperAnalyzer Importing and Exporting Wells The options in the Calibration Status section are the exact column names Frequency 1 and Frequency 2 Area 1 and Area 2 Frac UEP Frac Pause The options in the General section are the exact column names Importing and Exporting Wells Data Field Display Calibration Status Show Specified Hide All MV CALIBRATION M MASS SHIFT Frequency Analysis Show Specified Hide A
36. June 30 2006 User s Guide for iPLEX and hME Defining Plates PlateEditor Overview PlateEditor Overview Menu Bar Toolbar Click a plate to select it Click a tab to make it active This section provides a general overview of where features are located on the PlateEditor window and instructions for more commonly used tasks Many PlateEditor attributes can be customized For more information on customizing PlateEditor see Appendix B Configuring the MassARRAY Software on page 147 The PlateEditor includes a menu bar toolbar tree tabs and areas displaying the plate table plate layout and plate properties To view all of these the first step is to select a plate Plates are defined in the PlateEditor Once the plate is open it shows graphically in the window Each well is identified by the plate layout cell If there is nothing assigned to a well the well is marked with an X and has a white background Plate Layout seqbm045 Customer Project Dominik SBE _ PlatelD 24PLEX_PCRcondTest 021705 trisom 2 3 4 5 6 7 8 9 10 11 1213 14 15 t8 17 022405 7DNA 030905 Harva 031505 noadj 032405 iplex 040605 Acydic 041205dillution 051905_DF_bu 052405_DF_bu 20050316_Aar 20050317_Aar 20050317_Aar 20050317_Aar 24plex_12plex 24PLEX_3ADIL 24plex_buffer_ 24plex_ext_ch 24plex ext ch 24plex Extend Assay Sample E 24plex nudeot Assay Group ld Project ld Sample id Description Order No Si 24PLEX PCRc
37. MyAssay as well as MyAssays MyAssays1 MyAssays2 etc Click Go to start the search The search results are listed in the navigation tree Click Go again to find the next occurrence of an assay name matching the search query Creating and Create and edit assays using the Edit Assay tab Editing AssayS Creating Assays New assays may be created from scratch or by copying an existing assay and modifying its contents To create a new assay 1 MassARRAY Typer 3 4 Software User s Guide for iPLEX and hME In the right pane click the Edit Assay tab E AssayEditor charles seqhm106 File view Help CustomerSupport B Deleteme amp fl Devan2 Engineer Training iB Eunice x I cnr amp f Genomics George iPLEx testing SB uyTestaE3 1 amp fj 101002chori ARIUNC SNP1a amp fj Broad iPLEX 97 p r amp fj CFTR_SBE_MSNP fj GNSC 200 27p 25M 2NTP A Triploid fj betaTest Ri betaTestarp A iPLEX EDIT bg 1 Copy of 1717 1G gt A mpvs tag 7x12plex amp newGroup A next5o amp fj next501 fj superplex240 2 alphacrp amp fM gem200 tetraplex amp fl nextso 5 plext test Edit Assay tab 10 Eek Assay Group PEXEDT v New Copy Assay ID EopyofizT1RoA of Plex Group 1 Description NENNEN Terminator Mix PLEX gt Extend Dir R z Test Status Untested Num Runs 0 SNP Strand 1717 18 4 G542X
38. Reviewing Processed Data with Genotype Analyzer Using the Results Table Genotyping Filtering Columns You can choose to view or hide individual columns in a results table See Filtering the Results Table on page 125 The non calls are further categorized e Low Probability Implies that the spectrum in question contains peaks that fail any criteria of significance even for the aggressive parameter set Conflict Implies that there is more that one read or spectrum corresponding to one well and these reads give rise to different and conflicting genotypes e Bad Spectrum The spectrum for the well doesn t exist above noise level e Bad Assay Result of analyst or operator input errors in defining the assays The most common errors are mass values of analytes or contaminants that are out of range of the spectrum or contaminants and analytes having the same mass User Call The analyst or operator selects a genotype in the table and performs a manual call See To manually call a genotype in the table on page 135 The results appear in a table with color coded rows and a column titled Description The following table matches the color to the description Colors can be edited by your system administrator Table 3 Genotype Analyzer Color Codes for Genotyping Description Default Color in Table Conservative Green Moderate Yellow Aggressive Pink Low Probability Rose Conflict Red Bad Spectrum White
39. and the S frequency estimates will be i based on the data from one Di uu cides n SpectroCHIP Generating a report on a plate MassARRAY Typer 3 4 Software 132 Doc 11546 RO3 CO 060094 User s Guide for iPLEX and hME June 30 2006 Reviewing Processed Data with Genotype Analyzer Generating Reports Doc 11546 R03 CO 060094 June 30 2006 Generating a Genotype Area report on multiple chips is equivalent to generating a Genotype Area report individually for each chip and appending them into a single file The data for each chip is kept separate from the data for the other chips When you select Generate Area Report a Select Report Template dialog box appears If not done automatically open the C MassARRAY Typer ReportTemplates folder Specify Report Template F7 Allelotype ko GeneExpression AllelotypeCorrection t2 GenoQCCluster m ke AssayTypeCount cenotypeArea Reportt For a description of each report si i ne port types AC 2 BestCallProbability PlateDefinition type see Appendix A Reports 2 CallProbability e PlateResult 9 DescriptionCount 2 PrimerAdjustment on page 137 sioe p Select a report type and click Open Files of type Report Template xml x Cancel Selecting a report type Select a template and then click Open If you selected a Genotype Area report or Allelotype Correction report a Get User Input dialog box appears Proceed to the next step
40. any assay group may be dropped into the navigation tree of the Edit Group tab view to create a reference assay group You may copy individual assays to different groups using the Copy button on the Edit Assay tab but this is intended for creating new assays based on modifications to existing assays See Copying Assays for Editing on page 14 for instructions SNP groups may be copied by opening them for editing and saving them back to the database with a different ID or into a different project MassARRAY Typer 3 4 Software 24 Doc 11546 R03 CO 060094 User s Guide for iPLEX and hME June 30 2006 Defining Assays Moving Copying and Deleting Groups Deleting Groups Review information in this section for instructions on deleting assay groups or SNP groups You cannot delete an assay or locked definition assay group if any of the assays in the group have been associated with an experiment plate An assay group that does not have design settings associated may be deleted as described below To delete assay groups 1 On the Assay Group tab right click an assay group and choose Delete Assay Group A confirmation dialog box appears 2 To delete the assay group click Yes For instructions on deleting assays see Editing Assays on page 14 To delete locked definition assay groups 1 Onthe Assay Group tab right click a locked definition assay group blue padlock icon and choose Delete Assay Group Individual ass
41. associate SpectroCHIPs and experiments 05 61 Removing Plates from the Selection Table llus 62 To remove a plate from the selection table 62 Changing Plate Entries 0 0000 cee ee 62 To change plate entries 000 ee 62 Loading SpectroCHIPs eysa irera eai amaaa i a E a A eh 62 Selecting the Number of Shots and Rastering Options 63 To select the number of shots and rastering options 63 Acquisition Parameters Values 00 00 eee eee eee eee 64 Turning on the High Voltage 0 cece 65 To turn on the high voltage llle 65 To automatically turn off the high voltage after the last SpectroCHIP 65 Setting SpectroCHIP Geometry Options 0 00 0c eee eee 66 To set SpectroCHIP geometry options lille 66 Starting an Automatic RUN ns 67 To start an automatic run 1 ee 67 Unloading SpectroCHIPs from the Genotype Analyzer 0 0 0 ccc tees 70 Stopping an Automatic Run 0 0 0 es 70 To stop an automatic run 1 2 ee 70 Saving Spectra o reserare diese detest ade bat iaede reverted es bee a dud 71 To save the most recently acquired spectra 0 0005 71 Doc 11546 RO3 CO 060094 v MassARRAY Typer 3 4 Software June 30 2006 User s Guide for iPLEX and hME Recalling Plate Data lllllsleleeleee II 71 To recall plate data 0 eee 71 A
42. b b b b b P P P P P P P P P P P O CO om C ER wh uuuuuuuuuuuuuuu well numbers pool numbers MassARRAY Typer 3 4 Software 34 Doc 11546 R03 CO 060094 User s Guide for iPLEX and hME June 30 2006 Defining Plates Creating Plates Figure 3 Template file defining one plex per well on a 96 well plate P 1 In this example P 2 template file each well P 3 of the 96 well plate 4 contains a different E plex indicated by the E 5 third data column P B which contains pool P 7 numbers P 8 P 9 P 10 P 11 P 12 P 13 P 14 P 15 P 15 P 17 P 18 P 18 P 20 P 21 P 22 P 23 P 24 Creating Plates Using Templates Once you have created a template file you can use it to create a plate To create a plate using a template 1 On the Assays tab right click an assay group and choose Create Plates for the collection Doc 11546 R03 CO 060094 35 MassARRAY Typer 3 4 Software June 30 2006 User s Guide for iPLEX and hME Defining Plates Creating Plates The Create Plates dialog box appears Create Plates b Customer Project Plate 1536_chip_test 3K Instrument Validation Matrix 96 Wells 384 wells 96 QC FT of SpectroChips 3 A Aging Markers AlleleSpecificExpression Template File Name Allelotypina Anna Glass Al Y April K Bea Ben CPRD FEAS Plate Name Prefix Plate Number Terminator Plate Size Ld ad i ll ll dd Carmen Ch
43. can be any combination of characters and numbers X Plate Type Choose the option for the C 96 Well 384 appropriate number of wells pun o on the plate Co oe Create a New Plate dialog box 3 Type the Plate ID using any combination of alpha or numeric characters Click the option for 96 Wells or 384 Wells 5 Click OK The new blank plate opens Creating Plates using Templates Creating Templates A plate template is a tab delimited text file that specifies the layout of a plate The text file may be created in Microsoft Notepad or Microsoft Excel as long as it is saved as a tab delimited file Templates are used to create plates in PlateEditor The syntax of a plate template file is as follows Well Number P Pool Number Type one well of data per line and separate each data entry well number P pool number by pressing the Tab key Example plate template files are shown in Figure 1 below through Figure 3 on page 35 Doc 11546 RO3 CO 060094 33 MassARRAY Typer 3 4 Software June 30 2006 User s Guide for iPLEX and hME Defining Plates Creating Plates Figure 1 Template file defining quadrants on a 384 well plate amp PT 384Quads txt Notepad OF xi File Edit Search Help 7 This example defines quadrants on a 384 well plate Quadrant regions are indicated by the third data column 1 in this example only a portion of the first quadrant is shown in this example h b b b b b b
44. can create a new assay group Assay and assign assays to it Groups Tip Drag and Drop To drag and drop an item click it and hold down the mouse button Then drag the cursor across the Screen and into the desired location Release the mouse button to drop the selected item into the desired location MassARRAY Typer 3 4 Software User s Guide for iPLEX and hME To edit a group 1 On the Assay Group tab right click a reference assay group green icon and choose Edit Assay Group The Edit Group tab appears on the right side of the AssayEditor window displaying the selected assay group a g 1 Edit Group ID Test Group 4 99N26891 344 Number of plexes 2 99N28092 282 Number of assays 12 99N36000 26 99N43578 305 Selected Plex Bae 2 Plex ID 1 4 99N19673 125 Number of assays 6 99N2095 85 rS 4 99N2133 149 come Mix es ACT l 99N26881 273 Min inter assay analyte separation 26 0 Da 4 99N42504 388 Min intra assay analyte separation 32 0 Da 4 99N43573 166 Selected Assay Assay ID 99N20280 403 Terminator Mix ACT Expected peaks 2 Analytes 2 Contaminants Min analyte peak separation 32 0 Da The navigation tree on the Edit Add Plex Remove Assay Empty Group tab lists the plexes and peen en assays in the assay group Auto re assign numeric plex IDs currently selected for editing SAVE to Assay Project TrainingDemo IV Validate plexes before saving Edit Group
45. cell and select True or False Configuring Plex Settings Using the Plex settings you can configure the plex colors and layout To configure plex colors In the left pane click PlateEditor then click Plex l 2 Doc 11546 R03 CO 060094 June 30 2006 In the right pane click on Colors to open the Color options Click on the plex 1 Plex through 12 Plex whose colors you want to define Click the button In the Color dialog box define the color and click OK 149 MassARRAY Typer 3 4 Software User s Guide for iPLEX and hME Configuring TyperAnalyzer To configure plex layout 1 Inthe left pane click PlateEditor then click Plex 2 Inthe right pane click on Layout to open the Layout options 3 Configure the layout as follows Automatically Save Layout Automatically save the current layout as the default when the program closes Click in the cell and choose True or False Use Docking Stickers Display docking stickers for easy window docking Click in the cell and choose True or False Configuring Sample Colors Using the Samples settings you can configure the color of the interactive plot active node To set the sample colors 1 In the left pane click PlateEditor then click Sample 2 Inthe right pane click on Colors to open the Color options 3 Click the button 4 In the Color dialog box define the color and click OK Configuring The following general settings c
46. e Success conservative moderate compared to aggressive low probability bad spectra calls e Conservative moderate calls compared to aggressive low probability bad spectra calls e Failure conservative moderate calls compared to aggressive low probability bad spectra calls In addition you can define the colors of the following e Above optimal threshold conservative moderate calls e Above success threshold and below optimal threshold conservative moderate calls e Below success threshold and above failure threshold conservative moderate calls e Below failure threshold conservative moderate calls To configure traffic lights 1 In the left pane click TyperAnalyzer 2 Inthe right pane click on Layout 3 Configure any of the following Optimal Threshold Set the value in percent that splits optimal and success conservative moderate compared to aggressive low probability bad spectra calls Click in the cell and enter the value Success Threshold Set the value in percent that splits success conservative moderate calls compared to aggressive low probability bad spectra calls Click in the cell and enter the value Doc 11546 RO3 CO 060094 153 MassARRAY Typer 3 4 Software June 30 2006 User s Guide for iPLEX and hME Quitting the Configuration Software Failure Threshold Set the value in percent that splits failure conservative moderate calls compared to aggressive low probability bad spectra calls Click
47. group You must clear those samples from the plates before you can edit the sample group After closing the message find the plates that use samples from the sample group and then clear those samples from the plates See Importing and Exporting Plate Table Information on page 42 After clearing the samples from the plates you can repeat this procedure to edit samples For information about clearing samples from plates see Clearing Wells on page 54 4 Make the changes you want to the samples To change a name SampleID or description double click it and make the changes you want To add a new sample enter its name and optional description in a blank row Note If you do not want to save the changes you made click Exit to close the Edit Sample Group dialog box and return to the PlateEditor window 5 When you are done making changes click Save 6 Click Exit to return to the PlateEditor window Deleting a You can delete a sample group only if none of its samples are currently assigned to a Sample plate If a plate uses any of the sample group s samples you must clear those samples Group from the plate before deleting the sample group To find out which plates use samples from the sample group see Importing and Exporting Plate Table Information on page 42 To clear samples from a plate see Clearing Wells on page 54 Note You must be logged in with database privileges in order to delete a sample group Contact your dat
48. has been incorrectly applied to a plate or well of a plate you can Data recall the plate data and copy it to a new plate with the correct assays applied Use ChipLinker to recall plate data You may recall plate data on the RT Workstation computer or on the server See Recalling Plate Data on page 103 Caution Data recall should be used on only genotyping and genotype area data Do not recall allelotyping data MassARRAY Typer 3 4 Software 136 Doc 11546 R03 CO 060094 User s Guide for iPLEX and hME June 30 2006 Appendix A Allelotype Report Reports The reports available in TyperAnalyzer and Genotype Analyzer are identical Reports of plate data are generated as a tab delimited output file xls that can be viewed in Microsoft Excel This appendix provides a description of the output files for each report For instructions on how to run a report in TyperAnalyzer see To generate a report on page 106 For instructions on how to run a report in Genotype Analyzer see To generate areport on page 132 Note Do no run Gene Expression and Genotype Cluster reports for iPLEX and hME Gene Expression and Genotype Cluster reports are not applicable to iPLEX and hME and do not produce meaningful results You must have an allelotyping license to create an Allelotype report The Allelotype report contains allelotyping data such as estimated frequencies of each allele The following table describes the contents of an Allelotype
49. have been processed through the iPLEX or MassEXTEND reaction to a SpectroCHIP See MassARRAY Nanodispenser User s Guide 6 Acquire spectra MassARRAY analyzer use the MassARRAY Typer Workstation to operate the analyzer or MassARRAY analyzer compact Acquire spectra from the SpectroCHIP containing your processed samples Spectral data is automatically sent to the MassARRAY Typer Server Use the SpectroACQUIRE module of Typer to operate the analyzer The SpectroACQUIRE module is available only on a Typer Workstation See Chapter 4 Acquiring Spectra on page 59 Use the TyperAnalyzer or Genotype Analyzer modules of Typer You can view spectra and genotype calls You Doc 11546 RO3 CO 060094 June 30 2006 Typer Server can also generate reports on the data 7 Analyze data Typer Workstation or i be Typer Client See Chapter 5 Reviewing Processed Data with TyperAnalyzer on page 75 or Chapter 6 Reviewing Processed Data with Genotype Analyzer on page 115 3 MassARRAY Typer 3 4 Software User s Guide for iPLEX and hME Introduction Procedure Overview Notes MassARRAY Typer 3 4 Software 4 Doc 11546 RO3 CO 060094 User s Guide for iPLEX and hME June 30 2006 Chapter 2 Introduction Assay Design Software For more information about Assay Design Software see the MassARRAY Assay Design Software User s Guide Assay Groups In the database an Assay
50. left pane which lists customers projects plates and experiments select the plate you want Then right click the selected plate and choose Show All Calls for plate name gt where plate name is the name of the plate you right clicked The results table lists all calls from all experiments on the plate Since all calls from all experiments are listed you may see multiple calls for the same well position You can sort the results table on any column by clicking the column s header at the top of the table The rows of the table are sorted on the column you select in ascending order Doc 11546 R03 CO 060094 119 MassARRAY Typer 3 4 Software June 30 2006 User s Guide for iPLEX and hME Reviewing Processed Data with Genotype Analyzer Using the Results Table Genotyping To view only the best call from the experiments on a plate You can have multiple experiments that is MassARRAY analyzer or analyzer compact reads on a plate As a result there may be multiple calls for the same well position one from each experiment For a specific well position you can choose to view only the call that has the highest score for all the experiments To do so complete the following steps 1 In the left pane which lists customers projects plates and experiments select a plate Then right click the selected plate and choose Show Collated Calls for plate name gt where plate name is the name of the plate you right clicked
51. made to the assay or certain required data is missing Review the Edit Assay tab and make the necessary changes Editing Assays You may edit existing assays those already in the left pane navigation tree or new assays on the Edit Assay tab Note If an assay has already been associated with a design or if it has already been run you may not edit it Instead you must copy the assay or assays to a new assay group and then edit the assay See Copying Assays for Editing on page 14 for details MassARRAY Typer 3 4 Software 14 Doc 11546 RO3 CO 060094 User s Guide for iPLEX and hME June 30 2006 Defining Assays Creating and Editing Assays To edit assays 1 2 On the Assay Group tab click an assay to select it In the right pane click the Edit Assay tab which displays the assay definition for the assay you just selected Make changes to the assay as needed The Assay Group box cannot be changed when editing an existing assay Other fields may not be editable if the currently selected assay belongs to a locked definition assay group or if it has experimental data associated with it Click SNP Manager to associate the assay with a SNP sequence The SNP Manager dialog box appears See Managing SNPs on page 19 for details on using this dialog box Once you associate a SNP with the assay the SNP ID and SUSID appear in the SNP Strand box If the SNP sequence has multiple SNPs defined click the SNP dr
52. may generally not be as high as those in spectra acquired by the XACQ software When taking multiple shots of a SpectroCHIP well using ACQUIRE the intensities in the spectrum of each shot are accumulated and then divided by the total number of shots The resulting spectrum that is saved to the MassARRAY database is an average of the spectra from the multiple shots When taking multiple shots using the XACQ software on the MassARRAY analyzer the spectra are accumulated also but not divided by the total number of shots Thus in general the intensities in spectra acquired by the XACQ software are greater than in spectra acquired by ACQUIRE 128 Doc 11546 R03 CO 060094 June 30 2006 Reviewing Processed Data with Genotype Analyzer Viewing Spectra Unsplitting the Screen You can hide the spectrum display by unsplitting the screen To unsplit the screen 1 Move the mouse pointer over the top edge of the spectra display The pointer will turn to a double line with arrows 2 Click and drag the border to the bottom of the window The spectrum display is hidden from view only the results table is shown Zooming If you want to see more details in a spectrum use the mouse to quickly zoom in or revert to the default size Use the Zoom toolbar buttons to horizontally zoom the spectra view This is handy when matching peaks to alleles To vertical zoom in e Click the Zoom In toolbar button amp To vertical z
53. multiple terminator mixes and minimum peak separation check the Validate Plexes Before Saving option If any plex is found to be invalid the Save process is canceled Note Selecting this option may cause the save process to take more time Do not check this option if you want to save time or if you want to save the assay group as it is currently defined 10 Click SAVE The assay group is saved to the selected assay project with the given ID If an assay group with this name already exists in the selected assay project a message box appears prompting you to either overwrite the existing assay group or not Plexes with Numeric Names When you drag and drop assay groups into the Edit Group tab duplicate numeric plex names are appended with a number to indicate which duplicate it is For example a plex named 5 with two duplicates would appear as 5 5 1 and 5 2 in the Edit Group tab to distinguish the three different plexes You can automatically reassign numeric plex names to remove duplicate names To reassign numeric plex names e On the Edit Group tab select the Auto re assign numeric plex IDs option so a check mark appears in the box All duplicate numeric plex names are reassigned Duplicate naming is removed and duplicate plex names are assigned new numeric names Doc 11546 R03 CO 060094 17 MassARRAY Typer 3 4 Software June 30 2006 User s Guide for iPLEX and hME Defining Assays Managing Assay Pr
54. of the following Automatically Save Layout Specify whether to automatically save the current layout as the default when the program exits Click on the cell and choose True or False Use Docking Stickers Display docking stickers to be used for easy window docking Click on the cell and choose True or False Cluster Plot Type Combo Define the width of the Cluster Plot Type combo Width box width on tool bar Click on the cell and enter a number Cluster Plot Split Line Color Specify the color of the cluster plot split line Click to open the Color box and define a color MassARRAY Typer 3 4 Software 152 Doc 11546 R03 CO 060094 User s Guide for iPLEX and hME June 30 2006 Configuring TyperAnalyzer Histogram Display Limit Set the Histogram assay display limit at startup Click on the cell and enter a number Graph Label Font Size Set the font size for the graph labels Click in the Control cell and enter a value between 0 5 and 1 5 Configuring Reports You can configure TyperAnalyzer keep processing files for debugging in a report To configure reports 1 In the left pane click TyperAnalyzer 2 Inthe right pane click on Layout then click Report 3 Click in the Debug cell and enter True or False Configuring the Traffic Lights You can configure the threshold success and failure values used by the Traffic Lights in the TyperAnalyzer You can define in percent where the following calls are split
55. other customer information see the steps under To edit an existing customer Extend Primer Adjustment MassARRAY Typer 3 4 Software 56 User s Guide for iPLEX and hME To edit an existing project 1 On the Plate tab select a project 2 Right click the selected project and choose Edit Project The Project dialog box appears 3 Make any changes you want Click OK to save the changes or Cancel to discontinue Customers To create a new customer 1 On the Plate tab select the root of the Plate tree labelled Customer Project Plate the root level of the navigation tree to highlight it 2 Right click the root level and choose New Customer OR click on the File menu and select New followed by New Customer The New Customer dialog box appears 3 Fillin the required fields and any optional fields you want 4 Click OK to save the customer or Cancel to discontinue To edit an existing customer 1 On the Plate tab select an existing Customer to highlight it 2 Right click the selected customer and choose Edit Customer The Customer dialog box appears 3 Make any changes you want Click OK to save changes or Cancel to discontinue Due to the inverse relationship between peak intensity and analyte mass it is recommended that extend primers in iPLEX assays are adjusted by concentration to address this issue The highest mass primer 8500 Da has a peak intensity 25 less than the average of
56. page 21 for details 8 Select an assay project from the Assay Project drop down list The new SNP and its SNP group will be saved to the selected assay project 9 Once the current SNP group contains all the copied edited and or new SNPs you want click SAVE to save it to the database Associating SNPs with Assays Note The Associate with Assay button is only available if you opened the SNP Manager dialog box by clicking SNP Manager on the Edit Assay tab New or existing SNPs may be associated with assays Before a new SNP may be associated with an assay it must first be added to a SNP group and saved to the database See To create a new SNP by modifying an existing SNP on page 22 for instructions To associate a SNP with an assay 1 With an editable assay loaded in the Edit Assay tab click SNP Manager The SNP Manager dialog box appears 2 Selecta SNP See Selecting SNPs on page 20 for instructions 3 Click Associate with Assay to associate the selected SNP with the assay being edited The SNP Manger dialog box closes In the main AssayEditor window the SNP ID and SUSID for the SNP appear in the SNP Strand box Doc 11546 R03 CO 060094 23 MassARRAY Typer 3 4 Software June 30 2006 User s Guide for iPLEX and hME Defining Assays Moving Copying and Deleting Groups Exporting SNPs SNPs and SNP groups may be exported to an Assay Designer file To export SNPs e In the navigation tree right
57. page 59 Use the assay definitions in Typer for the actual multiplexes Each well on the SpectroCHIP will yield no calls because there is no analyte only unextended iPLEX primers A peak should appear at the expected mass for each iPLEX primer in the mix Note At this point you should quality check the iPLEX primers and the primer mixes by reviewing the spectra There should be a peak at the expected mass of each primer A missing peak generally indicates poor primer quality or a primer missing from the mix An unexpected peak generally indicates poor primer quality or the addition of an unnecessary primer to the mix 7 Now run the Primer Adjustment report to determine if the primer mix should be adjusted If all peaks are at least 4596 the height of the highest peak they are acceptable If any peak is less than 45 the height of the highest peak add more of that primer The FRAC ADD column in the Primer Adjustment report indicates the amount to add as a fraction of the given primer s original volume Note Adjust the original primer mix not the primer mix sample in the microplate MassEXTEND To get optimal results run the Primer Adjustment report before preparing and processing the hME reaction This report indicates which primers require volume adjustment The peaks in the mass spectrum for a multiplexed reaction may not have comparable heights Variations in peak height may stem from 1 inconsistent oligonucleotide quality
58. plus sign to expand a project and view Click and drag the splitter bar the groups it to resize the window panes contains He ge 13 gy 14 View Design Summary Details Edit Assay Edt Group AssayEditor window Click a tab to make it active Exiting AssayEditor To exit AssayEditor e On the File menu choose Exit MassARRAY Typer 3 4 Software 6 Doc 11546 RO3 CO 060094 User s Guide for iPLEX and hME June 30 2006 Defining Assays Navigating AssayEditor Navigating AssayEditor Definition Assay Group A collection of assays not associated with any design parameters An assay in an assay group may not be edited or deleted from the group if the assay has already been run New assays may be added to an assay group Locked Definition Assay Group A set of assays associated with a set of design parameters and with a Locked SNP Group Assays within a Locked Assay Definition Group may not be edited or deleted Reference Assay Group A group of references to assays stored in the database Assays deleted from Reference Assay Groups are not deleted from the database they are merely deleted from the group The Navigation Tree The left pane of the AssayEditor window contains the navigation tree for the Assay Group tab Navigate to assay projects assay groups plexes and assays using the navigation tree Note The general term assay group is used in this chapter to refe
59. report Table 6 Allelotype Report Contents Column Description PLATE Plate Name WELL Well Number Sample Name SAMPLE Sample name specified in Plate Editor when you created the plate Assay Name ies Assay applied to the well Data Points Number of spectra acquired from the well Typically if the report is generated for a four SpectroCHIP set there should be 20 spectra 5 from each SpectroCHIP Each provides a data point for frequency estimates If the report is generated for a single SpectroCHIP there should be 5 data points Any value less than 20 for four SpectroCHIPs or 5 for a single SpectroCHIP means the full number of spectra were not successfully acquired frequency estimates are still calculated The estimates are based on the available data points DATA POINTS Number of Chips The number of chips from which data was acquired for the well Typically allelotyping is done with four SpectroCHIPs Each SpectroCHIP contains the same sample on corresponding wells If you generated the report for a single SpectroCHIP the number of chips should be 1 NUM CHIPS Average Frequency of Allele 1 AVE FREQ Weighted average relative frequency found from the data points for the lower mass allele 1 0 means 100 Doc 11546 R03 CO 060094 137 MassARRAY Typer 3 4 Software June 30 2006 User s Guide for iPLEX and hME Allelotype Correction Report Allelotype Correction R
60. row or use the Up and Down arrow keys Copying the Grid You can copy the Plate Data grid to Microsoft Excel To copy the grid 1 On the Plate Data tab click inside the grid Click any row 2 Onthe Edit menu select Copy Plate Data Grid 3 Open Microsoft Excel 4 Paste the grid data into Excel Press the CTRL and V keys simultaneously to paste the data Doc 11546 RO3 CO 060094 89 MassARRAY Typer 3 4 Software June 30 2006 User s Guide for iPLEX and hME Reviewing Processed Data with TyperAnalyzer Viewing Assay Details for a Well Viewing Assay Details for a Well e hidden The assay table contains information about the assays applied to a well Under each assay are sections of detailed information about the assay The sections are initially collapsed First in the plate diagram click the well about which you want information The assay table lists the assays applied to the well Click the plus next to an assay to view its details When you click the plus next to an 500277 assay details 546106 about the assay 662714 appear below it 90389 Example of an assay table DNA Control 19 DNA Control 19 DNA Control 19 DNA Control 19 DESCRIPTION 4 4 Conservative 4 Conservative TE 4 Conservative G 4 Conservative The following illustration shows an example of the assay details that appear O Analyte O Analyte O Analyte O Analyte O Probe O Calibrate
