Protein-DNA Binding Assay User Manual
Contents
1. 2022200s nennen 4 www clontech com Clontech Laboratories Inc ATakara Bio Company Protein DNA Binding Assay User Manual I Introduction amp Protocol Overview Clontech Laboratories Inc ATakara Bio Company Chemiluminescent ProLabel Detection of Protein DNA Binding The Protein DNA Binding Assay Cat No 630460 provides a safe fast and sensitive alternative to traditional electro mobility shift assays EMSA for detection and quantitative characterization of protein DNA interactions The binding assay is performed in a 96 well plate thereby eliminating the need for gel electrophoresis It also abolishes the need for radioactive labeling ofnucleicacids because the assay is reformatted to take advantage of Clontech s sensitive and quantitative ProLabel chemiluminescence detection technology This method consists of fusing a small 6 kDa ProLabel tag to your protein of interest The resulting ProLabel fusion protein is capable of producing a strong chemiluminescent signal via the Q ee ProLabel enzyme complementation assay gt Protein Figure 1 July2007 Clontechniques Thus ofinterest ProLabel tag the ProLabel tag allows direct detection Detection of specific binding between your protein y e e e of interest and a dsDNA oligonucleotide Chemiluminescence without the need for antibodies or radio AS Active labeling Moreover because the ProLabel enzyme Enzyme Acceptor2. FWD Primer 10 pM 5 GAAT TCTGCAGTCGACGCCGCCGAGTACCCATACGACG TACCAGAT Forward PCR primer for amplification of any cDNA sequence from Clontech s Gal4 AD based yeast one or two hybrid pGADT7 prey vector for In Fusion PCR cloning into the pProLabel C Sall BamHl vector to yield an in frame N terminal fusion of ProLabel and the prey sequence 40 nl PL AD REV Primer 10 pM 5 TAGATCCGGTGGATCCAACTTGCGGGGTTTTTCAGTATCTACGATT Reverse PCR primer for amplification of any prey sequence from Clontech s Gal4 AD based yeast one or two hybrid pGADT7 prey vector for In Fusion PCR cloning into the pProlabel C Sal BamHI vector to yield an in frame N terminal fusion of ProLabel and the prey sequence 20 pl pProLabel C Vector 500 ng pl 4 1 kb cloning vector used to express an N terminal ProLabel protein fusion in mammalian cells 20 nl pProLabel p53 Control Vector 500 ng nl 5 4 kb control vector that expresses an N terminal ProLabel tagged p53 transcription factor 15 ml TransFactor Buffer 10X Specially formulated buffer used in the Protein DNA Binding Assay 50 ul Poly dIdC 1 mg ml 5 ul Control Annealed WT p53 oligo 20 pM Annealed oligonucleotide with three tandem repeats of the wild type WT p53 cis DNA consensus binding elements which the ProLabel p53 fusion protein recognizes and binds to This oligo is to be used as part of the positive control when performing the assay 5 pl Control Annealed Mutant p53 oligo
3. the wild type WT 3X p53 biotinylated oligo or the mutated MUT 3X p53 biotinylated oligo allowing protein DNA complexes to form The protein DNA complexes were then transferred and immobilized onto a streptavidin coated 96 well plate by incubation at room temperature for 1 hr After washing the wells 4X with Clontech s 1X TransFactor buffer ProLabel activity was assayed to measure the binding of ProLabel p53 and ProLabel Lamin to the oligos 25 000 PL Lam 20 000 E PL p53 15 000 10 000 5 000 ProLabel activity RLU 0 No oligo WT 3X p53 MUT 3X p53 WT 3x p53 WT 3X p53 WT 3X p53 50 100 150 Competitor pmol Figure 4 A competition assay confirms the specificity of ProLabel p53 binding to wild type 3X p53 oligo The interaction of ProLabel p53 with the WT 3X p53 oligo is specific and can be competed off by adding a nonbiotinylated competitor oligo to the initial binding reaction Protocol No PT3988 1 www clontech com Clontech Laboratories Inc Version No PR782347 ATakara Bio Company 4 Protein DNA Binding Assay User Manual ll List of Components Clontech Laboratories Inc ATakara Bio Company The Protein DNA Binding Assay Cat No 630460 contains sufficient reagents for 96 rxns Store the TALON Extractor Buffer blocking reagent and the streptavidin plate at 4 C The 10X TransFactor Buffer may be aliquoted into smaller more convenient volumes and stored at 20 C along with all other reagents 40 nl PL AD
4. 20 pM Annealed oligonucleotide with three tandem repeats of the mutant p53 cis DNA binding elements to which the ProLabel p53 fusion protein has reduced recognition and binding This oligo should result in reduced p53 binding and yield a reduced signal as compared to the WT p53 oligo www clontech com Protocol No PT3988 1 Version No PR782347 5 Protein DNA Binding Assay User Manual ll List of Components continued Protocol No PT3988 1 Version No 6 PR782347 3g Blocking Reagent Reagent to be prepared by rehydration with 1X TransFactor Buffer and used in blocking the streptavidin plate and the Protein DNA Binding Assay 5 ml TALON Extractor Buffer Specially formulated buffer used to prepare whole cell extract 1 Streptavidin plate 96 well 96 well streptavidin coated plate used to capture biotinylated dsDNA protein complexes for ProLabel detection pProLabel C Vector Information PT3935 5 pProLabel p53 Vector Information PT3989 5 1 ProLabel Detection Kit II also available separately as Cat No 631629 Reagents for detection of ProLabel activity from the captured ds DNA ProLabel fusion protein complex 4 ml Cell Lysis Buffer 3 ml CL Substrate Diluent 0 16ml Galacton Star Substrate 0 8 ml Emerald II Solution 4 ml EA Reagent 0 1 ml Positive Control Peptide Centrifuge vial before opening www clontech com Clontech Laboratories Inc ATakara Bio Company Pr
