Home

ABI 3900 High Throughput DNA Synthesizer

Contents

1. m d n E n n n n n n n n Columns EyEgESESESEUES EG ETEUES Bases This window has tabs for four panes Each tab provides the capability to set up sequences for a single bank of a Synthesizer file for use in the instrument Except for Disable and Column ID the individual table columns listed below are mapped to individual text file input as described under File Formats on page D 36 Trityl Off checked position Oligo ID Bases Sequence Note The Disable column check box provides the capability of disabling a particular sequence after entry into the Import Utility window so that it won t be synthesized The table column labeled Column ID provides the user with the capability of naming the column to be used for synthesis Besides the File Edit and View windows which work like those in the Synthesis window the Import Utility has a new menu Database Import which is used to import the six file types listed under Introduction on page D 25 The next section provides an example of using the Import Utility to import the contents of one of these file types Basically the Database Import menu is used to select the type of text file to be imported Each selection on this menu corresponds to one of the file types discussed under File Formats on page D 36 Note Four different views are presented for Banks 1 through 4 allowing discrete input for each bank D 26 Synthesizer Window Database
2. Topic See Page About the 3900 DNA Synthesizer 2 2 Overview 2 2 Types of DNA Chemistry Supported 2 2 DNA Synthesis Cycles 2 2 How the 3900 System Works 2 2 About Cartridge Banks 2 2 About Processing Cartridge Banks 2 2 3900 DNA Synthesizer System Hardware 2 3 3900 System 2 3 Front and Left Side View 2 4 Front Details 2 5 Top View 2 6 Beneath the Valve Rack Cover 2 6 Synthesis Chamber 2 7 Beneath the Cartridge 2 8 Back View 2 9 3900 Instrument Columns 2 10 About Columns 2 10 Color Coding of Columns 2 10 About the Software 2 11 Overview 2 11 Passwords and Levels of Access 2 11 Types of Files Used 2 11 Conventions Used for Software Procedures 2 12 Main Menu and Toolbar 2 12 Tour of the Instrument 2 1 About the 3900 DNA Synthesizer Overview Types of DNA Chemistry Supported DNA Synthesis Cycles How the 3900 System Works About Cartridge Banks About Processing Cartridge Banks 2 2 Tour of the Instrument The 3900 instrument couples single nucleotides bases together in a step wise fashion to form customized oligonucleotides linked to polystyrene solid support at the 40 nmol 0 2 umol and 1 umol scales The 3900 instrument can synthesize 48 primer length sequences at the 40 nmol and 0 2 umol scales in less than 1 5 hours The pressure of inert argon gas delivers reagents to the columns and purges the columns between deliveries The 3900 system supports Standard and FastPhoramidit
3. Waste vent to lab ventilation system Waste bottle cap assembly Bulk reagent bottles in ACN TCA secondary containers Waste bottle in secondary container Tour of the Instrument 2 9 3900 Instrument Columns About Columns Color Coding of Columns 2 10 Tour of the Instrument The 3900 instrument uses specifically designed open ended columns for DNA synthesis Columns contain the first base of an oligo sequence linked to a solid polystyrene support Top and bottom frits or plugs of porous material hold the powdery support within the column Columns are available in 40 nmol 0 2 umol and 1 umol scales Lip Seating recess Top frit Solid support Tip Bottom frit The 3900 instrument columns are color coded depending on the base linked to the solid support within the column Column P N Color Phosphoramidite Scale tubs of 200 Green dAbz 40 nmol 4316671 0 2 umol 4316675 1 umol 4316679 Yellow dGdnt 40 nmol 4316673 0 2 umol 4316677 1 umol 4316681 Red dCbz 40 nmol 4316672 0 2 umol 4316676 1 umol 4316680 Blue T 40 nmol 4316674 0 2 umol 4316678 1 umol 4316682 About the Software Overview The ABI 3900 High Throughput DNA Synthesizer software graphical user interface GUI allows you to enter information about the sequences you are synthesizing
4. 0 00 0 0 0 0 0 0 00 n 2 qoqqa aaa aas Amts E CN t i amp te 7 Columns 2 2 Bases 20 12 14 32 Looking at Imported The file imported into the Import Utility provides information for the four columns of the File Contents main table and the two rows in the lower table with the following headings Trityl Off checked position 9 9 9 9 Oligo ID Bases Sequence Columns it Bases Trityl Off when the box in this column is checked it indicates that the trityl is to be removed In the text file this is specified by default no entry in the Trityl field When the trityl is to be left on ON must be entered in the Trityl field in the text file Oligo ID the name of the sequence from the Name field of the text file Bases the number of bases for the sequence Sequence the listings for the sequences entered from the text file Columns the number of columns of each type needed for synthesis Bases the numbers of each type of base in the sequences listed under Sequence Synthesizer Window Database Import Utility D 35 File Formats Introduction This section describes the formats required for the text and Excel files to be used for inputting sequence information into the Import Utility Tab Delimited The format of the tab delimited text file imported into the Import Utility window on Text File page D 34 is shown below Bj Tabdelimited txt Notepad of x Fie Edit Search
5. D 28 Synthesizer Window Database Import Utility Project Window File Menu Commands continued Item Description Enabling Save As Displays the Save dialog box saves as syn extension files Always enabled Import Column Ctrl I Opens the Import sequence dialog box Box will be labeled with column selected in document seq extension files Enabled when a column is selected in the Synthesis document Import Bank Ctrl M Opens the Import Bank dialog box uses bnk extension files Always enabled Export Column Ctrl X Opens the Export sequence dialog box uses seq extension files Enabled when a column is selected in the Synthesis document Export Bank Opens the Export Bank dialog box uses bnk extension files Always enabled Print Displays the Print dialog box Always enabled oM The standard Print Setup dialog is opened from the Print dialog Exit Exits the Database Import Always enabled application Displays Save alert message if Project has pending changes Edit Menu The commands in the Edit menu are used to manage the contents of the Project window by performing standard actions like undo delete select etc and by enabling access to settings for Preferences Cut Ctrl Copy Ee Underscored single letters in commands Paste Ctrl V are keyboard shortcuts for executing Delete Del commands Select All Ctrl 4 F
6. r Calibration Verification Test Verify cartridge homes properly Place containers into positions 1 to 30 Close and lock lid Enter volume into text box Click Run Test Run Test Verify that volume dispensed meets lab specifications See your ABI 3900 DNA Synthesizer User s Manual for container and volume options Done You will be using the Calibration Verification Test a Prepare for the test as described in the window Verify cartridge homes properly Place MicroAmp reaction tubes or other suitable containers into positions 1 to 30 Close and lock lid b In the text field enter 288 when using MicroAmp reaction tubes or other appropriate number for other container types This is the volume in microliters c Click Run Test The quantity of reagent that you entered or accepted into the text box will be dispensed to the containers in columns 1 to 30 Note If you remove the containers from the cartridge it is important to either label them or preserve their orientation in a tube rack so that you know which tube corresponds to which valve Remove the PCR reaction tubes from positions 1 30 placing them into a tube rack or remove the cartridge from the instrument Evaluate the level of reagent in each container comparing their volumes Using microfuge tubes a meniscus at the lip of the tube or at the ridge below the lip indicates an acceptable dispense volume approximat
