Evaluation of suitable reference genes for gene expression studies
Contents
1. Karlen Y and Moorman A F M 2009 Amplification efficiency linking baseline and bias in the analysis of quantitative PCR data Nucleic Acids Research in press Vandesompele J De Preter K Pattyn F Poppe B Van Roy N De Paepe A and Speleman F 2002 Accurate normalization of real time quantitative RT PCR data by geometric averaging of multiple internal control genes Genome Bio 3 7 21 Evaluation of suitable reference genes for gene expression studies in bronchoalveolar lavage Attachments Melting curve B2M rad gt oe 5 o S m Temperature C Melting curve ACTB Fluorescence R T Temperature C 22 Evaluation of suitable reference genes for gene expression studies in bronchoalveolar lavage Melting curve GAPDH z R Fe ao wv 5 o 5 2 iL 76 78 Temperature C Melting curve HPRT Fluorescence R T Temperature C 23 Evaluation of suitable reference genes for gene expression studies in bronchoalveolar lavage Melting curve RPL32 R a ky 5 v D 9 3 wu Temperature C Melting curve UBB Fluorescence R T Temperature C 24 Evaluation of suitable reference genes for gene expression studies in bronchoalveolar lavage Melting curve SDHA E 8 3 w 25 Evaluation of suitable reference genes for gene expression studies in bronchoalveolar lavage Doing a good g2. One microliter of cDNA was added to thirteen microliter PerfeCta SYBR Green Super Mix Low ROX two microliter of the forward primer two microliter of the reverse primer and seven microliter of nuclease free water to make a total volume of 25 microliter The final concentration of both the primers in the reaction was 40 nM The PCR reactions were performed on a MX3005P machine Stratagene PCR conditions for HPRT1 B2M SDHA TFRC UBB and RPL32 were initial denaturation at 95 degrees for 5 minutes followed by 45 cycles of denaturation at 95 degrees for 1 minute annealing at 62 degrees for 30 seconds and extension at 70 degrees for 30 seconds After the last cycle the melting curve was determined in the range 60 95 C For GAPDH and ACTB we used the same protocol only the annealing temperature was 64 C instead of 62 C All the reactions were ran in triplicate on the same plate Negative control samples were always included in the amplification reactions to check for contamination Specificity of amplification was confirmed by melting curve analyses and 1 agarose gel electrophoresis 2 7 Data analysis The raw qRT PCR amplification data were exported from the MxPro software Stratagene to excel The software LinRegPCR Ruijter 2009 was used to calculate the efficiencies for all the reactions separately LinRegPCR is a free software tool that uses non baseline corrected data to perform a baseline correction on each sample separately then
3. S A Radoni A and Jung K 2005 Gene expression studies in prostate cancer tissue which reference gene should be selected for normalization J Mol Med 83 1014 1024 Pfaffl M W Horgan G W Dempfle L 2002 Relative expression software tool REST for group wise comparison and statistical analysis of relative expression results in real time PCR NAR 30 36 Pfaffl M W Tichopad A Prgomet C and Neuvians T P 2004 Determination of stable housekeeping genes differentially regulated target genes and sample integrity BestKeeper Excel based tool using pair wise correlations Biotechnology Letters 26 509 515 Picandet V L guillette R and Lavoie J P Comparison of efficacy and tolerability of isoflupredone and dexamethadone in the treatment of horses affected with recurrent airway obstruction heaves 2003 Equine Vet J 35 419 424 Ramakers C Ruijter J M Lekanne Deprez R H Moorman A F M 2003 Assumption free analysis of quantitative real time PCR data Neurosci Letters 339 62 66 Robinson N E Jackson C Jefcoat A Berney C Peroni D and Derksen F J 2002 Efficacy of three corticosteroids for the treatment of heaves Equine Vet J 34 17 22 Robinson N E Berney C Behan A and Derksen F J 2009 Fluticasone propionate aerosol is more effective for prevention than treatment of recurrent airway obstruction J Vet Intern Med 23 1247 1253 Ruijter J M Ramakers C Hoogaars W Bakker O van den Hoff M J B
4. 17 Eotaxin 2 IL 2 IL 5 Eotaxin 3 IL 3 IL 6 IL 8 IL 8 IL 9 IL 12 IL 10 IL 16 IL 13 IL 18 IL 18 TNF a TNF B TNF B GATA 3 IFN y 26 Evaluation of suitable reference genes for gene expression studies in bronchoalveolar lavage 2 Samples As described in the introduction used BAL cells taken from horses with IAD before and after treatment with DEX and FLUC Fifty milliliter of the BAL fluid for each horse was centrifuged 10 minutes at 1750 RPM to obtain a cell pellet The cell pellet was stored in 0 5 milliliter RNAlater at 20 C for later use Some of the horses had a lot of mucus in their BAL fluid This can affect the RNA extraction Therefore it is probably better to pass the BAL fluid through a filter a double layer of sterile cotton gauze or nylon mess is used in a lot of studies to remove debris and mucus from the fluid An advantage of this method is the preferential loss of bronchial epithelial cells but a disadvantage of this method is that you also lose some inflammatory cells because they stick to the mucus The company Sigma Aldrich recommends in their product description of RNAlater 1 to resuspend the cell pellet in a small volume of PBS to loosen up the cell pellet before adding the RNAlater so that the RNAlater can enter the cells more easily If you don t filter the sample before centrifuging it the cell pellet can be very big because of all the mucus 0 5 milliliter of RNAlater is then maybe not sufficie
5. and its volume was recorded Two 50 ml tubes for each horse were filled with the BAL fluid and spinned down during 10 minutes at 1750 RPM in a centrifuge GP Centrifuge Beckman USA The supernatant was carefully removed and the cell pellet was transferred to a 1 5 ml RNase free eppendorf tube after which 1 ml of RNAlater was added The samples were immediately stored for later use at 20 C 2 4 RNA extraction and cDNA synthesis Total RNA was extracted using the RNeasy mini kit Qiagen according to the manufacturer s instructions The cells were homogenized using the needle and syringe method RNA concentration and quality was measured with the Nanodrop 1000 by optical density 260 280 nm with expected values around 2 0 An average of 435 ng SD 109 6 total RNA was retro transcribed using the Omniscript RT Kit Qiagen combined with Oligo dT 1 3 Primers Invitrogen and RNaseOUT Recombinant Ribonuclease Inhibitor Invitrogen according to the manufacturer s specifications immediately after the RNA extraction cDNA was stored at 80 C until use 2 5 Reference gene selection and primer design Eight widely used reference genes were evaluated B actin ACTB glyceraldehyde 3P dehydrogenase GAPDH hypoxanthine ribosyltransferase HPRT B 2 microglobin B2M succinate dehydrogenase complex subunit A SDHA ubiquitin B UBB and ribosomal protein L32 RPL32 Primers for ACTB and GAPDH were designed based on available sequences usi
6. and quality of the RNA was measured using the Nanodrop2000 by optical density of 260 280 nm The samples had an average RNA concentration of ug l SD 57 14 41 48 ug ul and the average of the 260 280 nm ratio was 260 280 ratio SD 1 95 0 11 3 2 Amplification efficiency of the qRT PCR reactions The amplification efficiency for all qRT PCR reactions was calculated using the LinRegPCR software The results are shown in table 4 The best PCR efficiency that can be expected is two or a hundred percent In that case each DNA strand is replicated in each cycle of the PCR For ACTB and GAPDH the PCR efficiency is a little bit less than a hundred percent so in each cycle only 96 15 or 96 25 respectively of the DNA strands is replicated B2M HPRT RPL32 SDHA and UBB all have an efficiency higher then two or higher than a hundred percent This is theoretically impossible because in each PCR cycle the DNA can only be replicated once and not more than that The efficiency values are calculated values and therefore can be a little bit higher than two The linear regression coefficient for all candidate reference genes ranged between 0 997 and 0 999 Table 4 PCR efficiency of the used primer sets ACTB GAPDH B2M HPRT RPL32 SDHA UBB PCR efficiency 1 923 1 925 2 069 2 021 2 025 2 010 2 013 PCR efficiency 96 15 96 25 103 45 101 05 101 25 100 5 100 65 Correlation R 0 998 0 998 0 998 0 999 0 999 0 999 0 997 3 3 Gene expression levels of