5. Label p53 whole cell extract usually provides an adequate signal however some extracts may perform better at lower or higher concentrations e Fora background control use whole cell extract from cells transfected with the pProLabel fusion construct and omit the biotinylated oligo e The biotinylated oligo can be a wild type or mutant oligo e Optimal competitor oligo concentration may vary depending on the transcription factor For competition assays add 50 pmol competitor oligo to the sample and reduce the Blocking Buffer volume accordingly to maintain a total assay volume of 50 ul If this does not generate an adequate decrease then add more com petitor oligo in subsequent competition assays Clontech Laboratories Inc www clontech com Protocol No PT3988 1 ATakara Bio Company Version No PR782347 13 Protein DNA Binding Assay User Manual VI Protein DNA Binding Assay continued e The optimal Poly dldC concentration can vary with different transcription factors We find that 0 5 ug of Poly dldC per reaction is a good starting point 3 Incubate the samples on ice for 15 min 4 Meanwhile add 150 ul of the Blocking Buffer from Section VI A 2 to each well of the streptavidin plate that will be used in the binding assay and incubate at room temperature for 15 min 5 Remove the Blocking Buffer from the streptavidin plate 6 Add the 50 pl sample to the well and incubate for 60 min at room temperature 7 Wash the wells 4X
6. Protein DNA Binding Assay User Manual Cat No 630460 PT3988 1 PR782347 Published 24 October 2007 Protein DNA Binding Assay User Manual Table of Contents Protocol No PT3988 1 Version No 2 PR782347 I Introduction amp Protocol Overview uuuuuuunnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nun 3 ll List of Components 22202000000002n0nnnnnonnnnnnnn nun nun nnnnn nun nun nun nnnnn nun nnnnnnnnn nun annn anne 5 Il Additional Materials Required 0220220020002000n0nnnnnnnn anno nun nun nnnnnnnnnnnnnnn nun nun nun anne 7 IV Preparing amp Testing Binding Oligos amp ProLabel Fusion Constructs suzuu2rmssennn 8 A Protocol Design and Synthesis of Specific DNA Binding Oligos uusssssenssnensnnnnnnennnnnnnnnn 8 B Protocol Cloning of Pro Label Fusion Onstr ts ssscescuzeceusciascnawtesiavssebhaceustesnenerenisereecacctaabendeeystexatenars 9 C Protocol Optional Amplification of Insert with Universal In Fusion Primers n 9 D Protocol Verifying ProLabel Activity from ProLabel Fusion Proteins u2usneneennennnn 10 V Expression of ProLabel Fusion Protein for the Binding Assay 22220222020000200000 12 A ies etic Or Mimmalian Cellisca aenn en EEDE raean i ndai FEUER TENEUESERTER 12 B Prepatation ot Whole Cell Extract WOE cs sos cepetegnntennanesanncsacyesanceasaqncameioansaqvens
7. ach at an approximate concentration of 100 pM in a volume of 100 500 ul This will give a theoretical yield of 50 pM of biotinylated annealed oligo pair Heat the oligo mixture at 95 C for 10 min in an Eppendorf tube in a heating block and then allow the block containing the mixture to cool down slowly to room temperature After diluting the double stranded oligo to its desired concentration see Section VI B it is ready for use www clontech com Clontech Laboratories Inc ATakara Bio Company Protein DNA Binding Assay User Manual IV Preparing amp Testing Binding Oligos amp ProLabel Fusion Constructs continued Protocol Protocol 2 hr Clontech Laboratories Inc ATakara Bio Company B Protocol Cloning of ProLabel Fusion Constructs e Any gene of interest can be inserted into the multiple cloning site of the pProLabel C Vector to generate a ProLabel fusion construct It is important that the cloning design yields an in frame fusion with the ProLabel tag and does not contain any premature stop codons otherwise the proper ProLabel fusion protein will not be expressed e The In Fusion primers provided in the kit PL AD FWD REYV are specifically designed to facilitate the directional PCR cloning of inserts cDNA from any of the following Gal4 AD based yeast one or two hybrid library vectors pGADT7 pGADT7 Rec pGADT7 Rec2 or pLP GADT7 into the Sall BamHl restriction sites of the pProLabel C vector to generate i
8. apturing the protein DNA complexes and the ProLabel Detection Kit II are also included In addition the kit provides a control vector containing ProLabel fused to a known DNA binding protein as well as biotinylated dsDNA oligonucleotides designed to serve as positive and negative DNA protein binding controls respectively for the assay that examines the binding of the p53 fusion protein to its cognate cis acting DNA consensus element If you are confirming protein ProLabel tag Protein GOI N of interest Prepare whole cell extract DNA interactions identified using our Matchmaker One Hybrid Library PL nu gt amp e e e A Bi ti l t d Construction amp Screening Kit Cat pProLabel C i a Transfect Incubate and express with No 630304 you can take advantage sated express ee of our robust and efficient In Fusion cells oligo oot apture PCR Cloning technology by using the protein DNA g complexes included Universal In Fusion Clon as ing primers October 2007 Clontech d ooo N niques These primers are designed Wash bound AN N protein DNA complexes for direct and efficient directional wow ear and detect PL y e eo activity PCR cloning of putative yeast one hybrid clones from es of Clontech s Figure 2 Schematic diagram of the Protein DNA Binding Assay pGADT7 based cDNA library vectors PL ProLabel GOI gene of interest into the pProLabel C Vector www clontech com Protoco