7. Front Details The components on the front of the 3900 instrument are shown here On Of Pressure gauge Chamber Pressure Amidite ressure ACN A G c i 5 6 7 Bottle release r r buttons Reagent banks for e i E H phosphoramidites E and dye amidites GR1921 Component Function Buttons On Off Powers the instrument on and off Release buttons Releases the seal on the bottle neck to allow removal and reinsertion Pressure Gauges Chamber pressure Indicates the actual pressure within the synthesis chamber Purge pressure Manufacturer sets pressure of purge cycle to 5 psi bottles or ACN must occupy any unused positions Amidite ACN Indicates the delivery pressure for the amidites and ACN set to 6 psi Cap Activator Indicates the delivery pressure for Cap and Activator set to 6 psi Deblock Oxidizer Indicates the delivery pressure for Deblock and Oxidizer set to 6 psi Bottle Positions A G C T These are the recommended positions for phosphoramidites Position Phosphoramidite Bottle Label Color P N A dAbz Green 401159 G dGdmf Yellow 401165 C dC5z Red 401160 T T Blue 401162 5 6 7 8 9 0 Positions available for reagents used in customized production Empty Tour of the Instrument 2 5 Top View The view through the
8. Step Action 1 Set up a vial and use with a single column as follows a Label 2 mL Nalgene plastic vials 1 per sample and place them into a tube rack b Remove one column from the 3900 synthesizer cartridge c Using PVC cutters or similar sturdy tool cut the column below the lip but above the top frit Do not allow the powdery solid support to fall out of the column Lip Out in this area Cut column as little as possible to fit inside of a Nalgene vial E Top frit Solid support Note Use a lab tissue to wipe off moisture from the lip of the column if necessary d Insert the column into its labelled plastic vial Repeat steps 1a through 1d for all of the columns in the cartridge that contain oligonucleotide CHEMICAL HAZARD Ammonium hydroxide solution aqueous ammonia causes burns to the eyes skin and digestive and respiratory tracts Please read the MSDS and follow the handling instructions Wear appropriate protective eyewear clothing and gloves Follow these steps to begin cleavage Add 1 2 mL of fresh 3096 ammonium hydroxide to each vial and agitate gently Cap all of the vials and tighten the caps firmly Place the capped vials into the rotary evaporator a b a b Spin for 2 hr at 65 C with vacuum OFF Remove the vials from the rotary evaporator observing the listed precaution a Remove the vials from the rotary evaporator and a
9. yx eh There may be some residual chemicals in the tubing Dispense line to dispense tips Unscrew 5 8 Unscrew the two screws holding the valve onto the valve rack and the valve will release 4 18 Instrument Maintenance Installing New Use the following procedure to install new valves into place Valves f To install new valves Step Action 1 On the new valve connect the electrical connections 3 2 Connect the delivery line Screw these Jj 9 SA E lines on N di I E f I 3 7 Delivery line Dispense line X N Se 8 GR1973 3 Align the valve under the valve rack and fasten the valve to the rack with two screws 4 Connect the dispense line referring to the graphic in step 2 Place the valve rack cover back on Turn the 3900 instrument on Perform a valve calibration and dispense check on the valve just replaced For details see a Calibrating Valves on page 4 7 b Verifying Valve Calibration on page 4 10 8 Check valve as follows a Check for drips b Perform Chamber Leak Test Instrument Maintenance 4 19 Changing the Dispense Lines Dispense Lines Part The Part number for the dispense lines is P N P440042 Number Procedure lf the dispense line leading from the valve to the dispense tip gets clogged use t
10. 14 55 37 5 Preprocess 250ul 397ms of ACN Valve 05 in Col 04 zl el XX AEN MT Ae AOR A fale MEV S Fol OEM D 10 Synthesizer Window Database Import Utility The Archived Log Viewer window is used to access archived instrument logs Each instrument log provides a list of the system events that occurred during a synthesis run The events displayed in the log are set in the Options dialog box see page D 12 Each time a run is started a new Synthesis Log file is created Each Log file contains only the events associated with the run This report is read only but the contents of the window may be copied for pasting into another document Other actions available from this window include Open Last Log accessed by clicking this button This opens the Instrument Log referenced in the Instrument Log window after a run Open clicking this button presents an Open File dialog box enabling any archived log file to be accessed Print clicking this button prints out the current log file Tools The View menu is used to display the Amidite Summary and to set various instrument options Amidite Summary Ctrl F8 Options Amidite Summary Command The Amidite Summary command presents the Amidite Summary window as shown below to display the required amidites and reagents for all banks ABI3900 OLIGONUCLEOTIDE SYNTHESIZER AMIDITE SUMMARY Instrument Name MAGNET TripleDRI Current Date and Time 2 20 01 11 5
11. Cascading Menus Directions for navigating through cascading menus will appear as a single line of options you are to select each option separated by an arrow gt For example the directions Select File gt Import Column indicate that from the File menu you click on Import Column IE Edit View Tools Instru New CtrleN Open Ctl O Save Ctrl S Save As Import Column Import Bank Export Column Ctrl E Export Bank Print Ctrl P Exit Alt F4 Main Menu and The elements that are unique to the 3900 software main menu and toolbar are shown Toolbar and explained in the graphic and table that follow For information on menu and toolbar items that are common to most word processing programs consult a word processing user s guide File Edit View Tools Instrument Help Dill alias zele s A M pma Main Menu and Toolbar Toolbar Icon Menu Alternative Function ow File gt Import Bank Allows you to enter an entire bank of sequences and cycles from a bnk file created in 3900 software ne File gt Export Bank Allows you to save an entire bank of sequences and cycles from the 3900 software as a bnk file Instrument gt Status Lists the steps performed by the instrument l updated in real time Instrument gt Instrument Log Saved files of steps performed by the IE instrument for previous runs Instrument gt Waste Report Summarizes the a
12. and cycle file s into the software Verify reagent supply and bottle positions load columns and start run Y Perform Setup Tasks for the next run or shutdown procedure All sequences must be in all caps 3 2 Performing DNA Synthesis Setup Task Lists Which Task List to Perform Setup Tasks First Run of the Day The task list or procedure you use to begin instrument setup depends upon the status of the instrument Use the chart below to determine which procedure to use in preparing the instrument for a run The tasks listed under the Before Each Run procedure on page 3 5 always need to be performed Refer to the pages listed in the table below for the contents of the other procedures If the instrument will If the instrument has Then start with On be been Setup Task List page idle for less than 12 hours Before each run 3 5 idle for 12 hours to 5 days First run of the day 3 3 idle for more than 5 days After long term 3 7 shutdown before running the instrument again If the instrument is scheduled for shutdown for a several day period it is recommended that the Long Term Shutdown procedure be performed IMPORTANT As indicated in the 3rd row of the table above it is necessary to prepare for scheduled shutdowns longer than 5 days by performing the Long Term Shutdown procedure Then to restore the instrument to running condition perform the After