61. text file that contains the sample names and descriptions and click Open The sample names are imported into the New Sample Group dialog box Note For more information about using Microsoft Excel refer to its documentation or online Help system Importing You have the option of copying the well assay and plate information from the Plate and Table and pasting it into Microsoft Excel in order to manipulate its data Assuming the Exporting spreadsheet retains its original structure and saved in the proper format the data can be Plate Table imported back into the Plate Table within PlateEditor Files may be created from Information scratch or by copying existing plate data or a blank plate to establish the structure for the file To copy table data to Excel 1 Select the plate containing the contents to copy to Excel 2 Onthe Edit menu select Copy Table Grid This copies all of the well assay and group data contained in the Plate Table Start Microsoft Excel if not already open Right click the first cell and select Paste Manipulate the data as desired 9v Ue ee When complete use the Save As option to save the file in delimited text format Tab delimited Note The table data will not import unless saved in text delimited format only To import table data 1 Select the plate to contain the imported data 2 On the File menu select Import Into Grid 3 Atthe prompt select the text delimited file to import and
62. the same sequence but a different SNP ID Otherwise a SNP is identified as already existing in the database Opening SNP Manager To open SNP Manager e On the View menu choose SNP Manager Or if you are on the Edit Assay tab click SNP Manager to open the SNP Manager dialog box The SNP Manager dialog box appears i Assay Editor SNP Manager SNP ID 4N14 240 Locate Create select and edit SNPs M ProductDevelopment Rich test RickC Test SUSID S seqbm106 2098 amp BI Scott r here Sequence POAR GL LOLA Test zi amp B SpectroDESIGNER Validation SusanneMichael t Test E D Test2 t Test20 B Training 2 B TrainingDemo amp S mpvs tag 7 12plex amp j origGplex 30 20 gt OE ef 4N26 29 2f AN65 324 amp ANG7 40 Af 4N77 151 2f 99N1019 244 2f 99N1024 403 f 99N1051 284 2f 99N1055 140 2 99N1076 116 2f 99N1081 159 Af 99N1143 340 Strand length BJ 201 Number of SNPs 1 Add SNP to Group SNP Grp Members Empty SNP Group Size 0 SAVE to Assay Project TrainingD emo Data for the SNP group currently being edited is displayed here Close SNP Manager dialog box Doc 11546 R03 CO 060094 19 June 30 2006 MassARRAY Typer 3 4 Software User s Guide for iPLEX and hME Defining Assays SNP Groups Selecting SNPs SNPs may be selected for viewing in any of the following ways e By clicking them in the navigation tree e By clicking t
63. the table by a column in ascending order 89 To change the currently selected data 00000005 89 Copying the Grid 1 2 aake oia n o E eh 89 To copy tbe gid ios De ees RR oe a BA d UE Wee 89 Viewing Assay Details for a Well 0 00 00 eee 90 ASSAYINEQO 1 22 53 4c S LCLAE NC bU LE ADM ILLA C A 91 GALLIN FO uei ceu aee det qup eed eed s URL EE d met 91 PEAKINEQ 2 2 nouerat xs a Berri hr ESSA ELA TU OR eats LG en as 92 AREAINFO Genotype Area and Allelotyping only 93 FREQUENCYINFO Allelotyping only 0000 eae eee 94 Viewing Cluster Graphs 0 00 000 cee tees 94 Yield vS SKew ser hae Aden e ep ui Y xor a 95 Yield us tots ed tu AE Ed iV EM te LRL I rl DOE 95 Height ae e See qeX HU reb ge e eee Red eee 96 Log Height eai td ery ee PREND eno Ee E TI TRAE 97 Checking Assays for Quality llle 98 To view a cluster graph llsseleeeeleee eee 98 Manually Calling a Genotype in the Cluster Plot Pane 99 To manually call a genotype in the Cluster Plot pane 99 To select a group of points 00 00 99 Printing a Cluster Plot Graph 0 00000 cece eee 101 To print a Cluster Plot graph issllseesllelelesee 101 Viewing Histogram Graphs ssssssseese ees 102 To view a histogram graph 0 cee ee 102 Printing a Histogram llis eh 102 To print a histogram nh 102 Recallin
64. using standard dispensing conditions for hME reaction products It is recommended you dispense to two pads per primer mix For instructions on operating the Nanodispenser see the Dispensing MassEXTEND Reaction Products onto SpectroCHIPs chapter in MassARRAY Nanodispenser User s Guide Note If the entire SpectroCHIP is not used you may keep it for future use in adjusting MassEXTEND primer mixes Use only those pads on the SpectroCHIP that have not been used before you cannot reuse previously spotted pads Store SpectroCHIPs in their original packaging in a desiccator SpectroCHIPs may be stored for one week maximum 144 Doc 11546 R03 CO 060094 June 30 2006 Primer Adjustment Report Note Doc 11546 R03 CO 060094 June 30 2006 Acquire spectra from the SpectroCHIP For instructions on acquiring spectra see Chapter 4 Acquiring Spectra on page 59 Use the assay definitions in Typer for the actual multiplexes Each well on the SpectroCHIP will yield no calls because there is no analyte only unextended MassEXTEND primers A peak should appear at the expected mass for each MassEXTEND primer in the mix Note At this point you should quality check the MassEXTEND primers and the primer mixes by reviewing the spectra There should be a peak at the expected mass of each primer A missing peak generally indicates poor primer quality or a primer missing from the mix An unexpected peak generally indicate
65. well position You can sort the results table on any column by clicking the column s header at the top of the table The rows of the table are sorted on the column you select in ascending order To sort the results table MassARRAY Typer 3 4 Software You can sort the results table by any of its columns Clicking a column header at the top of the results table sorts the calls in ascending order by the column For example clicking the Well_Position column sorts the calls by their well positions in alphanumeric ascending order Clicking the same column header a second time sorts the calls in descending order by the column Clicking the column header again returns to sorting in ascending order and so on 120 Doc 11546 RO3 CO 060094 User s Guide for iPLEX and hME June 30 2006 Reviewing Processed Data with Genotype Analyzer Using the Results Table Genotyping To view information about a call 1 Onthe View menu select Call Info Dialog The Call Information Dialog dialog box appears n Call Information Dialog Calibration Spectrum Offset NSD Resolution Probability al Call Information Dialog dialog box If necessary move the Call Information Dialog dialog box to view the calls beneath it 2 Inthe results table click the call about which you want information The Call Information Dialog dialog box shows information about the call you click See the following illustration m Call Inform
66. 0 2006 To view only the no calls liliis 120 To view the no calls for all experiments on a plate 120 To sort the results table l ee ees 120 To view information about a call ce eee eee 121 To view a history of calls 0 2 eee 121 To view calibration and mass shift information 121 To hide calibration and mass shift information 121 Using the Results Table Genotype DX ecc 122 Using the Results Table Allelotyping lessen 122 Golor Gadirig ier sev ERE aA AI a 122 Data Columns i strii pa a a uaa tenes 122 Viewing Bad Spectrum ROWS 0 00 e cee eee eee lees 124 Viewing Data for all Experiments ona Plate leues 124 To view data for all experiments on a plate 0000 124 Viewing Detailed Assay Results 00 00 eee eee eee 124 To view detailed assay results 0 00 eee ee 124 Filtering the Results Table llle 125 To hide or show columns 0 00 cee ae 126 Printing the Results Table 0 0 tee 127 To print an entire table 0 ee eee 127 To print from the Print Preview window 0 200 eae 127 To print one row and the spectrum 2 000 ee 127 Viewing Spectra 0 0 ett 128 Splitting the Screen 0 tees 128 To split the screen 22 eee 128 Unsplitting the Screen 0 0 00 ccc eee 129 To unsplit
67. 000 c ete eee 139 Genotype Area Report 0 00 cece 140 Creating a Skew Correction File 0000 e eee eee eee 140 Skew Correction File 2 0 0 0 000 cc eects 141 Plate Definition Report 0 2 00 cee eee 141 Plate Result Report 000 ccc eee eens 141 Primer Adjustment Report lllsielelee eee 141 a CT 141 Adjusting iPLEX Primer Mixes 000 000 0020 n 141 To adjust iPLEX primer mixes sleeeeens 142 MassEXTEND exer an pata E ERE E eti VAR EE EIER 143 Adjusting MassEXTEND Primer Mixes 00000 cee ee eee 143 To adjust MassEXTEND primer mixes lessen 144 Appendix B Starting the Configuration Software 0 0 ccc eae 147 Configuring the JN l l MassARRAY Navigating the Configuration Interface liliis 147 To navigate to the settings you want to modify 147 Software Configuring Plate Editor llle 148 Configuring General Settings 0000 eee ee eee 148 To configure general settings llle 148 Configuring the Grid 0 0 ce tee 149 To configure the grid eee eee 149 Configuring Plex Settings lille 149 To configure plex colors llslselselele ee 149 To configure plex layout sss 150 Configuring Sample Colors 0 060 e eee eee eee ee 150 To set the sample colors 0 0 0 0 ee 150 Configuring TyperAnalyzer 0 000 cece eee 150 Configur
68. 009090909000900000000009 ece0990900909909000090000000000 Plate Layout New Sample Group dialog box Importing Sample Names and Descriptions from Microsoft Excel You can import sample names and descriptions from Microsoft Excel into the New Sample Group dialog box This feature is very useful in two situations e You want to prepare sample names and descriptions in Microsoft Excel and quickly import them into Typer e You already have a Microsoft Excel file containing the sample names and descriptions To import sample names and descriptions from Microsoft Excel Note It is assumed you are currently at the New Sample Group dialog box If you are not see the steps under To create a new sample group on page 37 Start Microsoft Excel 2 If you already have a Microsoft Excel file containing the sample names and descriptions open it If you do not have an existing file containing the sample names and descriptions enter them on a new worksheet Make sure the file includes SampleID and Description column headings If not create the column headings 3 Save the Excel spreadsheet as a tab delimited text file 4 Onthe Edit menu select Copy Doc 11546 R03 CO 060094 41 MassARRAY Typer 3 4 Software June 30 2006 User s Guide for iPLEX and hME Defining Plates Importing and Exporting Plate Table Information 5 In the New Sample Group dialog box click the Open Folder button In the Open dialog box select the
69. 0094 User s Guide for iPLEX and hME June 30 2006 Procedure Overview Table 1 Processing Samples Computer or Introduction Procedure Overview The following table is a very brief outline of the main steps in using the MassARRAY system to process samples N Step Instrument otes Use the Assay Editor module of Typer Typer Server An assay definition specifies the mass 1 Define assays Typer Workstation or peaks you expect to see in spectra and Typer Client how to interpret those peaks See Chapter 2 Defining Assays on page 5 Use the Plate Editor module of Typer A plate definition consists of a 2 Create a plate Typer Server representation of the physical d Typer Workstation or microplate of samples you intend to definition Typer Client process plus assays you want applied to each sample See Chapter 3 Defining Plates on page 29 3 Amplify samples In house amplification equipment Use your established amplification methods to amplify your samples For PCR guidelines see MassARRAY Liquid Handler User s Guide Process the iPLEX Use the MassARRAY liquid handler to add iPLEX or MassEXTEND reagents 5 MassEXTEND reaction products to a SpectroCHIP nanodispenser 4 or MassEXTEND Hors iud to your amplified samples and process reaction 3 the reaction See MassARRAY Liquid Handler User s Guide Use the MassARRAY nanodispenser to Transfer iPLEX or MassARRAY transfer your samples which
70. 08 A Coenatie GT S9N33I 2 137 A Coxenatie G3299N 3182210 A Coxenatie G3 2983925 353 A Conenatue 3229813182210 Acowenatue A Cox enatie GLi 29N1295 1 278 A Coxenatie Gitaa 1961 6 394 A Con enatie GU 29N12351 218 A Coxenatie GUI 9N 1987604 Acomenate G8I 39N23912 116 A Coxenatie GSI 39N16618 MT A Coematie G8I 99823912 116 A Coxenatie GSI 39N 1618 17 A Co enatie G HNLLE A Coxenatie G1 29N19191 206 A Coenatie G H29N IC Host AConenatue 040000000000 0 0 0 4040000000000 0 0 0 40 Page 1 M SeqData Field Display dialog Paint Count 318 3 Click the buttons at the top to Zoom In or Zoom Out view the previous or next page and close 4 Click the Print button located at the top of the window To print one row and the spectrum 1 On the File menu select Print Spectrum 2 Select the print options you want 3 Click OK Doc 11546 R03 CO 060094 127 MassARRAY Typer 3 4 Software June 30 2006 User s Guide for iPLEX and hME Reviewing Processed Data with Genotype Analyzer Viewing Spectra Viewing Once you have a results table open you can view the spectrum for each row i e well Spectra Split the screen to view spectra Splitting the Screen To split the screen l Drag this line to the point where you want to split the view and click the mouse button The result table will be above the line the spectrum display will appear below the line MassARRAY Typer 3 4 So
71. 094 87 MassARRAY Typer 3 4 Software June 30 2006 User s Guide for iPLEX and hME Reviewing Processed Data with TyperAnalyzer Viewing Spectra To save the spectrum to a file You can save an image of the spectrum as either a Windows metafile wmf or a bitmap bmp file 1 7 Right click the spectrum and select Export Dialog The Exporting lt assay name gt dialog box appears where lt assay name gt is the name of the assay Under Export select a file format Note Selecting Text Data Only saves text data values defining the spectrum graph For more information see To export spectrum graph data points below Under Export Destination select File Click Browse A Save As dialog box appears Choose a folder and enter a name for the file Wmf Windows metafile or bmp bitmap extensions are automatically added to the file name you type Click Save You are returned to the Exporting assay name gt dialog box Click Export To export spectrum graph data points You can copy the data points defining the spectrum graph as text to the Windows Clipboard or you can save them to a file If you copy the data points to the Clipboard you can then paste them from the Clipboard to a spreadsheet or graphing program If you save the data points to a file you can import them into another program 1 MassARRAY Typer 3 4 Software User s Guide for iPLEX and hME Right click the spectrum a
72. 2 0 81 Viewing a Results Table liiis 82 To view all calls 25e ERE knee ene aeuo 82 Viewing Spectra 2 ssec eee dees pex eee Ee xd bue da EA ee lad 83 Viewing the Spectrum from a Well 0000 cece eee eee eee 83 To view a spectrum showing all assays for a well 83 Using the Spectrum Display Cross Hairs lille 84 Zooming the spectrum display 0 0 00 cece eee 85 To zoom the spectrum display 000 c ee eee eee 85 To un zoom the spectrum display 20 0 cee eee eee 85 Viewing the Calibration Spectrum 0000 0 cece eee 85 MassARRAY Typer 3 4 Software vi Doc 11546 RO3 CO 060094 User s Guide for iPLEX and hME June 30 2006 To view the calibration spectrum lille 85 Adjusting the Spectrum Display 00 00 cece eee eee 85 To adjust spectrum display 00 e eee ee 86 Printing a Spectrum Graph 0 00000 eee 87 To print a spectrum graph sssaaa eee 87 Exporting a Spectrum 0 0 0 tetas 87 To copy a spectrum to the Clipboard 0 00 eee 87 To save the spectrum to a file 0 0000 eee eee 88 To export spectrum graph data points 2000000 eee 88 Plate Data Tab Options 00 0 cece tees 89 Manually Calling a Genotype 0 0 cece ee 89 To manually call a genotype in the results table 89 Selecting and Sorting Data 89 To sort
73. 2 applied to the well B Moderate kK Je e ee 256655 Low Probability Le ee 284629 cond Gc B Moderate EO H H 33146 con2 A Conservative ER al mas con NNO el af Ess Plate Data lise Well Data Example of a plate diagram and assay table The check boxes next to the assay names control how Example of ASSAY ID wells are color coded in the plate diagram The wells are 13526 assays names in color coded according to all of the selected assays t EE cono table selected assays are checked If you clear the check box Hed 198163 for one of the assays then the wells are color coded according to only those assays that remain checked Check boxes De select assays by clearing the check box to filter them out of the plate diagram For instance you may have a failed assay that results in weak calls for all wells Filter out the failed assay by de selecting it The wells will be color coded according to the remaining selected assays Also use the check boxes to view the strength of the calls for individual assays by de selecting all but the assay in question The wells will be color coded according to only the selected assay You can click on a well or use the arrow keys to change the currently selected well The shape of each well indicates its relationship to the currently selected well The shape of each well in the Traffic Light pane indicates the following e Squares indicate wells th
74. 282209 C 6617 300000 998 044321 17 028181 268 523247 O 6273 100000 0 526177 0 011341 L 6617 300000 0 473823 0 011341 Doc 11546 R03 CO 060094 June 30 2006 Reviewing Processed Data with TyperAnalyzer Viewing Assay Details for a Well AREAINFO Genotype Area and Allelotyping only This part lists information about the peaks in the spectrum Example of LJBREBINFOSGSES E REAA ESSRESUEHIICNI AREAINFO O 5999 900000 66 594350 45 111770 268 733247 O 6273 100000 1108 321027 17 961267 282 752209 tail Y 6304 100000 80 410700 43 494948 275 282209 idus 6617 300000 998 044321 17 028181 268 523247 a A EE Expected Area under Area may be Peak resolution massofa X thecurve of this amount peak the peak ASSAY ID SAMPLE ID CALL DESCRIPTION 6273 100000 O Analyte p 6617 300000 O Probe C11 48170 P 5999 900000 O Calibrated 1 000000 0 177160 i T O 5999 900000 5 926464 2 970775 0 286040 Peaks are identified by 0 6273 100000 115 235081 59 692560 1 000000 mass To find which 16304 100000 4 233089 2 200810 0 209770 analyte contaminant or 5617 300000 105 226 56 737394 1 000000 unextended primer a peak z represents match up the oO 5999 900000 66 594350 45 111770 268 733247 mass values For example d 1108 321027 17 961267 282 752209 gt A Saa 50 410700 43 494948 275 282209 this peak is for the G allele P 998 044321 17 028181 268 523247 O 6273 100000 0 526177 0 011341 6617 300000 0 473823 0 011341
75. 2893 l Right click the genotype row 1 3 SPS GA G 35170 A menu opens with the available 4 SP5 6A 33383 A genotypes see illustration 5 SPS EN a ee 6 SP5 CA 44323 t SPS G 47587 2 Select the proper name for the genotype E SP5 T 8 552545 that you want to call a SP5 GA G9 76 263848 7 10 SPS GA G10 83 238314 The genotype name is replaced in the a ss A 611 91 221404 table and underlined in the spectrum Manual calls are labeled User Call Viewing a Pie View the table s data graphically using the pie chart feature Chart This is the number of From the drop down list select times the genotype the data you want to view was called in the chart Pie Chart ASSAY ID G1 15 2 G2 28 260356 G3 38 235170 G4 43 238383 G5 48 241278 GB 52 244323 G7 57 247587 ne er arranr Click to print the chart To view a pie chart of selected data Doc 11546 R03 CO 060094 June 30 2006 Select the proper plate 2 From the View menu choose Pie Chart The Pie window opens initially showing a blank screen 3 From the drop down list select the type of data you want to view The data appears in the dialog box 4 If you want to print the results click the Print button 5 When finished viewing click OK 135 MassARRAY Typer 3 4 Software User s Guide for iPLEX and hME Reviewing Processed Data with Genotype Analyzer Recalling Plate Data Recalling Plate If you find that an assay
76. 42602 1 1 same experiment or plate M Lab Show Collated Calls for 042602 1 1 Caution The report will include data H E 47698 ConDN Show AllNOCalls for 042602 1 1 Do not select anything above for all of the chips under the ad e nM Generate Report for 042602 1 1 the plate level This would experiment or plate ic For example a Select experiments under 2 report generated on different plates Generating a amp 3 experiment 042602 report on experiments under amp 4 DE 7 1 1 will include data different plates does not 042702 1 1 FA create valid report data 042902 1 1 GA trom chipsi m amp 48170 ConPool o p and 4 Generating a report on an experiment tin most cases when LETTRE a ez o oe El generating an Allelotype or fe tt ve sp Show Collated Calls For 48170_ConDNA1 96_1 Allelotype Correction report EEB ala 0x L BZ Bl show arocals for 48170_ConDNAI 96 1 you should generate the H amp Gaeta Generate Report for 48170_ConDNA1 96_I report on the experiment Mi which may contain multiple pod chips Allele frequency wan estimates will be based on statistical analyses done on ies lf EE E the data from all identical Stow AI NOCals for READER 959 plate 48170 ConDNA1 chips You may generate an Generate Report for HiE AF HLATE 4 SP52 96 will include data Allelotype or Allelotype from chips 1 12 Correction report on an A individual chip
77. 73 100000 115 235081 59 692560 1 000000 Note For a bad part of assay C 6304 100000 4 233089 2 200810 0 209770 details 16617 300000 105 226049 56 737394 1 000000 spectrum no PEAKINFO p SS ee information is available Expected Intensity of Signal to noise Level of confidence mass of a a peak ratio ratio of peak that a peak is the peak i e height height to local actual expected along the noise peak expressed y axis as a probability 1 0 means 100 ASSAY ID SAMPLE ID DESCRIPTION J O Analyte A CAGAACACTTAGCACCCCACTG 6617 300000 LJ Analyte AGAACA AGCA ACC 62 3 100000 O Analyte GA CAGAACACTTAGCACCCCACC 6273 100000 O Analyte GA CAGAACACTTAGCACZCCACTG 6617 300000 O Probe C11 48170 P CAGAACACTTAGCACCCCAC 5999 900000 O Calibrated CALL GA rphic Peaks are identified by mass To find which analyte contaminant or unextended primer a peak represents match up the mass values For example 1 this peak is for the A allele LI 1 144805 0 177160 1 000000 O 5999 900000 O 6273 100000 O 6304 100000 6617 300000 5 926464 115 237081 433089 105 226049 2 970775 59 692560 2 200810 56 737394 0 286040 1 000000 0 209770 1 000000 O 5999 900000 66 594350 45 111770 268 733247 MassARRAY Typer 3 4 Software User s Guide for iPLEX and hME 92 O 6273 100000 1108 321027 17 961267 282 752209 O 6304 100000 80 410700 43 494948 275
78. 87 88 89 30 31 92 93 94 95 96 P Starting from well B1 samples would be applied as shown here the numbers are sample names oa RTs mw w e STATES TR TT STTRTRTRTETARTE A A 2 3 4 5 6 7 8 3 10 11 12 Ee SE 14 15 16 17 18 19 20 21 22 28 24 E Fis 26 27 28 28 30 31 32 38 34 35 36 e H 38 39 40 E 42 43 44 45 46 47 48 ell J 48 50 81 52 53 54 55 56 57 58 59 60 IK L t 62 63 64 65 66 67 68 69 70 n 72 jit N73 74 75 76 7 78 78 80 at 82 83 84 E p 85 86 87 88 E 90 a 32 33 94 95 96 Starting from well B2 samples would be applied as shown here the numbers are sample names o1 d2 os 04 05 06 oz os 09 q0 14 42 43 14 15 16 17 18 19 20 24 22 23 24 A v B l 2 3 4 5 5 7 8 9 10 11 12 ei D 38 14 1 406 a7 1 49 w A 2 3 4 E F 25 26 27 28 29 30 31 32 33 34 35 36 c H 37 38 39 40 41 42 43 44 45 46 47 48 d 49 50 51 52 53 54 55 56 57 58 58 60 K 61 62 63 64 65 66 67 68 69 70 71 72 M N 3 n T7 7 7 B 7 9 8 82 8 84 o P 85 86 87 88 89 90 9t 92 93 94 95 96 7 Inthe plate diagram right click the well from which you want to start applying the samples and choose Apply MassARRAY Typer 3 4 Software 52 Doc 11546 R03 CO 060094 User s Guide for iPLEX and hME June 30 2006 Defining Plates Applying Sample Group Mapping The sampl
79. CO 060094 65 MassARRAY Typer 3 4 Software June 30 2006 User s Guide for iPLEX and hME Acquiring Spectra Setting SpectroCHIP Geometry Options Setting SpectroCHIP geometry refers to the format whether calibrant wells are used and the SpectroCHIP order of processing the sample wells See the following for detailed instructions on setting Geometry SpectroCHIP geometry options Options To set SpectroCHIP geometry options 1 Onthe Auto Run Set Up tab under Geometry Auto Teach Geometry should be checked When this option is checked the positioning of each SpectroCHIP in the SCOUT plate is checked ACQUIRE can correct for small variations in the positioning of each SpectroCHIP 2 Check the Use Calibration Wells option if you want the calibrant wells on the SpectroCHIPs to be used If you choose to use calibration wells make sure calibrant has been dispensed onto at least one of the calibration wells on the SpectroCHIPs If you check Use Calibration Wells and there is no calibrant on the calibration wells ACQUIRE will automatically use the last good calibration values MassARRAY Typer 3 4 Software 66 Doc 11546 R03 CO 060094 User s Guide for iPLEX and hME June 30 2006 Acquiring Spectra Starting an Automatic Run Starting an To start an automatic run click Start Auto Run on the Auto Run tab See the following Automatic for detailed instructions Run To start an automatic run 1 Int
80. Chip Linker if you have MassARRAY Tracking this is not necessary 3 Load SpectroCHIPs 4 Select the number of shots and raster positions 5 Turn on the high voltage 6 Set SpectroCHIP geometry options 7 Start the automatic run 8 Unload SpectroCHIPs The remaining sections in this chapter cover each of these main steps in detail Follow the instructions in the sections in the order in which they appear Doc 11546 RO3 CO 060094 59 MassARRAY Typer 3 4 Software June 30 2006 User s Guide for iPLEX and hME Acquiring Spectra Starting the MassARRAY RT Software Starting the For information on starting the MassARRAY RT software see the user s guide for the MassARRAY analyzer that you are using as described at the beginning of this chapter RT Software On a Compact Workstation to start the MassARRAY RT software e On the analyzer computer double click the MassARRAY RT MassARRAY RT icon icon on the Windows desktop Using Chip Use the Chip Linker module to associate SpectroCHIPs with experiments to be processed Linker to This module generates the input files required by MassARRAY Typer RT Workstation for Associate Chips processing the SpectroCHIPs with Experiments ET Opening Chip Linker To open Chip Linker 1 In the MassARRAY folder on the Windows desktop double click the Typer 3 3 folder or the RT Workstation folder to open it Open either folder Each one contains a copy of the Chip Linker sho
81. Edit Group tab To add to the group drag and drop assays plexes or assay groups from the Assay Group tab into the Edit Group tab navigation tree Assays must be added to an existing plex in the assay group currently selected for editing Click Add Plex to add a new empty plex to the assay group 16 Doc 11546 R03 CO 060094 June 30 2006 Defining Assays Editing Assay Groups 4 Drag and drop to add assays to the new plex As assays are added to a plex the Selected Plex box provides information about the termination mixes and the minimum peak separation between any assay analyte and any other expected assay mass peak in the multiplex A multiplex is invalid if there is more than one common terminator mix for the assays or the minimum separation is too small relative to resolving the mass peaks for iPLEX or MassEXTEND spectra In this case an exclamation point appears next to the display indicating the multiplexing of the assays may be invalid 5 To remove an assay from a plex select it in the navigation tree and then click Remove Assay 6 Toremove a single plex select it in the navigation tree and then click Remove Plex To remove all the plexes from the currently selected assay group click Empty Type the name of the assay group in the Edit Assay Group ID box or select an assay project from the to Assay Project drop down list The assay group will be saved to the selected assay project 9 To check for
82. Group is synonymous with a panel of assays and can represent any logical grouping of Assays For example an Assay Group can group all the Assays relevant to a particular disease e g Hypertension or to a particular project or to a particular gene or amplicon The goal is to keep the Assay Group definition general enough so it can be used for any of these groupings Doc 11546 RO3 CO 060094 June 30 2006 locked definition assay group y fj orig plex 30 20 Defining Assays The AssayEditor module is used to define assays and store them in a SEQUENOM database In addition to manual editing of assays AssayEditor allows for the importing and exporting of assay groups along with the associated SNP sequences and design parameters in accordance with the MassARRAY Assay Design Software Assay Designer file formats AssayEditor also allows for the manual creation of subsets of multiplexed assays called reference assay groups This chapter covers the following information Basics of AssayEditor See Multiplex and Uniplex on page 5 through Exiting AssayEditor on page 6 for information e Working with Assays See Searching for Assays on page 10 through Editing Assays on page 14 for information e Working with SNPs See Managing SNPs on page 19 through Deleting SNP Groups on page 24 for information e Working with groups See Moving Copying and Deleting Groups on page 24 through Expor
83. POOLI er Polymorphic v le gt Ready Junknown 3 3 0 174PLDX 09 16 2005 16 47 41 TOTAL 4600 CALL NOCALL Example of Allelotyping MassARRAY Typer 3 4 Software 76 Doc 11546 RO3 CO 060094 User s Guide for iPLEX and hME June 30 2006 Reviewing Processed Data with TyperAnalyzer Starting TyperAnalyzer Note To perform allelotyping you must have an allelotyping license Contact SEQUENOM Inc for information Starting To start TyperAnalyzer TyperAnalyzer 1 In the Typer window click TyperAnalyzer td MassARRAY Typer File Application Help Assay Plate Genotype Editor Editor Ang Analyzer Click the TyperAnalyzer button to start TyperAnalyzer 2 Inthe Connect To Database dialog box enter your user ID password and a data source name and click OK The TyperAnalyzer window appears The The TyperAnalyzer window includes the following panes TyperAnalyzer e Cluster Plot Window stolis e Spectrum Histogram e Traffic Light e Plate Data e Well Data Data among each of the panes are always synchronized in real time For example clicking on a well in the Traffic Light pane changes the display information or currently active selections in the Plate Data and Cluster Plot panes Many attributes of the TyperAnalyzer window can be modified from their defaults For a detailed description of how to customize TyperAnalyzer see Appendix B Configuring the MassARRAY Software on page 147 Cluster Plot Pane The Cl
84. QCCluster B tcl p p y y h Documents 5 allelotypeSkew tcl S Genotype tel skew correction file named erase GenotypeArea xml 1 i i i BestCallProbability tcl 2 PlateDefinition xml m SkewCorrectionFile located in the Desktop 2 BestCallProbability xml K2 PlateResult xml Select SkewCorrectionFile ReportTemplates folder However S calProbabilty xml 59 PrimerAdjustment xml you may create and use other skew 9 CallResult xml E PrimerAdjustment A tcl I erm Ed vssver scc correction files To create a skew My Documents 39 DescriptionCount xmi 2 GeneExpression xml correction file select a folder type a ys Bl cenctspression A R After selecting j j 5 GeneExpression A tcl h AIR the A s The My Computer eee SkewCorrectionFile j e wi x iis po e d z i click OK actors rom t IS enotype rea My Network File name SkewCorrectionFile xls i i Pl report will be saved to it octo TEA Note If this is the first time you are running a Genotype Area report SkewCorrectionFile does not exist Select the ReportTemplates folder and type SkewCorrectionFile in the File name box When you click OK a skew correction file named SkewCorrectionFile will be created From this point on you should use this skew correction file 3 In the Save As dialog box select a different folder type a file name and click Save Default Name Soren O Rees SSS A default report file name is in the Tes eam form custom
85. Results Table Printing the The information in the table can be printed Results Table To print an entire table 1 From the File menu choose Print Table The Print dialog box opens 2 Select the appropriate print options 3 Click OK To print from the Print Preview window 1 Select the plate whose information you want to print 2 From the File menu choose Print Table Preview A preview window appears Chip 021402 Experiment 1 Iwo Page Zoomin SAMPLE D CALL ASSAY D WELLPOSMION DESCRIPTION CALIBRATION Ci e OTENREUET Ls Keenan cun cun cun cm can cm cm cin cu cui ce cut cun cun cin cm cem cm cm cun cun cui ceu cm cm cm cm cun ceu cui cu cu cun cin cun cm cm cm cm cui cun cea 4 GHN 19191 204 A Conenatue G H29N UC Hse A Coxenatie GizoNISISI 0 A Coematie 61 93582309 A Coxenatie GIONI 2 131 A Coenatie GT 29NIS amp 2 308 A Coxenatie G1 20N331 2 131 A Coxenatie G3 99N3182210 A Coxenatie 329983925 353 A Conematie G32 99N3182210 A Coxenatie 329982925 363 A Coceatie GU 29N1255 1218 A Coxenatie GLI 29N1981 6 394 A Coxenatie GUH39NI255 1 218 A Co eate GLI 29N 1981 6 394 A Coxenatie G8I 29823912 116 CAgyrecce Ger 2ON 1661 147 CAggressue G8I 29N23912 116 A Cox enatie G8I 99N 618 17 A Coxenatie GNIL A Coenatie G1 29N19191 206 A Coxenatie GNIL A Coienatie G1 s9N19191 206 Acomename GT 20N31582 308 Acowenatue G1 29NST 137 A Coxenatie GI 20N31582 3