9. bel Activity from ProLabel Fusion Proteins Once the ProLabel fusion protein has been generated and a stock DNA solution has been purified it is important to on o verify expression of the ProLabel fusion protein in mammalian cells prior to performing your Protein DNA Binding Assay The ProLabel activity of your fusion protein can be easily assessed in the lysate from cells transfected the ProLabel fusion construct using the ProLabel Detection Kit I included with the DNA Protein Binding Assay 1 Transfection of ProLabel Fusion Constructs Using a cell line and a transfection reagent of choice perform the following transfections in a 24 well plate according to the procedures recommended by the transfection reagents manufacturer The following constructs should be independently transfected GOI gene of interest a pProLabel C negative control b pProLabel p53 positive control c pProLabel GOI NOTE We typically use calcium phosphate to cotransfect HEK 293 cells using our CalPhos Mammalian Trans GA fection Kit see Section Ill since this combination consistently yields high transfection efficiencies If you wish to use a different transfection reagent and or cell line make certain that the selected transfection reagent is capable of providing high transfection efficiencies in your particular chosen cell line Protocol No PT3988 1 www clontech com Version No PR782347 10 Clontech Laboratories Inc ATakara Bio Company P
10. ch plate of cells and manually tilt the plate back and forth to coat the surface of the plate with the buffer Place the remainder of the CBE on ice for use in diluting the sample for the protein determination step Step 8 5 Keeping the plate on ice and using a cell scraper scrape to detach the cells from the culture plate 6 Collect the loosened cells into a clean 1 5 ml microcentrifuge tube and place the tube on ice for 30 min vortexing every 10 min for 10 sec to ensure complete lysis 7 Centrifuge the samples at 20 000 x g for 20 min at 4 C 8 Transfer the supernatant to a clean 1 5 ml microcentrifuge tube place the sample on ice and determine the protein concentration using a BCA bicinchoninic acid protein assay or a comparable assay NOTE The whole cell extract WCE can be stored at 70 C for up to 1 month in convenient aliquots to prevent multiple freeze thaw cycles however we recommend using the WCE in the binding assay the same day it is prepared to obtain maximal ProLabel signal intensity Protocol No PT3988 1 www clontech com Clontech Laboratories Inc Version No PR782347 ATakara Bio Company 12 Protein DNA Binding Assay User Manual VI Protein DNA Binding Assay PLEASE READ THE ENTIRE PROTOCOL BEFORE STARTING Use this procedure to perform the Protein DNA Binding Assay A Preparation of Buffers for Binding Assay P is tet 1 Determine the amount of 1X TransFactor TF Buffer required number o
11. cleotides 2 Wild Type Binding Oligo Design Guidelines Each DNA binding oligo should contain a specific transcription factor protein binding consensus sequence flanked by a short sequence on both the 5 and 3 ends The flanking region should consist of a short DNA sequence ranging from 3 10 base pairs which does not contain binding sites for other transcription factors If you are interested in a certain factor protein and do not know its consensus binding sequence or are seek ing alternative binding sites the binding sequence information may be obtained from the scientific literature or from transcription factor binding sequence databases Recommended databases include the commercially available TransFac Database from BioBase Biological Databases Wolfenbiittel Germany at http www biobase de and the public databases at http www cbrc jp research db TFSEARCH htm and at http www modor cgb ki se sgi bin jaspar2005 jaspar_db pl In all of these da tabases a field labeled MATRIX lists the highly conserved binding sequence for each transcription factor compiled from multiple known binding sequences The consensus sequence is the portion that is very highly conserved MATRIX also includes flanking sequences that are not as highly conserved The public JASPAR database at http www modor cgb ki se sgi bin jaspar2005 jaspar_db pl is an open access database of annotated high quality matrix based transcription factor binding site profiles fo
12. ction Kit Il e Insufficient incubation time after the ProLabel detection reagents are added e Insufficient number of repeat sequences of the consensus cis DNA binding site E High signal in mutant wells Improper mutant oligo design the mutant oligo lacks the necessary sig nificant changes particularly at the conserved nucleotides Refer to Section IV A for oligo design instructions F No competition or low Improper design of oligo Refer to Section IV A for oligo design instruc competition tions Check to make sure there is no biotin label on the competitor oligo and that the only difference between the competitor and the binding oligo is the lack of a biotin label on the former e Insufficient amount of competitor oligo added www clontech com Protocol No PT3988 1 Version No PR782347 15 Protein DNA Binding Assay User Manual VIII References Chemiluminescent Quantification of Protein Expression July 2007 Clontechniques XXII 3 18 19 Tootle T L and Rebay I 2005 Post translational modifications influence transcription factor activity A view from the ETS superfamily BioEssays 27 3 285 298 Protein DNA Binding Assay October 2007 Clontechniques XXII 4 21 23 Sandelin A Alkema W Engstrom P Wasserman W W and Lenhard B 2004 JASPAR an open access database for eukaryotic transcription factor profiles Nucleic Acids Res 32 D91 D94 Protocol No PT3988 1 www clontech com Clontech Labo