13. 10 00 Benk2 Benk3 Benki aes Sequence fields Cycle field Amidite and base summary Status bar Performing DNA Synthesis 3 9 About Entering Use the procedure below to enter sequence and cycle information into the software Sequence and Cycle Information TO enter sequence and cycle information Step Action 1 Launch the 3900 program from the desktop icon or Start menu The Synthesis window will be displayed Click the appropriate Bank tab starting with Bank 1 When entering sequences into the software keep in mind the following Each bank is processed with a single cycle program which must match the scale of the columns Each bank can process only one scale Do not mix scales within a bank Banks 1 and 2 are processed in parallel To minimize synthesis time on runs requiring only 2 banks load Banks 1 and 2 If you are using 1umol columns tandem banks either 1 and 2 or 3 and 4 must be dedicated to 1umol 3 10 Performing DNA Synthesis To enter sequence and cycle information continued Step Action 4 To enter sequences by Follow these steps Typing each sequence a In the Synthesis window click on a sequence field row to highlight it b Begin typing the sequence using all caps from 5 to 3 It will display from the right side of the screen scrolling le
14. B 4 Diluting Reconstituted Oligonucleotides for Quantitation page B 4 Cleavage Deprotect Materials Required OptionI 4 2 mL Cryogenic polypropylene screw top vials 1 vial per oligonucleotide Fresh concentrated 3096 ammonium hydroxide Tweezers Rotary evaporator 65 C oven or heat block Deionized water To perform cleavage deprotection by Option Step Action 1 Set up vials and use with columns as follows a Label 2 mL vials 1 per sample and place them into a tube rack b Remove each column from the 3900 synthesizer cartridge and place into its labeled vial Note Use a lab tissue to wipe off moisture from the tip of each column if necessary before placing into a labeled vial c Add 1 2 mL of ammonium hydroxide to each column at all scales 40 nmole 0 2 umole and 1 umole CHEMICAL HAZARD Ammonium hydroxide solution aqueous ammonia causes burns to the eyes skin and digestive and respiratory tracts Please read the MSDS and follow the handling instructions Wear appropriate protective eyewear clothing and gloves d Cap all of the vials and let them sit at room temperature for 1 hr 2 Place the capped vials into the rotary evaporator at room temperature and spin for 1 min 3 Remove the vials from the rotary evaporator remove the caps and add 250 uL of ammonium hydroxide to each column 4 Place the uncapped vials into the rotary evaporator at room temperature and spin
15. Bank 3 or Bank 4 only one of these may be selected at a time Determines which bank is affected by a purge Default field allows selection of the type of purge DEFAULT REACT LONG PURGE SHORT PURGE or DRY BEADS In order to see any selection besides DEFAULT a cycle file has to be loaded in selected Bank field above Purge button activates a purge 2nd Bank field ALL Bank 1 Bank 2 Bank 3 or Bank 4 only one of these may be selected at a time Determines which bank is affected by a wash Rinse Activator Tips button rinses the activator tips into the prime bucket Prime All button performs a prime for all valves Home button moves the cartridge to the Home position Valve Control button clicking this button presents the Valve Control window Valve Control O Argon Purge Argon Main O Q Waste Cyinder1 Weste Cynder 2 D O Waste Valve 1 Waste Valve 2 e The Valve Control window enables valves to be turned on and off The symbols for the valves are numbered circles Valve actuator buttons are Synthesizer Window Database Import Utility D 19 numbered squares The six labeled rectangular buttons control the valves for the labeled functions To turn a valve on click the button next to the valve The numbered valve symbol or plain circle for labeled buttons will turn red Toturn a valve off click the button next to the valve again The numbered valve symbol or plain circle for labeled bu
16. Help OLIGO1 TCTAGTTACAGATTAGGCTTA N OLIGO2 TCTTGTTTGTGTGGTGTCCAGRGATCT OLIGOS3 TCTATACTCATA OLIGOS TATATATTAATAACGCET ON When this text file is compared with the imported version shown on page D 34 it has the following characteristics Information in the text file is delimited or organized in tabbed columns Column 1 in the text file is mapped into the column labeled Oligo ID in the Import Utility Column 2 contains the sequence listings mapped into the Import Utility column labeled Sequence Column 2 contains either a blank or an ON entry with a blank indicating trityl to be removed entered as a check in the Trityl Off column in the Import Utility An ON entry in the text file leaves the Trityl Off column check box disabled for the sequence Space Delimited The format of the space delimited text file is shown below Text File B spacedelimited txt Notepad Iof x File Edit Search Help OLIGO1 TCTAGTTACAGATTAGGCTTA ON OLIGO2 TCTTGTTTGTGTGGETGTCCAGAGATCT OLIGO3 TCTATACTCATA OLIGO4S TATATATTAATAACGCET ON This type of text file is very similar to the tab delimited type except that spaces are used to organize information rather than tabbed columns The contents of each field are mapped the same as described for the tab delimited text file above D 36 Synthesizer Window Database Import Utility Comma Delimited The format of the comma delimited text file is shown below Text File B Commadelim
17. Import Utility Toolbar Icons The elements that are unique to the 3900 Import Utility toolbar are shown and explained in the graphic and table below For information on toolbar items that are common to most word processing programs New Open Save Cut Copy Paste Delete Print consult a word processing user s guide The commands available on the Database Import menu are used in conjunction with the text files described under File Formats on page D 36 Note The last term in the second column below is the Toolbar Icon label Toolbar Icon Menu Alternatives Toolbar Icon Label Function 5 File gt Import Column Allows you to enter a single sequence from a seq file created in 3900 software or the Import Utility i File gt Export Column Allows you to save a single sequence as a seq file iz File gt Import Bank Allows you to enter an entire bank of sequences and cycles from a bnk file created in 3900 software or the Import Utility i File gt Export Bank Allows you to save an entire bank of sequences and cycles from the Import Utility as a bnk file Synthesizer Window Database Import Utility D 27 Database Import Utility Main Menu Commands Introduction Command Activation and Special Terms File Menu This section describes the commands available from the Main menu except for those on the Edit menu common to word processing programs s
18. It is disabled if an instrument is not connected Selected checkbox Motion On Unselected checkbox Motion Off Instrument This selection enables the instrument to perform Dispensing dispensing operations Disabled if an instrument is Checkbox not connected Selected checkbox Dispensing On Unselected checkbox Dispensing Off Default Cycle File This editable text field is used to specify the Field pathname for the Cycle file to be automatically added to each bank when a new Sequence document is created D 12 Synthesizer Window Database Import Utility Instrument Overview of Instrument Menu The Instrument menu provides commands to control test and service the instrument and perform other functions such as status display waste reporting and logging of instrument operation Instrument Prime Ctrl G Start Ctrl R Pause Etre Y Stop Ctrl T Status Ctrl F5 Waste Report Ctrl F Instrument Log Ctrl F6 Valve Configuration Manual Control Diagnostics Service Ctrl M The windows presented by the Status Waste Report Instrument Log Valve Configuration Manual Control Diagnostics and Service commands are described in Instrument Menu Window Details on page D 15 Note No further descriptions are provided for the dialog boxes presented for the Prime Start Pause and Stop commands since these dialog boxes are either progress indictors or describe one or more conditions whic