7. determine a window of linearity and then uses linear regression analysis to fit a straight line trough the PCR data set From the slope of this line the PCR efficiency of each individual sample is calculated Ramakers 2003 The efficiency corrected Ct values were converted to a linear scale using the ACt method The averages of the ACt values for each triplicate were used both in the NormFinder software and in the GeNorm software Vandesompele et al 2002 NormFinder is a freely available software which automatically calculates the stability value for all candidate reference genes tested Andersen 2004 The stability value is based on the combined estimate of intra and intergroup expression variations of the genes studied A low stability value indicating a low combined intra and intergroup variation proves high expression stability Ohl et a 2005 GeNorm is also freely available on the internet The program selects from a panel of candidate reference genes the two most stable genes or a combination of multiple stable genes for normalization Ohl et al 2005 The program generates an M value for each gene and a pair wise stability measure to determine the benefit of adding extra reference genes for the normalization Perez et al 2008 12 Evaluation of suitable reference genes for gene expression studies in bronchoalveolar lavage 3 Results 3 1 Quantity and quality of RNA isolated from BAL samples After RNA extraction the quantity
8. housekeeping gene with a simple example using the software REST 2009 Relative Expression Software Tool 2009 Pfaffle 2002 The REST 2009 software is a tool that can analyze gene expression data from qPCR experiments It uses expression of reference genes to normalize expression levels of genes of interest in different samples In figure 1a the efficiency for both GAPDH and IL 4 is set to two The cycle threshold Ct value defined as the cycle number at which the fluorescent signal of the reaction crosses the level of signal that reflects a statistically significant increase over the calculated baseline signal threshold is approximately the same before and after treatment for GAPDH The Ct values for IL 4 are a little bit higher after treatment compared to the untreated group Using these values the software tells us that the expression of IL 4 is down regulated after treatment In figure 1b only the Ct values after treatment for GAPDH are changed by one cycle for the Ct Evaluation of suitable reference genes for gene expression studies in bronchoalveolar lavage value The values for GAPDH in the before treatment group and the values for IL 4 are the same as in figure 1a The efficiency of the reaction is still two for both GAPDH and IL 4 Using the new Ct values for GAPDH the software tells us that the expression of IL 4 after treatment is not significantly different from the expression of IL 4 in the untreated samples This example shows that a d
9. minutes before centrifuging it Then added the flow through with the eluted RNA again directly to the spin column membrane and waited for another ten minutes before centrifuging it again With this method got a higher concentration of RNA then with both adding only the first amount of nuclease free water and centrifuging the column directly after adding the water To ensure that there is no genomic DNA contamination after extraction the RNA can be treated with DNase an enzyme that degrades the genomic DNA You don t really need this if you make sure that you design your primers so that you can distinguish between amplification of mRNA and amplification of genomic DNA See primer design 28 Evaluation of suitable reference genes for gene expression studies in bronchoalveolar lavage Table 2 Methods for disrupting and homogenizing different types of tissues and cells 3 Starting material Disruption method Homogenization method Cultured animal cells Addition of lysis buffer Rotor stator homogenizer Animal tissue Mortar and pestle Mixer Mill MM 300 recommended for RNAlater stabilized tissues Bacteria Enzymatic lysozyme digestion followed by addition of lysis buffer Mixer Mill MM 300 Enzymatic lyticase zymolase digestion of cell wall followed by lysis of spheroplasts by addition of lysis buffer Rotor stator homogenizer QlAshredder homogenizer Syringe and needle Rotor stator ho
10. real runs for IL 17 IL 8 and IL 10 for the study After troubleshooting already expected some problems with the samples used in the study because had already problems with the troubleshooting samples As you can see the melting curves aren t good The melting curve shows more than one product for all the cytokines and therefore cannot use these results 36 Evaluation of suitable reference genes for gene expression studies in bronchoalveolar lavage Fresen A TD z z 3 7 Figure 2 Melting curves for IL 17 IL 8 and IL 10 On the left site the troubleshooting runs on the right site the runs for the study Fig 2a IL 17 Fig 2b IL 8 Fig 2c IL 10 37 s Evaluation of suitable reference genes for gene expression studies in bronchoalveolar lavage 8 Conclusion This gene expression study is not finished yet One reason is a lack of time Ten weeks was a too short period of time to completely set up a gene expression study Another reason is maybe a not optimal experimental set up but that is only guessing For example the size of my products All my products had a size smaller than 250 bp what in theory should be a good length for qRT PCR However in almost all gene expression study papers they used primer sets that gave products with a product size between 80 and 120 bp Designing primers that give a smaller product size is something to try Another thing to try is a different troubleshooting pr
11. tissues BMC Vet Res 3 Bedenice D Mazan M R and Hoffman A M 2008 Association between cough and cytology of bronchoalveolar lavage fluid and pulmonary function in horses diagnosed with inflammatory airway disease J Vet Intern Med 22 1022 1028 Cappelli K Felicitti M Capomaccio S Spinsanti G Silvestrelli M and Verini Supplizi A 2008 Exercise induced stress in horses Selection of the most stable reference genes for quantitative RT PCR normalization BMC Mol Bio 9 49 Cou til L L Rosenthal F S DeNicola D B and Chilcoat C D 2001 Clinical signs evaluation of bronchoalveolar lavage fluid and assessment of pulmonary function in horses with inflammatory respiratory disease Am J Vet Res 62 538 546 Cou til L L Hoffman A M Hodgson J Buechner Maxwell V Viel L Wood J L N Lavoie JP 2007 Inflammatory Airway disease of horses J Vet Intern Med 21 356 361 Courouc Malblanc A Fortier G Pronost S Siliart B and Brachet G 2008 Comparison of prednisolone and dexamethasone effects in the presence of environmental control in heaves affected horses The Vet J 175 227 233 Fogarty U and Buckley T 1991 Bronchoalveolar lavage findings in horses with exercise intolerance Equine Vet J 23 434 437 Gigu re S Viel L Lee E MacKay R J Hernandez J and Franchini M Cytokine induction in pulmonary airways of horses with heaves and effect of therapy with inhaled fluticasone propionate 2002 Vet Im and