13. es and primer designs to ensure that the fusion protein is in frame use a high fidelity DNA polymerase for the PCR amplification of your insert to avoid PCR induced mutations that may result in frame shift or premature stop codon Sequence to verify Low levels of expression can be the result of low transfection efficiency The steady state level of your protein of interest may be naturally low however this should not affect the Protein DNA Binding Assay because the ProLabel assay is highly sensitive and thus capable of detecting protein DNA interactions despite low expression levels However you may increase the incubation time after transfection for increased ProLabel fusion protein expression Improper design of binding oligo Refer to Section IV A for oligo design instructions D Lack of signal or weak signal in all wells Poly dldC concentration used in the binding assay is too high Omit Poly didC or use a lower concentration in the experiment Insufficient amount of cellular extract in the assay due to low steady state level of the ProLabel fusion protein Increase the amount of whole cell extract used No activity in the cellular extract This may be due to improper or ineffi cient induction of the cells or improper isolation or storage of the cellular extract Check the literature for the appropriate cell induction reagent and kinetics e Improper preparation of the assay reagents from the stocks in the ProLabel Dete
14. f assay wells x 1 5 ml Total Volume of TF Buffer needed for both the assay and the washes Dilute the 10X TransFactor Buffer with distilled water to obtain the above volume 2 Prepare Blocking Buffer as follows 300 ul assay 1X TF Buffer 10 mg assay Blocking Reagent 300 ul assay Volume of Blocking Buffer Mix the Blocking Reagent with the 1X TF Buffer at a final concentration of 33 mg ml or 3 3 w v until the Blocking Reagent completely dissolves then filter the Blocking Buffer through Whatman filter paper before use 2 Keep the remaining 1X TF Buffer on ice to use in the wash steps after the binding assay B Sample Incubation and Immobilization 1 If your sample has been stored at 70 C thaw the whole cell extract on ice Protocol 2 hr NOTE After the whole cell extract is thawed we recommend centrifuging the sample at 20 000 x g for 5 min at 4 C to remove residual cell debris Including this step will decrease the variability of your results 2 Prepare the sample by mixing the desired amount of whole cell extract and poly dIdC see Notes below with 2 pmol biotinylated annealed oligo In a microcentrifuge tube adjust the final volume of the mixture to 50 ul with Blocking Buffer ZK NOTES e Optimal extract concentration may vary depending on the protein transcription factor and cell type To optimize the assay perform a dose response curve with your whole cell extract We find that 100 ug of the control Pro
15. fusion protein the protein DNA binding assay since 15 fold more ProLabel p53 binding activity was fies nn 3x AGGCATGCCTAGCATGCCT wild type detected when utilizing the WT 3X p53 oligo instead 3 x AGGAATGCCTAGAATGCCT BEE of a mutated p53 oligo Moreover the binding of ProLabel p53 to the WT 3X p53 oligo could be competed off in the initial incubation step with a non 3 x AGGCATGCCTAGCATGCCT no biotin biotinylated WT 3X p53 oligo Table I Figure 4 Competitor p53 oligo oe E HEK 293 PL p53 3 500 mut p53 3 000 E HEK 293 PL p53 2 500 WT p53 amp 2 000 E HEK 293 PL Lam 3 1 500 WT p53 S 1 000 O 500 0 0 25 50 100 Whole cell lysate yg Figure 3 The Protein DNA Binding Assay quantitatively detects specific binding of ProLabel p53 fusion protein to wild type 3X p53 oligo Variable amounts of whole cell lysates prepared In TALON Extractor Buffer containing mammalian expressed ProLabel Lamin fusion protein negative control or ProLabel p53 fusion protein positive control were incubated with either a 5 biotinylated wild type 3X p53 annealed oligo or a mutated version The overall protein levels of the lysate containing the expressed ProLabel Lamin or ProLabel p53 fusion proteins were assayed by the BCA method to normalize for the addition of equivalent amounts of total protein in comparative assays The indicated amount of each lysate was incubated on ice for 15 min in the presence of Poly dldC with either
16. fusion protein is expressed in mammalian EA cells it can acquire biologically relevant Figure 1 The ProLabel screening assay The ProLabel tag on the fusion protein comple ments the function of the Enzyme Acceptor The ProLabel tag and the Enzyme Acceptor be necessary for functional DNA binding combine to form an active enzyme that cleaves the chemiluminescent substrate and Tootle et al 2005 produces a signal that can be detected with any standard luminometer posttranslational modifications that may A Complete Assay System for Cloning Expression amp Detecting Protein DNA Binding The binding reaction is carried out by incubating a cellular extract containing the ProLabel fusion protein of interest with a biotinylated dsDNA oligonucleotide containing a putative consensus binding sequence for this pro tein Figure 2 The biotin moiety on the oligonucleotide permits its subsequent capture on a streptavidin coated 96 well plate Then the wells are subjected to a series of wash steps to remove nonspecific binding interactions and minimize background signal Specific protein DNA binding interactions are measured using the ProLabel assay The Protein DNA Binding Assay provides the pProLabel C Vector for cloning and expressing your ProLabel fusion pro tein of interest in mammalian cells The kit also includes specially formulated buffers for preparing whole cell extracts and performing the binding assay A streptavidin coated 96 well plate for c