86. Tocreate a new sample group see To create a new sample group below e To add a sample to an existing sample group see Editing a Sample Group on page 44 To create a new sample group 1 Ifitis not currently running start the PlateEditor For instructions on starting the PlateEditor see Opening the PlateEditor on page 29 Doc 11546 R03 CO 060094 37 MassARRAY Typer 3 4 Software June 30 2006 User s Guide for iPLEX and hME Defining Plates Creating Samples 2 Inthe PlateEditor click the Sample tab 99922999 85 Sse False True No Sample 1D CROSS No Sample ID Color IH 150 150 150 239883 EWUSSWE zzz zou SS e B ay Group id Projectid Sample id Description Order No Sample Group id Click the Samples tab 3 Click the plus symbol next to Sample Sample Group Sample Sample Group appears 4 Right click Sample Group and choose Add New Sample Group The dialog box to add a sample appears ig Ba Group Id Sampleld Description 2 3 4 mi B if 8 9 E ES 2o New Sample Group dialog box 5 In the Group ID box type a name for the sample group This name appears in the tree list of the PlateEditor to identify the sample group Sample group names can have a maximum of 20 characters and must not contain any single quote marks 6 Foreach sample in the sample group type a name in the SampleID column and an optional description i
87. Undo Zoom You are returned to the top zoom level that is where no zooming is applied Viewing the Calibration Spectrum You can view the calibration spectrum for the chip in the Spectrum pane if it is available To view the calibration spectrum e On the View menu select Display Calibration Spectrum or click the Display Calibration Spectrum button in the tool bar The current well spectrum will be replaced by the chip calibration spectrum The calibration spectrum display is temporary Any changes that cause the well spectrum to be changed will replace the calibration spectrum with the corresponding well spectrum in the Spectrum pane Adjusting the Spectrum Display The spectra are not shown to the same scale along the y axis intensity In one spectrum the y axis may go up to 500 In another it may only go up to 350 Each spectrum is displayed with the y axis scaled to best show the spectrum You can choose to view all spectra scaled to the same maximum y axis value allowing you to better judge the relative intensities of peaks in different spectra Doc 11546 R03 CO 060094 85 MassARRAY Typer 3 4 Software June 30 2006 User s Guide for iPLEX and hME Reviewing Processed Data with TyperAnalyzer Viewing Spectra MassARRAY Typer 3 4 Software User s Guide for iPLEX and hME To adjust spectrum display 1 On the View menu select Spectrum Display The Spectrum Display dialog box appears Spectrum Di
88. a Spectrum y PER p Use the Es split View tool to split the view For more information about splitting the view see Splitting the Screen on page 128 2 On the toolbar click L Show Calibration Spectrum tool The calibration spectrum appears Viewing All You can view all spectra in succession similar to a slide show Spectra To view all spectra in succession 1 If you have not done so already split the view to see spectra Use the Bs spit View tool to split the view For more information about splitting the view see Splitting the Screen on page 128 2 On the toolbar click nmi Auto Play tool The Auto Scroll Rows Dialog appears See the following illustration Auto Scroll Rows Dialog Start Row 1 End Row 318 Time Interval 2 seconds Cancel Auto Scroll Rows Dialog 3 In the Start Row box type the row from which you want to start viewing the spectra 4 Inthe End Row box type the last row for which you want to view spectra 5 Inthe Time Interval box type the amount of time in seconds you want Typer to wait before displaying the next spectra It is recommended that you choose a time interval between 2 to 30 seconds MassARRAY Typer 3 4 Software 130 Doc 11546 R03 CO 060094 User s Guide for iPLEX and hME June 30 2006 Reviewing Processed Data with Genotype Analyzer Generating Reports 6 Click OK The spectra are displayed Note Depending on the number of cal
89. a and copy it to a new plate with the correct assays applied Note This feature only applies to MassARRAY CALLER used with Typer 3 3 If you are using CALLER with a different version of Typer you cannot recall plate data For assistance contact Sequenom Customer Support toll free at 1 877 4 GENOME To recall plate data 1 Onthe Windows desktop double click the MassARRAY folder to open it 2 Double click the Typer 3 3 folder or the RT Workstation folder Open either folder Each one contains a shortcut icon for Chip Linker 3 Then double click the Chip Linker icon to start the application The MassARRAY Typer Chip Linker window appears Doc 11546 R03 CO 060094 71 MassARRAY Typer 3 4 Software June 30 2006 User s Guide for iPLEX and hME Acquiring Spectra Autoteaching 4 In the MassARRAY Typer Chip Linker window click a plate in the selection window A plate is selected when its row in the selection table becomes highlighted 5 Click Recall The Select Recall Chip dialog box appears 6 Select the SpectroCHIP to be recalled 7 Click Recall Note If the Recall button is grayed out MassARRAY Caller is not set to use Typer 3 1 For assistance contact Sequenom Customer Support toll free at 1 877 4 GENOME The recall process may take a few moments to complete Once the recall is completed you can return to using Chip Linker Autoteaching When autoteaching is turned on recommended the positioning o
90. a from all SpectroCHIPs run for the plate When viewing all chips for a plate you can sort the results table by well position The same well positions on all chips will be grouped together Since the same well positions on all chips i e SpectroCHIPs contains the same sample you can compare the individual results from each SpectroCHIP To view data for all experiments on a plate e In the left pane which lists customers projects plates experiments and chips click a plate to select it Then right click it again and choose Show All Calls for plate name gt where plate name is the name of the plate you right clicked The results table lists the data from all chips on the plate You can sort the results table on any column by clicking the column s header at the top of the table The rows of the table are sorted on the column you select in ascending order To sort data by well position click the WELL POSITION column header Note Bad Spectrum rows are hidden from view To view these rows click the No Calls tool For more information see Viewing Bad Spectrum Rows above Viewing Detailed Assay Results For any well you can view detailed assay results such as peak heights peak areas and signal to noise ratios To view detailed assay results Onthe View menu select Call Info Dialog MassARRAY Typer 3 4 Software 124 Doc 11546 R03 CO 060094 User s Guide for iPLEX and hME June 30 2006 Reviewing Processed
91. a given well 63 MassARRAY Typer 3 4 Software User s Guide for iPLEX and hME Acquiring Spectra Selecting the Number of Shots and Rastering Options if three raster positions in a row fail then remaining raster positions on that well are skipped Use the Smart Raster Properties button to set the criteria that determines when rastering will be disabled Typically you should use the default settings of two failed wells and three failed raster positions However if you want to change the settings see the following illustration After this number of raster positions Awaba SL x fail in a row the remaining positions will be skipped for a well Failure is defined by Failure level _ gt Number of failures in a single well Remove assay from raster criteria after n failures A raster position or well has failed if the call from the acquired spectrum is at or below this level If this number of wells fail in a row Number of failures across wells 2 rastering will be disabled for roe Il il had subsequent wells until a spectrum is _ Failure level 1 Bad Spectrum successfully acquired At that point Successlevel 4 Moderte m rastering is re enabled Failure and success are defined by Failure level and Success level Setting smart rastering properties A well is considered successful if the call from the acquired spectrum is at or above this level After rastering has been disable
92. a green assay group icon Reference assay groups may be edited and references to additional assays may be added to them When you edit an assay in a reference assay group it alters the contents of that assay globally Meaning if the assay is referenced in multiple assay groups all instances of the assay are affected by the edits Typically a reference assay group contains a subset of assays from definition assay groups or it is used to manually create multiplexes of assays within AssayEditor for the purpose of defining plates in Plate Editor To view items on the Assay Group tab Click the plus symbol beside any item on the Assay Group tab navigation tree to display its contents To rename items on the Assay Group tab 1 Doc 11546 RO3 CO 060094 June 30 2006 Click a project assay group plex or assay on the Assay Group tab so it becomes highlighted Then click it again so a blinking cursor appears at the end of the item s name Type a new name and then press the Enter key 7 MassARRAY Typer 3 4 Software User s Guide for iPLEX and hME Defining Assays Importing Assays Importing Assays A message appears asking you to confirm the name change AssayEditor Warning Changing a plex ID may make Finding this plex difficult For another user or with respect to previously generated reports H Cancel Example confirmation message box for a renamed plex 3 Click OK to confirm the name change
93. abase administrator for information To delete a sample group 1 In the PlateEditor click the Sample tab 2 If necessary expand the tree list to find the sample group you want Click the plus symbol next to a node to view its contents 3 Click the sample group to highlight it Then right click the sample group and choose Delete Sample Group Doc 11546 RO3 CO 060094 45 MassARRAY Typer 3 4 Software June 30 2006 User s Guide for iPLEX and hME Defining Plates Applying Assays and Samples to Wells If the following message appears click OK to dismiss it If this message does not appear skip to the next step now PlateEditor o You do NOT have privileges to delete sample group Test This message appears because there are plates that use samples from the sample group you want to delete To delete the sample group you must first clear its samples from any plates using them To find out which plates use samples from the sample group see Importing and Exporting Plate Table Information on page 42 To clear samples from a plate see Clearing Wells on page 54 After you have cleared its samples from plates repeat this procedure to delete the sample group You are asked if you are sure you want to delete the sample group Click Yes The sample group is deleted Applying With a plate selected apply plexes or individual assays and samples to the wells by Assays and highlighting the specific plexes ass
94. accordingly from the time of installation and for a period of one 1 year thereafter so long as the MassARRAY System remains unchanged and in the original condition supplied by SEQUENOM SEQUENOM warrants that the MassARRAY Kits will be free from defects in materials and workmanship and will conform to SEQUENOM s specifications and perform accordingly up to the expiration date specified on the MassARRAY Kit packaging so long as the MassARRAY Kits are stored according to specifications and remain unchanged and in the original condition supplied by SEQUENOM The foregoing warranty does not include periodic maintenance or calibration recommended for some MassARRAY Products This warranty does not apply to defects resulting from improper or inadequate maintenance or calibration by the USER defects resulting from hardware software interfacing or supplies provided by parties other than SEQUENOM defects resulting from unauthorized modification maintenance or repair or improper use or operation outside of SEQUENOM s specifications for the MassARRAY Products or by personnel not authorized by SEQUENOM and defects resulting from abuse negligence accident loss or damage in transit In addition this warranty does not apply to damage due to 1 environmental conditions at the site of installation 2 operator failure to perform standard operating 155 MassARRAY Typer 3 4 Software User s Guide for iPLEX and hME procedures and routine mainte
95. alls 0 000 cee eee 13 Viewing Grid Colors cepe eek ee eee a E ee a ee ea eed 13 Doc 11546 RO3 CO 060094 MassARRAY Typer 3 4 Software June 30 2006 User s Guide for iPLEX and hME To turn off visual aid colors 2 2 eene 13 Copying Assays sss has 14 Copying Assays for Editing 00 tenes 14 To edit assays associated with a design 0e cee eee 14 Editing ASSAYS sce eSI TN BR BAL Pt 14 To editiassays x eee ae eae ee da eta es rad a vats 15 To edit description text 0002 cee 15 Deleting Assays 0 ec eee 15 To delete an assay llle 15 To view design summary 00 cee eee eae 16 Editing Assay Groups 00 0 c cette 16 Ioedita group se seated Sa ee Sa ek ie te 16 Plexes with Numeric Names 00000 0c eee eee eee eee 17 To reassign numeric plex names 000 17 Managing Assay Projects llli 18 Adding Assay Projects 200 0c cee eee 18 To add assay projects 00 cece ee 18 Emptying and Deleting Assay Projects 2 0000000 ee 18 To empty assay projects 0000 eee 18 To delete assay projects 0000 eee 18 Managing SNPS sssusssleeeeeeee rs 19 Opening SNP Manager 0 0 cece eee eee een teens 19 To open SNP Manager 000 e cece teens 19 Selecting SNPs 0 000 eect ett 20 To select a SNP from the navigatio
96. alse Allow Multiple Call Allow a user to select an area in the Cluster Plot Changes and change all of the calls within it Zoom will be turned off when the target call is set The default is False To turn on this feature click in the cell and select True Configuring the General Options You can configure display options e Mark same assay words Force cluster plot square Doc 11546 R03 CO 060094 151 MassARRAY Typer 3 4 Software June 30 2006 User s Guide for iPLEX and hME Configuring TyperAnalyzer To configure the general options 1 In the left pane click TyperAnalyzer 2 Inthe right pane click on General to open the General options Look and Feel Allows you to set the look and feel of the program You can choose from the following themes e Office 2003 OfficeXP e NativeWinXP Configuring the Help You can set which file is displayed when the help button in the TyperAnalyzer software is clicked To configure the help file 1 In the left pane click TyperAnalyzer 2 Inthe right pane click on Help 3 Click on the User Manual cell click on the button and locate and select the file that contains TyperAnalyzer user guide Configuring the Program Layout You can configure which file is displayed when the help button in the TyperAnalyzer software is clicked To configure the help file 1 In the left pane click TyperAnalyzer 2 Inthe right pane click on Layout 3 Configure any
97. ample direction e Inthe Properties pane open Sample Tab Settings and select Horizontal or Vertical Sample Order When you apply an entire sample group to a plate the order of the samples in the sample group determines the order in which they are applied to the wells of the plate See the following illustration im Bs g Group Id New Sample Group 12 3 45 67 8 9 1011 21314 15 1617 18 19 2021 222324 e 9006008000686086860090060009 The samples in the sample group 209008 are applied to the wells of the plate 690 in the order in which they appear in 60600098 rjeee the sample group 000000 Freeeeeescscscs 9090900000000000 ecje000000909909000000000000009 Hjeeeecsccscess09000000000900000 1 90009090090090909009000009009000009 2 1000000000000000000000009 bei id kKj 000000000000000000000009 diio Lje0e009090900900900000000000000 M 0000090000000000000000000 Nj 0000000000900000000000009 o00009000900900900090000090000009 Pj 000099090090900000900000000000 Plate Layout Note This illustration depicts a sample group applied vertically You can also apply a sample group horizontally In that case the samples would be applied across the rows rather than down the columns For information see Applying Sample Groups on page 49 ne win Doc 11546 R03 CO 060094 39 MassARRAY Typer 3 4 Software June 30 2006 User s Guide for iPLEX and hME Defining Plates Creating Samples Em
98. an be configured for TyperAnalyzer TyperAnalyzer Display Set the Cluster Plot and Well Data display settings e General Set the look and feel of the TyperAnalyzer program e Help Specify a new help file e Layout Set layout behavior e Report Set reporting options e Traffic Light Configure Traffic Light pane attributes Configuring the Display You can configure display options e Mark same assay wells Force cluster plot square MassARRAY Typer 3 4 Software 150 Doc 11546 R03 CO 060094 User s Guide for iPLEX and hME June 30 2006 Configuring TyperAnalyzer To configure the display options 1 In the left pane click TyperAnalyzer 2 Inthe right pane click on Display to open the Display options a Configuration PlateEditoi El Display yperAnalyze Mark Same Assay Wells General Force Cluster Plot Square Allow Multiple Call Changes General put HHA E Traffic Light Optimal Threshold 85 Success Threshold 50 Failure Threshold 15 Optimal Call Rate Color Bl o 128 0 Above Success Call Rate Color ES 154 203 52 Below Success Call Rate Color 225 216 30 Failure Call Rate Color B i72 0 0 3 Setany of the following Mark Same Assay Wells Mark the same assay wells in the same color as the currently selected well Click in the cell and select True or False Force Cluster Plot Square Make cluster plots square regardless of the window shape Click in the cell and select True or F
99. art a run without correcting chip positions with an Error status However once an error status SpectroCHIP is encountered the run will stop Any remaining SpectroCHIPs will not be run 94 67 MassARRAY Typer 3 4 Software User s Guide for iPLEX and hME Acquiring Spectra Starting an Automatic Run 3 Click the Auto Run tab SpectroACQUIRE MassCLEAVE par le Tock ted Click the Auto Run tab SEQUENOM ACQUIRE window with Auto Run tab selected 4 Under Auto Run click Start Auto Run The automatic run begins Each SpectroCHIP is processed as follows SpectroCHIP name is checked There must be an experiment associated with the SpectroCHIP name If there is none an error message appears and the run stops For information about associating SpectroCHIPs with experiments see Using Chip Linker to Associate Chips with Experiments on page 60 Positioning of the SpectroCHIP is checked for more information see Autoteaching on page 72 e f calibrant wells are used calibration spectra are acquired Using the calibrant is recommended Spectra are acquired from the wells on the SpectroCHIP Caution The SpectroCHIP names are not all checked at the beginning of the run The name of each SpectroCHIP is checked individually as ACQUIRE begins to process it If you leave an automatic run to run overnight and ACQUIRE encounters a bad SpectroCHIP name the run will stop at that Spec
100. at contain the same sample and assay as the currently selected well e Circles indicate wells that contain different samples and assays than the currently selected well MassARRAY Typer 3 4 Software User s Guide for iPLEX and hME Reviewing Processed Data with TyperAnalyzer Viewing a Results Table Viewing a Rather than view a color coded plate diagram you can view a table of all the calls for the Results Table plate similar to the results table in the Genotype Analyzer module To view all calls 1 Click the Plate Data tab TyperAnalyzergseqbm045 Dominik SBE 020305 7DNAs GT 3cycles 030405 semifinallNI RC Of CHP3 RECALL 35901 6 Justomer Project Plshe E ups A 4pl colbiant Beale Brian Caman Chemistry Chuhane David Deleted items E Fragnertabon Tests FT Analysis of SpectoCk Genet George george Guy 2 sei cascriprion hMCGenctyoe Eo coni A Conservative i scheme B isizeo coni A Conservatiee ye E 160195 cont B Moderate B imss cont A Connie Mathies g imss cont A Conservatie Methydation sees cont J A Conservative i Michael E 195916 cont 6 A Conservakive Mortoang 196941 ont A Conservative Palsson 1 182 cont A Conservative Ph cont a O Moderate peg cont A Conservative Priod Test cont D Low Probability Primea lt Tie Plate Oaka tier Wol Osta Recol 3 3 0 124PLEX 08 08 2006 10 43 11 TOTAL 6048 CALL 5591 NOCALL 457 Lon Matin
101. ation Dialog Calibration Call Spectrum Yes Offset 0 931 Prob 1 000 1 NSD 1 250 Height SNR Resolution Probability Area 7 753219 61 722059 7381130526 1 000000 1241 123883 zd 7609 000000 0 000000 0 000000 804 104522 0 000000 0 000000 Zl SIGIR PES SSeS ECT ARCs CED Example of Call Information Dialog dialog box with call information You can leave the Call Information Dialog dialog box open and click another call to view information about it 3 When you are done close the Call Information Dialog dialog box by clicking x in the upper right corner To view a history of calls On the toolbar click rm Show History tool A history of calls appears indicating who made each call To view calibration and mass shift information You can choose to either show or hide calibration and mass shift columns in the results table e On the View menu select Show Calibration Note If a check mark appears next to Show Calibration calibration and mass shift columns are already currently shown Selecting Show Calibration will hide these columns To hide calibration and mass shift information e On the View menu select Show Calibration Doc 11546 R03 CO 060094 121 MassARRAY Typer 3 4 Software June 30 2006 User s Guide for iPLEX and hME Reviewing Processed Data with Genotype Analyzer Using the Results Table Genotype Area Using the Results Table Genotype Area Using the Results Table Alle
102. axis labelS 112 Customizing Colors 0 000 c eects 112 To customize COlOrs 6 eee 112 Customizing Styles 00 00 cee tee eee 113 To customize colors 2 eee 113 Accessing the Export Dialog Box 0 0 eee eee ee 113 To access the Export dialog box 00 cc eee eee 113 Logging Debug Messages 0 cee teas 113 To turn on the Log Debug Message Option 20 5 113 Quitting TyperAnalyZer 2 xe e o xo ee ewe hese eden Eee ORO OR dog 113 To quit TyperAnalyzer lsssleeeeeee eh 113 Chapter 6 Introduction 2 0 RR RR rr rs 115 Reviewing l Processed Data Starting Genotype Analyzer unana nanana 116 To start Genotype Analyzer 00 000 cece eee eee 116 with Genotype Analyzer Finding and Selecting Data 0 2 0 cece eee ceececeeeeeueeeueees 116 By POJO Luce Ern woe ee ede aac n ROC E eee 116 UAI CM 117 BY Dates is ces vex acne ed eta CBE SUE Cue xr 117 Selecting Data in the Tree 2 0 0 cette 117 Using the Results Table Genotyping illie 117 Color Coding ssssssssessesee 117 Genotypes and PeakS 0 0c eects 118 To view only the calls 0 0 02 ee 119 To view the calls for all experiments on a plate 119 To view only the best call from the experiments on a plate 120 MassARRAY Typer 3 4 Software viii Doc 11546 R03 CO 060094 User s Guide for iPLEX and hME June 3
103. ay a Custo Iree control tabs E November 4 Month 014 Day Plate p Test plate 1 Date tab Experiment J3 c SpectroCHIP 1 Chip The illustration to the right shows the organization of the tree in the Date tab The tree is organized by year month then day Under a day are the plates run on that day Under each plate are experiments and chips To view spectra select a chip under one of the experiments Sample date tree control in TyperAnalyzer Color Codes Once you select a genotyping experiment see Selecting an Experiment on page 78 its plate diagram appears with wells color coded according to the strength of genotype calls 78 9 1011421344 15461748192021222324 Each well is color coded meecc 000o Dark Green Above the optimal threshold for 4 a conservative to moderate call default 85 1 96 Light Green Above the success threshold but below the optimal threshold for a conservative to moderate call default 50 84 Yellow Below the success threshold but above the failure threshold for a conservative to moderate Example of a plate diagram for a genotyping plate call default 15 49 VOZZr Re WOH aM Io 0 er Red Below the failure threshold for a conservative to moderate call default 0 14 White No data i e spectrum stored and or no assays applied to the well Wells are color coded according to the weakest call of all selected assays that were applied to i
104. ays and samples that you want applied to specific Sam ples to wells More than one assay can be applied to a single well After applied use the List Wells Items tab to show what exactly is applied to the plate Click a sample or assay in the tree and its location is identified graphically in the plate grid by a change in color Assay and Sample Tree When working with the information in the trees on these tabs click a plus symbol to expand a node A minus symbol means that the node is open When a tree is open all the way down to the assay or sample level there are no plus or minus symbols just the name of the assay or sample To apply plexes assays and samples to wells 1 On the Plate tab select and highlight the plate you want The plate opens automatically Empty wells are marked with an X and filled with a white background 46 Doc 11546 RO3 CO 060094 MassARRAY Typer 3 4 Software User s Guide for iPLEX and hME June 30 2006 Defining Plates Applying Assays and Samples to Wells 2 Click the Assay tab to make it active When the plate is empty it appears with the grid cells empty to signify there are no assays or samples applied to the wells r seqbm106 Customer Project Training Demo allelotyping test PlatelD 20040517 Omin recall 12 3 4 s s 7 e Hu SJEEEPEBEERE GR EER E rezig ma E E x S Mcheeleshereis Importer 2 1 AsseyC Lec
105. ays in a locked definition assay group may not be deleted 2 Ifa confirmation dialog box appears click Yes to delete the locked definition assay group Note A locked SNP group becomes unlocked once its associated locked assay definition assay group has been deleted If the locked definition assay group cannot be deleted the following message box appears AssayEditor A Assay Group cannot be deleted as it contains one or more assays that are assigned to plates 3 Click OK to close the message box The selected locked definition assay group is not deleted Note After deleting a locked definition assay group the associated Design Summary data is also deleted but an associated SNP group is not deleted The SNP group may be deleted separately in the SNP Manager dialog box if it is not associated with any other locked definition assay groups See Deleting SNP Groups on page 24 To delete SNP groups e For instructions see Deleting SNP Groups on page 24 Doc 11546 R03 CO 060094 25 MassARRAY Typer 3 4 Software June 30 2006 User s Guide for iPLEX and hME Defining Assays Exporting Groups Exporting Groups MassARRAY Typer 3 4 Software User s Guide for iPLEX and hME Assay groups and SNP groups may be exported to local files Plexes may not be exported directly To export a plex add it to a definition assay group or reference assay group and then export the assay group To export a gro
106. be available Only those appropriate for the type of Expected Mass Peak and assay type as specified by the Terminator Mix are available for selection For example after typing in a sequence for a new Analyte with the Terminator Mix set at iPLEX only the iPLEX analyte 3 termination mass offset option is available as shown Note To disable Mass Calculator from automatically appearing after typing in oligo sequences check the Don t show Mass calculator next time option before closing the Mass Calculator dialog box You can also do this or re enable the automatic Oligo Mass Calculator using the Display Mass Calculator option under the View menu ME Oligo Mass Calculator 3 Termination iPLEX analyte s Dont show Mass calculator next time Cancel 2 Ifyou do not plan to specify a DNA sequence you must type the mass value in the Mass cell To add analytes 1 On the Edit Assay tab double click inside the Expected Peaks grid and then type the appropriate value for the first analyte You should name the analyte with the SNP sequence to which it corresponds 2 To add additional analytes right click the existing analyte and choose Add New Analyte To add contaminants 1 On the Edit Assay tab double click inside the Expected Peaks grid and then type the appropriate value for the contaminant 2 To add another contaminant right click the existing contaminant and choose Insert New Contam
107. click Open Note A prompt will appear if the format of the file is not supported or if the file contains data issues Data will not import in either scenario MassARRAY Typer 3 4 Software 42 Doc 11546 R03 CO 060094 User s Guide for iPLEX and hME June 30 2006 Defining Plates Finding Which Plates Contain a Sample Group Finding You can select a sample group and view a list of the plates to which it has been Which Plates assigned Plates in the list do not have to contain the whole sample group a plate Contain a appears in the list if it contains at least one of the samples from the sample group Sample Group To view a list of plates to which a sample group is assigned 1 In the PlateEditor click the Sample tab 2 If necessary expand the tree list to find the sample group you want Click the plus symbol next to a node to view its contents 3 Click the sample group to highlight it Then right click the sample group and choose Sample Group Info The Sample Group Info dialog box appears Sample Group Information 1679_p1_2 There are 1 Plates that contain the Sample Group 1679_p1_2 Customer 050305 iPLEX 050305 1 Sample Group Info dialog box The Sample Group Info dialog box indicates the number of plates containing samples from the sample group It also lists the customer project and name for each plate containing samples from the sample group 4 Click OK to close the Sample Group Info dialog box A
108. click a SNP group or SNP ID and then choose Export Deleting SNP Groups SNPs may not be deleted you may only delete the SNP groups that contain them SNPs may be removed from a SNP group but they are not deleted from the database The SNP group that contains the last reference to a particular SNP may not be deleted Such a SNP group may only be deleted after its associated assays have been deleted See Editing Assays on page 14 for instructions To remove a SNP e See Removing SNPs from SNP Groups on page 22 for instructions To delete a SNP group 1 In the SNP Manager dialog box navigation tree select a SNP group 2 Right click the selected SNP group and choose Delete SNP Group The selected SNP group is deleted Moving Moving Groups Est You can move assay groups from one project to another by simply dragging them an G Pung within the navigation tree on the Assay Group tab Projects plexes and individual roups assays may not be moved in this way In the SNP Manager dialog box you may move SNP groups by dragging them to a new location on the navigation tree You may not move individual SNPs this way To move a group e On the navigation tree click and drag a group into its new location Copying Groups In order to limit the number of copies of particular assays in the database it is not possible to copy definition assay groups or locked definition assay groups using the drag and drop method However
109. consequential damages The limited warranty sets forth SEQUENOM s sole and exclusive responsibility with respect to any alleged breach of this limited warranty Except as provided herein the MassARRAY Products are provided without warranty of any kind or nature SEQUENOM does not warrant guarantee or make any representations regarding the use or the results of the use of the MassARRAY Products in terms of correctness accuracy reliability or otherwise The USER assumes the entire risk as to the results and performance of the MassARRAY Products The foregoing warranty is exclusive and is made in lieu of and to the exclusion of any other warranties whether oral or written express or implied direct indirect by estoppel or otherwise or created by the Uniform Commercial Code or the usage in the industry or the course of dealings of the parties as to any matter whatsoever including but not limited to those concerning merchantability or fitness for a particular purpose LICENSING Sequenom s patented DNA analysis by mass spectrometry methods including the iPLEX and MassEXTEND method are protected under U S patent rights including but not limited to 6 500 621 6 300 076 6 258 538 and 5 869 242 and their foreign equivalent patent rights With the purchase of Sequenom SpectroCHIP array chips whether purchased as a stand alone product or in a kit product with reagents Customer is granted a limited one time use only per each chip e
110. ct H E 47698 ConDNA1 96 I Plate 48170 ConDNA1 96 I Plate 042602 1 1 amp Experiment e Experiment Qi amp 2 4 Chi e Chip amp 3 P 4 042702 1 1 FA i amp 042902 1 1 GA H E 48170 ConPooli 96 P Example of the tree sorted by project MassARRAY Typer 3 4 Software 116 Doc 11546 R03 CO 060094 User s Guide for iPLEX and hME June 30 2006 Reviewing Processed Data with Genotype Analyzer Using the Results Table Genotyping Using the Results Table Genotyping By Test The tree is organized into the following levels Test a collection of assays e Assay e Plate e Experiment e Chip By Date The tree is organized into the following levels e Year e Month Day e Plate Experiment Chip Selecting Data in the Tree First level is always Test E Test Paull lt Test Assay p i Assay 3 Plate p amp Test plate 1 Experiment Jy B SpectroCHIP Chip gt i 2 3 Example of the tree sorted by assay First level is always Date E Date 2000 lt Year E July November lt Month 01 lt Day Plate p Test plate 1 Experiment Jje SpectroCHIP 1 Chip 3 Example of the tree sorted by date Regardless of whether you sort the tree by project assay or date the last three levels are always the same plate experiment chip To view data you must select a chip the lowest leve