12. 0 685 0 000 DOWN Figure 1a Result of the REST software with a stable expressed housekeeping gene GAPDH The expression of IL 4 is down regulated after treatment Evaluation of suitable reference genes for gene expression studies in bronchoalveolar lavage WA Untitled Document REST 2009 2 0 13 WA Untitled Document REST 2009 2 0 13 File Mode Help File Mode Help Gene Setup Gene Data Results Graph Notes Gene Setup Gene Data Results Graph Notes Values Controls Untreated Relative Expression Results Parameter Value Iterations 2000 15 6 15 9 Gene Type Reaction Efficiency M Std Error 95 C I P H1 Result 15 GAPDH REF 10 1 000 157 149 IL 4 TRG 1 0 1 094 0 648 1 901 0 420 3 031 0 650 15 1 15 9 16 1 16 14 1 Interpretation IL 4 sample group is not different to control group P H1 0 650 Non Normalised Results Gene Type Reaction Efficiency Expression Std Error 95 C l P H1 Result GAPDH REF 1 0 0 316 0 218 0 467 0 159 0 616 0 000 DOWN IL 4 TRG 1 0 0 346 0 233 0 536 0 159 0 685 0 000 DOWN Figure 1b Result of the REST software with an unstable expressed housekeeping gene GAPDH The expression of IL 4 before treatment is not different from the expression of IL 4 after treatment Evaluation of suitable reference genes for gene expression studies in bronchoalveolar lavage 2 Materials and methods The BA
13. ATG IL 17 Set 1 TATCGTGAAGGCGGGAATAG TCCCAGATCACAGAGGGGTA Set 2 ATTCCAGAAGGGCCTCAGAT GGACGGAGTTCATGTGGAAG IL 18 Set1 TGGCAGGCTTGAACCTAAAC TGGCAGGCTTGAACCTAAAC 199 Set 2 GCACCCCAGACCGTATTTAT TCATCATGTCCTGGAACACTTC 209 Set 2 TACGTCCCCGAATACAGCTC GTCGGTTCTGTCCGTTCATT 226 157 Eotaxin 2 Set 1 GGCCCTGCGACTGTCATA CGTTGGACAGCTGGTAGCTT Set 2 CCTGAGAGCCGAGTGGTAAG TTCTTGGCAGCCAGATTCTT 152 1 1 1 1 23 L 6 73 82 L 8 65 59 L 9 58 173 197 174 179 185 168 177 90 51 162 178 210 165 Set 3 CCCTGCGACTGTCATAGCTG CGTTGGACAGCTGGTAGCTT 1 55 Eotaxin 3 Set 1 CAAGGTCCTTCCCTGGAAAT CAAGGTCCTTCCCTGGAAAT 183 Set 2 GTGGCTAAGCTCTGCTGCTT TCTTTGCACCCATTTTTCCT 165 IFN y AGGCCTAACTCTCTCCGAAAC CCCACCATCCCCTACATCT 170 GTGTGCGATTTTGGGTTCTT CAGGTCCTCCTTGATGGTGT 197 ACCCAGATGTAGGGGATGGT AACGAACAGGTCCTCCTTGA 182 ACCCAGATGTAGGGGATGGT TGGTGTCCATGCTCTTTTGA 1 62 TNF a Set 1 TGAAAGCATGATCCGAGATG CCAGAGGGTTGATTGACTGG 216 Set 2 TGGAAAGGACATCATGAGCA CCAGAGGGTTGATTGACTGG 233 TNF B TCTACCTCCTGAGGGTGTGC ACAAGGTGAGCAGCAGGTTT 181 TCTACCTCCTGAGGGTGTGC AGGTGAGCAGCAGGTTTGAG 178 AAACCTGCTGCTCACCTTGT GACCACCTGGGAGTAGACGA 159 AAACCTGCTGCTCACCTTGT GAGAAGAGCTGGACCTCGTG 233 34 Evaluation of suitable reference genes for gene expression studies in bronchoalveolar lavage After finding the sequence of interest with the Ensembl Genome Browser checked for splice variants and then decided where wanted to have my primers All my primer sets span an intron
14. CTCCTGCTCCTGTTCA GGGGGTAGGCAGGTATGACT 152 TGAATCCAAATGAGATACAGATCC TCCCAATTTGTACTCTATCCTTGA 108 GACCCTTCTGAGGCCAAAC GGGGGTAGGCAGGTATGACT 112 TCCCAACTGATTCCAGCTCT AAGGCATCCGCTACAGTCAG 165 ATTCGTGCATGGAGCTGACT TTGAGGTTCCTGTCCAGTCC 160 GGAGCTGACTGTAGCGGATG TTGAGGTTCCTGTCCAGTCC 150 GGGTCTCATCTCCCAACTGA CTGTTGAAGCACCTTTGCAG 181 TGGCAGAGACCTTGACACTG ATAGTTTGGCCACAGCATCC 175 CCACTCATCGAACTCTGCTG ATAGTTTGGCCACAGCATCC 151 AAACTGTCCAAGGGGATGCT TCCGTTGTCCACTCAGTGTT 169 CCTGATGATTCCTACTCCTGAA TCCGTTGTCCACTCAGTGTT 1 Set1 AGCAAGGAGGTACTGGCAGA CCTTTTCACCCTTGAACTCG Set 2 ATGGCAGAAAAAGACGGATG TCAGGATCTGGACCAGGACT Set1 CGCACTCCAAACCTTTCAAT TCAAAAACGCCTGCACAATA Set 2 CCAAACCTTTCAATCCCAAA TCAAAAACGCCTGCACAATA CTTCCAGGAGGGTCTGTCA GTTGCCTCTTGTGGTTTGGT 1 GAAAACAAGATTCGCCCTGA TCTGGGTCTCTGCATCTCTG 189 CTTCTGCCCTCCTCCTCTG GTTGCCTCTTGTGGTTITGGT 159 GGTCGTGGTCCTTGCTTCT GTTGCCTCTTGTGGTTTGGT IL 10 Set1 CAAGCCTTGTCGGAGATGAT AAGGCACTCTTCACCTGCTC Set 2 ATCGATTTCTGCCCTGTGAA CGTTCCCTAGGATGCTTCAG IL 12a Set1 GCTGTGCCTTAGCAGCATCT GCTTTTGTGGCACAGTCTCA Set 2 CATGAATGCCAAGCTGTTGA AGGCATGAAGAAGGATGCAG IL 12B Set1 ATCAGCAGTGGTTGGTCCTC TGCCTTCTTCTTCAGGGGTA Set 2 ATCAGCAGTGGTTGGTCCTC TCCAGGTGATGCCTTCTTCT IL 13 GTGTTGGCTCTGAGCTCCAT TCAGGTTGACGCTCCACAC 1 GTGTTGGCTCTGAGCTCCAT CTGTCAGGTTGACGCTCCA 193 GTGTGGAGCGTCAACCTGA GCTGGTGAGGGCAGAGTTTA 124 CAATGGCAGCATGGTGTG TACCCCGGCTGAGAGCTG 1 IL 16 Set 1 AGCCTGTCACCAGAGGACAC AGCCTGTCACCAGAGGACAC Set 2 ATTTTCGTGCACACCCTCTC GATGTCGGCTGACAATG
15. Evaluation of suitable reference genes for gene expression studies in bronchoalveolar lavage cells from horses with Inflammatory Airway Disease Drs L Beekman Student number 3050181 Sept Dec 2009 Supervisors Dr C M Westermann Department of equine medicine Faculty of veterinary medicine University of Utrecht Dr R L guillette Faculty of veterinary medicine University of Calgary Evaluation of suitable reference genes for gene expression studies in bronchoalveolar lavage Contents Abstract 4 1 Introduction 5 2 Materials and methods 9 2 1 Horses 9 2 2 Study Design 9 2 3 Sample collection and preparation 10 2 4 RNA extraction and cDNA synthesis 10 2 5 Reference gene selection and primer design 10 2 6 Quantitative Real Time PCR 12 2 7 Data analysis 12 3 Results 13 3 1 Quantity and quality of RNA isolated from BAL samples 13 3 2 Amplification efficiency of the qRT PCR reactions 13 3 3 Gene expression levels of candidate reference genes 13 3 4 Expression stability of the seven candidate reference genes 14 4 Discussion 18 5 Conclusion 19 References 20 Evaluation of suitable reference genes for gene expression studies in bronchoalveolar lavage Attachments 22 Melting curve data candidate reference genes 22 Doing a good gene expression study Considerations and recommendations 26 1 Introduction 26 2 Samples 27 3 RNA extraction 27 4 RNA quantity and quality measurements 30 5 cDNA synthesis 31 6 Primer desi
16. If using Oligo dT primers it is therefore good to design your real time PCR primers as close to the 3 end of the sequence of interest as possible so that premature termination downstream of this location is less of a issue 5 31 Evaluation of suitable reference genes for gene expression studies in bronchoalveolar lavage If you want to use 18S ribosomal RNA R18S as a candidate reference gene and possible housekeeping gene you can t use Oligo dT primers because R18S mRNA doesn t have a poly A tail for the Oligo dT primers to bind That is the reason why had to exclude R18S as a candidate reference gene from my study 10 In that case you can use random primers They generate large pools of cDNA and therefore can offer the highest sensitivity in real time PCR They anneal throughout the target molecule so degraded transcripts and secondary structure do not pose as much of a problem as they do with gene specific primers and Oligo dT primers A third category of primers that can be used for reverse transcription are the gene specific primers They offer the greatest specificity but a new cDNA synthesis reaction must be performed for each gene to be studied 5 Random primer 5 _ _ _ BAA MANA N N N N Na a first strand cDNA _ Oligo dT primer Cs AAA AA AAAS ANA T _ _ Pil S first sirand COMA Seaquence specific primer AA mRNA X first stran
17. Immunopath 85 147 158 Hare J E and Viel L 1998 Pulmonary eosinophilia associated with increased airway responsiveness in young racing horses J Vet Intern Med 12 163 170 Hoffman A Robinson N E Wade J F Proceedings on a workshop on inflammatory airway disease defining the syndrome 30 September 3 October 2002 Boston USA Hoffman A M 1999 Bronchoalveolar lavage technique and cytological diagnosis of small airway inflammatory disease Equine Vet Educ 11 330 336 20 Evaluation of suitable reference genes for gene expression studies in bronchoalveolar lavage Kriegova E Arakelyan A Fillerova R Zatloukal J Mrazek F Navratilova Z Kolek V Du Bois R M and Petrek M 2008 PSMB2 and RPL32 are suitable denominators to normalize gene expression profiles in bronchoalveolar cells BWC Mol Bio 9 69 Lavoie J P L guillette R Pasloske K Charette L Sawyer N Guay D Murphy T and Hickey G J 2002 Comparison of effects of dexamethasone and the leukotriene D4 receptor antagonist L 708 738 on lung function and airway cytologic findings in horses with recurrent airway obstruction Am J Vet Res 63 579 585 Moore B R Krakowka S Robertson J T and Cummins J M 1995 Cytologic evaluation of bronchoalveolar lavage fluid obtained from standardbred racehorses with inflammatory airway disease Am J Vet Res 56 562 567 Ohl F Jung M Xu C Stephan C Rabien A Burkhardt M Nitsche A Kristiansen G Loening