17. ght is a trademark of Becton Dickinson and Company HALT is a trademark of Pierce Biotechnology Inc Clontech has the exclusive rights to make use and sell the In Fusion PCR Cloning System Clontech the Clontech logo and all other trademarks are the property of Clontech Laboratories Inc unless noted other wise Clontech is a Takara Bio Company 2007 Clontech Laboratories Inc www clontech com Protocol No PT3988 1 Version No PR782347 19
18. ifically to the annealed biotinylated wild type p53 cis DNA consensus element than to the annealed biotinylated mutant p53 cis DNA consensus element ProLabel fusion protein expression levels can be measured quantitatively from mammalian cell lysates using the method described in this user manual www clontech com Clontech Laboratories Inc ATakara Bio Company Notes Clontech Laboratories Inc ATakara Bio Company Protein DNA Binding Assay User Manual Notice to Purchaser Clontech products are to be used for research purposes only They may not be used for any other purpose including but not limited to use in drugs in vitro diagnostic purposes therapeutics or in humans Clontech products may not be transferred to third parties resold modified for resale or used to manufacture commercial products or to provide a service to third parties without written approval of Clontech Laboratories Inc For CMV Sequence The CMV promoter is covered under U S Patent Nos 5 168 062 and 5 385 839 assigned to the University of lowa Research Foundation For ProLabel Detection Products This product is intended to be used for research purposes only It is not to be used for drug or diagnostic purposes nor is it intended for human use Clontech products may not be resold modified for resale or used to manufacture commercial products without written approval of Clontech Laboratories Inc ProLabel is a trademark of DiscoveRx Inc BD Monoli
19. ition of substrate c Plot the ProLabel readings as a function of time to qualitatively assess that the signals detected within these time points are within the linear range of ProLabel enzymatic activity d Pick a time point in the linear range that has the highest readings to calculate the signal to noise ratio Protocol No PT3988 1 www clontech com Clontech Laboratories Inc Version No PR782347 ATakara Bio Company 14 Protein DNA Binding Assay User Manual VII Troubleshooting Guide Clontech Laboratories Inc ATakara Bio Company PROBLEM POSSIBLE EXPLANATIONS amp SOLUTIONS PCR component s are missing or degraded Template is not one of the GAL4 pGADT7 based library vectors and thus lacks complementarity with the PL AD FWD REV primers B Low In Fusion cloning efficiency pProLabel C Vector is not digested with the correct restriction enzyme is observed with PCR product make sure that it is digested with Sall BamHI when using the PL AD amplified using PLAD FWD REV FWD REV primers for In Fusion PCR cloning of your insert primers A PLAD FWD REV Primers fail to yield a PCR product pProLabel C Vector is incompletely digested and the remaining circular or religated single cut vector can contribute to the background in the cloning C No expression or low expression Lack of expression is often due to the ProLabel fusion protein being out of the ProLabel fusion protein of frame Check cloning strategi
20. l No PT3988 1 Version No PR782347 3 Protein DNA Binding Assay User Manual I Introduction amp Protocol Overview continued Specific amp Quantitative Detection of DNA Protein Interactions To verify that the Protein DNA Binding Assay detects specific interactions we compared the relative binding activities of ProLabel p53 and ProLabel Lamin fusion proteins after each was separately incubated with 5 biotinylated annealed oligonucleotides that contained tandem repeats of the wild type WT p53 cis acting DNA consensus elements Table I The relative levels of ProLabel activity captured on the plate for each binding reaction Figure 3 demonstrated that our in vitro assay detects specific binding of p53 to its cissDNA consensus binding element The WT 3X p53 containing oligonucleotide bound 55 fold more ProLabel p53 than ProLabel Lamin as determined by assaying ProLabel activity in the immobilized Sequence Oligo Type protein DNA complexes These measurements were p53 consensus sequence Table I Oligonucleotide Sequences Used in the DNA Protein Binding Assays also quantitative since the overall level of ProLabel l 2 RRRCWWGYYYRRRCWWGYYY wild type p53 binding detected was dependent on the amount RRRAWWGYYYRRRAWWGYYY eee of whole cell lysate added to each sample where R AorG W AorlT and Y CorT The assay screens for specificity in terms of the tar Se Biotinylated annealed p53 oligos used in get sequence as well as the ProLabel