111. ctroCHIP layout in a sense the definition of the Plate also serves as a definition for the SpectroCHIP Each well contains a single Sample which can be a pooled sample and one or more Assays that are run simultaneously on that Sample Assays which are run simultaneously are called multiplexed assays Plate Database Hierarchy The Plate exists within a hierarchy in the database As defined in the database hierarchy a Customer has Projects and a Project has Plates associated with it A Plate must exist within a single Project The Plate hierarchy can be used to associated Plates in any manner that is useful to you that is the hierarchies do not need to actually be Customers and Projects but can reflect some other organization of similar form e g Project and Subproject PlateEditor Opening the PlateEditor Basics To open the PlateEditor 1 From the MassARRAY Typer window click PlateEditor td MassARRAY Typer seqbm045 a m File Application Help g uH Editor Mm Pridie Click to open the PlateEditor The Connect to Database dialog box opens 2 Enter the appropriate information and then click OK Once connected the PlateEditor opens 3 Select the plate you want to work on and then assign assays and samples See Applying Assays and Samples to Wells on page 46 for instructions Closing the PlateEditor e On the File menu select Exit Doc 11546 R03 CO 060094 29 MassARRAY Typer 3 4 Software
112. d O 5999 900000 O 6273 100000 O 6304 100000 Genotyping O 6617 300000 O 5999 900000 O 6273 100000 Genotyping O 6304 100000 Area O 6617 300000 6273 100000 Allelotyping d 6617 300000 Example of assay details GA GA C11 48170 P 1 000000 5 926464 115 235081 4 233089 105 226049 66 594350 1108 321027 80 410700 998 044321 0 526177 0 473823 CAGAACACTTAGCACCCCACTG CAGAACACTTAGCACCCCACC CAGAACACTTAGCACCCCACC CAGAACACTTAGCACCCCACTG CAGAACACTTAGCACCCCAC 1 144805 2 970775 59 692560 2 200810 56 737394 45 111770 17 961267 43 494948 17 028181 0 011341 0 011341 DESCRIPTION 6617 300000 6273 100000 6273 100000 6617 300000 5999 900000 ASSAYINFO 0 177160 CALLINFO 0 286040 1 000000 0 209770 1 000000 PEAKINFO 268 733247 282 752209 275 282209 268 523247 AREAINFO FREQUENCYINFO Depending on the type of plate i e genotyping genotype area or allelotyping only some or all of the information illustrated here is shown For instance in a genotyping plate ASSAYINFO CALLINFO and PEAKINFO information is shown but AREAINFO and FREQUENCYINFO are not present MassARRAY Typer 3 4 Software User s Guide for iPLEX and hME 90 Doc 11546 R03 CO 060094 June 30 2006 Reviewing Processed Data with TyperAnalyzer Viewing Assay Details for a Well Example of ASSAYINFO part of assay details Example of CALLINFO part of a
113. d it is re enabled once a well is encountered that provides a spectrum that is called at or above this level Smart rastering occurs on a per assay basis That is when multiplexing the smart rastering criteria are applied to each assay individually It is possible to have rastering disabled for one assay while it is still enabled for other assays in the same well Acquisition Parameters Values The Acquisition Parameters values represent the following e Shots indicates the number of laser shots attempted during processing e Maximum acquisitions indicates that the acquisition will stop when the specified number of acquisitions is complete Minimum good spectra means collect the specified number of spectra before starting analysis e Maximum good spectra means to stop acquisition once the specified number of spectra is collected e Enable Smart Raster applies to genotyping only It indicates that the system will stop calling assays that fail consecutively Table 2 on page 65 provides recommended values for the options under Acquisition Parameters except Shots which you should determine separately MassARRAY Typer 3 4 Software 64 Doc 11546 R03 CO 060094 User s Guide for iPLEX and hME June 30 2006 Acquiring Spectra Turning on the High Voltage Note The values listed are the suggested defaults to use with Typer 3 3 If you are using a different version of Typer software these values do not apply Table 2 Recomm
114. d the standard error is less than 2 White Bad Spectrum a usable spectrum was not acquired from the well the best spectrum acquired contains only noise Note Low Probability and Bad Spectrum rows are hidden from view To view these rows see Viewing Bad Spectrum Rows on page 124 Data Columns The columns of data include information about the peak areas and allele frequencies The following table describes the data columns Table 5 Results Table Contents for Allelotyping Column Description Filtering Columns SAMPLE ID Sample name You can choose to view or hide individual columns in a CALL Alleles present in the pool results table See Filtering the Results Table on ASSAY ID Assay name page 125 WELL POSITION Well number MassARRAY Typer 3 4 Software 122 Doc 11546 R03 CO 060094 User s Guide for iPLEX and hME June 30 2006 Reviewing Processed Data with Genotype Analyzer Using the Results Table Allelotyping Doc 11546 R03 CO 060094 June 30 2006 Table 5 Results Table Contents for Allelotyping Continued Column Description Polymorphic both alleles found Non Polymorphic one allele found Low Frequency one of the alleles has a frequency of 0 06 i e 6 or less and the standard error is less than 296 DESCRIPTION Uncertain the average frequency of one allele is less than or equal to 3 times the standard error of the frequencies before averaging Bad Spectrum a u
115. dding a Sample to a Sample Group You can add a new sample to an existing sample group To do so you must edit the sample group to which you want to add the new sample See Editing a Sample Group below Editing You can change description of a sample To do so you must edit the sample group to Sam ples which the sample belongs See Editing a Sample Group below Note It is not possible to rename a sample Doc 11546 R03 CO 060094 43 MassARRAY Typer 3 4 Software June 30 2006 User s Guide for iPLEX and hME Defining Plates Editing a Sample Group Editing a You can add a new sample edit the samples in an existing sample group or delete a Sample sample group if it is not in use and the user has permission The editing options Group available are to change or add a description for a sample Note You can edit a sample group only if none of its samples has been assigned to a plate If any plate uses samples from the sample group you must first clear those samples from the plates To find out which plates use the sample group see Importing and Exporting Plate Table Information on page 42 To clear samples from a plate see Clearing Wells on page 54 To add a sample to a sample group l 2 3 4 In the PlateEditor click the Sample tab If necessary expand the tree list to find the sample group you want Click the sample group to highlight it Then right click the sample group and choose Edit Sample Group
116. e The contents of the plate are displayed in the plate grid Copying Plates If you want to create a copy of an existing plate use the Copy to new plate command See the following steps To copy a plate 1 AM Rr On the Customer Project Plate tree select a project to which the new plate will be added Right click and select New Plate Type the Plate ID using any combination of alpha or numeric characters Click the option for 96 Wells or 384 Wells Click OK On the Customer Project Plate tree select the plate that contains the contents you want to copy From the Edit menu select Copy OR press and hold down the Ctrl keyboard key and press C Click the new plate to which the copied contents will be added From the Edit menu select Paste OR press and hold down the Ctrl keyboard key and press P The contents of the plate copied populate the newly created plate 10 Select Save on the File menu MassARRAY Typer 3 4 Software 54 Doc 11546 R03 CO 060094 User s Guide for iPLEX and hME June 30 2006 Defining Plates Working with Plates Deleting Plates Note If a plate has data in it you must have database administrator privileges to delete the plate To delete a plate 1 On the Plate tab select the plate to be deleted on the Customer Project Plate navigation tree 2 Right click the selected plate and choose Delete Plate 3 Inthe confirmation dialog box that appears click OK to dele
117. e Xml Files xml X Cancel To import a saved XML file 1 From the File menu select Import 2 In the Open dialog box select the XML file to import and click Open p IE on Ci C1 Panel 020205 10plex 8plex 020205 1 1 BO i cg_b1_15_1_1 1 xml My Recent Documents 3 Desktop My Documents My Computer My Network File name GeneE pression Clontech MTC1 Panel 0202 gt Places Files of type Xml Files xm X Cancel Note Imported chips are for display only Although most of the functionality in works properly the result cannot be saved to a database Also the import function is available even if TyperAnalyzer starts without a database connection Doc 11546 R03 CO 060094 105 MassARRAY Typer 3 4 Software June 30 2006 User s Guide for iPLEX and hME Reviewing Processed Data with TyperAnalyzer Generating Reports Generating Reports Tab Delimited File A file containing plain text items separated by a tab character Each line of data is separated by a carriage return character Experiment In a genotyping or genotype area plate an experiment represents a SpectroCHIP and chip represents an analyzer run Copying Plate Data to the Clipboard You can copy plate data to the clipboard so it can be pasted into other programs such as Excel To copy plate data to the clipboard 1 Click on the Plate Data tab to make it active 2 From the Edit menu select Copy P
118. e Eee eer qe n n de ee P de RE n 24 Copying Gro ps i acest Res ae ewes nk wa a RR T e eed a 24 Deleting Groups 0 0 0 c cect ren 25 To delete assay groups 0 eee 25 To delete locked definition assay groups 0 0 eee eee 25 To delete SNP groups 000 e eee eee 25 Exporting GrOupS x use oa c ten ils x o 9 oo d ORE ow A eS 26 Toexportagroup sasine daai aaraa aai a a aea nn 26 Chapter 3 lntrod Ction MERETERCETOTO 2T DET 0L 011 0 dad ad whee ate deta TS 29 Defining Plates Physical Plate sew is ee RA S ERE ERR Made HR Ph 29 Plate Database Hierarchy llis 29 PlateEditor Basics 000 cece seh 29 Opening the PlateEditor 0 ccc eee 29 To open the PlateEditor 00 0c cee eee 29 Closing the PlateEditor llle 29 PlateEditor Overview llle 30 PlateEditor Window sesesesesll esee 30 Menu Bar and Toolbar illis 30 Message Bat eee vac Wr eed rusa XR xu 30 Status Bal dos Ru da eA S p VR AUR VEU eg uS RU Po 30 Plate tab ose eee ee Sis ane E E ee et 30 Assay tabu seh ezechtosi ei mee anda nien Rd ned hee aces 31 Sample tab 00 00 cc rn 31 Plate Table siad mea ae Od ee bk PN e eR eee ER eds 31 Plate Layout utes i rraian iude EE Derek ed Re ER 31 Plate Properties cis se tebe neon end ok Meee eee RR RET e o 31 Right Click Menu ssssesseees RII I 31 Selecting Plates
119. e P value falls below 0 01 it means the data does not score well on the Hardy Weinberg Equilibrium HWE Use the Log Height and Yield cluster graphs to perform quality checks of your assays Yield vs Skew In a Yield vs Skew cluster graph the yield is the combined yield of both low and high mass analytes The skew shows the relative yield of each analyte Assays that worked well will usually have high yields closer to 1 Assays that produced homozygous calls for the low or high mass allele will cluster around the skew 0 or 1 axes respectively whereas those that produced heterozygous calls will cluster around the skew 0 5 50 axis Assays that lead to No Calls will usually result in points that have low yield values or that fall somewhere between the homozygous and heterozygous skew axes 1 0 HOM LM HET HOM HM Example of a Yield vs Skew graph for a reliable assay Yield The Yield cluster graph plots the relative yields for the two alleles of an assay directly against each other In this graph the total yield and relative yields of the alleles lie along the diagonals of the plot Points that fall close to one or the other axis are homozygous Points that are close to zero on both axes are assays where there was little probe primer extension Use the Yield graph to understand the reasons for No Call genotype call results shown as red data points on the cluster graph Low yield indicates a less efficient extension reacti
120. e correct option was selected by looking at the status bar as described in Selecting an Experiment on page 78 3 Select Genotype or Genotype Area from the Process Method drop down list 4 Select the nanodispenser used to dispense to the SpectroCHIPs from the Dispenser drop down list Nanodispenser R indicates a Robodesign pintool Nanodispenser S indicates a Samsung pintool 5 Type a name for the group of SpectroCHIPs in the Experiment Name box 6 Inthe Chip Barcode box type a name for the chip After typing the name copy it to the Windows clipboard Later in ACQUIRE you will paste this name into the Plate box 7 Click Add to add the plate to the selection table Doc 11546 R03 CO 060094 61 MassARRAY Typer 3 4 Software June 30 2006 User s Guide for iPLEX and hME Acquiring Spectra Loading SpectroCHIPs Loading SpectroCHIPs MassARRAY Typer 3 4 Software User s Guide for iPLEX and hME Continue to add plates as needed Follow Steps 1 6 above After you have added all plates to be included in the ACQUIRE run click Create to create the input files used by the MassARRAY Typer RT Workstation The selection table is cleared after the input files are created Removing Plates from the Selection Table You can remove plates from those listed in the selection table To remove a plate from the selection table 1 In the MassARRAY Typer Chip Linker window click a plate in the selection
121. ed file in the File name prefix box By default the File name prefix uses the name of the group or individual assay or SNP you are exporting Note The directory used to write the exported assay files will be the last one selected via the File Open dialog box that appears when the Browse button is clicked If you Export without first using the Browse button the assay files will be saved in directory the AssayEditor exe program was installed to 4 Click Export The selected assays SNPs and design settings are saved and exported 5 Click Close to exit the Export dialog box 27 MassARRAY Typer 3 4 Software User s Guide for iPLEX and hME Defining Assays Exporting Groups Notes MassARRAY Typer 3 4 Software 28 Doc 11546 R03 CO 060094 User s Guide for iPLEX and hME June 30 2006 Chapter 3 Defining Plates Introduction The PlateEditor module is used to define samples and plates and to apply samples and assays to a plate s wells This chapter explains how to use the PlateEditor by providing an overview of what you will see followed by sections on how to perform specific tasks such as select a plate create a plate define samples apply assays and samples to wells create an assay group and edit plates Physical Plate A Plate in the MassARRAY Server database database represents the physical microtiter plate that is spotted onto the SpectroCHIP Since the Plate layout 96 wells or 384 wells also mirrors the Spe
122. electing points press and hold down the Shift key and press and hold the left mouse button 99 MassARRAY Typer 3 4 Software User s Guide for iPLEX and hME Reviewing Processed Data with TyperAnalyzer Viewing Cluster Graphs 2 3 MassARRAY Typer 3 4 Software User s Guide for iPLEX and hME Drag the mouse to enclose the desired points Release the mouse button and the Shift key when done Lassoing points The region is always closed by a line from the last point to the first point Use a simple polygon when lassoing Line crossings that result in a simple polygon are allowed however if a line crossing is not allowed the crossing line will be displayed in red rather than cyan and the status bar indicates the invalid state Invalid Lasso can t change calls until lasso closing line is not red If you terminate the drawing while the crossing line is red the option for changing the call is disabled In this case you must either clear the lasso by clicking elsewhere or finish the drawing by holding down the Shift key and the left mouse button and continuing to draw the line until the line no longer crosses y 2 Low Mass Height Lassoing points 100 Doc 11546 R03 CO 060094 June 30 2006 Reviewing Processed Data with TyperAnalyzer Viewing Cluster Graphs 4 To change the calls for the data points in the enclosed region right click on the cluster plot and choose the desired call from the
123. ended Values for Acquisition Parameters IPLER Genotypin Allelotypin Option Recommended yping yping Value Value Value Maximum Acquisitions 5 uniplex 9 ies 9 9 multiplex Minimum Good Spectra 1 uniplex 5 M 5 5 multiplex Maximum Good Spectra 5 uniplex 5 ind 5 5 multiplex Enable Smart Raster yes uniplex no E no no multiplex For optimal results these values 9 5 5 are recommended when you run 8 plexes or higher Tu rning on the Make sure the high voltage is on If you are leaving the analyzer to run overnight choose High Voltage to have the high voltage turned off automatically after the last SpectroCHIP is run See the following for detailed instructions The high voltage should turn on automatically when you click Start Auto Run To turn on high voltage yourself follow the instructions below To turn on the high voltage e Inthe Auto Run Set Up tab under tig oti laco High Voltage click this button to Instrument make sure the High Voltage turn on the high button is red voltage red Instrument M Tum Off HV after To automatically turn off the high voltage ins on the high voltage after the last SpectroCHIP e Check the Turn Off HV after last chip is complete option After the last SpectroCHIP has been run the high voltage will be shut off automatically This is useful if you will leave the analyzer to run overnight Doc 11546 R03
124. ending across and down the display Use the cross hairs to find the coordinates of a point in the graph See the following illustration Coordinates of the current location of the cross hairs are listed here mass intensity A coax 1 This line shows where MEI This line shows where the point falls on the the point falls on the mass axis intensity axis Move the cross hairs to the point for which you want coordinates i joo Mri Wet MA tiet ttt Pi 4000 5000 6000 7000 0 9000 10000 11000 Using the cross hairs to find point coordinates MassARRAY Typer 3 4 Software 84 Doc 11546 R03 CO 060094 User s Guide for iPLEX and hME June 30 2006 Reviewing Processed Data with TyperAnalyzer Viewing Spectra Zooming the spectrum display You can zoom in on an area of the spectrum display To zoom the spectrum display Inthe spectrum display click the left side of the area into which you want to zoom and drag the mouse to the right Assay 1 Assay 2 Click the left side of A the area into which T nid LA you want to zoom Then drag the mouse A to the right Zooming the spectrum display 2 When the zooming box encloses the area you want release the mouse button The zoomed view remains for any subsequent spectra you view To turn off the zoomed view follow the instructions under To un zoom the spectrum display on page 85 To un zoom the spectrum display e Right click the spectrum and select
125. ending them into a single file The data for each chip is kept separate from that for the other chips Note To generate an Allelotype Correction report there must be a skew correction file containing heterozygous skewing factors for the assays applied to your plate Skew factors are saved to a skew correction file when you generate a Genotype Area report on genotype area experiments For more information see Skew Correction File on page 141 2 Inthe Get User Input dialog box click the Browse button and select a skew correction file This is the file to which heterozygous skewing factors will be appended Note This dialog box appears for only Genotype Area and Allelotype Correction reports If you are not generating either kind of report skip to the next step MassARRAY Typer 3 4 Software 108 Doc 11546 R03 CO 060094 User s Guide for iPLEX and hME June 30 2006 Reviewing Processed Data with TyperAnalyzer Generating Reports Get User Input Please enter a value for SKEWNAME Browse button when you click this button the Please specify a Cancel filename dialog box appears see below Please specify a filename Note It is Selecting a skew Look in E RepotTemplates gt e If not done automatically open recommended that correction file 2 ee A si pns papi E Es eons ini oe ou have only one My Recent AllelotypeNode tel Geno
126. enotype Analyzer on page 115 TyperAnalyzer is used to view and analyze data from the analyzer The TyperAnalyzer and Genotype Analyzer modules complement each other they provide alternative ways to view the same data Note Some TyperAnalyzer features apply only to genotyping some only to allelotyping and others to both types of analysis Sections in this chapter applicable to only genotyping have Genotyping after their headings Sections applicable to only allelotyping have Allelotyping after their headings Sections applicable to both have plain headings with no analysis type indicated Screen Resolution When viewing results data in TyperAnalyzer it is recommended you set the resolution of your computer screen to 1024 by 768 This screen resolution settings provides the best possible viewing of well data and processing results See the online help provided with Microsoft Windows for instructions on setting screen resolution Genotyping When genotyping TyperAnalyzer is particularly well suited to viewing and analyzing multiplexed assays It may also be used to view uniplex assays A selected plate is shown with its wells color coded according the strength of the genotype calls for each well relative to the optimal threshold for a conservative to moderate call Dark green indicates a call above the optimal threshold light green indicates a call above the success threshold but below the optimal threshold yellow indicate
127. eport Genotype Area report See Assay Type Count Report on page 139 Skew Correction File See Skew Correction File on page 141 Table 6 Allelotype Report Contents Column Description Average Frequency of Allele 2 AVE FREQ2 Weighted average relative frequency found from the data points for the higher mass allele 1 0 means 10096 Frequency Error FREQ ERROR The weighted uncertainty of the frequencies for both the lower and higher mass alleles Assay Status Polymorphic Both alleles found Non Polymorphic One allele found Uncertain The average frequency of one allele is less than or equal to 3 times the standard error of the frequencies before averaging Bad Spectrum A usable spectrum was not acquired from the well the best spectrum acquired contains only noise No Spectrum No spectrum acquired or no assay applied to the well ASSAY STATUS Primer Frequency Ratio of peak areas PRIMER FREQ Unextended Primer Area Unextended Primer Area Allele 1 Area Allele 2 Area Pause Frequency Ratio of peak areas PAUSE FREQ Pausing Peak Area Pausing Peak Area Allele 1 Area Allele 2 Area You must have an allelotyping license to create an Allelotype Correction report The Allelotype Correction report contains the same information as the Allelotype report plus corrections for heterozygous skewing In heterozygous samples some skewing has been observed in spect
128. equencies found at all successful raster positions Standard error of the frequencies found for the lower mass Frequency Err 1 allele Average frequency of the higher mass allele This is an Frequency 2 average of the frequencies found at all successful raster positions Standard error of the frequencies found for the higher Frequency Err 2 mass allele 123 MassARRAY Typer 3 4 Software User s Guide for iPLEX and hME Reviewing Processed Data with Genotype Analyzer Using the Results Table Allelotyping Table 5 Results Table Contents for Allelotyping Continued Column Description Ratio of peak areas of the unextended primer to Frac UEP unextended primer allele1 allele2 Ratio of peak areas of the pausing peak to pausing Pine AySG peak allele1 allele2 Viewing Bad Spectrum Rows Bad Spectrum rows are usually hidden from view To view them click the No Calls tool Genotype Analyzer F tool bar 8 E Bj amp 100 Ll gt E Bl Set Abs Y Max J Called Only No Calls To view the Polymorphic Non Polymorphic Uncertain rows click the Called Only tool Switch back and forth between the two views by using the Called Only and No Calls tools Viewing Data for all Experiments on a Plate In a single results table you can view the data for all chips on a plate When allelotyping a chip represents an individual SpectroCHIP Viewing all chips for a plate shows you the dat
129. er project Initially this dialog box shows the ReportTemplates folder A Metype Shew t You should not save your k nln Jod Cetrepi S00 OCHA ANDR HAAS reports to this folder Select or D ME mitate plate experiment chip create a different folder for j meet If you selected a plate the default your reports name only goes to plate i e customer project plate Similarly if you selected a chip the name goes to chip My Documents A default name is supplied for your report based on the experiment chip or plate you selected see right Edit or amp a a Aa replace the name if you wish COD LI Selecting a report type 4 When you click Save the report is generated The report is displayed in Excel For descriptions of report contents see Appendix A Reports on page 137 Doc 11546 R03 CO 060094 109 MassARRAY Typer 3 4 Software June 30 2006 User s Guide for iPLEX and hME Reviewing Processed Data with TyperAnalyzer Customizing the Window Layout Customizing the Window Layout Customizing the Displays You can customize the window layout by resizing moving and combining panes Once you have set the layout as you want it you can save the layout so it will load each time the program starts You can also load a saved layout reset the layout to the original default layout and add menu items to the tool bar for easy selection of frequently used items
130. er Leelee Sea be ere er e Pee 54 Copying Plates Ai nirso ert Enenda i ni hh 54 pienes aeae E e RE E EEA E ee A EEES EEEE 54 Deleting Plates on e a a a aa o E ree 55 To delete a plate 0 cc tees 55 PIOJOCIS rum e a e e sk e ar a e Pe qo ee ee ae ee 55 To create a new project 0 0 eee rh 55 To edit an existing project llssllle eene 56 GUMTREE HM 56 To create a new customer 0 eee 56 MassARRAY Typer 3 4 Software iv Doc 11546 RO3 CO 060094 User s Guide for iPLEX and hME June 30 2006 To edit an existing customer 0 0 00 e eee eee 56 Extend Primer Adjustment 00 00 cece eae 56 To calculate the extend primer adjustment 00005 57 Changing Layout Options 0 0 cee eee es 58 To save a layout uox eR ERU Ronde Mus Pe 58 To loada layout 2 ve ape et Pei dae ER en qae epa 58 To restore the default layout llle 58 Chapter 4 INtHODUCTION auae de wad ad eh ed tation ed Oia de AR dave 59 Acquiring l ln Spectra Overview of Acquiring Spectra 0 c ccc tees 59 Starting the MassARRAY RT Software 00 0 ccc teen eas 60 On a Compact Workstation to start the MassARRAY RT software 60 Using Chip Linker to Associate Chips with Experiments 60 Opening Chip Linker 0 0c e 60 To open Chip Linker 0 0 0 c eee eh 60 Associating SpectroCHIPs and Experiments 0 0000 eee 61 To
131. er than 24 assays the scroll bar will not be visible Printing a Histogram To print a histogram 1 2 MassARRAY Typer 3 4 Software User s Guide for iPLEX and hME Click on the Histogram tab to make it active From the File menu select Print Graph In the Printing dialog box choose a printing style Color Monochrome or Mono Plus Symbol Click Setup to set up the printer Click OK to print the graph 102 Doc 11546 R03 CO 060094 June 30 2006 Reviewing Processed Data with TyperAnalyzer Recalling Plate Data Recalling Plate If you find that an assay has been incorrectly applied to a plate or well of a plate you can Data recall the plate data and copy it to a new plate with the correct assays applied Use ChipLinker to recall plate data You can recall plate data on the RT Workstation computer or on the server See Recalling Plate Data on page 71 Caution Data recall should be used on only genotyping and genotype area data Do not recall allelotyping data Filtering the You can control which columns are shown in the Plate Data tab by hiding individual Results Table columns or groups of columns When you hide a column it is simply hidden from view You can easily switch back to showing the column To hide or show columns 1 On the View menu select Display Fields Dialog The Data Field Display dialog box appears Data Field Display Calibration Status Calibration Data Show Specified
132. es are applied to the plate wells 8 To apply additional sample groups to the current plate repeat these steps from step 3 Applying The mapping option applies a sample group to the wells of a plate in the same way that Sample certain automated pipettors transfer material from four 96 well plates to a single 384 Group well plate This transfer scheme is illu
133. esents match up the mass values For example y 0526177 0 011341 this peak is for the G allele m 0 473823 0 011341 Viewing Cluster Cluster graphs provide a visual description of certain measurements used in the genotype Graphs calls for an assay on a SpectroCHIP Cluster graphs help you to determine if an assay is reliable or not If there are chemistry problems with an assay they are likely to be revealed in the cluster graphs There are four types of graphs available Yield vs Skew plots the combined yield of both low and high mass analytes Yield plots each assay result by probe of extension rates from 0 0 to 1 0 096 to 100 e Height plots each assay result by probe of extension rates using the reported height of allele peak signals e Log Height plots each assay result by low mass allele and high mass allele heights on a logarithmic scale Each sample of a particular assay produces a point of data on a cluster plot The color and shape of the point reflects the genotype call for a particular sample The top of the cluster graph lists Hardy Weinberg Chi Square and P values A P value of 0 01 corresponds to an approximate Chi Square value of 6 5 Values listed as indicate that no calculation MassARRAY Typer 3 4 Software 94 Doc 11546 R03 CO 060094 User s Guide for iPLEX and hME June 30 2006 Reviewing Processed Data with TyperAnalyzer Viewing Cluster Graphs could be made When th
134. et of experiments The following table describes the contents of a Genotype Area report Table 8 Genotype Area report Contents Column Description CUSTOMER Customer name PROJECT Project name PLATE Plate name EXPERIMENT Experiment name CHIP Chip name WELL Well number SAMPLE Sample name as specified in Plate Editor when you created the plate ASSAY GROUP Assay Group name as specified in Assay Editor when you created the assay group ASSAY Assay ID as specified in Assay Editor when you created the assay GENOTYPE Genotype call In addition to the contents described in the table above the Genotype Area report contains summary information at the bottom See the following illustration A G GA TOTAL Number of samples called for TOTAL 64 1 27 each allele and heterozygotes FREQ 0 8424 0 1576 FREQ Relative frequency of each allele AVE HETERO RATIO a 0 4654 in all samples STABLE Yes AVE HETERO RATIO In heterozygous HETERO 29 3596 samples the average ratio of the alleles EVEN Yes means the average Example of the summary information appearing qup at the bottom of a Genotype Area report heterozygous ratio is not more than 70 30 ii i e 30 lt either allele s frequency lt 70 Note For genotyping data with no area STABLE Yes means the standard error information AVE HETERO RATIO EVEN of the heterozygous ratios is less than Genotype Area and STABLE will be 0 These values are 0 11 Experiment based on peak area data whic
135. ex To adjust MassEXTEND primer mixes 1 MassARRAY Typer 3 4 Software User s Guide for iPLEX and hME For each multiplex prepare a mixture of the required MassEXTEND primers referred to as a primer mix The final concentration of each primer in the primer mix must be 9 uM Consider how much primer mix you will need Each single hME reaction i e a single well in a 384 well microplate requires 1 uL primer mix Note When ordering MassEXTEND primers from your oligonucleotide supplier it may be useful to consider at what plex level you will use the primers and ask for the primers to be supplied at a certain concentration For example ordering primers for a 12 plex at 108 uM makes preparing primer mixes much easier You can simply mix equal volumes of each 108 uM primer Each primer will have a concentration of 9 uM in the final primer mix Similarly for a 10 plex order MassEXTEND primers at 90 uM Pipette 1 uL of the primer mix into a well of a microplate and add 24 uL nanopure water to obtain a 360 nM dilution of the primer mix referred to as a primer mix sample Repeat steps 1 and 2 for each multiplex to generate a microplate containing primer mix samples for all of the multiplexes Add 3 mg Clean Resin to each well of the microtiter plate MTP using the dimple plate Note Do not add any water The existing dilutions of the primer mix samples are appropriate Dispense the primer mix samples to a SpectroCHIP
136. f each SpectroCHIP is checked before spectra are acquired from it ACQUIRE corrects for small variations in the positioning of SpectroCHIPs The positioning of each SpectroCHIP is checked by examining wells A2 to H2 forward and back The video display in the upper left of the ACQUIRE window Autoteaching will show autoteaching cross hairs in cross hairs addition to the laser cross hairs see right ACQUIRE finds the location of each well and places the auto teaching cross hairs on it The difference between the location of o the auto teaching cross hairs and the laser t cross hairs is found for each of the wells Laser A2 to H2 The differences between the Ui RAIS laser and autoteaching cross hairs for the Video display wells are averaged This average upper left of ACQUIRE window difference is used as an offset to correct the positioning of the SpectroCHIP After autoteaching the autoteaching cross hairs disappear MassARRAY Typer 3 4 Software 72 Doc 11546 R03 CO 060094 User s Guide for iPLEX and hME June 30 2006 Acquiring Spectra Saving Parameters Note If ACQUIRE is unable to find one of the autoteaching wells A2 to H2 it will Saving Parameters Tools Menu Quitting ACQUIRE Doc 11546 R03 CO 060094 June 30 2006 skip the well You can tell that a well is not found by watching the video display during autoteaching The autoteaching cross hairs will not appear when a well cannot be found A