18. L samples were collected in a previous study by Tohver et al in press 2 1 Horses Eight adult horses from mixed breeds with IAD from our research herd were studied The horses consisted of five mares and three geldings of various ages Criteria for inclusion were 1 the presence of respiratory clinical signs during exercise but not at rest 2 the absence of increased lung resistance at rest after a challenge with moldy hay 3 the presence of airway hyper reactivity measured by an increase in lung resistance R by 75 at lower doses of nebulized histamine and 4 a BAL with increased percentage of mast cells and or eosinophils and or neutrophils The animals were kept in the same outside paddocks for at least three weeks before the experiment and the management remained the same throughout the period of the study The horses were kept on straw and were fed round bale hay None of the horses had received treatments for respiratory disease during the 3 months preceding the study 2 2 Study design The study used a controlled randomized cross over design Two groups of four horses each were subjected to two treatment protocols On day O of the study a bronchoalveolar lavage was performed on all the horses as described below The treatments with DEX and FLUC were started on day 2 of the study DEX was administered intramuscularly once a day in the morning between seven and eight o clock and FLUC was nebulized using the Aerohippus twice dail
19. T The protocol says 350 ul buffer RLT if there are less then 5x10 cells and 600 ul of buffer RLT if the amount of cells is between 5x10 and 1x10 cells used 400 ul of buffer RLT for all the samples knew that there were less then 5x10 cells in all the samples because the cells were counted in a previous study Because of the amount of mucus in some of the samples and because left some RNAlater in the tubes when extracted the first samples 400 ul was maybe not enough left the samples for ten minutes before homogenizing the cells For homogenizing used the needle and syringe method Recommended in the manufacturer s protocol is a blunt 20 gauge needle used a sharp 21 gauge needle It is not a problem to use a sharp needle instead of a blunt one only make sure that you don t damage the inside of the eppendorf tube you are using think that this method was pretty successful got good quantities of RNA for most of the samples There are a lot of techniques available for disrupting and homogenizing different types of tissues and cells Table 2 gives an overview of these methods The method you have to use depends on the material you use and of course what is available in the laboratory The next steps except for the last part were all performed following the manufacturer s instructions For the last step the elution of the RNA added 35 ul of nuclease free water directly to the spin column membrane waited ten
20. candidate reference genes To evaluate the gene expression levels of all studied housekeeping genes we took the average of the expression measured in all the samples we used n 20 Out of the seven studied genes B2M mean Ct 17 081 and UBB mean Ct 17 562 were expressed at the highest levels followed by ACTB mean Ct 17 563 RPL32 mean Ct 19 361 GAPDH mean Ct 20 724 and SDHA mean Ct 21 737 HPRT mean Ct 22 953 was expressed at the lowest level in BAL cells 13 Evaluation of suitable reference genes for gene expression studies in bronchoalveolar lavage 30 25 20 15 Ct values 10 B2M HPRT RPL32 SDHA UBB GAPDH ACTB Figure 2 Average Ct of candidate reference genes Shows the expression levels of the candidate reference genes The values are given as qRT PCR cycle threshold numbers Ct values The circles show the average ct value the bars indicate the standard deviation 3 4 Expression stability of the seven candidate reference genes The data were first analyzed with the NormFinder software The software calculates the stability value for each candidate reference gene and also takes in account variation across subgroups and avoids artificial selection of co regulated genes The program starts with calculating the inter and intragroup variation between the untreated and treated samples as shown in Figure 3 The blue and the red bars indicate the intergroup variation of the expression of the candidate referenc
21. d SDHA are the most stable housekeeping genes 1 2 0 8 ha _ 0 6 ara 0 4 0 2 Average expression stability M B2M ACTB UBB RPL32 HPRT GAPDH SDHA lt Least stable genes Most stable genes gt Figure 5 Average expression stability M calculated by the GeNorm software Stepwise exclusion of the least stable genes by calculating the average expression stability measure M The value of M was calculated for each gene and the least stable gene with the highest M value was automatically excluded for the next calculation round The x axis from left to right indicates the ranking of the genes according to their expression stability The GeNorm software calculates also a normalization factor assessing the optimal number of reference genes for generating that factor The results are shown in figure 6 The normalization factor is calculated from at least two genes taking into account the variable V as the pair wise variation between two sequential normalization factors A pair wise variation value of 0 15 is taken by Vandesompele et al 2002 as a cut off value below which the inclusion of an additional control gene is not required Figure 6 tells us that only a combination of the four best genes GAPDH SDHA HPRT and RPL32 have a pair wise variation value between 0 15 Out of these results it can be concluded that normalization using four housekeeping genes GAPDH SDHA HPRT and RPL32 is an adequate normalization approach for this kind
22. d cDNA Figure 1 Different types of primers for reverse transcription 5 32 Evaluation of suitable reference genes for gene expression studies in bronchoalveolar lavage 6 Primer design There are a lot of general rules for real time PCR primer design 5 e The amplicon length should be approximately 80 250 bp since longer products do not amplify as efficiently Shorter amplicons act as a buffer against variations in template integrity Primers designed to amplify larger regions are less likely to anneal with the same fragment in a slightly degraded nucleic acid sample e Starting with reverse transcription it is best to locate the amplicon near the 3 end the transcript If RNA secondary structure prohibits full length cDNA synthesis in a percentage of the transcripts these amplicons are less likely to be impacted e The primers should be 18 24 nucleotides in length This provides for practical annealing temperatures e The primers should be specific for the target sequence You can confirm this by performing a BLAST search against public databases to be sure that your primers only recognise the target of interest e The primers should be free of internal secondary structures e They should avoid stretches of polybase sequences or repeating motifs as they can hybridize inappropriately to the template e Primer pairs should have compatible melting temperatures within 5 C e They should contain approximately 50 GC content i
23. e genes in BAL cells before treatment and after treatment of the horses respectively The green bars indicate the average of the intragroup variation The housekeeping gene with the lowest intergroup variation combined with the lowest average intragroup variation is the most stable housekeeping gene Then the program calculates a stability value for each candidate reference gene The gene with the lowest stability value is the most stable housekeeping gene As a result the gene with the highest stability value is the least stable Figure 4 shows the stability values for the seven candidate reference genes GAPDH is the most stable expressed gene stability value 0 013 followed by RPL32 stability value 0 025 HPRT stability value 0 027 B2M stability value 0 028 SDHA stability value 0 033 and ACTB stability value 0 034 UBB has the highest stability factor 0 04 and is therefore the least stable expressed 14 Evaluation of suitable reference genes for gene expression studies in bronchoalveolar lavage The program also gives the best combination of two genes The best combination of two genes is GAPDH and RPL32 stability factor 0 014 0 040 E Intergroup variation untreated samples E Intergroup variation treated 0 000 samples Variation E Average intragroup variation of untreated and treated samples 0 010 0 020 0 030 0 040 Figure 3 Inter and intragroup variation of the candidate reference g