19. Long Term Shutdown procedure These are the setup tasks that should be performed at the start of each day or when the instrument has been idle for more than 12 hours After completing these steps go to Setup Tasks Before Each Run on page 3 5 To setup for the first run of the day For details see Step Action topic page 1 Check the maintenance logs and perform maintenance as Required follows Maintenance a Check the laboratory weekly and monthly maintenance logs Items on to ensure that no maintenance procedures are overdue page 4 3 b Perform any needed maintenance procedures 2 Check the chamber O ring and clean if necessary a Inspect the chamber O ring for wear or chemical residue CHEMICAL HAZARD Acetonitrile ACN is a flammable liquid and vapor that may cause eye skin and respiratory tract irritation central nervous system depression and damage to the heart liver and kidneys Please read the MSDS and follow the handling instructions Wear appropriate protective eyewear clothing and gloves b Clean with a cotton swab or laboratory tissue moistened with acetonitrile if necessary Performing DNA Synthesis 3 3 To setup for the first run of the day continued Step Action For details see topic page 3 Verify the chemical bottle positions a Select Instrument gt Valve Configuration b Check the positions of the reagents and amidites against
20. Text File D 37 Short Format Files D 37 Long Format Files D 38 Excel Files D 39 D 2 Synthesizer Window Database Import Utility Overview of Synthesizer and Database Import Utility Windows Introduction This appendix provides information about the two software interfaces used with the ABI 3900 High Throughput DNA Synthesizer the interface for 3900 software and the interface for the 3900 Database Import Utility These applications are discussed together because the main windows of these applications are similar This similarity makes the applications easier to use The two applications are generally used in this order First the Database Import Utility is used to convert sequence information in the form of text files into the sequence seg extension files required for the 3900 software Then the 3900 software is used to import sequence files and other information required for synthesis The 3900 software is also used to start synthesis and provide control and monitoring functions for the instrument Main Application The main windows for the 3900 software first and Database Import Utility second Windows are shown below 3900 DNA Synthesizer File Edit View Tools Instrument Help olele lels sleek S al amp gt lal Trityl Off m d n d n n Aya im n d n n n n B 0 Cycle y fel eed eee SEE S e K pesar emm IEIEIEEXESEIESEEHES
21. To remove non functioning valves Step Action 1 Turn the 3900 instrument off 2 Release pressure from the bottle served by the valve to be replaced by doing one of the following For phosphoramidite and dye bottles push the bottle release button and rock the bottle gently For reagent bottles turn the bottle counterclockwise just until the seal releases You may hear a slight hiss or puff of air escaping as the pressure is released Do the following with the bottle served by the valve to be replaced a Remove the bottle b Wipe the delivery line and bottle gasket free of reagent c Put an empty bottle on the position but do not tighten it Leave it loose to equalize pressure d Place an absorbent towel underneath the bottle Remove the cover over the valve rack by grasping the inner edge and lifting up Instrument Maintenance 4 17 To remove non functioning valves continued Step Action 5 Unscrew only the delivery line from the valve This should allow any chemicals remaining in the line to flow backwards into the bottle Delivery line 8 S I E from bottle i l P n P amp A J tips Unscrew this SRM side only C9 g 5 6 Wipe the free end of the delivery line with lint free laboratory tissue and position it so that chemical residue will not escape from the end of the tubing while you work on the valve 7 Unscrew the dispense line from the valve
22. Use the index number when requesting documents following the procedures below by phone for fax a From the U S or Canada call 1 800 487 6809 or delivery from outside the U S and Canada call 1 858 712 0317 b Follow the voice instructions to order the documents you want Note There is a limit of five documents per request through the a Access the Applied Biosystems Technical Support Web site at Internet for fax or http www appliedbiosystems com techsupp e mail delivery b Under Resource Libraries click the type of document you want c Enter or select the requested information in the displayed form then click Search d In the displayed search results select a check box for the method of delivery for each document that matches your criteria then click Deliver Selected Documents Now or click the PDF icon for the document to download it immediately e Fill in the information form if you have not previously done so then click Deliver Selected Documents Now to submit your order Note There is a limit of five documents per request for fax delivery but no limit on the number of documents you can order for e mail delivery 1 12 Introduction Tour of the Instrument Overview About This Chapter This chapter provides an overview of the ABI 3900 High Throughput DNA Synthesizer hardware and the software components that you will use most often
23. and Efficient Computer Use 1 6 Technical Suppoft sis sp Sse bars wo heels Pe glee PERT wah Dede UNM E Ke ha LER 1 8 Contacting Technical Support 0 00 ee cece ene 1 8 To Contact Technical Support by E Mail 0 0 0 eee eee eee 1 8 Hours for Telephone Technical Support 0 0 02 eee eee eee eee 1 8 To Contact Technical Support by Telephone or Fax 00 00 00 0000 1 8 To Reach Technical Support Through the Internet llle esses 1 12 To Obtain Documents on Demand 0 eee eee eee ee 1 12 2 Tour of the Instrument OVEIVIEW deret ded Rss eu aee b wae IRE CEP INE E etin E RC 2 1 About This Chapter iisdem gebe b pq b OX Oe RE pale p 2 1 About the 3900 DNA Synthesizer 0 00 cece eens 2 2 OVetVIeW c oeucoEeRUSSA BRGISen CoEPGC E T E EE eu Dp KPBS Re fay 2 2 Types of DNA Chemistry Supported 0 0 00 0 eee eee 2 2 DNA Synthesis Cycles etes e te BGG VA ee Vea bea 2 2 How the 3900 System Works 2 0 0 0 2 2 About Cartridge Banks sec ce ccst ee ccc eee eee eee 2 2 About Processing Cartridge Banks 00 0 eee ee 2 2 3900 DNA Synthesizer System Hardware llle 2 3 3900 System ove ceva Sees ee e PLAS bbe eh ENS RR UR PER DR E NRE 2 3 Front and Left Side View 0 0 0 0 0 cee rn 2 4 Front Detail sin oe rea en eR M PRU ATE hates Sees E cre Soe S 2 5 Top VIeW cobre ecole bathed wis Pp ai CREE A CR ERE DN EE Se easels 2 6 Beneath the Valve Rack Cove
24. any one bank must be the same scale and the columns within any one bank are processed with the same customer defined cycle The only exception to this arrangement is for customers producing oligonucleotides at the 1 umol scale The 1 umol scale of production requires that either Banks 1 and 2 or Banks 3 and 4 must be loaded with 1 umol scale columns Only the 40 nmol and 0 2 umol scale cycles can be run on different banks of the same run The 3900 system processes cartridge banks in parallel Banks 1 and 2 first then Banks 3 and 4 Parallel processing allows for even greater efficiency and shorter production times 3900 DNA Synthesizer System Hardware 3900 System The 3900 system consists of the 3900 DNA Synthesizer and a Dell desktop computer in the configuration shown here Tour of the Instrument 2 3 Front and Left Side This three quarter view shows you the front and the left side of the 3900 instrument View 2 4 Tour of the Instrument Synthesis chamber Power on off Gas pressure gauges Reagent banks for phosphoramidites and dyes U Ld V 4 GR1923 Reagent banks see table below Bottle Position Reagent P N A Tetrazole Acetonitrile ACN 401173 B 1 Methylimidazole Tetrahydrofuran THF 401175 C Acetic anhydride pyridine THF 402220 D 0 02 M lodine water pyridine THF 401632