137. ftware User s Guide for iPLEX and hME From the Edit menu choose Spectrum Split or click the Spectrum Split toolbar button E A horizontal line appears across the view and the mouse pointer turns into a double line SAMPLE ID DN GENOTYPE ID ASSAY ID WELL POSITION DESCRIPTION ENTRY OPERATOF 4 dna G Assay A12 amp Conservative Automatic or dna07 cT Assay3 A12 A Conservetive Automatic 40 dnaQt G Assay A2 A Conservative Automatic 11 dnaQt CG Assay2 A2 B Moderate Automatic 12 dna01 CT Assay3 A2 A Conservative Automatic 13 Assay A3 A Conservative Automatic mn c Assay2 A3 A Conservative Automatic 15 CT Assay3 A3 A Conservative Automatic 18 dna 11 G Assay A4 B Moderate Automatic EXE 18 dnao11 CT Assay3 A4 A Conservative Automatic 18 dna022 G Assay AB A Conservative Automatic 20 dna022 cG Assay2 AB A Conservative Automatic 24 dna022 CT Assay3 AB A Conservative Automatic B 4 gt Count 208 NUM 4 Splitting the screen To view the spectrum for a well click it in the results table The spectrum appears in the spectrum display The selected genotype is identified by its underlined yellow text Note Spectra acquired using the ACQUIRE module may appear less intense than older spectra acquired by the XACQ software on the MassARRAY analyzer and processed by the Data Process module in earlier versions of Typer That is the intensity peaks in spectra acquired by ACQUIRE
138. g Plate Data lisse A 103 Filtering the Results Table llle 103 To hide or show columns eeeleeee eae 103 Importing and Exporting Wells 20 0 00 cece eee 104 To export wells e reenen EES TEO EE eee 104 To import a saved XML file 0 0 llle 105 Doc 11546 RO3 CO 060094 vii MassARRAY Typer 3 4 Software June 30 2006 User s Guide for iPLEX and hME Copying Plate Data to the Clipboard 0 000 eee eee 106 To copy plate data to the clipboard 00 ee eee eee 106 Generating Reports lilissslsselelee 106 To generate a report llillselle ne 106 Customizing the Window Layout islsseseslele seh 110 To save the current window layout 00 e eee eee 110 To reset the window layout to the default layout 110 To load a saved layout 00 eee ee 110 To add menu items to the tool bar 0 20 eee eee 110 Customizing the Displays 000 cece tees 110 To customize the title or subtitles 0 0 0 cee eee eee 110 To customize the plot axis or style 0 2 0 ee ee 111 Creating Subsets auauua eect eee 111 To create a subset lllllllieeleeeeeeeell ellen 111 Setting Fonts e kots lg RR aa eed iga E a ar Pap a ai 111 To specify the font 0 0 ce eee 111 Customizing Subsets Points and Axis Labels 0005 112 To customize subsets points and
139. h is not HETERO Percentage of samples that A genotyping experiment available on plain genotyping data are heterozygous in Typer whose data includes peak area data You choose to capture such data when setting up th analyzer mass Creating a Skew Correction File spectrometry run for a When you generate a Genotype Area report on a genotype area experiment SpectroCHIP For more h kewine data icall d it f l information see Using eterozygous skewing data is automatically saved to a skew correction file see Chip Linker to Associate below The skewing data is used in an Allelotype Correction report to adjust the Chips with Experiments frequency estimates for alleles on page 60 MassARRAY Typer 3 4 Software 140 Doc 11546 R03 CO 060094 User s Guide for iPLEX and hME June 30 2006 Plate Definition Report Skew Correction File A skew correction file contains heterozygous skewing data for assays It serves as a repository of skewing data for various assays any new data is appended added to the existing data For each assay the relative frequencies of the lower and higher mass alleles are stored When an Allelotype Correction report is generated skewing data from a skew correction file for the applied assays are used to correct allele frequency estimates It is recommended that you create and maintain only one skew correction file Whenever you generate new skewing data by generating a Genotype Area report o
140. he Auto Run Set Up tab click Barcode Report The Barcode Report dialog box appears Note Running a bar code report is optional However it is strongly recommended It allows you to check all chip positions before starting a run During a run each chip position is checked only as it is processed All chip positions are not checked at the beginning of the run If an error status chip position is encountered the run is stopped and any remaining SpectroCHIPs are not processed Auto Run Set Up tab in ACQUIRE Barcode Report Barcode Tem dialog box j j Doc 11546 R03 CO 0600 June 30 2006 CHIP ID STATUS MAPPING ANALYSIS Chipl fassay12 Plate5_020517 foun SpectioPoint 384 to 384 384 Genotyping Chip 2 assayt2_Plate6_020517 fov fSpectroPoint 384 to 384 384 Genotyping Chip3 Assayt 2_Plate _020517 fous o fSpectroPoint 384 to 384 384 Genotyping Chip4 assayi2 Plates_020518 M ChipS fassay12_Plates_020518 EOUND SpectroPoint 384 to 384 Genotyping Each chip position should have a FOUND status which means the SpectroCHIP is properly associated with an experiment in the MassARRAY database An Error status means the SpectroCHIP has not been properly associated with an experiment in this illustration Chip 4 has an Error status See Using Chip Linker to Associate Chips with Experiments on page 60 2 Click CLOSE and correct any chip positions with an Error status Caution You may st
141. hem in the Members box e By searching for them with the Locate button Once a SNP is selected its SUSID and sequence appear If the SNP is in the SNP group currently selected for editing then the SNP is also selected in the Members box To select a SNP from the navigation tree Inthe SNP Manager dialog box click a SNP ID in the navigation tree The SNP becomes highlighted indicating it is selected To select a SNP from the Members list e In the Members box click a SNP ID The SNP becomes highlighted indicating it is selected To select a SNP using Locate 1 Type a SNP ID in the SNP ID box Note The Locate function requires the exact name of the SNP ID to locate a SNP Partial names and the wildcard character 96 may not be used 2 Click Locate If the located SNP is a member of the SNP group currently selected for editing its entry in the Members box becomes highlighted Otherwise the SNP is searched for in the database and the assay project and SNP group containing the SNP are opened with the SNP selected If the SNP ID was associated with more than one SNP having different sequences then the SUSID box contains multiple values from which to select If the SNP ID was not located in any SNP group in the database then the SUSID box contains the value New and the current sequence becomes editable 3 Click Locate again if you want the search to continue from the currently selected SNP If the same SNP is a member of m
142. hema owner To configure general settings 1 Inthe left pane click PlateEditor then click General E Configuration 3 General B Grid Plex Show Hints Sample I3 TyperAnalyzer A A Click Plate Editor to view or Click Plate Editor to view or access the settings access the settings 2 In the right pane click on General to open the General options MassARRAY Typer 3 4 Software 148 Doc 11546 RO3 CO 060094 User s Guide for iPLEX and hME June 30 2006 Configuring Plate Editor Configure the settings as follows Look and Feel Property Grid Help Height NULL Concentration Value Schema Owner Configuring the Grid Set the look and feel of the program Click and select one of the following themes from the drop down list e Office 2003 e OfficeXP e NativeWinXP Set the height of the property help window Click on the cell and enter the height Allow a NULL concentration value Click on the cell and choose True or False Set the owner of the schema Click on the cell and enter the owner name The Grid setting allows you to show hints when a user holds the mouse pointer over a button or icon on the Plater Editor user interface To configure the grid In the left pane click PlateEditor then click General 1 2 3 In the right pane click on Grid to open the Grid options Configure the settings as follows Show Hints Indicates whether hints are displayed Click in the
143. herwise or stored in a database or retrieval system for any reason other than a licensee s internal use without the prior written permission of SEQUENOM Printed in the United States of America MassARRAY Typer 3 4 Software Doc 11546 RO3 CO 060094 User s Guide for iPLEX and hME June 30 2006 TRADEMARKS SEQUENOM MassARRAY and SpectroCHIP are registered trademarks of SEQUENOM Inc MassARRAY 20K MassARRAY 200K RealSNP RealSNP com SNPCredits and iPLEX are trademarks of SEQUENOM Inc Autoflex is a registered trademark of Bruker MS DOS Windows and Microsoft are registered trademarks of Microsoft Corporation UNIX is a registered trademark of UNIX System Laboratories Doc 11546 R03 CO 060094 MassARRAY Typer 3 4 Software June 30 2006 User s Guide for iPLEX and hME This page is intentionally blank MassARRAY Typer 3 4 Software Doc 11546 R03 CO 060094 User s Guide for iPLEX and hME June 30 2006 Contents Chapter 1 MassARRAY SysteM 5 acr a n ok eoe Ace Dl Dc CR D ace ee 1 Introduction B System Administrator 20 0 0 0c teen eens 2 Procedure Overview 00 cece 3 Chapter 2 litrodUuctlon esis etree actore RC dae ah ad Rd are Rod b RR RR 5 Defining Multiplex and Uniplex sssseeeeeee II 5 Assays Assay Database Hierarchy 0 0 ee 5 AsSayEditor Basi6S scs ee epus ein erat iat antewen ees 6 Opening AssayEditor 0 cc eee eens 6 To open the AssayEditor window
144. in a group you can quickly apply the entire group to a plate There are four options 192 Bottom Half Horizontal 192 Left Half Vertical 192 Right Half Vertical and 192 Top Half Horizontal If a horizontal sample group option is selected the samples fill each well in order of left to right in the first selected row then left to right in the second row and continues until the plate is filled or the sample group ends If you prefer to fill the wells vertically then select a vertical sample group option This will apply the samples in the group from top to bot tom in the first column then top to bottom in the second column until the plate is filled or the sample group ends To apply a sample group to a plate l 2 3 4 Open a plate Select the Sample tab In the navigation tree highlight the sample group you want to apply Right click the sample group and choose the desired Apply option The samples apply to each well From the File menu choose Save OR click the Save toolbar button OR right click a well and choose Save Plate The status bar indicates the progress The 4 96 to 1 384 mapping option applies a sample group to the wells of a plate in the same way that certain automated pipettors transfer material from four 96 well plates to a single 384 well plate This transfer scheme is illustrated below Doc 11546 R03 CO 060094 June 30 2006 49 MassARRAY Typer 3 4 Software User s Guide for iPLEX and hME
145. in the cell and enter the value Optimal Call Rate Color Set the display color for above optimal threshold conservative moderate calls Click in the cell click on the button and define the color in the Color dialog box Above Success Call Rate Set the display color for above success threshold Color and below optimal threshold conservative moderate calls Click in the cell click on the button and define the color in the Color dialog box Below Success Call Rate Set the display color for below success threshold Color and above failure threshold conservative moderate calls Click in the cell click on the button and define the color in the Color dialog box Failure Call Rate Color Set the display color for below failure threshold conservative moderate calls Click in the cell click on the button and define the color in the Color dialog box Quitting the Changes you make are applied the next time Plate Editor or TyperAnalyzer are started Configuration Software To apply the changes and quit the Configuration Software Click OK To quit the Configuration Software without saving the changes e Click Cancel MassARRAY Typer 3 4 Software 154 Doc 11546 RO3 CO 060094 User s Guide for iPLEX and hME June 30 2006 Doc 11546 R03 CO 060094 June 30 2006 Appendix C Terms and Conditions LIMITED LIABILITY SEQUENOM shall not be liable to any extent whatsoever for any damages resulting from or arisi
146. inant 3 Type the value for the contaminant Copying and Pasting Items in the Expected Peaks Grid 1 Right click an item in the Expected Peaks grid and choose Copy 2 Right click inside another cell of the grid and then choose Paste The selected item is pasted into the cell Deleting Items from the Expected Peaks Grid e Right click an item in the grid and choose Delete Adding Genotype Calls When an analyte is added to the Expected Peaks grid a row is added to the Genotype Calls grid See To add analytes on page 12 for instructions on adding analytes The rows of the Genotype Calls grid represent the analytes associated with a particular MassARRAY Typer 3 4 Software 12 Doc 11546 R03 CO 060094 User s Guide for iPLEX and hME June 30 2006 Defining Assays Creating and Editing Assays genotype call The columns of this grid are where you specify what combination of observed analyte peaks lead to a particular genotype call After defining two analytes you should specify the corresponding homozygous calls for each of those peaks To specify homozygous calls 1 Type the analyte peak combination call name the genotype 2 Click the check boxes to associate calls with the analyte peaks Now the Genotype Calls grid looks similar to the illustration below Genotype Calls A G A ANALYTE A O G ANALYTE O i Example of Genotype Calls To specify heterozygous calls 1 In the Genotype Calls grid
147. ing the Display 0000 cece eee 150 MassARRAY Typer 3 4 Software x Doc 11546 R03 CO 060094 User s Guide for iPLEX and hME June 30 2006 To configure the display options 2 0 0 eee ee 151 Configuring the General Options sili ellen 151 To configure the general options 200000 cee eee 152 Configuring the Help 000 c eects 152 To configure the help file 20 0 eee eee 152 Configuring the Program Layout 0 000 c eee eee eee 152 To configure the help file 2 0 0 0 eee eee 152 Configuring Reports i lure eiie a eere D ei aia Le ae s 153 To configure reports lille 153 Configuring the Traffic Lights saasaa aaaea 153 To configure traffic lights llle 153 Quitting the Configuration Software liliis 154 To apply the changes and quit the Configuration Software 154 To quit the Configuration Software without saving the changes 154 Appendix C Terms and Conditions Doc 11546 R03 CO 060094 xi MassARRAY Typer 3 4 Software June 30 2006 User s Guide for iPLEX and hME MassARRAY Typer 3 4 Software xii Doc 11546 R03 CO 060094 User s Guide for iPLEX and hME June 30 2006 Chapter 1 Introduction MassARRAY Typer Typer is software for analyzing spectral data acquired from SpectroCHIPs Typer analyzes each spectrum based on the assay or assays applied to it An assay establ
148. is and along the diagonal see figure below Results from a less reliable assay would show data points scattered across the entire graph region The quality of the clusters reflects the quality of the assay performance Good clusters are defined as those where samples assigned common genotypes fall in the same local area on the graph Outliers may require closer examination of their spectra On a graph with red data points No Call genotype calls you may also want to view the Yield cluster graph to determine if the red data points are the result of low yield Generally a high quality P value 0 219 assay has a Log Height graph similar to the example shown here The homozygous calls are clustered along each axis and the heterozygous calls are clustered along the diagonal running through the center of the graph The Chi Square value and P value indicate the assay performs well under Hardy Weinberg Equilibrium HWE Doc 11546 R03 CO 060094 97 MassARRAY Typer 3 4 Software June 30 2006 User s Guide for iPLEX and hME Reviewing Processed Data with TyperAnalyzer Viewing Cluster Graphs MassARRAY Typer 3 4 Software User s Guide for iPLEX and hME Checking Assays for Quality Use the Typer cluster graphs and histogram graph to perform quality checks of assays on a SpectroCHIP The cluster graphs and histogram graph may be used separately or at the same time and you may also find it helpful to use them in conju
149. ishes where mass peaks are expected in a spectrum and how to interpret the presence of each peak Based on the peaks present in a spectrum Typer automatically identifies the genotype in genotyping experiments or estimates the relative frequencies of alleles in allelotyping experiments MassARRAY The following illustration shows how computers and instruments in the MassARRAY system System are networked An instrument i e liquid handler nanodispenser and analyzer or analyzer compact is represented by the computer that directly controls it All computers are networked using TCP IP MassARRAY System Required MassARRAY Analyzer or wm Optional MALDI TOF CELEEETTE Only with MassARRAY Tracking MassARRAY Liquid Handler MassARRAY Nanodispenser MassARRAY Typer Workstation t oO t te MassARRAY Typer Server eee I MassARRAY Typer Client MassARRAY Typer Client MassARRAY Typer Client There are three types of the Typer software Server Workstation and Client referred to as Typer Server Typer Workstation and Typer Client respectively Each type runs on a separate computer and serves different purposes The computers themselves are identified as Typer Server Typer Workstation or Typer Client depending on which Typer software is installed Doc 11546 RO3 CO 060094 1 MassARRAY Typer 3 4 Software June 30 2006 User s Guide for iPLEX and hME Introduction System Administrator System Administra
150. ively in conjunction with the specially designated reagent kit product catalog item no 10130 purchased from Sequenom License rights to use the iPLEX Software are not granted by or with the iPLEX Software by itself separate and apart from use in conjunction with such specially designated reagent kit product purchased from Sequenom All Software licenses shall terminate automatically and immediately if Customer fails to abide by any of the terms in this section or under this Agreement CONFLICTS In the event that a conflict arises between the language of this Proposal and any work order purchase order billing statement or invoice related to the purchase license or other transfer of any SEQUENOM products or technology or services to be provided the language of this Proposal shall govern and control and the conflicting terms provisions and conditions of any such other documents shall be deemed non existent and shall not obligate or be binding upon Customer or SEQUENOM Doc 11546 R03 CO 060094 157 MassARRAY Typer 3 4 Software June 30 2006 User s Guide for iPLEX and hME MassARRAY Typer 3 4 Software 158 Doc 11546 R03 CO 060094 User s Guide for iPLEX and hME June 30 2006
151. king at both Log Height and Yield graphs you determine it to be an assay that performs well you may choose to replace the genotype call for the assay with a manual user call See Manually Calling a Genotype on page 89 for information Or if after looking at both graphs you determine it to be a good assay you may choose to keep the genotype call as it was automatically assigned by Typer Height The Height cluster graph is similar to the Yield cluster graph but uses the reported height of allele peak signals directly rather than a measurement relative to the unextended probe peak primer signal The height axis is not normalized to a maximum of 1 0 The distribution of the data points reflect the variation in peak intensities of the individual mass spectrum recorded Doc 11546 R03 CO 060094 June 30 2006 Reviewing Processed Data with TyperAnalyzer Viewing Cluster Graphs Example of a Height graph for a reliable assay Log Height The Log Height cluster graph is similar to the Height cluster graph except log o height 1 is plotted instead of the reported allele peak heights This graph may be more useful for visualizing assay skew clustering where there is a large variation in spectrum peak intensities between wells The Log Height graph plots each assay result by low mass allele and high mass allele heights on a logarithmic scale An ideal assay has a Log Height graph with data points that fall mostly along each ax
152. l of the tree Chips contain the data from a SpectroCHIP Chips under a genotyping plate contain data from different MassARRAY analyzer runs on the same SpectroCHIP Chips under an allelotyping plate contain data from MassARRAY analyzer runs on different SpectroCHIPs Selecting a chip in the tree will display the data from the chip You can also choose to view data from groups of chips If you select an experiment and choose to view its calls then data from all chips under the experiment will be displayed If you select a plate and choose to view its calls then data from all chips from all experiments under the plate will be displayed Color Coding Genotype Analyzer uses a three parameter model to calculate the significance of each putative genotype Based on the relative significance a final genotype will be called Different parameter settings can give rise to different results Thus based on internal testing and training of the model three different sets of parameters have been developed for the model e Conservative The most conservative set makes no error on the training and test data but has the most uncalled genotypes Aggressive The most aggressive set makes the most errors still less than 1 percent but makes the most number of calls e Moderate The moderate set is a compromise between the two extremes Doc 11546 RO3 CO 060094 117 June 30 2006 MassARRAY Typer 3 4 Software User s Guide for iPLEX and hME
153. late Data Grid You may create a report of plate results as a tab delimited file When you create a report the file is automatically displayed in Microsoft Excel The following reports are available Allelotype e Allelotype Correction e Assay Type Count e Best Call Probability To generate these reports you must sas have an allelotyping license For more i Call Probability information contact SEQUENOM e Description Count e Genotype Area Plate Definition e Plate Result e Primer Adjustment Note The reporting functions are identical in the TyperAnalyzer and Genotype Analyzer modules Note Do no run Gene Expression and Genotype Cluster reports for iPLEX and hME Gene Expression and Genotype Cluster reports are not applicable to iPLEX and hME and do not produce meaningful results For a description of each report see Appendix A Reports on page 137 To generate a report on the SpectroCHIP Multiple 1 In the tree control I TyperAnalyzer chips represent multiple select the chip on a window analyzer runs on the same which you want a SpecirocHIE report Then right click the chip and select lt Name gt Report where Z lt name gt is the name of the report listed j MassARRAY Typer 3 4 Software 106 Doc 11546 R03 CO 060094 User s Guide for iPLEX and hME June 30 2006 Reviewing Processed Data with TyperAnalyzer Generating Reports E Customer EDAM Allelotype
154. lement right to practice iPLEX and MassEXTEND methods Such license right granted is limited to one time use for the number of elements provided per SpectroCHIP array chip purchased For example Sequenom s SpectroCHIP 384 array chip is provided with 384 elements Sequenom s SpectroCHIP 96 array chip is provided with 96 elements Such license right is granted for customer s internal research and development purposes only and not for commercial use Customer may not practice Sequenom s patented methods for providing services to third parties in exchange for fees or other consideration without written permission from Sequenom Re manufacture or re use of Sequenom s SpectroCHIP array chips and elements with Sequenom s patented MassARRAY Typer 3 4 Software 156 Doc 11546 RO3 CO 060094 User s Guide for iPLEX and hME June 30 2006 DNA analysis methods is prohibited Other than as expressly set forth above no license rights are granted or implied SOFTWARE LICENSING For purposes of this section Software means computer software or programs supplied by Sequenom to the Customer under this Agreement including but not limited to such software that is embedded in or forms an integral part of Sequenom s hardware products in addition to separately provided software for application specific or other purposes For purposes of this section Software does not include Oracle Corporation software products provided by Sequenom a
155. lick Save Save As Save in ReportT emplates c e maem ke Allelotype AllelotypeCorrection E AllelotypeNode tcl Es AllelotypeSkew tcl amp AssayTypeCount e BestCallProbability E BestCallProbability tcl e CallProbability E crm R E DescriptionCount 23 GeneExpression El GeneExpression A R Study hME AF PLATE 4 SP5 E GeneExpression A Ecl I genoclust R e GenoQCCluster s GenoQCCluster A tcl I GenoQCCluster B tcl E Genotype tcl 17 Save as type fall Files Selecting a report type x Cancel Default Name A default report file name is in the form customer project plate experiment chip If you selected a plate the default name only goes to plate i e customer project plate Similarly if you selected a chip the name goes to chip When you click Save the report is generated The report is displayed in Excel For descriptions of report contents see Appendix A Reports on page 137 MassARRAY Typer 3 4 Software 134 User s Guide for iPLEX and hME Doc 11546 R03 CO 060094 June 30 2006 Reviewing Processed Data with Genotype Analyzer Manually Calling a Genotype Man ually You can override the automatic call by manually calling the genotype Calling a Genotype To manually call a genotype in the Sequenom AF Study tab le SAMPLE ID CALL ASSAY ID s5 T 06145
156. ll Frequencies V Frequency Uncertainties Peak Areas Peak Area Variants Iv Fractional Unextended Primer Peak Area IV Fractional Pausing Peak Area General MV SAMPLE ID DN M CALL jv ASSAY ID jv DESCRIPTION ENTRY OPERATOR Cancel Iv WELL POSITION Column names Click OK To export wells From the File menu select Export Export wells Enter well positions separated by pot Export All Wells 104 Checking an item means you want the column displayed Clear any item you want hidden from view Frequency Uncertainties and Frequency Err 2 Delta 1 and Delta 2 Under Calibration Status and Frequency Analysis you can also choose to hide all items in the group To do so select Hide All You can export some or all of the wells in the current chip to an XML file A saved XML file can be imported back into TyperAnalyzer In the Export Wells dialog box enter the wells to be exported separated by commas or check the Export All Wells check box and click Next MassARRAY Typer 3 4 Software User s Guide for iPLEX and hME Doc 11546 R03 CO 060094 June 30 2006 Reviewing Processed Data with TyperAnalyzer Importing and Exporting Wells 3 In the Save As dialog box enter or select an XML file and click Save Save in amp Temp ek E3 My Recent Documents My Network Fle name anel_020205_10plex_Splex_020205_1 1 BO v laces Save as typ
157. lotyping Note If there is no check mark next to Show Calibration calibration and mass shift columns are already currently hidden Selecting Show Calibration will show these columns For a genotype area experiment the color coding of the rows is done on the same basis as for genotyping experiments by the strength of calls see Color Coding on page 117 The columns in the table however are the same as for an allelotyping experiment It includes data about peak areas and allele frequencies For instructions on using the results table see Using the Results Table Allelotyping below skip the first section on color coding Color Coding The columns and color coding in the results table for an allelotyping experiment are different from that for a genotyping experiment Instead of color coding by strength of genotype calls the rows are color coded according to whether each well is polymorphic both alleles found or non polymorphic only one allele found The following table describes the color coding scheme Table 4 Genotype Analyzer Color Codes for Allelotyping Color Description Green Polymorphic both alleles present Cyan Non Polymorphic one allele present Uncertain the average frequency of one allele is less than or equal to 3 times Pink the standard error of the frequencies before averaging Yellow Low Frequency one of the alleles has a frequency of 0 06 i e 6 or less an
158. ls it may actually take longer than the time interval you set for Typer to display each successive spectra If there are a large number of calls there may be a longer time interval between the spectra If you want to stop the display of the spectra before the last one is shown click Stop Auto Scroll tool The display of the spectra may not immediately stop There is a slight lag time between your click of the Stop Auto Scroll tool and the actual stopping of the spectra display A few more spectra may be displayed before it stops Generating You may create a report of plate results as a tab delimited file When you create a report Reports the file is automatically displayed in Microsoft Excel The following reports are available Tab Delimited File A file containing plain text items separated by a tab character Each line of data is separated by a carriage return character Note e Allelotype e Allelotype Correction e Assay Type Count e Best Call Probability To generate these reports you must m have an allelotyping license For more Call Probability information contact SEQUENOM e Description Count e Genotype Area Plate Definition Plate Result e Primer Adjustment The reporting functions are identical in TyperAnalyzer Traffic Lights and Genotype Analyzer For a description of each report see Appendix A Reports on page 137 Doc 11546 R03 CO 060094 June 30 2006 131 MassARRAY
159. n changes to the layout last saved To restore the default layout 1 On the Options menu select Layouts 2 Click Reset Layout MassARRAY Typer 3 4 Software 58 User s Guide for iPLEX and hME Doc 11546 R03 CO 060094 June 30 2006 Chapter 4 Introduction Overview of Acquiring Spectra The ACQUIRE module of Typer controls a MassARRAY analyzer compact autoflex or biflex to acquire spectra from SpectroCHIPs As each SpectroCHIP is processed by the analyzer the spectral data is automatically processed and saved to the MassARRAY database which resides on a MassARRAY Typer Server For specific information on using the MassARRAY analyzer see the documentation for the specific system that you are using e MassARRAY Analyzer Compact See the MassARRAY Analyzer Compact User s Guide Part Number 11533 for instructions e For users of the Bruker Autoflex see the MassARRAY Typer User s Guide Autoflex Part Number 11530 e For users of the Bruker Biflex see the MassARRAY Typer User s Guide Biflex Part Number 11531 Note ACQUIRE is available only on a Typer Workstation It is not available on a Typer Server or on Typer Clients This section provides an overview of the main steps involved in acquiring spectra from Acquiring SpectroCHIPs and saving the spectral data to the MassARRAY database Spectra The main steps are 1 Start the MassARRAY RT software 2 Associate SpectroCHIPs and experiments using
160. n genotype area data you should save it to the same file This way you are assured you are applying the most up to date skewing correction for an assay Note The reporting functions are identical in the TyperAnalyzer and Genotype Analyzer modules The same skew correction file should be used regardless of whether you are generating reports in the TyperAnalyzer or Genotype Analyzer module Plate Definition The Plate Definition report is useful when you want to see what assays and samples are Report applied to the wells This report lists the contents of each well Plate Result The Plate Result report lists the call for each well Report Primer iPLEX Adjustment Report To get optimal results it is recommended that you select one of the three options A B or C in Plate Editor that account for inverse relationship between analyte mass and signal to noise ratio Still non predictable variations in peak heights can occur These variations may stem from inconsistent oligonucleotide quality and poor desorption ionization behavior in MALDI The Primer Adjustment report allows you to account for these variations and refine your adjustment from the sprectra from the actual oligo mixture This combination offers the best chance of success and is recommended if your plan to use the same primer mixture over a large number of samples For more information see Appendix A of the iPLEX Application Guide After performing the procedures described in
161. n the Description column Use one row for each sample When you apply an entire sample group to a plate the order of the samples determines to which well each sample is applied The samples are applied in the order in which they appear in the sample group For more information see Sample Order and Applying Sample Groups on page 39 Note You can import sample names and descriptions from a Microsoft Excel file See Applying Sample Group Mapping on page 53 or Importing and Exporting Plate Table Information on page 42 MassARRAY Typer 3 4 Software 38 Doc 11546 R03 CO 060094 User s Guide for iPLEX and hME June 30 2006 Defining Plates Creating Samples 7 Click OK The sample group is saved and you are returned to the PlateEditor window Click the plus symbol next to sample Under sample the name of the new sample group you created appears Note If you want to return to the PlateEditor window without saving the sample group click Exit Sample Order and Applying Sample Groups The order in which samples are entered in a sample group determines how they are applied to a plate For information about applying sample groups to a plate see Applying Sample Groups on page 49 Samples can be applied to a plate either horizontally or vertically Note You can individually apply any sample to any well This section describes how sample order affects the application of an entire sample group to a plate To specify the s