24. ene expression study Considerations and recommendations 1 Introduction This report gives an overview of the gene expression study did at the University of Calgary will describe how did my study and will give some considerations and recommendations about things you have to think about by setting up a gene expression study A part of this report is based on scientific evidence a part is based on my own experience Hopefully this helps other students to set up a good gene expression study The aim of my study was to determine if the cytokine expression the activation status of the inflammatory cells in broncho alveolar lavage BAL fluid in horses with Inflammatory Airway Disease IAD is affected by treatment with intramuscular dexamethasone DEX and inhaled fluticasone propionate FLUC To answer this question used samples taken from eight horses with IAD before and after treatment with DEX and FLUC as described in my research report Evaluation of suitable reference genes for gene expression studies in bronchoalveolar lavage cells from horses with Inflammatory Airway Disease We were interested in the influence of DEX and FLUC on the expression of 22 different cytokines and chemokynes Because there is no scientific evidence about the immune response that is involved in IAD we choose some TH1 TH2 and TH17 cytokines and some chemo attractants to investigate table 1 Table 1 Cytokines and chemokynes of interest IL 1B IL 4 IL
25. enes The blue bars show the intergroup variation of the BAL samples taken before treatment of the horses The red bars show the intergroup variation of the BAL samples taken after treatment of the horses The green bars show the average of the intragroup variation 0 045 0 04 0 035 0 03 0 025 0 02 Stability value 0 015 0 01 0 005 UBB ACTB SDHA B2M HPRT RPL32 GAPDH lt Least stable genes Most stable genes gt Figure 4 Stability value of the candidate reference genes calculated by the NormFinder software 15 Evaluation of suitable reference genes for gene expression studies in bronchoalveolar lavage Then the same data were analyzed with the GeNorm software This program calculates the gene expression stability measure M for a reference gene as the average pair wise variation V for that gene with all other tested reference genes Stepwise exclusion of the gene with the highest M value allows ranking of the tested genes according to their expression stability This is shown in figure 5 All the candidate reference genes started with an M value below 1 5 default limit below which candidate reference genes can be classified as stably expressed with a lower value indicating a greater stability of the gene expression Ohl 2005 The candidate reference genes are ranked based on the average of their M value B2M is the least stable gene and was excluded first B2M was followed by ACTB UBB RPL32 and HPRT GAPDH an
26. etermine an effective treatment for IAD It is thought that environmental management changes to minimize exposure to irritants helps reducing the presence of clinical signs Based on research done in horses with Recurrent Airway Obstruction Courouc Malblanc et al 2008 Lavoie et al 2002 Robinson et al 2002 Robinson et al 2009 Giqu re et al 2002 Picandet et al 2003 glucocorticosteroids mainly dexamethasone and Evaluation of suitable reference genes for gene expression studies in bronchoalveolar lavage mast cells stabilizers are used in practice to control the airway inflammation in horses with IAD but there is no scientific evidence that they really work Tohver et al summer 2009 in press did a research project to determine the effect of the glucocorticosteroids dexamethasone DEX and fluticasone propionate FLUC in horses with IAD They found that both treatments significantly decreased airway hyper sensitivity and airway hyper reactivity and they also found a significant decrease in the amount of lymphocytes in the bronchoalveolar lavage fluid of horses with IAD There was no effect on the counts of inflammatory cells content neutrophils mast cells and eosinophils in the bronchoalveolar lavage fluid The corticosteroids that were used worked by decreasing the airway hyper sensitivity and airway hyper reactivity but they had no effect on the inflammatory cells content The main question that came out of this project was how do
27. f 0 013 GAPDH was followed by RPL32 stability factor 0 025 HPRT stability factor 0 027 and B2M stability factor 0 028 in this order SDHA stability factor 0 033 ACTB stability factor 0 034 and UBB stability factor 0 040 completed the list with the highest stability factor The best combination of two genes is GAPDH and RPL32 stability factor 0 014 The GeNorm software ranks GAPDH and SDHA as the most stable housekeeping genes followed by HPRT RPL32 UBB and ACTB The least stable expressed gene was B2M Based on the pair wise variation cut off value 0 15 a combination of the four most stable housekeeping genes GAPDH SDHA HPRT and RPL32 is accurate for normalization in this kind of studies We thus recommend using GAPDH alone or in combination with either RPL32 or SDHA as housekeeping genes for gene expression studies in the BAL fluid of horses with IAD treated with steroids Evaluation of suitable reference genes for gene expression studies in bronchoalveolar lavage 1 Introduction Inflammatory Airway Disease IAD in horses is an inflammatory respiratory disorder that can affect horses of any age The definition of IAD was established at a conference in Boston in 2002 The members of the conference determined inclusion and exclusion criteria to stipulate if a horse with a respiratory history has IAD or not Cou til et al 2007 Hoffman 2002 Table 1 Inclusion and exclusion criteria for determining IAD in horses Cou ti
28. gn 33 7 Quantitative real time PCR 35 8 Conclusion 38 References 39 Evaluation of suitable reference genes for gene expression studies in bronchoalveolar lavage Abstract The best way to normalize quantitative real time polymerase chain reaction qRT PCR results is by using an internal control or housekeeping gene To date no reference genes have been validated for expression studies of bronchoalveolar lavage cells of horses The aim of this study was to determine a gene with a stable mRNA expression in bronchoalveolar lavage cells of horses with inflammatory Airway Disease IAD irrespective of treatment with intramuscular dexamethasone DEX or inhaled fluticasone propionate FLUC The mRNA expression of seven housekeeping genes B2M HPRT1 GAPDH ACTB UBB RPL32 and SDHA was investigated in bronchoalveolar lavage cells of seven horses with IAD The horses were treated in a controlled randomized cross over design study with DEX seven horses and FLUC three horses The seven housekeeping genes were tested with qRT PCR to analyze the stability of the genes under the described circumstances The results were analyzed with both the NormFinder software and the GeNorm software These software s rank the genes according to the stability of their expression Glyceraldehyde 3 phosphate dehydrogenase GAPDH came out as the most stable housekeeping gene in the NormFinder software under the described circumstances with a stability factor o