25. bottles contain appropriate filters and Trap Paks FWILVD CHEMICAL HAZARD Tetrazole acetonitrile is a flammable liquid and vapor that may cause eye skin and respiratory tract irritation central nervous system depression and damage to the heart blood system liver and kidneys Please read the MSDS and follow the handling instructions Wear appropriate protective eyewear clothing and gloves Reagent Size Trap Pak P N Amidites Mini GEN084034 Bulk ACN and Medium GEN084033 Tetrazole 6 Verify that the cartridge reaches the home position properly Verifying a Look directly down through the synthesis chamber window Home Position use a step stool if necessary on page 4 9 b Check to be sure that dispense tip 1 is directly over column 1 7 Prime the lines to eliminate air bubbles and crystals a Select Instrument gt Manual Control b Click Long Prime All c Watch through the synthesis chamber window to observe the instrument priming all of the lines into the prime waste position 8 Perform a 30 valve calibration verification test 4 10 IMPORTANT Ensure that appropriate containers are in column positions 1 through 30 before performing test 9 Perform Chamber Pressure Test Testing Chamber Pressure on page 4 6 10 Continue to Setup Tasks Before Each Run 3 5 Setup Tasks Before Each Run a step see the detailed instructions on the pages listed To setup before each run Perform the following setup tasks before ea
26. elements Motion and Dispensing these controls work as follows Prime Column options only one of these may be selected at a time Sets what to move either prime bucket or column 1 48 Valve Reagent field sets the destination for the prime bucket or selected column Note When using the Move Dispense or Prime buttons be aware that only one of these buttons can be active selected at any time Move button moves the item specified in the Valve Reagent field to the specified column D 18 Synthesizer Window Database Import Utility Dispense button dispenses reagent from the specified valve into the specified column or prime bucket microliters and milliseconds buttons sets the volume and duration of a dispense The fields are linked and a change to one automatically calculates the proper setting for the other Microliter range is 0 999 and Millisecond range is 100 to 10 000 These fields are linked to valve calibration and calculation for either valve is based on the other value specified and the calibration values for the specified valve Prime button activates the prime enabled by Prime option selection Not Dispensing into Cartridge checkbox this button is used during valve calibration and disables the interlock for the top of the instrument so deliveries can be made with the top of the instrument open Instrument these controls work as follows 1st Bank field Bank 1 Bank 2
27. into the cartridge as follows a Load the banks in order Banks 1 through 4 b Push each column down until the seating recess presses firmly against the cartridge c Make sure that all columns are firmly seated by making a second pass pressing each column down into the cartridge to ensure that it is firmly seated against the seating recess lips Seating Top frit recess D Solid support Cartridge retaining ring lock screw GR1925 Load columns of the same scale into the unused column positions of any bank being used for synthesis If a bank contains any columns all of the column positions must be filled Make sure that the cartridge retaining ring lock screw is firmly tightened Inspect the dispense tips for chemical residue white crystals To clean the tips use a lint free laboratory tissue moistened with acetonitrile Close the lid and tighten the lid lock screws Click the Start icon ir Performing DNA Synthesis 3 15 To load columns continued Step Action 8 A dialog box will pop up asking Do you want to Prime All lines a Click Yes b Watch each delivery into the prime waste position to be sure the lines are free of clogs and delivering properly Use a flashlight to see this clearly if necessary Watch the Chamber pressure gauge at the beginning of the run to ensure that the chamber is holding pressure properly
28. is no longer calibrated to within your laboratory s specifications The procedure below shows you how to calibrate valves by the weight of the reagent dispensed Use a Microsoft Excel spreadsheet to calculate the volume of each reagent dispensed based on the reagent s density To calibrate valves Step Action 1 Status of the system Instrument and computer on and 3900 software running Instrument lid up Reagent s on the valve position s to be tested CHEMICAL HAZARD Some of the chemicals used with Applied Biosystems instruments and protocols are potentially hazardous and can cause injury illness or death Fume hood in place to prevent any deleterious effects from exposure to chemicals see 3900Appendix E for installation instructions 2 Record the empty tube weight tare on a balance with 0 1 mg resolution Note Itis easiest to use tubes which can be capped Select Instrument gt Valve Configuration and click Calibrate On the Valve drop down list select the appropriate valve number Select the Weight option o oO wo Ensure that a check is present in the Use column check boxes for Points 1 2 and 3 On the Number of Dispenses column for rows 1 2 and 3 enter 3 With the empty tared tube positioned directly under the dispense tip for the valve selected in Step 4 click Dispense 1 and catch the reagent delivered 9 a Enter the weight of reagent delivered with Di
29. maintenance and minor calibrations of the ABI 3900 High Throughput DNA Synthesizer Topic See Page Scheduling Necessary Maintenance 4 3 Introduction 4 3 Required Maintenance Items 4 3 Instrument Maintenance Log 4 5 Pressure Tests 4 6 Introduction 4 6 Testing Chamber Pressure 4 6 Calibrating Valves 4 7 When to Calibrate Valves 4 7 Calibrating Valves By Weight of Reagent Dispensed 4 7 Verifying Home Position 4 9 Procedure 4 9 About Verifying Calibration 4 10 Schedule for Verifying Valve Calibration 4 10 30 Valve Calibration Verification 4 10 Single Valve Calibration Verification 4 12 Replacing Valves 4 13 Valve Part Number 4 13 About Valves 4 13 Valve Graphic 4 13 Valve Numbering 4 14 Valve Bottle Position Map 4 15 Removing Malfunctioning Valves 4 16 Removing Non Functional Valves 4 17 Installing New Valves 4 19 Instrument Maintenance 4 1 4 2 Topic continued See Page Changing the Dispense Lines 4 20 Dispense Lines Part Number 4 20 Procedure 4 20 Maintaining O Rings Gaskets and Bottle Seals 4 21 Checking the Synthesis Chamber O Ring 4 21 Replacing the Synthesis Chamber O Ring 4 21 Replacing Phosphoramidite Bottle O Rings 4 21 Replacing the Synthesis Chamber Gasket 4 21 4 22 Replacing EPR and Kalrez Gaskets Instrument Maintenance Scheduling Necessary Maintenance Introduction Follow
30. our Web site for answers to frequently asked Support Through questions and for more information about our products You can also order technical the Internet documents or an index of available documents and have them faxed or e mailed to you through our site The Applied Biosystems Web site address is http www appliedbiosystems com techsupp To submit technical questions from North America or Europe Step Action 1 Access the Applied Biosystems Technical Support Web site 2 Under the Troubleshooting heading click Support Request Forms then select the relevant support region for the product area of interest 3 Enter the requested information and your question in the displayed form then click Ask Us RIGHT NOW blue button with yellow text 4 Enter the required information in the next form if you have not already done so then click Ask Us RIGHT NOW You will receive an e mail reply to your question from one of our technical experts within 24 to 48 hours To Obtain Free 24 hour access to Applied Biosystems technical documents including MSDSs Documents on iS available by fax or e mail or by download from our Web site Demand To order documents Then by index number a Access the Applied Biosystems Technical Support Web site at http www appliedbiosystems com techsupp b Click the Index link for the document type you want then find the document you want and record the index number c