162. n to general data for allelotyping experiments General Data Columns that appear for both genotyping and allelotyping experiments The options under Frequency Analysis are not necessarily the column names instead they are the types of data in the columns Use the following illustration to match an option to a column The options in the Data Field Display Calibration Status section are the exact column Calibration Status Show Specified Hide All Iv CALIBRATION M MASS SHIFT names Frequency Analysis Show Specified Hide All Frequency 1 and Frequency 2 IV Frequencies IV Frequency Uncertafffy Area 1 and Area 2 IV Peak Areas Peak Area Errors Frac UEP M Fractional Unextended Primer Peak Area Frac Pause Fractional Pausing Peak Area RASTERS V RASTERS General M SAMPLE ID jv CALL jv WELL POSITION ENTRY OPERATOR Cancel The options in the General section are the exact column names Iv ASSAY ID M DESCRIPTION Column names 3 Click OK MassARRAY Typer 3 4 Software 126 User s Guide for iPLEX and hME Checking an item means you want the column displayed Clear any item you want hidden from view Frequency Err 1 and Frequency Err 2 Delta 1 and Delta 2 Under Calibration Status and Frequency Analysis you can also choose to hide all items in the group To do so select Hide All Doc 11546 R03 CO 060094 June 30 2006 Reviewing Processed Data with Genotype Analyzer Printing the
163. n tree 0 000 eae 20 To select a SNP from the Members list 0000000 00 20 To select a SNP using Locate 0 0 0 c cece ee eee 20 SNP Groups dele he i ei ok de ee hee aed 20 Creating SNP Groups 0000 c cette ee 21 To create a SNP group 0 00 eee eee 21 Adding SNPs to SNP Groups 000 cece eee eee eee 21 To add SNPs toa SNP group 000 c cece eee 21 Removing SNPs from SNP Groups 2002 0c ee eee eee eee 22 To remove a SNP froma SNP group 0000 ee eee eee 22 SNPS statis Saha ae ete RT ed aid dh Pave woe et AT 22 Creating New SNPs 0 0000 tees 22 To create a new SNP by modifying an existing SNP 22 To create a new SNP 0 0 ct lees 22 Associating SNPs with Assays 0 00 0c cece eee eee 23 To associate a SNP with an assay 0 00 0c eee eee eee 23 Exporting SNBS s idu Behe arte ere ee ea el a Ub eid 24 To export SNPSs Zire wow sea baa Se e aw CRTRUR Owe e a tals Who 24 Deleting SNP Groups 0 0 0 cece teens 24 Toremovea SNP ccc tte n eens 24 To delete a SNP group ssssssslee essen 24 Moving Copying and Deleting Groups 0 000 e eee eee eee 24 MassARRAY Typer 3 4 Software ii Doc 11546 RO3 CO 060094 User s Guide for iPLEX and hME June 30 2006 Moving GrOUps usas acerca na dre Gade Ped s aos or OD d 24 To MOVE a group ise M
164. nalyte G ANALYTE COCAGCGATAGCAGCO 4916 2 Analyte peaks on the Expected Peaks grid In the example illustration above the analyte masses are colored pink This is a warning that their masses are close together lt 30 Da for iPLEX or lt 50 Da for MassEXTEND At least 30 Da from allele peaks and peaks from other assays is recommended for iPLEX 50 Da for MassEXTEND However an allele peak from the same assay can be as close as 16 Da in the iPLEX or MassEXTEND chemistry The software does not distinguish between the two cases and will flag any mass pair with than 30 Da 50 Da for MassEXTEND difference between them If a particular grid cell value is missing or invalid its background color is red Or if the masses between two analytes are closer than 5 Da the grid cell is colored red To add probe sequence and sequence mass 1 On the Edit Assay tab double click inside the Expected Peaks grid and then type the appropriate values for probe sequence and sequence mass An assay must have at least a probe sequence defined with an ID sequence and sequence mass When you tab away from editing a sequence its value is tested for syntax and the mass of the sequence is calculated in the Sequence Mass Calculator dialog box Doc 11546 RO3 CO 060094 11 MassARRAY Typer 3 4 Software June 30 2006 User s Guide for iPLEX and hME Defining Assays Creating and Editing Assays Note Not all oligo mass calculation options may
165. nance as prescribed in the operator manuals 3 moving by other than SEQUENOM authorized personnel the MassARRAY System from its installed location 4 exposure of the MassARRAY Products to Bio Safety Level 3 or 4 as defined by the United States Occupational Health and Safety Administration agents or 5 exposure to radioactivity SEQUENOM 5 sole obligation and liability for any breach of the limited warranty set forth herein shall be at SEQUENOM s sole discretion and option 1 to replace the MassARRAY Products in whole or in part provided that the USER notifies SEQUENOM of the defects SEQUENOM directs the USER to return the defective MassARRAY Products to SEQUENOM and the USER returns the MassARRAY Products as directed at SEQUENOM s expense or 2 to repair and recalibrate as necessitated by repair the MassARRAY Products in whole or in part MassARRAY Products may not be returned to SEQUENOM under any circumstances without SEQUENOM s prior authorization SEQUENOM shall not be liable to any extent whatsoever for any damages resulting from or arising out of the use or performance of the MassARRAY Products provided regardless of foreseeability or the form of the cause of action whether in contract breach of warranty tort including negligence strict liability or otherwise and including but not limited to damages resulting from loss of data loss of anticipated profits or revenue or any special direct indirect incidental or
166. nction with the spectrum graph The section below provides instructions for viewing a cluster graph See Printing a Cluster Plot Graph on page 101 for instructions on viewing a histogram graph To view a cluster graph 1 In the navigation tree select a chip Then click a well to select it The cluster graph for the selected well appears in the Cluster Plot pane Cluster Plot pane On the tool bar drop down list select one of the following Log Height plots each assay result by low mass allele and high mass allele heights on a logarithmic scale e Yield plots each assay result by height of extension products The graph is updated according to your selection To perform a quality check of an assay do the following e View the Log Height graph to determine how well the assay fits HWE and to see how well the genotype calls are clustered e View the Yield graph to see how the extension reaction performed or to determine if the No Call genotype calls red data points were made as the result of a lack of extension product To zoom in on a particular cluster or data point click and drag the cursor around an area on the graph The graph view is updated to display only the selected area 98 Doc 11546 R03 CO 060094 June 30 2006 Reviewing Processed Data with TyperAnalyzer Viewing Cluster Graphs Manually Calling a Genotype in the Cluster Plot Pane You can override an assay call or no call by manuall
167. nd select Export Dialog The Exporting lt assay name gt dialog box appears where lt assay name gt is the name of the assay Under Export select Text Data Only Under Export Destination select File or Clipboard If you selected File as the Export Destination click Browse A Save As dialog box appears Choose a folder and enter a name for the file Then click Save Click Export The Export lt assay name gt dialog box appears 88 Doc 11546 R03 CO 060094 June 30 2006 Reviewing Processed Data with TyperAnalyzer Plate Data Tab Options Plate Data Tab 6 Select the export options you want 7 Click Export Manually Calling a Genotype Options You can override an assay call or no call by manually calling a genotype You can manually call a genotype in the results table on the Plate Data tab To manually call a genotype in the results table 1 Click the Plate Data tab to view the results table 2 Inthe results table right click on the row of the assay call you want to override and select the call you want to make No Call Right click menu for manually calling genotypes Calls are made locally and not saved to the database unless you save them 3 To save the change to the database click the Save icon or select Save Changes from the File menu Selecting and Sorting Data To sort the table by a column in ascending order e Click on the column header To change the currently selected data e Click on a
168. ng out of the use or performance of this system and related documentation or the procedures specified in this manual regardless of foreseeability or the form of action whether in contract tort including negligence breach of warranty strict liability or otherwise and including but not limited to damages resulting from loss of data loss of anticipated profits or any special indirect incidental or consequential damages In no event shall SEQUENOM s liability to the user exceed the amount paid by the user to SEQUENOM hereunder The USER assumes full responsibility for the results obtained from the use of this system and related documentation and for application of such results This system is for research use only and is not to be used for diagnostic purposes THE USER IS HEREBY PUT ON NOTICE THAT SEQUENOM S MASSARRAY PRODUCTS AND iPLEX AND MassEXTEND METHODS AND PROCESSES HAVE NOT BEEN SUBJECTED TO REGULATORY REVIEW OR APPROVED BY THE FEDERAL FOOD AND DRUG ADMINISTRATION OR ANY OTHER UNITED STATES GOVERNMENTAL AGENCY OR ENTITY AND HAVE NOT BEEN APPROVED FOR CLIA COMPLIANCE OR OTHERWISE APPROVED UNDER ANY STATUTE RULE LAW OR REGULATION FOR ANY PURPOSE RESEARCH COMMERCIAL DIAGNOSTIC OR OTHERWISE LIMITED WARRANTY Limited Warranty Relating to MassARRAY Products SEQUENOM warrants that the MassARRAY System will be free from defects in materials and workmanship and will conform to SEQUENOM s current specifications and perform
169. o 24plex primer WA 01 377623 multiplex validation 7 12plex tag AssayProjectlnitialDefault paeem 1 01 24plex_w4w7 W4_02_276901 multiplex_validation_7 12plex tag AssayProjectinitiaIDefault 01 24plex w4w7n W4 03 385985 multiplex validation 7 12plex tag AssayProjectlnitiaiDefault 01 1 24plex wn Wi 04 310334 multiplex validation 7 12plex tag AssayProjecthniiaDefaut 01 1 24pexes act WA4 05 368140 multiplex validation 7 12plex tag AssayProjectlnitialDefault 01 1 1 1 1 Jon A B c D E F G E I J K 5 M N o p Concentration Hide Plex Level False Show Selected Assay True No Sample ID CROSS No Sample ID Color Bi 150 150 150 Jnique A y EEEEEEEEEEEREEEREEEREREEEEEEEEEE 24plexPCR 24plexPCR324 W4 06 299531 multiplex validation 7 12plex tag AssayProjectiniiaIDefautt 01 v W4 07 205008 multiplex validation 7 12plex tag AssayProjectinitiaIDefault 01 Wi NR PERNA mulfinlev validatinn 7 12nlev tan A savPrniertinitiaIefault 01 Ready Num Status Bar ar PlateEditor window PlateEditor Window The main areas that you work with in the PlateEditor are explained below Menu Bar and Toolbar Apply commands from the menu items The more frequently used commands are also represented in toolbar buttons Message Bar This area is located in the lower part of the window It displays messages regarding the current state of the program Status Bar When opening or saving a plate the status bar indicates the progress
170. oc Heb SNPOUU G SNPODUL AG Conservative Conservative Auto Bin Auto Run Set Up Disabled Marna Contd Disabled N UE MOELCE S Dd ODE ED dC dD K DDR DD E E XOU WOOD DEBESSSSERSSSSESESEESSSEESEN SpectroCHIP Diagram Shows the status of each well using color codes Light blue Dark blue Green with plus symbol Red with minus symbol Waiting to be processed Well will not be processed Conservative or moderate call In multiplexed assays all assays must yield a moderate or better call Aggressive call no call bad spectrum or no spectrum In multiplexed assays just one assay yielding an aggressive call no call or bad spectrum will cause the well to be marked in red Red may also mean no allele found Primer peaks were found but extension products were not detected Negative control generally gets a red well 69 SEQUENOM SpectroCHIP Information Shows the name and mapping type for the current SpectroCHIP also a SCOUT plate diagram shows the status of each SpectroCHIP using color codes Yellow Currently being processed Light blue Waiting to be processed Dark blue Chip position is empty Green Processed Red Bad SpectroCHIP name Double click on the chip to view error details MassARRAY Typer 3 4 Software User s Guide for iPLEX and hME Acquiring Spectra Unloading SpectroCHIPs from the Genotype Analyzer Unloading For detailed instructi
171. ojects Managing You may add or delete entire assay projects in the database Before you can delete an Assay assay project it must first be emptied See Emptying and Deleting Assay Projects Projects on page 18 for instructions Adding Assay Projects To add assay projects 1 On the File menu choose Project Administrator The Assay Project Administrator dialog box appears Assay Project Administrator Add New Assay Project Change Assay Project Name TrainingDemo v Delete Assay Project Administrator dialog box 2 Type a name for a new assay project and then click Add 3 Click Close to exit the dialog box Emptying and Deleting Assay Projects An assay project must be emptied of its contents assays assay groups and SNP groups before it can be deleted from the database Only assays or assay groups that have not been associated with experimental data may be deleted You may move an assay group or SNP group into another assay project which removes it from its original assay project See Moving Groups on page 24 for information To empty assay projects 1 Onthe Assay Group tab select an assay group Then right click the selected assay group and choose Delete Assay Group Or select an individual assay and then right click it and choose Delete Assay 2 Inthe message box that appears click Yes to confirm the deletion To delete assay projects 1 On the File menu choose Project Administ
172. ok similar to the illustration below Genotype Calls A G AG T AT A ANALYTE W V LJ V LJ e ANALYTE O iM Vf L1 DL M TANALYTE LI LJ E M M IU Example of Genotype Calls for tri allelic SNP Copying Assays You can copy and paste an assay into another assay group on the Edit Assay tab The steps for copying the contents of an assay are the same as those for editing assays already associated with a design run See the section below for instructions Copying Assays for Editing You may not change the definition of assays that are associated with designs or that have been run The only way to edit assays associated with a design or that have been run is to copy these assays to a new assay group and modify them To edit assays associated with a design 1 On the Edit Assay tab click Copy A copy of the currently selected assay is created The copy unlike the original is available for editing 2 If you plan to save this copied assay to the same assay group as its original you must change the Assay ID to a new name Or if you plan to save this copied assay to a different assay group than its original select an assay group from the Assay Group drop down list 3 Make changes to the assay as needed See Adding Items to the Expected Peaks Grid on page 11 and Adding Genotype Calls on page 12 for instructions 4 Click SAVE to save the assay If the SAVE button is unavailable it means either no changes have been
173. on The low yield cutoff is approximately 0 25 data points below this cutoff should Doc 11546 R03 CO 060094 95 MassARRAY Typer 3 4 Software June 30 2006 User s Guide for iPLEX and hME Reviewing Processed Data with TyperAnalyzer Viewing Cluster Graphs Chemistry Issues Certain assays those you determine to be poor performers or to have inefficient extension reactions may need to be re designed For information on chemistry and cluster graphs see the MassARRAY Typer Reference Manual MassARRAY Typer 3 4 Software 96 User s Guide for iPLEX and hME have genotype calls of No Call which may be the result of low yield and or other performance factors Generally a high quality assay has a Yield graph similar to the example shown here The homozygous calls are clustered at the outer edge of each axis and the heterozygous calls are clustered near the middle You can imagine a diagonal line connecting each of the cluster groups The Chi Square value and P value indicate the assay performs well under HWE Example of a Yield graph for a reliable assay The Log Height and Yield graphs provide different types of information In general you may want to look at an assay s Log Height graph first and then at its Yield graph If the Log Height graph shows weak clustering or the Yield graph shows low yield then you may need to examine the spectra to determine if the assay is unstable Or if after loo
174. ons on unloading SpectroCHIPs see the user s guide for the specific SpectroCHIPs MassARRAY Analyzer that you are using as described at the beginning of this chapter from the Genotype Caution Do not unload SpectroCHIPs while ACQUIRE is acquiring spectra Wait Analyzer until the acquisition run is complete If you want to stop the run before it is done see the next section Stopping an Itis recommended you allow an automatic run to complete However if you must stop Automatic the automatic run before it is done see the following instructions Run To stop an automatic run Under Run click Stop Auto Run 2 If spectra has been acquired from any SpectroCHIP wells the following dialog box appears If spectra has not yet been acquired for the current SpectroCHIP this dialog box does not appear the run stops Do not complete the remaining steps xl 4n automatic run is in progress How would you like to proceed C Stop and discard the data that has been collected on the currently running chip C Stop and store the data from the current chip C Stop the automatic run after completing the current chip NI Continue with the automatic run Resumes the run from where it left off Stop and discard the data that has been collected on the currently running chip Stops the run Any spectral data acquired for the current SpectroCHIP is discarded Important If you want to rerun the SpectroCHIP later and save it to the experiment cu
175. oom out e Click the Zoom Out toolbar button amp To horizontally zoom in on an area 1 Use the mouse to click and drag over the area in the spectrum that you want to zoom in on 2 Repeat for more zooming To revert to the default size e Right click the spectrum The spectrum reverts to its original size no matter how much you zoomed in Setting an Absolute Y Axis Maximum The spectra are not shown to the same scale along the y axis intensity In one spectrum the y axis may go up to 500 In another it may only go up to 350 Each spectrum is displayed with the y axis scaled to best show the spectrum You can choose to view all spectra scaled to the same maximum y axis value allowing you to better judge the relative intensities of peaks in different spectra To set a y axis maximum for the spectrum display e On the toolbar at the top of the First type a maximum value Genotype Analyzer window type a maximum value and click the check Set Abs Y Max V 400 box for Set Abs Y Max Then check this box Doc 11546 RO3 CO 060094 129 MassARRAY Typer 3 4 Software June 30 2006 User s Guide for iPLEX and hME Reviewing Processed Data with Genotype Analyzer Viewing the Calibration Spectrum Note Be sure to type the maximum value first and then check the Set Abs Y Max box Viewing the To view the calibration spectrum Calibration 1 If you have not done so already split the view to see spectr
176. op SNPs from the SNP Manager dialog box navigation tree into the Members box Select an assay project from the Assay Project drop down list The new SNP group will be saved to the selected assay project Once the current SNP group contains all the SNPs you want click SAVE to save it to the database Adding SNPs to SNP Groups While creating or editing a SNP you can add SNPs to the current SNP group To add SNPs to a SNP group 1 Doc 11546 RO3 CO 060094 June 30 2006 Select an existing SNP See Selecting SNPs on page 20 for instructions Or create a new SNP See Creating New SNPs on page 22 for instructions Information for the selected SNP is loaded into the right side of the SNP Manager dialog box To add SNPs to the current SNP group do either of the following e Click Add SNP to Group to add the selected SNP to the SNP group currently being edited e Or drag and drop SNPs from the SNP Manager dialog box navigation tree into the Members box Click SAVE to save your changes 21 MassARRAY Typer 3 4 Software User s Guide for iPLEX and hME Defining Assays SNPs Removing SNPs from SNP Groups To remove a SNP from a SNP group 1 2A 3 4 In the Members box select a SNP ID The Add SNP to Group button changes to the Remove SNP from Group button Click Remove SNP from Group To remove all SNPs from the Members box click Empty Click SAVE to save your changes Yo
177. op down list and select the particular SNP to associate with the assay Continue specifying the contents of the assay See Adding Items to the Expected Peaks Grid on page 11 and Adding Genotype Calls on page 12 for instructions Click SAVE to save the assay If the SAVE button is unavailable it means either no changes have been made to the assay or certain required data is missing Review the Edit Assay tab and make the necessary changes To edit description text 1 2 On the Details tab click Edit Description The Edit Description dialog box appears AssayEditor Edit Assay Group Description Description Text Cancel Edit Description dialog box Type a new description and then click SAVE Deleting Assays To delete an assay 1 On the Assay Group tab click an assay to select it 2 Right click the selected assay and choose Delete Assay Doc 11546 RO3 CO 060094 June 30 2006 15 MassARRAY Typer 3 4 Software User s Guide for iPLEX and hME Defining Assays Editing Assay Groups To view design summary 1 On the Assay Group tab select an assay or assay group by clicking it 2 Inthe right pane click the Details tab if it is not already selected 3 Onthe Details tab click View Design Summary If there is a Design Summary file associated with the currently selected assay or assay group the file is displayed Editing You can add or delete assays stored in a group or you
178. or Cancel to maintain the original name The Work Window The right pane of the AssayEditor window lists details or task options for whatever item is currently selected in the navigation tree any work to be performed editing creating new items etc is done in this window pane The right pane provides three tabs which are described in the following sections Details tab The Details tab displays information about the currently selected item in the navigation tree This information may be copied and pasted into another application The description text displayed for certain items may be edited See To edit description text on page 15 for details For assays and assay groups that have associated design parameters you may view the associated Design Summary file See To view design summary on page 16 for details Edit Assay tab The Edit Assay tab displays editable information for the assay currently selected in the navigation tree If the assay is part of a locked definition assay group or has been associated with experimental data some information may not be available for editing Edit Group tab On the Edit Group tab reference assay groups may be viewed edited or created Assays plexes and assay groups from the Assay Group tab may be dragged into the Edit Group tab to become part of the currently selected reference assay group Assays can be directly imported into the database using AssayEditor as long as they follow the As
179. ore than one SNP group these occurrences are highlighted in the navigation tree as they are located 4 Ifthe SNP ID is associated with multiple DNA sequences click the SUSID drop down list and select an individual SNP SNP Groups SNPs must belong to at least one SNP group New SNPs cannot be saved to the database until they are assigned to a SNP group While you are creating a new SNP or editing an existing SNP you can create and or edit a SNP group in the SNP Manager dialog box See Creating New SNPs on page 22 for instructions on creating SNPs from scratch of by modifying an existing SNP MassARRAY Typer 3 4 Software 20 Doc 11546 R03 CO 060094 User s Guide for iPLEX and hME June 30 2006 Defining Assays SNP Groups Tip Drag and Drop To drag and drop an item click it and hold down the mouse button Then drag the cursor across the screen and into the desired location Release the mouse button to drop the selected item into the desired location Creating SNP Groups Create a new SNP group while creating or editing a SNP To create a SNP group 1 Select an existing SNP See Selecting SNPs on page 20 for instructions Information for the selected SNP is loaded into the right side of the SNP Manager dialog box In the SNP Grp box type a name for the new SNP group To add the currently selected SNP to the new SNP group click Add SNP to Group To add other SNPs to the SNP group drag and dr
180. ose Add Doc 11546 R03 CO 060094 47 MassARRAY Typer 3 4 Software June 30 2006 User s Guide for iPLEX and hME Defining Plates Applying Assays and Samples to Wells These wells already have samples no X The color indicates an assay appears is applied to these wells s 7 9 9 1011 1212 14 15 16 17 19 1920 21 22 23 26 20979952 This sample is selected pant TT Samples tab These wells are selected nce the Add command is selected the sample information will appear in the Plate Table The sample is applied to the wells Once applied the X within the well contained in the Plate Layout disappears and the name of the sample appears in the Plate Table 6 From the File menu choose Save OR Click the Save toolbar button OR Right click the selected wells and choose Save Plate The status bar indicates the progress To apply samples to a region 1 Onthe Samples tab select the samples you want to apply 2 Inthe Properties pane set Keep in Selected Region to True 3 On the plate layout click a well and then drag the cursor across a region of the plate The selected region becomes highlighted 4 Right click the sample group and choose Apply MassARRAY Typer 3 4 Software 48 Doc 11546 R03 CO 060094 User s Guide for iPLEX and hME June 30 2006 Defining Plates Applying Sample Groups Applying Sample Groups Applying Sample Groups Using 4 96 to 1 384 Mapping If you have samples
181. ose the dialog box or Apply to apply your changes and continue customizing MassARRAY Typer 3 4 Software 110 Doc 11546 R03 CO 060094 User s Guide for iPLEX and hME June 30 2006 Reviewing Processed Data with TyperAnalyzer Customizing the Displays To customize the plot axis or style 1 2 Right click on either the Spectrum Cluster Plot or Histogram pane In the Customization dialog box click on the Cluster Plot tab To modify the axis select the Axis Intensity or Axis 2 through Axis 6 To modify the plot style select from the following options Area Bar Line Points Points BestFitCurve Points BestFitLine Points Line Points Spline or Spline To specify a companion plot style select from the following options Line Points Points BestFitCurve Points BestFitLine Points Line Points Spline Spline Click OK to save your changes and close the dialog box or Apply to apply your changes and continue customizing Creating Subsets You can specify subsets to include in the graph To create a subset 2 Right click on either the Spectrum Cluster Plot or Histogram pane In the Customization dialog box click on the Subsets tab Select a subset from the Subsets to Graph list Use the scrollbar to scroll through 0 through n Current subset number is displayed in text box Click OK to save your changes and close the dialog box or Apply to apply your changes and continue customizing Set
182. otype Analyzer Starting Genotype Analyzer Starting To start Genotype Analyzer Genotype From the Typer window select the Genotype Analyzer button Analyzer td MassARRAY Typer Eile Application Help Assay Typer Genotype Editor Editor Analyzer Analyzer Click Genotype Analyzer 2 If you have not yet connected to the MassARRAY database the Connect to Database dialog box opens Enter the appropriate information 3 Onceconnected Genotype Analyzer opens Finding and Typer data in Genotype Analyzer is organized into a tree The tree has multiple levels Selecting Data each successive level is indented to the right Each level of the tree represents a different type of item There are three different ways to view the Typer Tree tabs data in the tree sorted by project assay group below the tree zs xm age Sorted by Date Assay Project Group called test in Genotype Analyzer or date Use the tree tabs to switch between the views The data is the same the three views are simply different ways to organize it For example use the Date tab to find data grouped by the date on which it was created By Project The tree is organized into the following First root level is levels EGE Customer always Customer E Allelotyping Customer e Customer My Control Assays e E Mi Lab 1 4 Project Proje
183. owing instructions Doc 11546 RO3 CO 060094 53 MassARRAY Typer 3 4 Software June 30 2006 User s Guide for iPLEX and hME Defining Plates Viewing Applied Assays and Samples Viewing Use the Plate tab to identify the assays and samples that are applied to the plate Expand Applied the tree nodes and click a specific plate to view Once selected its contents are indicated Assays by Plate Layout and detail appears in the Plate Table Assays appear different colors and depending on the amount of assays added A well that is solid in color indicates the Sam ples presence of a sample Working Clearing Wells with Plates You can remove the assays or samples that are currently applied to wells If you want to change what is applied to a well clear the well before applying the proper assay or sample If an existing plate can be used to create a new plate make a copy To clear a well 1 2 3 4 On the navigation tree select the plate whose wells you want cleared On the plate grid highlight the wells you want cleared Right click the selected wells and then choose Clear Select to clear either the assay the sample or all The assays or samples are removed from the selected wells as indicated by an empty well Opening Plates The Plate tab shows all the plates present in the database in a navigation tree organized by Customer and Project To open a plate On the Plate tab navigation tree select a plat
184. paste the concentrations Note The default values for options A and B show the recommended stock oligo concentrations which require no adjustment 4 If option C is selected change the aliquot volume to reflect the amount of fluid used to pipette in step 1 This value is not applicable if using options A or B Doc 11546 R03 CO 060094 57 MassARRAY Typer 3 4 Software June 30 2006 User s Guide for iPLEX and hME Defining Plates Changing Layout Options 5 Inthe Stock Oligo Concentration column click in the applicable fields and type the appropriate concentration values 6 To copy the contents to a spreadsheet click the Copy Table button Open a spreadsheet in Excel and paste the contents Use the printouts to help set up reactions 7 Click Cancel to close the screen Changing You can rearrange the positioning of the Plate Table Properties Plate Layout and Plates Layout areas to create one customized layout Do so by clicking and dragging the title bar of each Options area to its desired position Resize the area as necessary by clicking and dragging a corner or edge of the window It is possible to change back and forth between a customized layout and the original default layout To save a layout 1 On the Options menu select Layouts 2 Click Save Layout 3 Click Yes to make the layout the default To load a layout 1 On the Options menu select Layouts 2 Click Load Layout The scree
185. per 3 4 Software User s Guide for iPLEX and hME Type the ID for the new SNP in the SNP_ID box Click Locate If the SNP_ID does not yet exist in the database the SUSID box displays lt New gt indicating a new SNP is being created 22 Doc 11546 R03 CO 060094 June 30 2006 Defining Assays SNPs If a SNP or SNPs already exist in the database with this same SNP ID it is selected To create a new SNP with this same SNP ID select New from the SUSID box and then modify the Sequence value 3 Type or paste the sequence into the Sequence box Click Test to test the syntax of the SNP sequence you entered If the SNP syntax is valid then the total SNP sequence length and number of SNPs are reported below the sequence If any errors are detected during Test a message box appears 5 Inthe SNP Grp box type the name of the SNP group where the SNP will be stored A new SNP cannot be saved to the database until it belongs to a SNP group 6 Click Add SNP to Group to add the new SNP to the currently selected SNP group A temporary value indicated by appears in the SUSID box This value gets updated once the currently selected SNP group is saved to the database 7 Ifyou want to add additional SNPs to the SNP group click and drag them from the navigation tree into the Members box Repeat this step to add other new SNPs to the group or to add other existing SNPs to the group See Adding SNPs to SNP Groups on