29. hibitor Invitrogen according to the manufacturer s specifications 9 The plan was to use 500 ng RNA in each reverse transcription reaction After analyzing the protocol for cDNA synthesis we decided to use not more than 13 ul of RNA in each reaction As a result for samples with a low RNA concentration the amount of RNA in the reverse transcription reaction was less than 500 ng The final cDNA concentration that got after reverse transcription therefore differed between the samples Table 4 Reverse transcription reaction mixture Components Amount ut dNTP mix Oligo dT 2 15 Primers For samples with a high RNA concentration did two to four reverse transcription reactions to get as much cDNA as possible The different tubes with cDNA for each sample were mixed in one tube to start each PCR reaction for an individual sample with exactly the same cDNA quantity and quality There are different types of primers you can use for the reverse transcription used Oligo dT 12 13 primers Oligo dT primers are poly T primers with in my case a length of 12 to 18 nucleotides These primers bind the poly A tail at the 3 end of the mRNA The advantages of these primers are their specificity for mRNA and they allow many different targets to be studied from the same cDNA pool However because they always initiate reverse transcription at the 3 end of the transcript difficult secondary structure may lead to incomplete cDNA generation
30. ifference of only one Ct value in the expression of the housekeeping gene gives a totally different outcome in the results leading to completely opposite conclusions for the study Using a stable expressed housekeeping gene for normalization is therefore very important The aim of this study was therefore to determine a stable housekeeping gene for use in a gene expression study in BAL fluid of horses with IAD treated with DEX and FLUC WA Untitled Document REST 2009 V2 0 13 EPA Untitled Document REST 2009 V2 0 13 File Mode Help File Mode Help Gene Setup Gene Data Results Graph Notes Gene Setup Gene Data Results Graph Notes Values Relative Expression Results Controls Untreated GAPDH F Parameter Value 1 Iterations 2000 2 15 6 3 _ 159 Gene Type Reaction Efficiency Expression Std Error 95 C I P H1 Result 1 GAPDH REF 1 0 1 000 6 149 IL 4 TRG 1 0 0 354 0 165 0 707 0 101 1 238 0 001 DOWN ra 154 8 15 9 g 161 Interpretation 10 16 141 IL 4 is DOWN tegulated in sample group in comparison to control group by a mean factor of 0 354 S E range is 0 165 0 707 12 13 IL 4 sample group is different to control group P H1 0 001 Samples Treated Non Normalised Results Gene Type Reaction Efficiency Expression Std Error 95 C I P H1 Result GAPDH REF 1 0 0 979 0 648 1 414 0 482 2 075 0 828 IL 4 TRG 1 0 0 346 0 233 0 536 0 159
31. ion data figure 6 ACTB was ranked on the sixth place by both the programs This means that this gene is not stable expressed and as a result not useful for validation in gene expression studies Considerable is that ACTB is a frequently used housekeeping gene in a lot of gene expression studies This is also the case in a gene expression study done in horses with Recurrent Airway Expression treated with corticosteroids Giqu re et a 2002 ACTB was used in this study without validation of the expression stability under the used experimental circumstances Our project shows that the use of ACTB in this study is probably not right and the results should be taken with a large reservation 5 Conclusion We thus recommend using GAPDH alone or in combination with either RPL32 or SDHA as housekeeping genes for studies on the gene expression in bronchoalveolar lavage cells from horses with IAD after treatment with DEX and FLUC 19 Evaluation of suitable reference genes for gene expression studies in bronchoalveolar lavage References Andersen C L Jensen J L and rntoft T F 2004 Normalization of real time quantitative reverse transcription PCR data a model based variance estimation approach to identify gene suited for normalization applied to bladder and colon cancer data sets Cancer Res 64 5245 5250 Ayers D Clements D Salway F Day P 2007 Expression stability of commonly used reference genes in canine articular connective
32. ixture Components Amount ul PerfeCta SYBR Green Super Mix Low ROX 13 ul Nuclease free H20 To optimize my PCR reactions ran all the primer sets for the different cytokines following the protocol shown in table 7 ran them all twice with different annealing temperatures 62 C and 64 C respectively and for different samples The samples used were extracted for troubleshooting only used the primer sets with the lowest Ct value combined with the highest efficiency and the best melting curve for my study 35 Evaluation of suitable reference genes for gene expression studies in bronchoalveolar lavage Table 7 qRT PCR cyclus qRT PCR Cycle Segment 2 45 cycles 15 seconds at 95 C 30 seconds at 62 or 64 C Ooo pod seconds at 70 C Pp df 8 seconds at 60 C po BO seconds at 95 C e After troubleshooting my primers started my experiment ran for IL 17 primer set 2 with an annealing temperature of 62 C for IL 8 primer set 1 with an annealing temperature of 62 C and for IL 10 primer set 2 with an annealing temperature of 62 C The choice for these protocols was based on the melting curves got from the troubleshooting runs as shown in the left part of figure 2 The melting curves aren t perfected There were two troubleshooting samples that gave problems for almost all the primer sets tested Therefore we decided to ignore those samples Also shown in figure 2 are the melting curves for the
33. l et al 2007 Inclusion criteria Exclusion criteria 1 Respiratory clinical signs during exercise 1 Evidence of infection but not at rest 2 Increased respiratory effort at rest after 2 Absence of increased lung resistance at challenge with moldy hay rest after challenge with moldy hay 3 The presence of airway hyper reactivity measured by an increase in lung resistance R by 75 at lower doses of nebulized histamine 4 a BAL with increased percentage of mast cells or and eosinophils or and neutrophils The disorder can develop in horses which are stabled inside or after exposure to dusty hay or straw The immunological basis of IAD is still not well documented and more research needs to be done to determine if there is a TH1 a TH2 or a TH17 inflammation reaction involved The most important test to confirm a diagnosis of IAD is a bronchoalveolar lavage BAL Horses with no clinical signs have on average 60 macrophages 35 lymphocytes lt 5 neutrophils lt 2 mast cells lt 0 1 eosinophils and occasional or no epithelial cells in BAL fluid Hoffman 2002 The BAL fluid of horses with IAD is characterized by increased total nucleated cell counts with lymphocytosis and monocytosis The count of neutrophils and or mast cells and or eosinophils can be increased Cou til et al 2007 Bedenice et al 2008 Cou til et al 2001 Fogarty et al 1991 Hare et al 1998 Hoffman et al 1999 Moore et al 1995 There is no research done yet to d
34. mogenizer QlAshredder homogenizer Syringe and needle Mixer Mill MM 300 Vortex Mixer Mill MM 300 Vortex Mixer Mill MM 300 Mixer Mill MM 300 Plants and filamentous fungi Mortar and pestle QlAshredder homogenizer If lt 1 x 10 cells are processed lysate can be homogenized by vortexing Simultaneously disrupts and homogenizes Rotor stator homogenizer usually gives higher yields than mortar and pestle The Mixer Mill MM 300 gives results comparable to using a rotor stator homogenizer If more than 5 x 108 cells are being processed further homognization using QlAshredder homogenizer or a syringe and needle may increase yield Bead milling simultaneously disrupts and homogenizes bead milling cannot be replaced by vortexing Bead milling simultaneously disrupts and homogenizes bead milling cannot be replaced by vortexing Mortar and pestle cannot be replaced by rotor stator homogenizer This table was made based on information from Qiagen Of course there are other companies that offer machines for disruption and homogenization as well 29 Evaluation of suitable reference genes for gene expression studies in bronchoalveolar lavage 4 RNA quantity and quality measurement measured the quantity and the quality of the RNA directly after extraction using the Nanodrop 1000 spectrophotometer The first time used the Nanodrop 1000 repeated the measurement three times for each sa