21. n frame ProLabel fusion proteins Please note that this primer set may share sequence homology with other Gal4 based AD vector constructs in addition to those listed here Please check the boldfaced underlined portions of the primer sequences see Section II against your vector of choice to determine if the primers will anneal in the correct orientations and in frame positions for use in this In Fusion PCR cloning application Additionally restriction sites other than the ones listed above can be used for inserting the gene sequences however different In Fusion primer designs are necessary for the clon ing as well as for generating in frame fusions It is also possible to use traditional restriction enzyme cloning We recommend Clontech s In Fusion 2 0 CF Dry Down PCR Cloning Kit Cat No 639607 or 639608 for simple efficient directional PCR cloning of your insert s into the pProLabel C vector Whether you use In Fusion 2 0 or an alternative PCR cloning system it is essential that the DNA polymerase used for the amplification has superior performance and high fidelity such as Clontech s Advantage HD Polymerase Mix Cat No 639241 so as to ensure that the function of the expressed ProLabel fusion protein is not compro mised by any introduced mutations C Protocol Optional Amplification of Insert with Universal In Fusion Primers If you are using the Universal In Fusion Primers supplied in this kit for directional In Fusion PCR cloni
22. nd lyse the adherent cells For each sample being assayed transfer 80 pl of the lysate to a 96 well plate with a clear bottom and white black sides Set up a positive control sample by mixing 50 pl of Positive Control Peptide with 30 ul of ProLabel Detection Buffer and adding the mixture to an empty well g To each 80 ul of lysate being assayed add 30 pl of the substrate mix j Gently pipet up and down twice to mix the contents Incubate the plate at room temperature from 15 min up to 1 hr Using a luminometer record ProLabel activity every 15 min during this time interval 4 Interpretation of Results Clontech Laboratories Inc ATakara Bio Company Different ProLabel fusions will yield different levels of ProLabel activity However if your ProLabel fu sion protein is efficiently expressed in the transfected cells then the ProLabel activity detected should be significantly higher than the one observed in the negative control cells transfected with the empty pProLabel C Vector as these lysates should not yield any significant ProLabel activity www clontech com Protocol No PT3988 1 Version No PR782347 11 Protein DNA Binding Assay User Manual V Expression of ProLabel Fusion Protein for the Binding Assay PLEASE READ THE ENTIRE PROTOCOL BEFORE STARTING Use this procedure to express your ProLabel fusion protein of interest in mammalian cells Section A and prepare a whole cell extract Section B for u
23. ng of acDNA insert from any of the following Gal4 AD based yeast one or two hybrid library vectors pGADT7 pGADT7 Rec pGADT7 Rec2 or pLP GADT7 the following set up and thermocycler conditions are recommended 1 PCR Set Up 1 ul pGADT7 cDNA plasmid template 1ng ul or water for negative no template control NTC 10 ul 5X Advantage HD PCR Buffer 4 ul dNTP mix 2 5 mM each 1 pl PL AD FWD Primer 10 pM 1 ul PL AD REV Primer 10 pM 32 5 ul deionized water 0 5 ul Advantage HD Polymerase 50 ul Total Volume www clontech com Protocol No PT3988 1 Version No PR782347 9 Protein DNA Binding Assay User Manual IV Preparing amp Testing Binding Oligos amp ProLabel Fusion Constructs continued 2 Thermocycler Program We recommend the following thermocycler program for use with the primers provided in the kit Cycling Parameters 98 C for 5 min 30 cycles 98 C for 15 sec 55 C for 15 sec 72 C for 1 min kb 72 C for 10 min 4 C for GY NOTE As a general rule of thumb the extension time should be 1 min kb but 3 min will work for the major ZK ity of the cDNAs in the Gal4 based pGADT7 AD library If you know that your cDNA is longer than 3 kb then change the extension time accordingly Analyze 5 ul of the PCR product on a 1 agarose TAE EtBR gel alongside a DNA standard such as a 1 kb ladder to assess the yield and specificity of the product before proceeding to the cloning step D Protocol Verifying ProLa
24. otein DNA Binding Assay User Manual lil Additional Materials Required Clontech Laboratories Inc ATakara Bio Company DMEM FBS Sodium pyruvate PBS Trypsin EDTA CalPhos Mammalian Transfection Kit Cat No 631312 recommended or other transfection reagents Cell scrapers Halt Protease Inhibitor Cocktail Pierce Biotechnology Cat No 78410 or an analogous substitute PMSF Customer specific biotinylated annealed oligo s Distilled water Pipettor Pipette tips Multi channel pipet Whatman filter paper folded grade 113V Whatman Cat No 1213 125 Luminometer plate reader 24 well plates 96 well plate with clear bottom and white black sides Thermocycler www clontech com Protocol No PT3988 1 Version No PR782347 7 Protein DNA Binding Assay User Manual IV Preparing amp Testing Binding Oligos amp ProLabel Fusion Constructs Protocol Protocol 30 min Protocol No PT3988 1 Version No 8 PR782347 PLEASE READ THE ENTIRE PROTOCOL BEFORE STARTING Use this procedure to design oligos for the binding assay clone your protein of interest and confirm that it is expressed in mammalian cells A Protocol Design and Synthesis of Specific DNA Binding Oligos 1 Oligo Purity Requirements The synthesized oligonucleotides should at the minimum be supplied in a desalted form However we highly recommend that they be HPLC or PAGE purified particularly if they are longer than 75 nu