186. piate d btm stock cio omen 20 Recommended romten a showe by del e uiri Radeon tn 4 Create Primer mis by posing egat volumes of wach dibnd dios usa Om orignal volume or ie Concentration Primes Mass Concentration Concentration tet 02 en t 136000 905 0000 ye 40 0006 1261200 erae 1000 onw 196000 es 3000 rJ 1381300 exo one 1309000 v 00 0 x0 260009 bet ao 2800 x0 9000 ven soo 300 0006 6458000 2 300006 nemo 2 300 9000 7336 8000 300 0006 Mas 9000 200 0000 3062606 1 fete hort vans of sich 1 shock cho te dite uL Enter stock lego concentration fl Recommended concentran is shown by dela 3 D te mach abquot uang R dt nal watar 4 Croate Primer vis by posing equal volumes of each died gos use lhe orignal vilume or less LE Mer Md Stock obgo Unestomted Primer Mass foe 23 II tare 2000 m 168 4800 6557 3000 mm 108 4800 6757 4000 naw 052000 tet e000 259 252000 4958 5000 1922 2062000 704 e000 LaL miae TW moo vm 2052300 TRO Imas 252000 7645 9000 151268 2m 0000 76120000 209006 2700380 7032 0000 Stock oligo Concentration ITE uM must be entered 2 Erter stock olga concentration u 3 Dike each siquot using Ad tonai Water 4 Groste river m by pocing equal volumes of each dluted olgos use the orignal vj Pto Right click on a cell to open the context menu and use the copy and paste options for entering stock oligo concentration You can then select groups of cells and
187. pty Row When entering the samples of a sample group you can leave a row empty When the sample group is applied to a plate the well that corresponds to the empty row will not have a sample applied to it See the following illustration New Sample Group Sampleld 6 7 8 9 101112131415 1617 1819 20 21 222324 ees0909090909909000000009 SPEO m No sample is uir x AALALA AA to this well New Sample Group dialog box Plate Layout Repeated Samples When entering the samples of a sample group you can enter the same sample name SampleID multiple times When you apply the entire sample group MassARRAY Typer 3 4 Software 40 Doc 11546 R03 CO 060094 User s Guide for iPLEX and hME June 30 2006 Defining Plates Creating Samples to a plate multiple wells on the plate have the same sample applied to it See the following illustration ig BS g Group Id New Sample Group Sampleld 1 2 3 4 5 6 7 8 9 10 11 1213 1415 1617 18192021 222324 fleeeeseoocoeococooco0000098 629 900909500009099 Asia is entered twice Ld i ece0909090090009 eo e0909090090009 veo09099090909099090900009009000009 vev99999090909099090090909000000009 ece090909909090900909009090000000009 jooe0090909090909090090000000000 e00909090909909090909009090090000099 vee90909090909099090090009000000009 v 90999090990909090090090009000900009 ve009909090090909000090000000009 e0099090909090900909009009000000009 ve09090909
188. r to any type of assays grouped together in AssayEditor When necessary specific terms are used instead these terms are definition assay group locked definition assay group and reference assay group These specific terms are described below Assay Group tab The Assay Group tab lists definition assay groups locked definition assay groups and reference assay groups These items are described as follows A Definition Assay Group is a set of assay definitions Assay groups with a blue assay group icon are assays that are not associated with a design or SNP group although the individual assays may be associated with SNP sequences Manually created assays may be added to these groups An assay may only be edited or deleted from a definition assay group if the assay has not yet been associated with an experiment Editing or deleting assays from a definition assay group will permanently change the assay definition or remove it from the database A Locked Definition Assay Group is a set of assays associated with a set of design parameters and with a locked SNP group A locked definition assay group has a blue padlock assay group icon which indicates the assays within this group may not be edited These assay groups are always imported from an assay design file in combination with a design parameter file and design SNP group file A Reference Assay Group is a group of references to assays stored in the database A reference assay group has
189. ra acquired by analyzers skewing can also be caused by multiple reasons When performing allelotyping you can adjust for such skewing Any assay you will use for allelotyping pooled samples should first be used to genotype individual DNA samples When genotyping the individual DNA choose genotype area as the analysis type in an analyzer mass spectrometer The relative frequencies of the alleles in heterozygous samples will be calculated for each spectrum Then in TyperAnalyzer or Genotype Analyzer generate a Genotype Area report on the data When the Genotype Area report is generated the relative frequencies of the alleles in heterozygous samples will be averaged and saved to a skew correction file These average heterozygous frequencies from individual DNA will be used as skewing factors to adjust the frequencies found in pooled DNA whenever the assay is used for allelotyping Once you have saved skewing factors to a skew correction file you may view allelotyping results that are adjusted for heterozygous skewing by generating an Allelotype Correction report The report will show allele frequencies adjusted with the skewing factors from the skew correction file MassARRAY Typer 3 4 Software 138 Doc 11546 R03 CO 060094 User s Guide for iPLEX and hME June 30 2006 Assay Type Count Report Assay Type Count Report Best Call Probability Report Call Probability Report Description Count Report Doc 11546 RO3 CO 060094 139
190. rator The Assay Project Administrator dialog box appears 2 Selecta name from the Change Assay Project drop down list 3 Click Delete to delete the selected assay project Click Close to exit the dialog box MassARRAY Typer 3 4 Software 18 Doc 11546 R03 CO 060094 User s Guide for iPLEX and hME June 30 2006 Defining Assays Managing SNPs Managing SNPs A yellow SNP icon indicates the SNP group is not currently associated with a locked definition assay group and may be deleted A yellow padlock SNP icon indicates the SNP is associated with a locked definition assay group and cannot be modified Click a SNP to select it Use the SNP Manager dialog box to work with SNPs in AssayEditor In the SNP Manager dialog box you can manually create and edit SNP sequences and SNP groups and you can locate SNPs and associate them with assays AssayEditor stores raw SNP sequences to the database to complete the information associated with an assay design Every SNP stored in the database has a SNP ID a DNA sequence and a SUSID Sequenom Unique SNP ID Each SNP must belong to at least one SNP group Typically a SNP group is imported into the database with a definition assay group A new SNP is stored in the database only if it has a unique combination of sequence and SNP ID Hence several SNPs in the database may have the same SNP ID e g rs128986 if they have different sequences Alternatively two SNPs may have
191. re wells that you want to select This can be a single well a contiguous group of wells or a non contiguous group of wells Once wells are selected choose an assay or sample and apply it Right Click Menu Right click the mouse on either the project name plate name or a well within the plate layout to open a menu of commands Point to the command you want This is a quick method to add a customer add move or delete a plate and to copy or clear well contents The first step in using PlateEditor is to select a plate This can be a blank plate that needs assays and samples applied to its wells or a plate that already has assays and samples applied to its wells After a plate s data is transferred and used in the Genotype Analyzer the plate can be opened copied or viewed but not edited 31 MassARRAY Typer 3 4 Software User s Guide for iPLEX and hME Defining Plates Selecting Plates To select a plate 1 On the Plate tab select and expand the Customer WProjectVPlate tree Continue down the tree to select the plate you want M 021X0 Tsom Mj 022405 7D Bj 030905 Harve Bl 031505 noct 032405 plex 040605 Acyd m 041205 8 8c qi 05 905 pe x Click a plate to select it arlag AssayPromctntal 9 AssayProjectnitadets o Assay ProectneaDeta Plate tab with plate selected To select an individual well e Click the individual well To select a contiguous group of wells 1 Click the first well
192. right click an existing genotype and choose Add New Genotype If you have not yet added a genotype see To specify homozygous calls for instructions 2 Type a name for the heterozygous genotype 3 Select the checkboxes for the analyte peaks that would result in this call Now the Genotype Calls grid appears similar to the illustration below Genotype Calls A G AG A ANALYTE VM O M m G ANALYTE O Vi I Example of Genotype Calls Viewing Grid Colors As you define genotype calls some cells rows or columns of the grid may be colored red This indicates errors such as a missing genotype ID or multiple genotypes specified by the same combination of analyte peaks If you click a genotype call ID its column is colored green indicating the item is selected The analytes involved in the selected genotype call also become colored green in the Expected Peaks grid These colors are intended to be used as a visual aid If you prefer you may turn off this visual aid To turn off visual aid colors e Click the empty cell above the analyte names in the Genotype Calls grid Doc 11546 R03 CO 060094 13 MassARRAY Typer 3 4 Software June 30 2006 User s Guide for iPLEX and hME Defining Assays Creating and Editing Assays You can define assays with more than two analytes by continuing the process detailed under To add analytes on page 12 As an example the Genotype Calls grid for a tri allelic SNP would lo
193. right shows the organization of 1 Chip the tree in the Customer tab Plates are organized by 3 customer and project First expand the customer containing your plate Next expand the project 6 containing your plate Under each plate are 7 experiments and chips To view spectra select a chip Sample project tree control under one of the experiments in TyperAnalyzer To select a chip by assay e At the bottom of the tree control box click the Assay tab rai ge y i Paull Assay Group Assay M Assay 3 Tree control tabs y A Date Ey Assay d Custo Plate 1 Test plate 1 Experiment t SpectroCHIP Chip 9 4 Assay tab 3 Doc 11546 R03 CO 060094 June 30 2006 The illustration to the right shows the E E xample assay group tree organization of the tree in the Assay Group tab control in TyperAnalyzer Plates are organized by assay group and assay Expand the assay group containing the assay you want Under each assay are the plates to which the assay has been applied Under each plate are experiments and chips To view spectra select a chip under one of the experiments 79 MassARRAY Typer 3 4 Software User s Guide for iPLEX and hME Reviewing Processed Data with TyperAnalyzer Color Codes To select a chip by date At the bottom of the tree control box click the Date Date tab 2000 4 Year m E July A Date Ass
194. ristian Compact_Testing David David O Plate Number 1 Debug Prefix Plate Terminator Suffix Cancel Create Plates dialog box Click to browse for a template Template File 2 On the Customer ProjectVPlate tree select a project to which the new plate will be Create a template file in added Microsoft Excel or Notepad The tab 3 Click the Template Browse button delimited file must be A Browse for File dialog box appears formatted with three tab delimited columns 4 Selecta properly formatted template file and then click OK well the letter EM and the 5 Select a plate size pool number For details i see Creating Templates 6 Under Plate Name edit the plate prefix and plate number as desired on page 33 7 Then check the Term Suffix box if you want to include the terminator at the end of the plate name 8 Click OK Creating Plates via Assay Groups You can create plates from the Assays tab To create plates via assay groups 1 On the Assays tab select an assay group 2 Right click the selected assay group and choose Create Plates for the collection MassARRAY Typer 3 4 Software 36 Doc 11546 R03 CO 060094 User s Guide for iPLEX and hME June 30 2006 Defining Plates Creating Samples The Create Plates dialog box appears Create Plates FS Customer Project Plate Piste size 1536_chip_test 3K Instr
195. rrently associated with it select this option Stop and store the data from the current chip Stops the run Any spectral data acquired for the current SpectroCHIP is saved to its associated experiment in the MassARRAY database Since data is saved to the experiment the experiment will no longer be available to receive future data If you want to rerun the SpectroCHIP at a later time you will have to save its spectral data to another experiment Stop the automatic run after completing the current chip Stops the run after completing the current chip 3 Select how you would like to proceed and click OK MassARRAY Typer 3 4 Software 70 Doc 11546 R03 CO 060094 User s Guide for iPLEX and hME June 30 2006 Acquiring Spectra Saving Spectra Saving Spectra When manually acquiring spectra you can save the most recently acquired The spectra is saved to a file To save the most recently acquired spectra 1 Click the Manual Control tab Manual Control tab in ACQUIRE 2 Click Save Current to save what is currently shown on the screen 3 Click Automatic Save if you want to automatically save the results after each well is processed This option is on when a check mark appears in the box 4 Enter the path to save the data in the Root File Name box Recalling Plate After a SpectroCHIP has been processed if you find that an assay has been incorrectly Data applied to a plate or well of a plate you can recall the plate dat
196. rt was generated SKEW HIGHMASS Corrected Average Frequency of Allele 1 CORR FREQ Average relative frequency found for the lower mass allele adjusted for heterozygous skewing using the SKEW LOWMASS value Corrected Average Frequency of Allele 2 CORR FREQG2 Average relative frequency found for the higher mass allele adjusted for heterozygous skewing using the SKEW HIGHMASS value An Assay Type Count report lists the number of assays for the selected data The Best Call Probability report looks at all the data results and provides the best score result for the same sample and assay from among several results The Score column in the output file indicates how good the call was on a scale from 0 tol The Call Probability report provides the same information as the Plate Result report but with additional scoring information See Plate Result Report on page 141 for information The Score column in the Call Probability output file provides a record of how good the call was based on a scale of 0 to 1 The Description Count report provides a count of each call status Conservative Moderate etc for the selected data MassARRAY Typer 3 4 Software User s Guide for iPLEX and hME Genotype Area Report Genotype Area You must have an allelotyping license to create a Genotype Area report Report This report contains genotyping data for the selected experiment or s
197. rtcut icon Ge EHEHEH e Him 2 Double click the Chip Linker shortcut icon to open the application Chip Linker The Database Info dialog box appears 3 Typeauser name and password 4 Selecta server from the DB Host drop down list 5 Click Enter The MassARRAY Typer Chip Linker window appears MassARRAY Typer 3 4 Software 60 Doc 11546 R03 CO 060094 User s Guide for iPLEX and hME June 30 2006 Acquiring Spectra Using Chip Linker to Associate Chips with Experiments Associating SpectroCHIPs and Experiments To associate SpectroCHIPs and experiments 1 In the MassARRAY Typer Chip Linker window select a plate from the navigation tree __ MassARRAY Chip Linker seqma064 E 5 xl Terminator Chemistry PLEX C hME HIV 1 Viral Load Process Method Genotype Area Rs 9 HTC m e ac rt Dispenser Nanodispenser S 96 4 to 384 QGA Validation m Target Validation Diagnostic Assay Design i XXDebug Experiment Name compact SN 1 704 Chip Barcode he Find Next Plate Add Remove Change Recall Process Method Customer Plate Chip Barcode GenotypesArea XXDebug CFTR Eda mass shift N 1 Compact SN 1704 Genotype Area oum ae Bda mass shitt4 k pese ___ GenotyperArea_ XXDebug CFTR fRecal Kishor 3 Compact SN 1704 MassARRAY Typer Chip Linker window 2 Forthe Terminator Chemistry option select iPLEX or hME NOTE At the end of the run you can confirm that th
198. rted assay group is the same as the name of the local assay group file If the selected group ID conflicts with an existing ID in the database a message appears prompting you to enter a different ID 5 Onthe Import to Assay Project drop down list select the Assay Project where the imported items will be stored 6 If desired click View to preview the Design Summary file to ensure you have selected the correct set of assay design files for importing 7 Click Import The selected files are imported into the database Note Importing large assay groups into the database may take some time It is recommended that assay groups contain no more than 10 000 assays Working with larger assay or SNP groups may hamper performance when opening items in the database navigation trees and could possibly result in an out of memory problem on smaller systems 8 Click Close to exit the Import Assay SNP Groups dialog box Doc 11546 R03 CO 060094 9 MassARRAY Typer 3 4 Software June 30 2006 User s Guide for iPLEX and hME Defining Assays Searching for Assays Searching You can search for any assay name listed on the Assay Group tab You cannot search for Assays for an assay project name or an assay group name To search for assays 1 Type an assay name in the Search box Use a percentage sign as a wildcard to find one or more characters in the assay name For example searching on the name MyAssay will return an assay named
199. s set the Number of number of shots you want the number of raster positions and rastering options See the Shots and following for detailed instructions Rastering Options To select the number of shots and rastering options Recommended Values If you are using Typer 3 1 see Table 2 on page 65 for the recommended values for the options listed under Acquisition Parameters Rastering If the initial acquisition yields an unacceptable spectrum you may have the analyzer raster When the analyzer rasters it aims the laser a little off the center of the SpectroCHIP well and acquires another spectrum Doc 11546 R03 CO 060094 June 30 2006 1 On the Auto Run Set Up tab under isis puanetes Acquisition Parameters type the Shots n jo number of shots you want in the Maximum accuistine 2 Shots n box Minimum good spectra fb Maximum good spectra P For the recommended number of shots for your MassARRAY Enable Smart Raster T Analyzer see the appropriate Giret ener Pieperies MassARRAY Analyzer user s guide as described at the beginning of this Acquisition Parameters chapter In the Maximum Acquisitions box type the maximum number of raster attempts you want Enter a number between 1 and 9 Entering 1 means you do not want the analyzer to raster at all spectra is acquired from only the center of the well By default the spectra is acquired from the center of the well In addition ra
200. s a call below the success threshold but above the failure threshold and red indicates a call below the failure threshold The colors and thresholds along with other TyperAnalyzer attributes can be Doc 11546 R03 CO 060094 75 MassARRAY Typer 3 4 Software June 30 2006 User s Guide for iPLEX and hME Reviewing Processed Data with TyperAnalyzer Introduction customized using the Configuration software For more information see Appendix B Configuring the MassARRAY Software on page 147 TyperAnalyzer seqbm045 Dominik SBE 020305 7DNAs GT 3cycles 030405 semifinallN RC OF CHP3 RECALL 359012 6 EE i File Edit View Options He i Customer a Customer Project Plate E xpe l 4pt_calibrant Beatiice Brian Carmen The spectrum for selected paket Christiane assays appears here David Deleted Items Diagnostics Test Dom misc Dominik Emply Eunice Fragmentation Tests FT Analysis of SpectroCk E Genset George george2 i Traffic Light g Guy 1412134 56 7 8 910111213141516171819 2021 222324 ASSAY ID SAMPLE ID hMC Genotype mne ooo coni GA z ia Emecoc e cont G Lori Martin The assays applied to Mathias a well are listed here ichael Monitoring Palsson Phil ping Pintool Test 222774 PrimerSet3 v T 24 The cluster plot for selected assays appears here A plate is shown with its wells color coded according to the strength of the genotype calls
201. s poor primer quality or the addition of an unnecessary primer to the mix Now run the Primer Adjustment report to determine if the primer mix should be adjusted If all peaks are at least 4596 the height of the highest peak they are acceptable If any peak is less than 45 the height of the highest peak add more of that primer The FRAC ADD column in the Primer Adjustment report indicates the amount to add as a fraction of the given primer s original volume Adjust the original primer mix not the primer mix sample in the microplate 145 MassARRAY Typer 3 4 Software User s Guide for iPLEX and hME Primer Adjustment Report Notes MassARRAY Typer 3 4 Software 146 Doc 11546 R03 CO 060094 User s Guide for iPLEX and hME June 30 2006 Appendix B Configuring the MassARRAY Software The Configuration program is a companion program that allows you to customize Plate Editor and TyperAnalyzer components of the MassARRAY software Starting the The Configuration program resides in the same directory as the TyperAnalyzer program Configuration To start the Configuration program double click the Configuration icon as shown below Software Configuration exe Navigating the The Configuration software provides a navigation pane on the left to locate the type of Configuration settings you want to configure and a settings pane on the right for viewing and setting the Interface parameters Configuration DER General
202. s such Oracle products are separately governed by the attached Oracle End User License Terms a Sequenom grants Customer a non exclusive and non transferable license to use the Software for processing data for business purposes only Customer shall not permit another party to use the Software and Customer shall effect and maintain adequate security measures to safeguard the Software from access or use by unauthorized persons Customer shall not transfer rent lease sublicense loan copy modify adapt merge translate reverse engineer decompile or disassemble the Software or create derivative works based on the whole or any part of the Software b The Software license shall not be deemed to extend to any of Sequenom s intellectual property rights including rights in source code No copies may be made of the Software without the prior written consent of Sequenom except that Customer may make a single back up or archival copy The Software license shall apply to any copy as it applies to the Software c With specific reference to Sequenom s iPLEX application software the IPLEX Software that is part of Sequenom s Typer 3 3 software product Customer is provided free of charge a royalty free non exclusive and non transferable license to use the iPLEX Software subject to the terms and conditions in subsections a and b above and elsewhere in this section solely upon the condition that such iPLEX Software is used exclus
203. sable spectrum was not acquired from the well the best spectrum acquired contains only noise Automatic The call see CALL above was made automatically by Typer User Call The call see CALL above was manually Selected by a user ENTRY OPERATOR Yes calibration spectrum was acquired and applied CALIBRATION No calibration was not applied MASS SHIFT Calibration offset applied to the spectrum Number of raster positions from which spectra were acquired A MassARRAY analyzer attempts to acquire spectra from five positions raster positions on a SpectroCHIP well the center plus the four corners 5 means spectra were acquired from all five positions Anything less means spectra could be successfully acquired from only the indicated number of positions Frequency estimates for an allele are generated by averaging the frequencies found from the successful raster positions RASTERS Average area under the curve for the lower mass allele Area 1 This is an average of areas found at all successful raster positions The average difference in area for the values used to Delta 1 calculate Area 1 Average area under the curve for the higher mass allele Area 2 This is an average of areas found at all successful raster positions The average difference in area for the values used to Delta 2 calculate Area 2 Average frequency of the lower mass allele This is an Frequency 1 average of the fr
204. say Design software Assay group file format See the MassARRAY Assay Design Software User s Guide for information on assay group files Typically SNP sequences that these assays were designed against and the parameters used in the design would be imported at the same time from a SNP Group file and Design Summary file in the same directory However assay groups may be imported without a design summary file and SNP groups may be imported independently To import assays 1 On the File menu choose Import Assay Group Or on the Assay Group tab right click a project and choose Import Assay Group MassARRAY Typer 3 4 Software 8 Doc 11546 RO3 CO 060094 User s Guide for iPLEX and hME June 30 2006 Defining Assays Importing Assays The Import Assay SNP Groups dialog box appears E Assay Editor Import Assay SNP Groups iv Design Summary IV Assay Group Browse M SNP Group Browse New Assay Group ID Close to Assay Project TrainingDemo Import Assay SNP Groups dialog box in AssayEditor 2 Click the check box of any item you want to import Selecting one of the file types will generally cause all three file types to be specified if these files were produced as a result of a Assay Designer run 3 Click Browse to locate the Design Summary trs file Assay Group or SNP Group you want to import 4 If desired type or update the name in the New Assay Group ID box By default the ID for the impo
205. say Group writes the set of selected assays out to an Assay Designer assay group format file which is a tab delimited text file that has a xls file name extension This option is available whenever any assay group or individual assay is selected for exporting e SNP Group writes out a complete SNP group to an Assay Designer SNP group format file which is a tab delimited text file with a txt file name extension This option will be available when a SNP group individual SNP or locked definition assay group is selected for exporting For locked definition assay groups the whole SNP group associated with the locked definition assay group is exported even though this group may contain SNPs that are not associated with individual assays 26 Doc 11546 R03 CO 060094 June 30 2006 Defining Assays Exporting Groups Doc 11546 R03 CO 060094 June 30 2006 e Assay SNPs writes a SNP group file for only those assays in the assay group or for the individual assay selected for exporting This is the only SNP group export option available for assays that were not associated with a design e Undesigned SNPs writes a SNP group file for a set of SNPs within a SNP group that is not associated with assays This option is only available when exporting a locked definition assay group associated with a SNP group This option is equivalent to exporting the SNPs in the group that failed to be designed by Assay Designer 3 Type the file name for the export
206. says in the currently selected well You can click each row or use the Up and Down arrow keys to change the selected assay For each assay it also contains detailed information such as peak information You can access this detailed information by clicking the sign next to the assay name Status Bar Displays the caller version selected chemistry and date and time of the current plate On the right side of TyperAnalyzer is a tree control Use the tree control to select the Experiment experiment under a plate for which you want to view data TyperAnalyzerGseqbm045 Dominik SBE 020305 7DNAs GT 3cycles 030405 semifinalINI RC OF CHP3 RECALL 359012 6 le Edit View Options Help d amp mc pa BI LogiHeight 3 Customer 2 Customer Project Plate E xpe H 4pt_calibrant No Call LM Homo etero HM Homo Bose Brian Carmen Chemistry Christiane David Deleted Items 1 Diagnostics Test Dom misc Dominik Empty Eunice Fragmentation Tests FT Analysis of SpectroC Genset o Bill Spectrum B Histogram George Le Em jeorge2 Traffic Light y MellData man RN 2 Gy 1 2 3 4 5 6 7 8 9 1011 1213 14 1516 17 1819 20 21 22 23 24 ASSAY ID SAMPLE ID DESCRIPTION hMC Genotype e 150342 cont A Conservative iF Johanna 151288 cont A Conservative Fa 160195 cont B Moderate i Nu 174545 cont A Conservative d ses 174550 cont A Conservative M ethylation 188463 coni A
207. sociated with a set of design parameters and Example Assay Editor navigation tree cannot be edited 5 MassARRAY Typer 3 4 Software User s Guide for iPLEX and hME Defining Assays AssayEditor Basics AssayEditor Opening AssayEditor Basics To open the AssayEditor window 1 In the MassARRAY Typer window click the AssayEditor button 2 If you have not yet connected to the database the Connect to Database dialog box opens Enter the appropriate information Once connected the AssayEditor appears The Title bar lists your user name and the database to ig AssayEditor charles seqhm106 which you are connected File View Help Menu bar i Plex 1 SusanneMichael of Locked Definition Assay Group origBplex 30 20 of Assay Project TrainingDemo Senis T T iN 2 Contents 6 multiplexed assays e in fhe naola mae ji Ta 2 eminence 5B TrainingDemo Multiplex Confidence Score 59 0 amp K 12P10_1P10_2PForJay M AssayDesign_CPDR_DML_Tri_ B orig plex 30 20 Minimum inter assay analyte peak separation 26 0 Da g A ESY dietis This pane lists details 4 99N20280 403 Minimum intra assay analyte peak separation 32 0 Da or editing options for r 99N2156 183 Minimum peak separation 26 0 Da the item currently 4 99N26891 344 selected in the 4 ini navigation tree r i 4 99N43578 305 t2 He gh 3 Total number of expected peaks 24 12 analyte 12 other The navigation tree lists assay project data Click a
208. splay Fixed Y Scale o Minimum Y Scale jV Enable Minimum Height Height 10 Auto Zoom IV AutoZoom LeftMargin 300 Right Margin 300 V Show All Peak Annotations Show Grid Lines Cancel Spectrum Display dialog box To specify a fixed height for the Y axis click the Enable Fixed Height option so a checkmark appears Then in the Height box specify a Y axis height All spectra graphs will now use this height for the Y axis To specify a minimum height for the Y axis click the Enable Minimum Height option so a checkmark appears Then in the Height box specify a Y axis height To automatically zoom on all spectrum graphs click the Auto Zoom option so a checkmark appears This option may already be selected If so clicking it again removes the checkmark and turns off the option Specify a mass margin in the Left Margin and Right Margin boxes The zoomed view will have the selected mass margin around it To show all peak annotations click the Show All Peak Annotations option so a checkmark appears To show grid lines click the Show Grid Lines option so a checkmark appears Click OK to save your changes Your settings are applied to all spectra displayed unless you return to the Spectrum Display dialog box again to make changes 86 Doc 11546 R03 CO 060094 June 30 2006 Reviewing Processed Data with TyperAnalyzer Viewing Spectra Printing a Spectrum Graph To print a spectrum graph 1
209. ssay details Doc 11546 R03 CO 060094 June 30 2006 ASSAYINFO This part lists information about analytes MassSEXTEND or iPLEX primer Probe and contaminants expected in the spectrum O Analyte O Analyte O Analyte O Analyte O Probe Type of expected peak CALLINFO A CAGAACACTTAGCACCCCACTG 6617 300000 G CAGAACACTTAGCACCCCACC 6273 100000 GA CAGAACACTTAGCACCCCACC 6273 100000 GA CAGAACACTTAGCACCCCACTG 6617 300000 C11 48170 P CAGAACACTTAGCACCCCAC 5999 900000 puc gg cocer T t T Names Sequences Expected mass specified NULL means values Da when the no sequence specified when assay was specified only a the assay was created in mass value was created in Assay Assay Editor specified Editor This part lists calibration information L calibrated 4 Calibrated means cali brant was present on the SpectroCHIP and a calibra tion spectrum was SUCCeSS fully acquired 1 000000 1 144805 0 177160 20 MEMMT O00 4D o0 i t t Level of Standard Calibration confidence in error of offset applied the assay call noise to spectra expressed as a probability 1 0 means 100 91 MassARRAY Typer 3 4 Software User s Guide for iPLEX and hME Reviewing Processed Data with TyperAnalyzer Viewing Assay Details for a Well PEAKINFO This part lists information about the peaks in the spectrum E l i i i eas O 5999 900000 5 926464 2 970775 0 286040 rof 0 62
210. stering proceeds around eight different positions 5 2 around the SpectroCHIP well First around the corners and then Well g around the sides The illustration to the right shows the raster positions the numbering indicates the order of rastering The 4 7 3 number you type in the Maximum Acquisitions box determines how many of the raster positions you want attempted For instance typing 5 means you want the center of the well plus the first four positions attempted Raster positions Note Not all raster positions you specify may be attempted You are specifying only the maximum number of raster positions you want to try The analyzer will move on to the next SpectroCHIP well when either good spectrum is acquired or the maximum number of raster positions has been attempted For multiplexed assays this criteria is applied to each assay individually i e the analyzer moves on when good spectrum is acquired or the maximum rasters have been attempted for each assay Type the minimum and maximum number of good spectra to acquire See Acquisition Parameters Values on page 64 for a description of these values Check Enable Smart Raster to automatically disable rastering if too many SpectroCHIP wells are failing Smart rastering saves time by disabling rastering when a SpectroCHIP is found to have too many wells providing bad spectra By default when smart rastering is enabled after two wells in a row fail rastering is disabled Also in