35. mple to determine the accuracy of the machine The measurements are shown in table 3 The values were pretty close for three of the five samples We decided based on these results that one measurement for each sample was enough to get a good impression of the RNA quantity Table 3 Accuracy Nanodrop 1000 ng ul ng ul ng ul SD 116 3 132 3 126 2 8 6 a og eeas orsa 3492 680 The Nanodrop 1000 has a couple of advantages in comparison with the standard cuvette spectrophotometer The Nanodrop needs only 1 ul of the sample to measure the RNA concentration The machine is also capable to measure highly concentrated samples samples with a RNA concentration that is fifty times higher than the samples that can be measured by the cuvette spectrophotometer As a result in most cases it is not necessary to dilute the samples before measurement Cleaning of the Nanodrop between measurements is also very easy Wiping the sample from both the upper and lower pedestals upon completion of each sample measurement is usually sufficient to prevent sample carryover and avoid residue buildup 8 30 Evaluation of suitable reference genes for gene expression studies in bronchoalveolar lavage 5 CDNA synthesis cDNA synthesis was performed directly following RNA extraction and RNA quantity and quality measurement used the Omniscript RT Kit Qiagen combined with Oligo dT 12 18 primers Invitrogen and RNaseOUT Recombinant Ribonuclease In
36. n their sequence High GC content results in the formation of stable imperfect hybrids while high AT content depresses the Tm of perfectly matched hybrids e The 3 end of the primer should be rich in GC bases to enhance annealing of the end that will be extended e The sequences should be analyzed to avoid complementarity and prevent hybridization between primers primer dimers e Design primers that anneal to exons on both sides of an intron or span an exon exon boundary of the mRNA to allow differentiation between amplifi cation of cDNA and potential contaminating genomic DNA by melting curve analysis All primers where based on horse specific sequences from the Ensembl Genome Browser 7 designed my primers table 5 using the free available software Primer3 6 This program is very easy to use You can enter a complete sequence or only the specific exons where you want to have your primers The program than gives you five different primer sets to choose from 33 Evaluation of suitable reference genes for gene expression studies in bronchoalveolar lavage Table 5 Primer sets Cytokine Set__ Sense primer Antisense primer Product size bp IL 16 Set 1 ACCATAAATCCCTGGTGCTG CGTCCCACAAGACAGGTACA 179 Set 2 TGTGACAACTGGGATGAAGG TTCTCCTTGCACAAAGCTCA 183 IL 2 Set 1 TCCCAAACTCTCCAAGATGC TCCCAGAACTGTTACATTGATATTG 175 Set 2 TCCCAAACTCTCCAAGATGC TTGATATTGCTCATTAATTCCTTGA 159 IL 3 CTGCTCCTGTTCACACTCCA CTGCAGAATGCATCCAGGT 159 CCTT
37. ng the Primer3 software Primers for HPRT1 B2M SDHA TFRC UBB RPL32 and R18S were earlier described Cappelli 2008 10 Evaluation of suitable reference genes for gene expression studies in bronchoalveolar lavage Table 2 Details of the eight genes evaluated Gene Symbol Gene Name Function Accession number ACTB B actin Cytoskeletal structural protein AF035774 GAPDH Glyceraldehyde 3P dehydrogenase Glycolytic enzyme AF083897 B2M B 2 microglobin Cytoskeletal protein involved X69083 in cell locomotion HPRT Hypoxanthine ribosyltransferase Metabolic salvage of purines AY372182 in mammals RPL32 Ribosomal protein L32 Member of ribosomal CX594263 proteins SDHA Succinate dehydrogenase complex Electron transporter in the DQ402987 subunit A TCA cycle and respiratory chain UBB Ubiquitin B Protein degradation AF506969 Table 3 Characteristics of used primers Gene Symbol Sense antisense primers 5 gt 3 Amplicon length bp ACTB CTGGCACCACACCTTCTACA 249 CCCTCATAGATGGGCACAGT GAPDH GGTGAAGGTCGGAGTAAACG 106 AATGAAGGGGTCATTGATGG B2M CCTGCTCGGGCTACTCTC 89 CATTCTCTGCTGGGTGACG HPRT AATTATGGACAGGACTGAACGG 121 ATAATCCAGCAGGTCAGCAAAG RPL32 GGGAGCAATAAGAAAACGAAGC 138 CTTGGAGGAGACATTGTGAGC SDHA GAGGAATGGTCTGGAATACTG 91 GCCTCTGCTCCATAAATCG UBB TTCGTGAAGACCCTGACC 91 CCTTATCCTGGATCTTGGC 11 Evaluation of suitable reference genes for gene expression studies in bronchoalveolar lavage 2 6 Quantitative Real Time PCR
38. nt to obtain a good stabilization of the RNA Sigma Aldrich recommends adding 5 10 equivalent volumes of RNAlater to the cell suspension 3 RNA extraction The samples were thawed on ice After thawing they were centrifuged to separate the cell pellet from the RNAlater had a lot of problems with separating the cell pellet from the RNAlater centrifuged the samples for different periods of time range 5 10 minutes at different speeds range 5 000 14 500 RPM 14 500 RPM was the maximum speed of the centrifuge used Because RNAlater has a high density this speed is probably not high enough to form a cell pellet What you can do to obtain a cell pellet at lower speeds is using small volumes of cells in the reagent since smaller volumes of cells pellet efficiently with lower centrifugal force 2 By extracting the last samples for the study removed all the RNAlater with some small particles that were floating around without centrifuging the samples first left the big cell pellet in the tube By doing this lost some cells but got a higher quantity of RNA by doing it this way than by leaving some or a lot RNAlater in the tube 27 Evaluation of suitable reference genes for gene expression studies in bronchoalveolar lavage For RNA extraction used the RNeasy Mini Kit Qiagen following the manufacturer s instructions 4 will briefly describe the procedure The first step is disrupting the cells by adding buffer RL
39. o be used in bronchoalveolar lavage samples from horses with IAD treated with DEX and FLUC The samples were all collected and processed following a standard protocol to reduce the risk of variation between samples To make cDNA we used different amounts of mRNA in the reaction We used standard one microliter of cDNA in each qRT PCR reaction As a result the cDNA concentration differed in almost each reaction It is better to use the same concentration of cDNA in each reaction because then there is a third software BestKeeper Pfaffl et al 2004 that we could use beside NormFinder and GeNorm This program uses the standard deviation of the difference in expression in all the samples used for the different candidate reference genes Pfaffl et al 2004 Because we used different concentrations of cDNA the standard deviation is big That is the reason why we cannot use this program in this study Table 5 Ranking of the candidate reference genes based on their stability calculated by the NormFinder and GeNorm software Ranking NormFinder GeNorm 1 GAPDH GAPDH SDHA 2 RPL32 3 HPRT HRPT 4 B2M RPL32 5 SDHA UBB 6 ACTB ACTB 7 UBB B2M 18 Evaluation of suitable reference genes for gene expression studies in bronchoalveolar lavage There are some major differences in the results that we got from the two programs as shown in table 5 Both programs ranked GAPDH as the most stable housekeeping gene SDHA in the other hand shares a first place
40. of gene expression studies 16 Evaluation of suitable reference genes for gene expression studies in bronchoalveolar lavage 0 3 0 25 0 2 0 15 Pairwise variation V 0 1 0 05 V2 3 V3 4 v4 5 v5 6 V6 7 Figure 6 Determination of the optimal number of reference genes for normalization The software calculates the normalization factor from at least two genes at which the variable V defines the pair wise variation between two sequential normalization factors V4 5 for example shows the variation of the normalization factor of three genes in relation to four genes 17 Evaluation of suitable reference genes for gene expression studies in bronchoalveolar lavage 4 Discussion This is the first study done in horses with IAD to determine a stable housekeeping gene for gene expression studies There are several methods available for accurate normalization of gene expression using qRT PCR Andersen et al 2004 Vandesompele et al 2002 but there is nothing known about which algorithm should be used For that reason it is better to use a comparison of different methods of reference gene selection That allows for a better identification of the most reliable controls and reduces the risk of artificial selection of co regulated transcripts Ayers et al 2007 In this study we compared two different software s NormFinder GeNorm to evaluate seven candidate reference genes in order to select the best reference gene t