31. the Synthesis document Always enabled Fill Down Ctrl D Fills the entry in the first selected table cell into all lower cells in this column Limited to one column with each use Can be used in the Oligo ID Sequences and Column ID table columns Enabled when an entry is made in the selected table cell Synthesizer Window Database Import Utility D 9 View Menu General The View menu is used to switch between the four bank views in the Synthesizer window view the current synthesis cycle and view archived logs Bank 1 Ctrl F1 fank g Ctri F2 Underscored single letters in commands Bank 3 Ctrl F 3 are keyboard shortcuts for executing Bank 4 Ctrl F 4 commands Cycle Archived Logs The following table is provided as a reference for the View menu Synthesizer Window View Commands Item Description Enabling Bank 1 Shows the selected bank tab in Always enabled Bank the Synthesis document If the RE tab is visible a checkmark is Bank 3 placed next to the item Bank 4 Ctrl F1 4 Cycle Displays the View Cycle window Always enabled Archived Logs Displays the Archived Log Always enabled Viewer described below Archived Log Viewer The Archived Logs command presents the Archived Log Viewer window Archived Log Viewer Applied Biosystems 3900 48 Channel Oligonucleotide Synthesizer Software Version 1 00 Instrument Name MA
32. the file type in the Database Import menu for example Import Tab Delimited Database Import Import Prepfile into Column Import Multiple Order Short Format Import Multiple Order Long Format Import Space Delimited Import Comma Delimited Import Tab Delimited Import Excel Substitute String Editor This will present a Directory dialog box Navigate to the folder containing sequence files and choose a file created in the tab delimited format Look in EL Import Files E amp Ek Commadelimited txt IMO Long format tst a IMO_Short_format txt s prepfile t t spacedelimited t t Tabdelimited txt File name Tabdelimited tt Files of type Text Files txt bd Cancel Open as read only Note The current example uses an example from the DB Import Files provided with the Import Utility Using a file type other than that specified in step 1 creates an error D 34 Synthesizer Window Database Import Utility To import the sequence in a text file into the Import Utility continued Step Action 3 Click Open in the Directory dialog box to enter the contents of the tab delimited text file into the Import Utility window Eie Edi View Database Import oela zelek S el DLIGOT TCT AGT TAC AGA TTA GGC TTA OLIGO2 TCT TGT TTG TGT GGT GTC CAG AGA TCT OLIGO3 TCT ATA CTC ATA DLIGO4 TAT ATA TTA ATA ACG CGT
33. the instrument After installing new chemical bottles continue to Setup Tasks First Run of the Day on page 3 3 To install Phosphoramidites on the instrument see Preparing and Installing Phosphoramidites and Dye Amidites on page A 5 Reagents on the instrument see Changing Reagent Bottles on page A 7 Performing DNA Synthesis 3 7 Entering Sequence and Cycle Information into Software prepare the instrument Enter sequences and cycle You are here file s into the software Verify reagent supply and bottle positions load columns and start run Y Perform Setup Tasks for the next run or shutdown procedure Run Events Chart Step 2 Ge the Setup Tasks S All sequences must be in all caps Overview To prepare for entering sequence and cycle information you must know The sequences to be synthesized or their file locations The cycle to be used to synthesize each sequence The production scale 40 nmol 0 2 umol or 1 umol to be used for each sequence Guidelines for Using The following guidelines will help you to decide how to position columns in particular Columns and Banks banks Columns are arranged in the cartridge in 4 banks of 12 columns The banks are labelled on the cartridge and correspond to the bank tabs on the Synthesis window The columns loaded within any one bank must be of the same scale but different banks can have either 40 nmol or 0 2 umol sca
34. the possible settings but only two parameters in the Dispense view can be changed by a user without a password Service Password Some service settings require a password If you need access to those settings enter the password Otherwise click OK Password Note Besides providing information needed to make the two user entries enabled the discussion of the Service window in this manual provides only general information about the parameters in the three views Initial Service View Dispense Parameters Upon opening the Service window without a password the initial view of the Service window is the Dispense view Service Dispense Motion Servo Activator Rinsing Parameters r Timing Activator Rinsing bases 4 ACN Volume ul 75 Activator Re Prime ul 55 Chamber Dry Time sec 3 Min Valve Time msec 40 Pre Move Delay msec 20 m Miscellaneous Iterations 3 Purge Increment Vial sec 0 40 Interim sec 0 75 Purge PressurizationTime sec 1 00 Chamber Vent After Purge sec 3 00 Busen come ah Purge Prime Duration sec 200 Prime Volume ul 0 Default Purge Parameters Amidite Re Prime Every min x Reps i Amidite Re Prime Volume ful x Duration secs 2 Interim sec 95 Factory Defaults Note All parameters are greyed out except for the Chamber Dry Time and Purge Pressuriza
35. used 2 12 Start icon 2 13 Status icon 2 12 Stop icon 2 13 Synthesis chamber details of cartridge placement 2 7 Synthesis Window purposes 3 12 Synthesis Window details 3 12 Synthesis Bank and Sequence Files file contents D 34 importing text files D 33 overview of file use D 32 types of files D 32 Synthesizer and Database Import Utility windows main windows D 3 overview D 3 Synthesizer window general description D 6 T tasks performed before each run procedure 3 5 Index 3 Technical Support 1 8 to 1 12 hours 1 8 how to contact 1 8 Internet address 1 12 outside North America 1 9 technical support 1 8 to 1 12 e mail address 1 8 telephone fax North America 1 8 Tetrazole acetonitrile storage conditions A 4 Tetrazole Acetonitrile ACN bottle position 2 4 Threaded holes location 2 8 top down view beneath valve rack cover 2 6 Trichloroacetic acid DCM storage conditions A 4 U User attention words 1 3 Users background needed 1 2 Using columns and banks guidelines 3 8 V Valve locations 2 6 Valve calibration when to perform 4 3 Valves when to calibrate 4 7 Verifying reagents supply and bottle positions procedure 3 14 View menu Tools menu D 11 W waste disposal user s responsibilities 1 5 waste profile where to find for instrument 1 5 Waste Report icon 2 12 Waste trough location 2 8 WWW address Applied Biosystems 1 12 Documents on Demand 1 12 Index 4 I Applied KS Bibsystems 850 L
36. 000 3 8 Rin Events Chart Step 2 ss ssg cs24 85 4 anes Rel ew PETS RDERERIEVerUEPRUPES 3 8 OVerVIe Ws sco a ac M ee DU RN S E Ee ORA aceon IS QUAERE EE BUR c ARD 3 8 Guidelines for Using Columns and Banks 0 00 00 eee eee eee ee 3 8 About Entering Sequence and Cycle Information 0000 3 9 Synthesis WIndow 24 5 deft EDI URINE eene E 3 9 Synthesis Window Details 0 00 cee ee e 3 9 Verifying Reagent Supply and Bottle Positions and Loading Columns 3 13 Run Events Chart Step 3 cerea terebra cence eee 3 13 Verifying Reagents Supply and Bottle Positions 0 0 0 0 ce eee eee eee 3 14 Loading Columns nsee isse skal hg eds Lae PR RE hae ek EG 3 15 Perform Setup Tasks for the Next run or Shut Down Procedure 04 3 17 Run Events Chart Step 4 0 0 0 0 0 eee eee ee eee mte 3 17 High Throughput Production 0 0 00 eee ee eee 3 17 To Leave Instrument Idle eee ee Rer ra hA RU UR 3 17 Short Term Shutdown 00 0 cee ee Ie 3 18 Long Term Shutdown eeeeeeeeeeeeee eee eens 3 18 4 Instrument Maintenance OVERVIEW ed sea EL RUE EC e cc ba RU dase Ade ERO Bree RR CAR 4 1 About This h pter sob EEE EUER ESPERA NUEVE Vb 4 1 Scheduling Necessary Maintenance 0 0 eee ee 4 3 Introduction rap eR big ERE GMOHIQE VES gS DR RU ER NR RS et as 4 3 Required Maintenance Items 0 0 00 ccc eee e 4 3 Instrument Ma