211. strated below Mapping The wells of each 96 well plate are mapped horizontally across the 384 well plate to illustrate the mapping of wells A1 A2 and A3 of 96 well plate 1 are indicated here by arrows e2e020e0000000080 00000000000 The wells of the 96 well plates are mapped to every other well in every other row The mapping of wells for 96 well plate 1 begins with well A1 of the 384 well plate The mapping for 96 well plate 2 bibi desideres begi ith well A2 Th ing for 96 well plate 3 begi ith e 09090909000000 egins with well A2 The mapping for 96 well plate 3 begins wi ee00900000000 well B1 And the mapping for 96 well plate 4 begins with well B2 eec0 0 0000000 0 IN LLL 96 well plate 1 Well A1 6606000000605 8 66060000000060089 6 6 6 OO 6000000000060 9 6 6 O6 O O O OG 9006 6060000000600 O 6606000000060 6600 0 066008 96 well plate 2 N 384 well plate 96 well plate 3 ee00880808080080 000000000000 Note The 96 well plates and 384 well plate are not shown to scale The 96 well plates are depicted oe ssecoespeeon iere size of the 384 well plate for 6060000000000 Purposes eee eee00e0080 8 e e2 e 0008808860868080 96 well plate 4 In Typer you can apply samples to a plate in the manner depicted above by having a separate sample group represent each of the 96 well plates and then applying the sample groups using the mapping option See the foll
212. t Default colors and values are assigned as described above To change the these defaults see Configuring TyperAnalyzer on page 150 MassARRAY Typer 3 4 Software 80 Doc 11546 R03 CO 060094 User s Guide for iPLEX and hME June 30 2006 Reviewing Processed Data with TyperAnalyzer Viewing Relationships of a Currently Selected Cell Note The coloring in the assay table is not related to the color coding of the plate diagram The coloring of the assay table follows the coloring convention of the results table in the Genotype Analyzer module see Table 3 Genotype Analyzer Color Codes for Genotyping on page 118 Viewing Relationships of a Currently Selected Cell Doc 11546 RO3 CO 060094 81 June 30 2006 Selecting Which Assays Are Shown When you select a well in the plate diagram the assays applied to the well appear in a table to the right called the assay table 1 2 3 4 s 6 7 8 9 t0 t1 1213 14 15116 17 18 19 20 21 2223 4 ASSAY_ID SAMPLE ID CALL DESCRIPTION A eeeoe eeee00 ee 13526 con2 cA C Agaressive Be ee ee ee e ee 170447 con2 A A Conservative c je e Fr 180923 con TA B Moderate H 2 9 000009 H zz 198163 con2 T A Conservative 205384 con2 A A Conservative r eeee eeeeoe e E 206146 A E mma c ee e ee e e ee elses com n TE H amp 9 E e v Conservi Tole e ee 22 These are the assays p moderate Je e ee 23512
213. t Excel 41 Importing and Exporting Plate Table Information 4 42 To copy table data to Excel 00 0000 cee eee 42 To import table data 1 0 0 eee 42 Finding Which Plates Contain a Sample Group 00 000eeees 43 To view a list of plates to which a sample group is assigned 43 Editing Samples 000 cect nns 43 Editing a Sample Group 00 060 eee ete 44 To add a sample to a sample group 0 eee ee eee 44 To edit a sample group cee rh 44 Deleting a Sample Group 2 2 0 0 6 0 cece 45 To delete a sample group 0 eee ee 45 Applying Assays and Samples to Wells illii isses 46 Assay and Sample Tree 0 00 ccc teens 46 To apply plexes assays and samples to wells 46 To apply samples to aregion 202 00 ccc ee 48 Applying Sample Groups sssslsseselse es 49 To apply a sample group to a plate lllllsesllllslssss 49 Applying Sample Groups Using 4 96 to 1 384 Mapping 49 To apply a sample group using the 4 96 to 1 384 mapping 51 Applying Sample Group Mapping sess 53 Viewing Applied Assays and Samples 0 00 0c ee eee e eens 54 Working with Plates 0 0 ete 54 Clearing Wells 0 0 00 ccc cette eae 54 Tocleara well epek a Aa a RE ee ee 54 Opening Plates 0 00 tenes 54 T operra plat coc
214. t least four of the autoteaching wells must be found for autoteaching to work If less than four are found no correction is applied to the SpectroCHIP Unless you save parameters the auto run settings will revert to original default values if you quit and restart ACQUIRE To save parameters On the Tools menu select Save Parameters The current settings are saved If you quit ACQUIRE and restart it the current settings will still be in place The Tools menu of the ACQUIRE window contains three options Configure Image Processing and Save Parameters Unless instructed to do so by SEQUENOM do not select Configure or Image Processing These options access configuration settings for ACQUIRE These configuration settings should not be changed The Save Parameters option may be used to save the current auto run settings See Saving Parameters above To quit ACQUIRE e On the File menu select Exit 73 MassARRAY Typer 3 4 Software User s Guide for iPLEX and hME Acquiring Spectra Quitting ACQUIRE Notes MassARRAY Typer 3 4 Software 74 Doc 11546 R03 CO 060094 User s Guide for iPLEX and hME June 30 2006 Chapter 5 Reviewing Processed Data with TyperAnalyzer Introduction This chapter covers using TyperAnalyzer to view results after data is processed from the analyzer by the ACQUIRE module on the Typer Workstation Similar to the Genotype Analyzer module see Chapter 6 Reviewing Processed Data with G
215. table A plate is selected when its row in the selection table becomes highlighted Click Remove The selected plate is removed from the selection table This plate will not be included when you create input files for the MassARRAY Typer RT Workstation Changing Plate Entries After a plate has been added to the selection table you can change the information associated with it To change plate entries 1 In the MassARRAY Typer Chip Linker window click a plate in the selection window A plate is selected when its row in the selection table becomes highlighted Click Change Details for the selected plate appear in the boxes on the top right of the MassARRAY Typer Chip Linker window Change the plate information as needed Click Add to add the updated plate to the selection table Place the SpectroCHIPs from which you want to acquire spectra into the SCOUT plate In ACQUIRE on the Typer Workstation name each SpectroCHIP For detailed instructions see the user s guide for the specific MassARRAY Analyzer that you are using as described at the beginning of this chapter Important Use only the SCOUT plate supplied with the analyzer Do not use any other SCOUT plate for example from the MassARRAY nanodispenser 62 Doc 11546 R03 CO 060094 June 30 2006 Acquiring Spectra Selecting the Number of Shots and Rastering Options Selecting the In ACQUIRE on the Auto Run Set Up tab under Acquisition Parameter
216. te of the art algorithms to assist you in your research efforts Use this manual as a guide to assist you in mastering the features and tools of this software package If for any reason you need assistance in using the features of the software or your MassARRAY system contact your SEQUENOM Customer Support Scientist by phone or email Your institution s use of this software is governed by a Terms of Use clause Please refer to this clause on page 155 of this manual to understand your institution s rights and responsibilities At SEQUENOM we are continually focused on developing the best products to increase the research success of our family of customers SEQUENOM Inc San Diego California SEQUENOM s mission is to be the leading provider of genomic systems and knowledge for personalized medicine and the life science industry Corporate Headquarters US East Coast Office European Office 3595 John Hopkins Court 189 Wells Avenue Mendelssohnstrasse 15D D 22761 San Diego CA 92121 Newton MA 02459 Hamburg Germany Tel 858 202 9000 Tel 617 244 8777 Tel 449 40 899676 0 Fax 858 202 9001 Fax 617 868 4975 Fax 49 40 899676 10 Sales 877 4GENOME Asia Pacific Office 300 Herston Road Herston QLD 4006 Australia Tel 61 7 3845 3683 Copyright 2006 All rights reserved No part of this publication may be reproduced distributed or transmitted in any form or by any means electronic mechanical photocopying recording or ot
217. te the plate or Cancel to discontinue Projects To create a new project 1 On the Plate tab select an existing customer 2 Right click the selected customer and choose New Project OR click on the File menu and select New followed by New Project The New Project dialog box appears Create New Project Dialog Project Description DD MON YYYY ex 04 JUL 2003 Start Date End Date Project Sponsor New Project dialog box 3 Type aname in the Project ID box The remaining boxes are optional Type values in these boxes if desired 5 Click OK to save the project or Cancel to discontinue Doc 11546 RO3 CO 060094 55 MassARRAY Typer 3 4 Software June 30 2006 User s Guide for iPLEX and hME Defining Plates Extend Primer Adjustment Tip Rename Project It is possible to change the name of a project without using the Project dialog box In the navigation tree click the project name in the tree to highlight it and click again so acursor appears Typea different name and then press the lt Enter gt key A confirmation dialog box appears click Yes to change the name or No to discontinue Tip Change Customer ID To change a customer ID select the customer name in the navigation tree to highlight it and click again so a cursor appears Type a different name and then press the lt Enter gt key A confirmation dialog box appears click Yes to change the name or No to discontinue To edit any
218. the lower mass primers Because of this analyte signal to noise ratio estimation throughout the spectrum can pose a significant challenge to the Caller software In the context of a genotyping reaction analyte peaks can be missed leading to genotyping errors Therefore it is recommended that extend primers in iPLEX assays are adjusted by concentration and tested prior to use in order to help address these issues There are three options for preparing iPLEX primer cocktails provided labelled options A B and C Option A represents the most simple method and is favored for a simpler reaction process however this may result in lower call rates For maximum call rates option B or C is preferred See Appendix A of the iPLEX Application Guide for more information You can copy the contents of the Primer Adjustment grid to send data to Microsoft Excel The spreadsheets can be printed and used to help set up reactions within the lab environment NOTE For options A and B you can use the default values to determine the stock oligo ordering concentrations that require dilutions Doc 11546 R03 CO 060094 June 30 2006 Defining Plates Extend Primer Adjustment To calculate the extend primer adjustment 1 On the Plate tab select the desired plate on the Customer Project Plate navigation tree On the Options menu select Primer Adjustment 3 Select either Option A Option B or Option C Option A L rto shoot vum of ea s sa
219. the next section run the the Primary Adjustment report This indicates which primers require further adjustment It creates an Excel file xls that indicates how to adjust the volume of the primer mixture for each assay in a multiplex For all the assays in a well the one with the highest signal to noise ratio SNR receives a score of 1 Scores for the other assays in the multiplex are calculated relative to this score For any assays in the well that fall below 45 0 45 the primer volume needs to be adjusted The FRAC ADD column in the Excel file lists the amount of oligonucleotide to add to the mixture Adjusting iPLEX Primer Mixes For best multiplexing results the concentrations of iPLEX primers should be adjusted to even out peak heights intensities in the mass spectrum This adjustment must be done prior to preparing the iPLEX reaction cocktail and processing the iPLEX reaction Doc 11546 R03 CO 060094 141 MassARRAY Typer 3 4 Software June 30 2006 User s Guide for iPLEX and hME Primer Adjustment Report Note Adjusting iPLEX primer mixes requires the use of a SpectroCHIP bioarray Adjusting iPLEX primer mixes is critical to successful multiplexing An assay with a very low primer peak will systematically fail when applied to samples as part of a multiplex To adjust iPLEX primer mixes 1 For each multiplex prepare a mixture of the required iPLEX primers referred to as a primer mix according to method A
220. the screen 0 eae 129 ZOOMING rs ea ede eed and en a ange o CE M er qo PN i 129 To vertical zoom in psi srere reni arere ee E EKA U e EA 129 To vertical zoom OUt 1 eae 129 To horizontally zoom in on an area 6 aaa elles 129 To revert to the default size anaa llle 129 Setting an Absolute Y Axis Maximum llle 129 To set a y axis maximum for the spectrum display 129 Viewing the Calibration Spectrum 0 0 0 eee 130 To view the calibration spectrum sasasaa auaa a naaa 130 Viewing All Spectra 6 2 ele 130 To view all spectra in succession lllelle ee 130 Generating Reports 0 0 00 cece tte eee 131 To generate a report 0 eae 132 Manually Calling a Genotype 000 eee 135 To manually call a genotype inthe table 004 135 Doc 11546 RO3 CO 060094 ix MassARRAY Typer 3 4 Software June 30 2006 User s Guide for iPLEX and hME Viewing a Pie Chart issssslsseseee s 135 To view a pie chart of selected data 0 0 e eee eae 135 Recalling Plate Data 2 2 0 ee Ie 136 Appendix A Allelotype Report 0 00 cece ees 137 Reports Allelotype Correction Report 0 00 cece eee 138 Assay Type Count Report 0000 e eects 139 Best Call Probability Report 00000 c eee eee 139 Call Probability Report 0 000 c cece 139 Description Count Report 2 0
221. ting Fonts You can set the font and style for the main title or subtitles in the Spectrum or Plot Cluster displays To specify the font 1 2 Doc 11546 R03 CO 060094 June 30 2006 Right click on either the Spectrum Cluster Plot or Histogram pane In the Customization dialog box click on the Font tab To set the font for the main title click on the Main Title drop down box and choose the font from the list To specify a font style for the main title select any of the following options bold italic or underline 111 MassARRAY Typer 3 4 Software User s Guide for iPLEX and hME Reviewing Processed Data with TyperAnalyzer Customizing the Displays 5 To set the font for the subtitles click on the Sub Title drop down box and choose the font from the list 6 To specify a font style for the subtitles select any of the following options bold italic or underline 7 Click OK to save your changes and close the dialog box or Apply to apply your changes and continue customizing Customizing Subsets Points and Axis Labels You can define how subsets points and axis labels are displayed in the Spectrum or Plot Cluster displays To customize subsets points and axis labels 1 Right click on either the Spectrum Cluster Plot or Histogram pane 2 Inthe Customization dialog box click on the Subsets tab 3 Select a subset from the Subsets to Graph list A sample appears at bottom of dialog box
222. ting Groups on page 26 for information Multiplex and Uniplex An Assay is defined as the procedure that yields a single genotype outcome Assays can be run together in the same reaction well to allow DNA sequences to be analyzed for multiple genotype determination but each assay is still defined individually Assays that are designed to be run together are referred to as multiplexed assays A run of a single assay is referred to as a uniplex assay Generally multiplexed assays may be separated into smaller multiplexes or uniplexes using AssayEditor or Plate Editor but uniplex assays may not be multiplexed together without considering potential interactions of the reactants and peak overlaps in the resulting mass spectra Assay Database Hierarchy In the MassARRAY Server database hierarchy each Assay belongs to a Plex which belongs to an Assay Group Assay Groups and SNP Groups are stored in Assay Projects which are the top level of the hierarchy There are three types of assay group as shown below M TrainingDemo SNP group TestSnps100 8B TrainingDemo FB nervo locked SNP group 3 amp siigplex 30 20 reference assay group newPool2 Bf 4N14 240 H orig plex 30 20 SNP P 2f 4N26 29 T B c2 ef AN65 324 definition assay group y amp Import Be a l Example navigation plex 2 g rs1508714 assay gt FK 151508717 51508718 tree in SNP Manager Locked groups are as
223. tor A Typer Server is the informational heart of the MassARRAY system It contains the MassARRAY database an Oracle relational database management system All data generated by the MassARRAY system is stored in this database A Typer Workstation controls the operation of the analyzer to acquire spectra from SpectroCHIPs Spectral data is sent from the Typer Workstation to the Typer Server A Typer Client is used to set up experiments e g create a plate definition specifying the samples in a physical microplate and the assays to be applied to those samples It is also used to view and analyze spectral data Any computer that is networked to a Typer Server via TCP IP may be set up to be a Typer Client For example the computer at your desk may be set up as a Typer Client You could then set up experiments and view data on your computer At least one person at your facility or company is designated as the MassARRAY system administrator This person is trained and has the computer access privileges to maintain the MassARRAY system and perform installations and upgrades For questions about the MassARRAY system especially issues relating to user IDs passwords and installing Typer Clients see your MassARRAY system administrator The MassARRAY Typer System Administration Guide contains instructions for many of the functions typically carried out by the MassARRAY system administrator MassARRAY Typer 3 4 Software 2 Doc 11546 RO3 CO 06
224. troCHIP Click Barcode Report on the Auto Run Set Up tab to check all SpectroCHIPs before running them MassARRAY Typer 3 4 Software 68 Doc 11546 R03 CO 060094 User s Guide for iPLEX and hME June 30 2006 Acquiring Spectra Starting an Automatic Run Video Display Shows real time video of the SpectroCHIP surface from the analyzer s camera the red cross hairs indicate where the laser is aimed Note If the video does not display correctly restart SpectroACQUIRE Well Status Shows the call status of each SpectroCHIP well as spectrum is acquired Note Once ACQUIRE is done acquiring spectra from a SpectroCHIP you can analyze the data in the SpectroAnalyzer or Genotype Analyzer modules The data is automatically processed and saved to the database The data from a particular SpectroCHIP may be available on the MassARRAY database before the entire SCOUT plate of SpectroCHIPs has been processed Spectral data is processed and saved to the database on a chip by chip basis As soon as a SpectroCHIP is done Typer starts to save its spectral data to the database Doc 11546 R03 CO 060094 June 30 2006 The following illustration shows a sample ACQUIRE window during an automatic run Spectrum Display Shows the spectrum from each well as it is acquired if multiple shots are taken the spectrum shown is the average of the spectra from the shots Sample automatic run SpectroACQUIRE Ele l
225. u may not save an empty SNP group to the database Add SNPs to the SNP group if it is currently empty Then click SAVE SNPs Creating New SNPs New SNPs may be created by updating existing SNPs or from scratch To create a new SNP by modifying an existing SNP 1 Select an existing SNP See Selecting SNPs on page 20 for instructions In the SUSID drop down list select lt New gt In the SNP_ID box type a new SNP_ID Or leave the SNP_ID as it appears for the selected SNP Then modify the sequence in the Sequence box Click Test to test the DNA sequence for sequence maximum strand length and the number of SNPs to be reported If any errors are found a message box appears Make any necessary corrections to the sequence Click Add SNP to Group to add the SNP to the SNP group currently being edited The new SNP cannot be saved to the database until it belongs to a SNP group The SNP_ID is added to the Members box and it is assigned a temporary value in the SUSID box The SUSID will be updated once the SNP is saved to the database Note Once a SNP has been added to a SNP group the SNP may no longer be edited 6 Instead you must make a copy of it the copied SNP may be edited Also if any assays were associated with the original SNP they must be re associated with another SNP before the original SNP can be deleted Click SAVE to save your changes To create anew SNP 1 2 MassARRAY Ty
226. u select a plate well the spectrum display shows the spectrum acquired from the well The spectrum is annotated with the expected location of allele peaks and the unextended primer peak In some cases contaminant peaks may be indicated depending on whether you defined them in Assay Editor when creating the assay see Defining Assays on page 5 If the well is multiplexed i e multiple assays are applied to it then annotations for all assays are shown To view a spectrum showing all assays for a well e In the plate diagram click a well Doc 11546 R03 CO 060094 83 MassARRAY Typer 3 4 Software June 30 2006 User s Guide for iPLEX and hME Reviewing Processed Data with TyperAnalyzer Viewing Spectra Note When viewing a spectrum showing multiple assays the color assigned to each assay does not indicate anything Different colors are assigned to each assay simply to differentiate it from the other assays The spectrum appears All assays applied to the well are shown Each pair of alleles for each assay are shown in the same color Each assay is shown as a different color W1 I C8 P W1 I F5 P W1 I G23 P W1 I G9 P W4 II I22 P2 m Mui ALL AMA e AR Ae Aes AE iti 4000 5000 6000 7000 80 9000 10000 11000 13000 Sample spectrum display showing all assays for a well Using the Spectrum Display Cross Hairs When you point the mouse cursor over the spectrum display it turns into cross hairs a cross with lines ext
227. u should start from well A1 A2 B1 or B2 See the following illustration Starting from well A1 samples would be applied as shown here the numbers are sample names 02 03 o4 o5 os oz oe o9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 A 2 3 4 5 6 7 8 8 10 n 12 Note B Samples are applied in c 5 14 18 16 17 18 19 20 2 22 28 24 the order in which they Lo E5 26 2r 28 28 30 31 32 38 34 35 36 appear in the sample F group In the illustration ku 38 39 40 E 42 43 44 45 48 47 48 to the right 1 is the first H sample in the sample 49 50 51 52 53 54 55 56 57 58 59 60 ue J group 2 Is the second K ls 62 63 64 65 66 67 68 69 70 n 72 3 is the third and so on L M 73 74 75 76 7 78 79 80 8 82 83 84 N o lss 86 87 88 89 90 91 92 93 94 95 96 P Continued on next page Doc 11546 RO3 CO 060094 51 MassARRAY Typer 3 4 Software June 30 2006 User s Guide for iPLEX and hME Defining Plates Applying Sample Groups Using 4 96 to 1 384 Mapping Continued Starting from well A2 samples would be applied as shown here the numbers are sample names fe 13 14 15 16 17 18 19 20 2 22 23 24 D E 25 26 27 28 29 30 21 32 33 34 35 36 E G 37 38 39 40 4 42 43 44 45 46 47 48 H 49 50 51 52 53 54 55 56 57 58 59 60 J K 61 62 63 64 65 66 67 68 69 70 72 3 M 73 74 75 76 7 78 79 80 81 82 83 84 N o 85 86
228. ument Validation Matrix 96 Wells 384 Wells 96 QC FT of SpectrocChips A Aging Markers AlleleSpecificExpression Template File Name Allelotyping Anna Glass Al Y April K Bea Ben CPRD FEAS Plate Name Prefix Plate Number Terminator Carmen Christian Compact Testing David David O Plate Number 1 Debug Prefix Plate FFFFEFEFEEERRRRRERERERE Terminator Suffix Cancel Create Plates dialog box Click to browse for a template 3 Onthe Customer WProjectVPlate tree select a project to which the new plate will be added 4 Ifusing a template click the Template Browse button and select a properly formatted template file then click OK 5 Select a plate size Under Plate Name edit the plate prefix and plate number as desired 7 Then check the Term Suffix box if you want to include the terminator at the end of the plate name 8 Click OK Creating The samples in Typer relate to your physical samples For each physical sample you Sam ples should create a sample in Typer In Typer there are only two items of information associated with a sample its name and an optional short description A sample cannot be created by itself It must belong to a sample group There are two ways to create a new sample Either it is created as part of a new sample group or it is added to an existing sample group For instructions see the following
229. up 1 In the navigation tree right click a group and choose Export The navigation tree may vary depending upon the type of group you are selecting For example if you are exporting a SNP group you must be in the SNP Manager dialog box navigation tree The Export dialog box appears The options available on the Export dialog box may vary Export options for Assay Group depending upon the r type of group selected for export and the export options checked Assay Editor Export Assay SNP Groups v Assay Group V Assay SNPs I E File name prefix next50 Browse In this example illustration the resulting export files test50 xls and test50 txt would be created Export Assay SNP Groups dialog box Select export options by clicking the checkboxes Up to three export files are created during export depending upon the type of group selected for export and the export options selected The Export Options are as follows Design Parameters writes the design parameters for an assay group to a text file that has a trs file name extension Typically this file is a MassARRAY Assay Design Software Assay Designer format file that describes the full set of parameters used to design a set of assays previously imported in to the database via AssayEditor More generally this is any text file that was imported with an assay group that serves as a description of how those assays were designed or collected together e As
230. uster Plot pane shows the data currently selected in either the Plate Data or Well Data tabs of the Plate Data pane If there is no valid data in the Plate Data pane due to lack of good alleles measured an empty plot is displayed Spectrum Pane The Spectrum pane shows the raw spectrum for the well currently selected in the Traffic Light pane The color markers indicate the peak information for the currently selected assay in Well Data The gray markers indicate the peak information for the rest of assays in the same well Doc 11546 R03 CO 060094 77 MassARRAY Typer 3 4 Software June 30 2006 User s Guide for iPLEX and hME Reviewing Processed Data with TyperAnalyzer Selecting an Experiment Selecting an Histogram Pane The Histogram pane provides information about the distribution of calls made for each assay on a chip Use the histogram graph in conjunction with the cluster graph in the Cluster Plot pane and the spectrum graph in the Spectrum tab to analyze assays Traffic Light Pane The Traffic Light pane shows all the wells that have data You can click on a well or use the arrow keys to change the currently selected well The shape and color of each well indicates its relationship to the currently selected well Plate Data Pane The Plate Data pane lists the calls for the plate and displays information for each call including sample ID well position and description Well Data Pane The Well Data pane shows all the as
231. utoteachlng i op er ete Ye kad ter ee gua aah eae eret 72 Saving Parameters illii nes 73 To save parameters 1 2 0 0 73 TOO MONU e succes ata rece Roe Ca ed cals s SORGEN T dale CR RR as 73 Quitting ACQUIRE 0 rh 73 To quit ACQUIRE 1 n icerum Ies pH sade a a Pe idan 73 Chapter 5 Introduction iuuezle edu ete esc wee dae Ete oe m pude RUE LA ae 75 Reviewing Screen Resolution 000 cece teens 75 Processed Data E UmTTTTT i with VDING ian iaa WH a me ii a ETT TyperAnalyzer starting TyperAnalyzer 0 2 0 cc E EER EAEE n 77 To start TyperAnalyzer 0 0 ce ee 77 The TyperAnalyzer Window 0 000 cece tees 77 Cluster Plot Pane 00 00 cece tte 77 Spectrum Pane ssa siirad i aaia dbase ade eb etis eias 77 Histogram Pane 0c c ee tees 78 Traffic Eight Pane terr deed ee eee eee nt 78 Plate Data Pane 4 2e RE nr ERR ARRA KC qu dale 78 Well Data Pane ect wad bi mE RE REGReeu eee RR Ree Re eda 78 LAWS Bal scr HP rem 78 Selecting an Experiment 0000 c cece eee ene 78 To select an experiment by customer 0 22 00000 cae 79 To select a chip by assay 00 00 ees 79 To select a chip by date 000 0 80 Color Codes x s dco PERPE UR PX rExaRepiriecbiuevvd T 80 Selecting Which Assays Are Shown 00000 eee ence neces 81 Viewing Relationships of a Currently Selected Cell
232. w to view the results after receiving data from a MassARRAY analyzer or MassARRAY analyzer compact The Genotype Analyzer module displays results in both a table format and in a graph view that shows where the genotypes fall in the spectrum For genotyping data you can view the successful Calls and the No Calls You can make a judgement on the No Calls and perform a User Call if necessary For allelotyping data you can view whether a sample is polymorphic or not i e both alleles or just one and the relative frequencies of each allele You can also view additional statistical details about the spectra for each sample El Genotype Analyzer Plate 021402_Expression Chip 021402 Experiment 1 File Edit View Help a Bl amp B amp amp vox u GD E setabey Max 111700 Boston BD recall Sequenom Domink 021402 Expression 021402 1 Charles 06 13 2005 Si d 112000 Boston BD boprimer SAMPLE ID CALL ASSAY ID WELL POSITION DESCRIPTION CALIBRATION MASS SHIFT im H 112000 Boston DT 1 C421 c G1 99N4924 254 A01 A Conservative Yes 0 930553 120700 4plex_t D Ca21 Tm ADI A Conservalive Yes 0 757277 amp amp 120700 4plex 2 3 r sa ren rem fees m s ru amp 121300 dr tmatrix AF Results Table Ed gt amp Data for each well in the currently selected experiment are Tree TUR n listed here For more information see Typerdatais F Exrresson 55 wa Using the Results Table
233. y calling a genotype in the Cluster Plot pane Caution When you manually call a genotype the call will be noted as a user call even if you change it back to the original call To manually call a genotype in the Cluster Plot pane 1 To enter Change Call mode right click in the Cluster Plot pane and select Change Call and the call you want to make from the submenu i Cluster Plot 2 i Histogram Change Call No Call G GT Font Size gt Maximize Customization Dialog Export Dialog lt AIA Spectrum Right click menu for manually calling genotypes Apply the call to points on the graph as follows e To apply the selected call to a single point on the graph click on the point e To select multiple points by drawing a lasso around them see To select a group of points on page 99 Note To select multiple points by dragging the mouse the Allow Multiple Call Changes option must be set in Configuration See Configuring TyperAnalyzer on page 150 Calls are made locally and not saved to the database unless you save them To exit Change Call mode right click in the Cluster Plot pane and select Change Call and reselect the call from the submenu to remove the check box To save the change to the database click the Save icon or select Save Changes from the File menu To select a group of points Doc 11546 R03 CO 060094 June 30 2006 1 Place the pointer where you want to begin s
234. your changes and close the dialog box or Apply to apply your changes and continue customizing Accessing the Export Dialog Box From the Customization dialog box you can at any time access the Export dialog to export your spectrum or plot cluster diagram to another graphic format To access the Export dialog box e Inthe Customization dialog box click Export Logging Debug Turning on the Log Debug Message option writes debugging messages to the Messages TyperAnalyzer log file located in the same directory as the TyperAnalyzer executable Restarting the program automatically turns off the Log Debug Message until it is turned on again Besides writing debug messages the TyperAnalyzer log file contains warning and error messages when the program encounters unexpected situations It is useful for troubleshooting if some operations do not perform as expected To turn on the Log Debug Message Option From the Options menu select Log Debug Message Quitting To quit TyperAnalyzer TyperAnalyzer e On the File menu select Exit Doc 11546 R03 CO 060094 113 MassARRAY Typer 3 4 Software June 30 2006 User s Guide for iPLEX and hME Reviewing Processed Data with TyperAnalyzer Quitting TyperAnalyzer Notes MassARRAY Typer 3 4 Software 114 Doc 11546 R03 CO 060094 User s Guide for iPLEX and hME June 30 2006 Chapter 6 Reviewing Processed Data with Genotype Analyzer Introduction This chapter explains ho
235. zygous skewing factors will be appended il Get User Input Please enter a value for SKEWNAME D Sequenom Mass4RRAY T Please specify a filename Look in CQ ReportTemplates Ex Allelotype K2 AllelotypeCorrection E AllelotypeNode tcl AllelotypeSkew tcl e AssayTypeCount e BestCallProbability E BestCallProbability tcl CallProbability Si crm R 2 DescriptionCount 2 GeneExpression I GeneExpression A R per ReportsNSkewLCorrectionFile xls amp E3 si GeneExpression A tcl E genoclust R 2 GenoQCCluster I GenoQCcCluster A tcl si GenoQcCluster B tcl El Genotype tcl xj File name orts SkewCorrectionFile Files of type All Files E Cancel Note If this is the first time you are running a Genotype report SkewCorrectionFile does not exist Select the ReportTemplates folder and type SkewCorrectionFile in the File name box When you click OK a skew correction file named SkewCorrectionFile will be created From this point on you should use this skew correction file Browse button when you click this button the Please specify a filename dialog box appears see below If not done automatically open the C MassARRAY Typer ReportTemplates folder Select SkewCorrectionFile After selecting SkewCorrectionFile click OK In the Save As dialog box select a different folder type a file name and c

iPLEX Software Guide.book

Contents

Download Pdf Manuals

Related Search

Related Contents