41. otocol Recommended is to run each primer set on three different annealing temperatures 58 C 60 C and 62 C and for different primer concentrations as shown in table 8 for a fixed cDNA concentration Optimal performance is achieved by selecting the primer concentrations that provide the lowest Ct values and the highest efficiency 10 Table 8 Troubleshooting primer concentrations omm 00 50 00 300 200 300 soon s00 50 300 300 soya 38 Evaluation of suitable reference genes for gene expression studies in bronchoalveolar lavage References Articles Vallone P M and Butler J M 2004 AutoDimer a screening tool for primer dimer and hairpin structures Bio techniques 37 226 231 Protocols and websites Oo Oy 10 http www sigmaaldrich com etc medialib docs Sigma Bulletin 1 r0901bul Par 0 001 File tmp r0901bul pdf http johnhiscottlab ca Microarray 20Services Protocols Microarray 20Protoco I 20edited htm RNAstabilizationincellculturecells Protocol RNA Stabilization disruption and homogenization of starting materials for isolation of RNA http www1 giagen com literature handbooks literature aspx id 1000632 RNeasy Mini Handbook http www1 giagen com Products RnaStabilizationPurification RNeasySystem R NeasyMini aspx Tabs t2 qPCR handbook Real Time PCR from theory to practice www invitrogen com http frodo wi mit edu primer3 input htm http www ensembl org index html Nanodrop 1000 Spec
42. these corticosteroids work in horses with IAD We think that the corticosteroids maybe have an inhibitory effect on the expression of the cytokines and chemokines produced by these inflammatory cells To reach valid conclusions in any gene expression study it is very important to have a stable housekeeping gene or internal control to normalize the effect of the amount of starting material enzymatic efficiencies and differences between tissues or cells in overall transcriptional activity on the measurement of the expression levels Cappelli et a 2008 Vandesompele 2002 A good housekeeping gene should ideally be constitutively expressed by all cell types and should not be affected by disease and experimental procedure Housekeeping genes are expressed by any cell type but their expression varies between tissues and organs Kriegova et al 2008 Also experimental procedures can have influence on the expression of housekeeping genes It is therefore necessary to evaluate multiple housekeeping genes before their use in the tissue or organ of interest but also under the relevant experimental conditions Cappelli et al 2008 However a lot of studies make use of earlier described common used housekeeping genes without validation of their presumed stability of expression Vandesompele 2002 This might result in unreliable conclusions As an example to illustrate the importance of a good housekeeping gene we can show the effect of an unstable expressed
43. to allow differentiation between amplification of cDNA and potential contaminating genomic DNA The difference is that by amplifying cDNA the intron will be spliced out of the sequence this is not the case in the amplification of genomic DNA As a result the product made out of genomic DNA is a lot bigger in most cases then the product made out of cDNA The different products can be visualized by melting curve analysis or agarose gel electrophoresis see Quantitative Real Time PCR screened all my primers for primer dimer and hairpin structures with the AutoDimer program Vallone and Butler 2004 According to the software it s not likely that my primers will form primer dimer or hairpin structures 7 Quantitative real time PCR ran my polymerase chain reactions on a MX3005P machine Stratagene The reactions had a total volume of 25 ul table 6 used the complete Perfecta SYBR Green Super Mix Low ROX Quanta Biosciences This is a ready to use reaction cocktail that contains all components except primers and template for quantitative real time PCR The advantage of using a complete mastermix instead of preparing the mastermix yourself is that the mastermix is exactly the same for all your reactions When you prepare the mastermix yourself there is a bigger chance of making mistakes because you have to do a lot of pipetting The more pipetting steps you have to do the bigger the risk of contamination Table 6 qRT PCR reaction m
44. trophotometer V3 7 User s Manual http www nanodrop com Library nd 1000 v3 7 users manual 8 5x11 pdf Omniscript Reverse Transcription Handbook http www1 giagen com products pcr giagenreversetranscriptases omniscriptrt aspx Tabs t2 http www dorak info genetics realtime html 39
45. with GAPDH following the GeNorm software while NormFinder ranks SDHA on a fifth place The rest of the ranking also shows a lot of variability between the two programs This is not what we expected We expected a similar ranking of the candidate reference genes We can say that GAPDH is the most stable expressed gene in this panel of genes but we cannot be sure that GAPDH alone is enough to give a proper validation because the GeNorm software tells us that we need the four most stable housekeeping genes while NormFinder gives us that a combination of GAPDH and RPL32 has a higher stability factor stability factor 0 014 then GAPDH alone stability factor 0 013 NormFinder tells us that we have to use only GAPDH while GeNorm tells us to use a combination of GAPDH SDHA HPRT and RPL32 for validation of the expression stability The reason for these differences in ranking is probably our study design The fact that we used different concentrations of cDNA for different samples results in wrong proportions in expression of the genes between the samples This results in incorrect results if the program uses this proportion in expression between the samples for the calculation of the stability of the genes GeNorm calculated normalization factors for all the samples and then compares them with each other to calculate the pair wise variation V Because of the difference in the amount of cDNA that we used for different samples we cannot use the pair wise variat
46. y between seven and eight o clock in the morning and in the afternoon On day 16 the last day of treatment a second BAL was carried out The first treatment phase was followed by a 3 week washout period In the second part of the study the treatments were switched between groups The bronchoalveolar lavages were performed following the same protocol as in the first half of the study Evaluation of suitable reference genes for gene expression studies in bronchoalveolar lavage 2 3 Sample collection and preparation BALs were performed in the morning following a standardized procedure as described previously Lavoie 2002 Briefly horses were sedated with xylazine 0 4 to 0 6 mg kg of body weight IV and butorphanol 10 to 20 ug kg of body weight IV A fiber optic flexible endoscope 3 m in length 12 9 mm in diameter was inserted through the nostrils and directed down into the lung until its tip was wedged in one of the distal bronchus During the passage of the endoscope through the airway several small boluses of a 0 5 solution of lidocaine solution were administered up to a maximal volume of 120ml to desensitize the airway mucosa Two 250 ml boluses of sterile 0 9 sodium chloride were alternatively instilled under pressure into the bronchus and aspirated via the endoscope biopsy channel by use of a suction pump Vacuum pressure of the pump was maintained at 15 kPa The BAL fluid was collected in a 500 ml plastic Nalgene jar kept on ice
Download Pdf Manuals
Related Search