25. r eukaryotes developed by the Center for Genomics and Bioinformatics Karolinska Instituret Stockholm Sweden Sandelin et al 2004 An oligo that contains 2 3 concatenated tandem copies of the binding sequence can often produce a stronger binding signal than a single copy However increasing the sequence copy number may not necessarily raise the binding efficiency any further data not shown We recommend designing and testing two oligonucle otides with varying numbers of concatenated copies of the binding sequence 3 Control Oligo Design Guidelines Mutant Binding Oligos Mutant binding oligos may be used as additional controls for the binding assay To design a mutant binding oligo replace the most highly conserved nucleotides in the consensus sequence which are most likely to be the nucleotides that interact directly with the protein transcription factor with other nucleotides To make the mutant oligo a good control it is best to limit the number of nucleotides that are changed to no more than 4 within a given DNA binding site Wild Type Competitor Oligos A wild type competitor oligo has the same sequence as a wild type binding oligo but it is not biotinylated 4 Oligo Synthesis and Annealing After the DNA binding consensus sequence is determined arrange for the synthesis of two complementary oligos One of the two oligos should contain a biotin label at its 5 end Combine equimolar ratios of the two complementary oligos e
26. ratories Inc Version No PR782347 ATakara Bio Company 16 Protein DNA Binding Assay User Manual Appendix A Plasmid Information Clontech Laboratories Inc ATakara Bio Company Ween Tag Pvul To MCS pProLabel C as HSV TK SV40 polyA pau me 1072 f1 ori Kan Neo SV40 ori Pstl Kpnl Smal 781 CAA GCT TCG AAT TCT GCA GIC GAC GGT ACC GCG GGC CCG GGA TCC ACC GG Hindlll EcoRl Sall Apal BamHl Figure 5 pProLabel C Vector Map and Multiple Cloning Site pProLabel C is amammalian expression vector designed to express a protein of interest fused at its N terminus to the the C terminus of a 6 kDa ProLabel tag The resulting fusion protein can be quantified using the ProLabel Detection Kit Il included with the Protein DNA Binding Assay Cat No 630460 to perform enzyme fragment complementation assays 1 2 In these assays two inactive enzyme fragments the ProLabel tag and a larger Enzyme Acceptor are combined to form a complete active enzyme that cleaves the Galacton Star chemiluminescent substrate The resulting signal can be detected and quantified with any standard luminometer The pProLabel C vector contains a CMV promoter that drives strong constitutive expression of the fusion protein and an SV40 polyadenylation signal that directs processing of the 3 end of the mRNA transcript The vector also contains a kanamy cin neomycin resistance cassette Kan Neo that allows G418 selection of stably transfected eukaryo
27. rotein DNA Binding Assay User Manual IV Preparing amp Testing Binding Oligos amp ProLabel Fusion Constructs continued 2 Preparation of ProLabel Assay Reagents Forty eight hr posttransfection prepare reagents and assay for ProLabel fusion protein expression using the included ProLabel Detection Kit II First thaw the components from the ProLabel Detection Kit II at room temperature Once the components are thawed invert to mix and then place the components on ice d Preparation of ProLabel Detection Buffer e Combine 1 volume of Cell Lysis Buffer with 3 volumes of EA Reagent Mix well and place on ice until use e The volumes can be scaled accordingly depending on how many samples are being assayed For verification of ProLabel fusion protein expression you will need 100 ul of ProLabel Detection Buffer per sample to lyse the transfected cells It is a good idea to prepare 10 extra to account for pipetting error NOTE You will use 80 ul of each lysate for the ProLabel assay see Section IV D 3 e Preparation of Substrate Mix Galacton Star Substrate 1 2 ul Emerald Il Solution 6 0 ul CL Substate Diluent 22 8 ul Total Volume Sample 30 0 ul 3 Prolabel Detection Procedure Remove the medium from the well and wash the cells with 500 ul of PBS Aspirate off the PBS and keep the plate containing the cells on ice To each well add 100 pl of the ProLabel Detection Buffer Pipet up and down several times to dislodge a
28. se in the Protein DNA Binding Assay Protocol 1 hr A Transfection of Mammalian Cells 1 For each transfection you will need one 60 mm plate 2 One day before the transfection seed cells onto 60 mm plates at a density recommended by the manufacturer of your transfection reagents For HEK 293 cells being transfected with Clontech s CalPhos Mammalian Transfection Kit see Section IH this means that approximately 1 x 10 cells are seeded onto each 60 mm plate 3 Set up the control and experimental transfections as follows a Positive Control pProLabel p53 b Experimental Sample pProLabel GOI fusion construct GOI gene of interest 4 Transfect according to the protocols recommended by the reagent s manufacturer B Preparation of Whole Cell Extract WCE Protocol 1 5 2 hr NOTE Samples should be kept on ice during the entire extraction procedure to prevent protein degradation and denaturation 1 Forty eight hr posttransfection remove the culture medium and wash the cells in each plate with 2 x 5 ml of cold PBS 2 Aspirate PBS and place the plates containing the cells on ice 3 Calculate and prepare the required amount of Cell Extraction Buffer CBE as follows and keep it on ice e Prepare 600 ul of CBE per 60 mm plate e CBE TALON Extractor Buffer containing 1X Halt Protease Inhibitor Cocktail recommended see Section III or a similar mixture of protease inhibitors and 1 mM PMSE 4 Add 500 ul of CBE to ea