37. 09 in Col 04 Base 04 115ul 309ms of ACTIVATOR Valve 08 in Col 05 Base 04 075ul 313ms of T Valve 10 in Col 05 Base 04 115ul 308ms of ACTIVATOR Valve 08 in Col 06 Base 04 075ul 268ms of A Valve 06 in Col 06 Base 04 115ul 308ms of ACTIVATOR Valve 08 in Col 07 Base 04 075ul 268ms of A Valve 06 in Cok 07 Base 04 115ul 309msjof ACTIVATOR Waves m in Col 08 Base 04 075ul 313ms of T Valve 10 in Col Purge Bank 1 Settings Reps 1 Secs 7 5 Interim 0 0 Rep 1of 1 Waiting 40 0 seconds for Coupling Reaction on Banks 1 and 2 Base 04 08Dul 312ms of CAPB Valve 04 in Col 01 Base 04 O80ul 318msjof CAPA Valve 03 in Col 01 080ul 312ms of CAPB Valve 04 in Cok 02 Base 04 D8Dul 318ms of CAPA Valve 03 in Col 02 080ul 312ms of CAPB Valve 04 in Col 03 Base 04 080ul 318ms of CAPA Valve 03 in Cok 03 Q80ul 312ms of CAPB Valve 04 in Cok 04 Base 04 D8Dul 318ms of CAPA Valve 03 in Col 04 Q80ul 312ms of CAPB Valve 04 in Col 05 Base 04 D8Dul 318ms of CAPA Valve 03 in Col 05 080ul 312ms of CAPB Valve 04 in Col 06 Base 04 D8Dul 318ms of CAPA Valve 03 in Col 06 080ul 312ms of CAPB Valve 04 in Col 07 Base 04 O80ul 318msjof CAPA Valve 03 in Cok 07 080ul 312ms of CAPB Valve 04 in Cok 08 Base 04 D8Dul 318ms of CAPA Valve 03 in Col 08 Purge Bank 1 Settings Reps 1 Secs
38. 1 270 8288 Italy Milano 39 0 39 83891 39 0 39 838 9492 Norway Oslo 47 23 12 06 05 47 23 12 05 75 Poland Lithuania Latvia and Estonia 48 22 866 40 10 48 22 866 40 20 Warszawa Portugal Lisboa 351 0 22 605 33 14 351 0 22 605 33 15 Russia Moskva 7 095 935 8888 7 095 564 8787 South East Europe Zagreb Croatia 385 1 34 91 927 838 385 1 34 91 840 Spain Tres Cantos 34 0 91 806 1210 34 0 91 806 1206 Sweden Stockholm 46 0 8 619 4400 46 0 8 619 4401 Switzerland Rotkreuz 41 0 41 799 7777 41 0 41 790 0676 The Netherlands Nieuwerkerk a d IJssel 31 0 180 331400 31 0 180 331409 or 31 0 180 392499 United Kingdom Warrington Cheshire 44 0 1925 825650 44 0 1925 282502 All other countries not listed 44 0 1925 282481 44 0 1925 282509 Warrington UK Japan Japan Hacchobori Chuo Ku Tokyo 81 20 477392 Toll free or 81 3 5566 6230 81 20 477120 Toll free or 81 3 5566 6507 Telephone Fax Region Dial Dial Latin America Caribbean countries Mexico and 52 55 35 3610 52 55 66 2308 Central America Brazil 0 800 704 9004 or 55 11 5070 9694 95 55 11 5070 9654 Argentina 800 666 0096 55 11 5070 9694 95 Chile 1230 020 9102 55 11 5070 9694 95 Uruguay 0004 055 654 55 11 5070 9694 95 Introduction 1 11 To Reach Technical We strongly encourage you to visit
39. 1 30 Individual Valve Consumption Valve Reagent Milliliters 1 DEBLOCK 4 OXIDIZER G ACTIVATOR C T ACN 5 6 ACT Wash1 DEBLOCK OXIDIZER CAPA CAPB ACN A G ACTIVATOR C T CN 8 3 coooooooooooooousooo 0 ACT Wash2 Synthesizer Window Database Import Utility D 11 Amidite Summary Window Elements Report Element Description Required Reagents The table in this window displays First column the valve number associated with the second column of the table Second column the name of each required reagent Third column the volume of reagent required in each bottle The calculation for these volumes is based on the particular sequences in all banks and the cycle used for synthesis Options Command The Options command presents the Options dialog box m Message Logging Default Cycle File C Short Detailed Instrument 34 Browse Motion T Dispensing This dialog box provides the elements listed in the table Options Command Elements Element Description Message Logging Sets the level of information detail that is written to the instrument log Logging is disabled if an instrument is not connected Short brief list of valve actions Detailed precise timing for each valve dispense Instrument Motion This selection enables the instrument to perform Checkbox motion operations
40. 16 In the Status window shown below BANKS LWASH OXIDATION FINAL_FLUSH LWASH LWASH LWASH Base Total Bases Percent Complete 0 Elapsed Time 0 00 00 Est Time Remaining 0 00 This window displays status information in the following ways The top portion of this window displays current status information for various System steps for each bank The first four line of the table display information graphically for four functions Moving Dispensing Waiting and Purging The actual chemistry cycle steps in progress are shown by a name presented in the rows labeled UC and LC The UC row presents information for sequences entered in Upper Case format The LC row presents information for sequences entered in Lower Case format The bottom portion of the window displays general progress indicators which include Base and Total 4 Bases indicators the Base increments until 100 complete is reached when Base equals Total Bases A bar indicator which increments upwards in percentage complete Elapsed Time and Est Time Remaining indicators which increment during the progress of synthesis Synthesizer Window Database Import Utility D 15 Waste Report The Waste Report presents the calculated volumes of waste output to the waste container for each listed reagent since the date and time entered on the report The relative volumes of consumption of two reagents can
41. 16015 Information about the release of new products that can be used on or with this instrument 3900 Specification Sheet 108SP01 01 1 2 Introduction Safety Documentation User Attention Words Chemical Hazard Warning Chemical Waste Hazard Warning Five user attention words appear in the text of all Applied Biosystems user documentation Each word implies a particular level of observation or action as described below Note Calls attention to useful information IMPORTANT Indicates information that is necessary for proper instrument operation y N27 a e Indicates a potentially hazardous situation which if not avoided may result in minor or moderate injury It may also be used to alert against unsafe practices Wie Indicates a potentially hazardous situation which if not avoided could result in death or serious injury rN Indicates an imminently hazardous situation which if not avoided will result in death or serious injury This signal word is to be limited to the most extreme situations NUNN CHEMICAL HAZARD Some of the chemicals used with Applied Biosystems instruments and protocols are potentially hazardous and can cause injury illness or death Read and understand the material safety data sheets MSDSs provided by the chemical manufacturer before you store handle or work with any chemicals or hazardous materials Minimize contact with and inhalation of chemicals Wear appro
42. 4 times Refer to the illustration on page 3 14 for a default map of valve configuration Valves 1 and 16 trichloroacetic acid valves Valves 6 7 8 9 10 21 22 23 24 and 25 valves for amidites not counting specialty amidites Valve 12 13 14 27 28 or 29 only If specialty amidites are used in bottle positions 5 6 7 8 9 or O Note Only the valve positions corresponding to speciality amidites actually used need to be prepared for short term shutdown by priming Long Term t is necessary to remove all reagents and run clean up procedures if you plan to leave Shutdown the instrument idle for more than 5 days For such planned shutdowns perform the long term shutdown procedure below to avoid line and valve clogs Note Applied Biosystems recommends that you discard reconstituted phosphoramidites rather than store them for reuse IMPORTANT The instrument must be properly shut down if it is to be left idle for more than 5 days Failure to properly shut down the instrument could cause tubing clogs that will interfere with reagent deliveries To perform Long term shutdown Step Action 1 Remove the retaining ring and cartridge from the synthesis chamber 2 CHEMICAL HAZARD Acetonitrile ACN is a flammable liquid and vapor that may cause eye skin and respiratory tract irritation central nervous system depression and heart liver and kidney damage Please read the MSDS and follow th