29. seononlcnsanrasacresxepsosencads 12 VI Protein DNA Binding Assay 42 240002000000000000 anno anno nun nun nun nun nun Dann n nun nun nun nun anne 13 A Preparation of Buffers tor Binding Assay srities emer reer tee ait aea ee wre pete ay enn E EEEE 13 B Sample Incubation and Imro 0 16 21 on nee er een 13 C ProLabel Detection of Immobilized Protein DNA Interactions cccccsssscceeesessceeeeeseesseeeeeeeessaes 14 VII Troubleshooting Guide 02002200200000 n0n0nnnnnnnannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nun 15 VI E nung seen ebenen A neues E E E E renden E een ereseee 16 Appendix A Plasmid Information 2222220200200000000000nnnn anno nun nnnn nun nn nn Ran nnnn nun anne 17 List of Figures Figure I Ihe ProLabel screening assay use naeueieeunsnelgunbe 3 Figure 2 Schematic diagrami of the Brotein DINA Binding Assay 2zccsnctcenssestecetectnscreieesesncsatdeseeseieuatdeces 3 Figure 3 Ihe Protein DNA Binding Assay quantitatively detects specific binding of ProLabel p53 fusion protein to wild type 3X p53 oligo zen een 4 Figure 4 A competition assay confirms the specificity of ProLabel p53 binding to wild type EE 02 2 AEA E E E EEN A E AA E E CANCER 4 Mgure 5 pProLabel C Vector Map and Maltiple Cloning Site sense een 17 Figur 6 pProLabel p33 Vector Map nase ren 18 List of Tables Table I Oligonucleotide Sequences Used in the DNA Protein Binding Assays
30. sses the ProLabel tag 6 kDa fused to the N terminus of a truncated version of the murine p53 tumor suppres sor protein containing amino acids 72 391 The resulting fusion protein can be quantified by using the ProLabel Detection Kit Il included with the Protein DNA Binding Assay Cat No 630460 to perform enzyme fragment complementation assays 1 2 In these assays two inactive enzyme fragments the ProLabel tag and a larger Enzyme Acceptor are combined to form a complete active enzyme that cleaves the Galacton Star chemiluminescent substrate The resulting signal can be detected and quantified with any standard luminometer The pProLabel p53 vector contains a CMV promoter that drives strong constitutive expression of the fusion protein and an SV40 polyadenylation signal that directs processing of the 3 end of the MRNA transcript The vector also contains a ka namycin neomycin resistance cassette Kan Neo that allows G418 selection of stably transfected eukaryotic cells a bacterial promoter upstream of this cassette allows kanamycin selection of transformed bacterial cells In addition pProLabel p53 contains an SV40 origin of replication for propagation in mammalian cells that express SV40 T antigen a pUC origin for propagation in E coli and an f1 origin for the production of single stranded DNA pProLabel p53 is used as a control construct in the Protein DNA Binding Assay to show via ProLabel detection that p53 binds more spec
31. tic cells a bacterial promoter upstream of this cassette allows kanamycin selection of transformed bacterial cells In addition pProLabel C contains an SV40 origin of replication for propagation in mammalian cells that express SV40 T antigen a pUC origin for propagation in E coli and an f1 origin for the production of single stranded DNA The pProLabel C vector is used to create a fusion of your protein of interest and the ProLabel tag for use in the Protein DNA Binding Assay in order to detect specific binding of this protein to a biotinylated dsDNA oligonucleotide containing a putative consensus binding sequence In order to do so your gene of interest must be in the same reading frame as the ProLabel tag sequence with no intervening stop codons ProLabel vector constructs can be transfected into mammalian cells using standard transfection methods Specific protein DNA binding interactions can be measured quantitatively from mammalian cell lysates using the instructions in this user manual www clontech com Protocol No PT3988 1 Version No PR782347 17 Protein DNA Binding Assay User Manual Appendix A Plasmid Information continued Protocol No PT3988 1 Version No 18 PR782347 pUC P ori ProLabel Tag HSV TK polyAt pProLabel p53 5169 bp p53 Kan Neo SV40 fori PONA Figure 6 pProLabel p53 Vector Map pProLabel p53 is a mammalian expression vector encoding a ProLabel p53 fusion pro tein It expre
32. with 150 ul of 1X TF Buffer from Section VI A 3 per well Allow 4 min for each wash After the final wash remove the 1X TF Buffer from the wells C ProLabel Detection of Immobilized Protein DNA Interactions Thaw the components from the ProLabel Detection Kit II at room temperature Once the components are thawed Protocol invert to mix and then place the components on ice 0 5 1 hr 1 ProLabel Detection Buffer e Combine 1 volume of Cell Lysis Buffer with 3 volumes of EA Reagent Mix well and place on ice until use e The volumes can be scaled accordingly depending on how many samples are being assayed For ProLabel detection of immobilized protein DNA interactions you will need 80 ul per binding assay It is a good idea to prepare 10 extra to account for pipetting error 2 Substrate Mix Galacton Star Substrate 1 2 ul Emerald Il Solution 6 0 ul CL Substate Diluent 22 8 ul Total Volume Sample 30 0 ul 3 Prolabel Detection Procedure a Add 80 ul of the ProLabel Detection Buffer to each well that contains the captured protein DNA complex Then set up a positive control by mixing 50 ul of Positive Control Peptide with 30 ul of ProLabel Detection Buffer and adding the mixture to an empty well b Add 30 ul of Substrate Mix to each well containing the ProLabel Detection Buffer and measure the chemiluminescent signal from each sample using the BD Monolight 96 well reader or equivalent at 0 15 30 45 and 60 min after add
Download Pdf Manuals
Related Search