43. 7 6 Interim 0 0 Note The pathname provided for the Log file location assumes that 3900 and other program files are stored on Drive C D 16 Synthesizer Window Database Import Utility During the run the current instrument log presents the events in progress for viewing After the run the instrument log for the current run is identified as shown in the illustration on the next page in the Instrument Log window To view the contents of instrument logs including that for the run just completed bring up the Archived Log Viewer using the Archived Logs command View menu see Archived Log Viewer on page D 10 Use the Open Last Log button in the Archived Log Viewer to see the contents of the last Instrument Log Instrument Log Applied Biosystems 3900 48 Channel Oligonucleotide Synthesizer Software Version 1 00 Instrument Name MAGNET TripleDRI Log File CNPROGRA 153900DN 1 3800Log ABI 3900 LogFile 3 1 01 11 21 20 log Initiated 3 1 01 11 21 20 Valve Configuration The Valve Configuration window enables specification of the reagent to be associated with each valve array position Valve Configuration Reagent Reagent DEBLOCK DEBLOCK OXIDIZER OXIDIZER CAPA CAPB MM ACN ACT Wash2 Default Settings Calibrate Caibration Sumy OK Cancel The Valve Configuration window has these elements Valve Array 1 and Valve Array 2 the 30 val
44. 800 831 6844 then press 25 1 505 982 7690 Peptide Synthesis 433 and 43X Systems 1 800 831 6844 then press 31 1 650 638 5981 Protein Sequencing Procise Protein Sequencing Systems 1 800 831 6844 then press 32 1 650 638 5981 PCR and Sequence Detection 1 800 762 4001 then press 1 for PCR 2 for the 7700 or 5700 6 for the 6700 or dial 1 800 831 6844 then press 5 1 240 453 4613 Voyager MALDI TOF Biospectrometry and Mariner ESI TOF Mass Spectrometry Workstations 1 800 899 5858 then press 13 1 508 383 7855 Biochromatography BioCAD Workstations and Poros Perfusion Chromatography Products 1 800 899 5858 then press 14 1 508 383 7855 Expedite Nucleic acid Synthesis Systems 1 800 899 5858 then press 15 1 508 383 7855 Peptide Synthesis Pioneer and 9050 Plus Peptide Synthesizers 1 800 899 5858 then press 15 1 508 383 7855 PNA Custom and Synthesis 1 800 899 5858 then press 15 1 508 383 7855 FMAT 8100 HTS System and CytoFluor 4000 Fluorescence Plate Reader 1 800 899 5858 then press 16 1 508 383 7855 Chemiluminescence Tropix 1 800 542 2369 U S only or 1 781 271 0045 1 781 275 8581 Applied Biosystems MDS Sciex 1 800 952 4716 1 650 638 6223 Outside North America Region Telephone Dial Fax Dial Africa and the Middle East Africa English S
45. ABI 3900 High Throughput DNA Synthesizer User s Manual 3 Applied KS Biosystems Copyright 2001 Applied Biosystems All rights reserved For Research Use Only Not for use in diagnostic procedures ABI PRISM and its design Aquapore AmpliCover Anitron Biobytes Brownlee FastPhoramidite GeneScan Genotyper HLP INHERIT MicroAmp MicroCoat MPLC NEWGUARD ONESTEP OPC PCR MATE Phosphalink POLYPORE Precipitette ProBlott PROCISE ProFocus ProSort ProSpin SeqEd Sequence Navigator SPHERIS SPHERI10 StockMarks Stretch Synergy SynthAssist and VeloSep are registered trademarks of PE Corporation or its subsidiaries in the U S and certain other countries ABI ABI Masterpiece AmpF lt Mistral gt ISTR Applied Biosystems AutoAssembler BaseSprinter CATALYST GeneAssist LV40 MatchMaker PDQ Primer Express and ProSorb are trademarks of PE Corporation or its subsidiaries in the U S and certain other countries AmpErase AmpliTaq AmpliTaq Gold EnviroAmp GeneAmp and TaqMan are registered trademarks of Roche Molecular Systems Inc AppleScript and Macintosh are registered trademarks of Apple Inc Kalrez and Teflon are registered trademarks of the Dupont Corporation All other trademarks are the sole property of their respective owners PE Corporation is committed to providing the world s leading technology and information for life scientists PE Corporation consists of the Applied Biosystems and Celera Genomics busin
46. Chamber pressure should register 5 psi as the chamber pressurizes decreasing to 0 psi between pressurizations 10 You can monitor the run from the Status bar Instrument log by clicking the Instrument Log icon 3 16 Performing DNA Synthesis Perform Setup Tasks for the Next run or Shut Down Procedure Run Events Chart Step 4 High Throughput Production To Leave Instrument Idle Perform the Setup Tasks to prepare the instrument Enter sequences and cycle file s into the software Y Verify reagent supply and bottle positions load columns and start run Y Perform Setup Tasks for the next run or shut down procedure You are here All sequences must be in all caps To take full advantage of the high throughput features of the ABI 3900 DNA Synthesizer prepare the instrument and begin another run prior to processing the oligonucleotides from the previous run To do so return to Setup Tasks Before Each Run on page 3 5 If you plan to leave the instrument idle for more than 2 days you must perform a short term shutdown procedure in order to avoid clogs in the lines or valves If you plan to leave the instrument idle for more than 5 days you must perform the long term shutdown procedures in the section which follows in order to avoid clogs in the lines or valves After beginning the next run or after performing the long term shutdown procedure
47. Configuration ners seebzenesreseeb ne RHET Pe Uer Reb Pee abs D 17 Manual Conttol senrt sre esene eet bike DER eRe Sake Meee OR D 18 Diagnosties obs on E Ubu IS EB tena p ve D 20 DELVICE cos p LE UR PPS EMEN C HAS c vue red VOLO ER D 21 Database Import Utility Overview sseleeeeeeee eee eee D 25 Introduction x5 baee db RM eC Ee C AA D 25 The Import Utility Window sssleseeeeeeeee II D 26 Toolbar ICONS s uae Ce Ge ERE doe Ded CARS DAD RATER RES D 27 Database Import Utility Main Menu Commands sslsleee eese D 28 Introduction russe patie be ble ERE PEE E ERREUR RE Rm REESE D 28 Command Activation and Special Terms 0 0 00 e eee eee leen D 28 File Menu er ete e RH onde eh ene OO hes SEG Nama esq Oe D 28 Edit Menus i gp e e OR poke x OR Rea e be Ed a D 29 MAVAU IEEE P D 30 Database Import Menu 1 2 ee D 31 Synthesis Bank and Sequence Files 0 0 0 0 eee cece nee D 33 Types Of Files eorr oes a ee i m ARS Cal a PEDE dees D 33 Overview of File USse iu cae OE RENI GUERRE RR D 33 Importing Text Files 22x uEURREUERREH ERREUR EHE Ee eene D 34 Looking at Imported File Contents lesse ee D 35 File denuLi ec E PM C T DE CE D 36 Introd ctionsc o nade seh P aes esi Ba aad eae TERR d ARE D 36 Tab Delimited Textile ui ates ban tac eons pia eer EX ea Wek Een REY D 36 Space Delimited Text File 2 0 2 eee eee D 36 Comma Deli
48. GNET TripleDRI Log File C PROGRA 143900DN 1 3900Log AB 3300 LogFile 2 20 01 14 55 04 log Initiated 2 20 01 14 55 04 Sea ct VR 14 55 04 7 Synthesis Summary 14 55 04 7 14 55 04 7 Column 01 Oligo ID 41128 48 41 Sequence AACTCTCTCCCAAGAGCGAAAGTCACACAGCA 14 55 04 7 Column 02 Oligo ID 41128 50 41 Sequence AACTCTCTCCCAAGAGCGATCTGCCACTCCCT 14 55 04 7 Column 03 Oligo ID 41128 55 41 Sequence AACTCTCTCCCAAGAGCGACCAAAGTCACACAGCA 14 55 04 7 Column 04 Oligo ID 41128 60 A1 Sequence AACTCTCTCCCAAGAGCGATCCTCTGCCACTCCCT 14 55 04 7 Column 05 Oligo ID 41141 48 41 Sequence AACTCTCTCCCAAGAGCGACTCACATGAAAATCAT 14 55 04 7 Column 06 Oligo ID 41141 50 A1 Sequence AACTCTCTCCCAAGAGCGATCCAAACTCTAGAATCA 14 55 04 7 Column 07 Oligo ID 41141 55 A1 Sequence AACTCTCTCCCAAGAGCGACATTCCAAACTCTAGAATCA 14 55 04 7 Column 08 Oligo ID 41141 60 41 Sequence AACTCTCTCCCAAGAGCGACATTAAGCTCACATGAAAATCAT 14 55 04 7 14 55 04 7 14 55 04 7 ICycles 1um 0 05M Rev E xls 14 55 37 3 14 55 37 3 14 55 37 3 14 55 37 3 kd 14 55 37 3 Begin Preprocess 14 55 37 4 Rep 1of 1 14 55 37 4 s 14 55 37 4 Preprocess 250ul 397ms of ACN Valve 05 in Col 01 250ul 322ms of ACN Valve 11 in Col 07 14 55 37 4 Preprocess 250ul 397ms of ACN Valve 05 in Col 02 250ul 322ms of ACN Valve 11 in Cok 08 14 55 37 5 Preprocess 250ul 3897ms of ACN Valve 05 in Col 03 hw AT Open Last Log Open Print Close
49. IEHI View Browse i Bases 3900 DNA Synthesizer Database Import Utility x Eile Edit View Database Import Dig x eslelx S el i Banke Bank3 Banka ojojoj ojojoj Synthesizer Window Database Import Utility D 3 3900 Software and The 3900 software and Database Import Utility windows differ in the following ways ur Utility 4 Some 3900 software menus are different for the two windows PUES The 3900 software window has Tools Instrument and Help menus These will be described under 3900 Synthesizer Window Commands on page D 7 The Database Import Utility has the Database Import menu This menu will be described under Database Import Menu on page D 31 Besides these differences the rest of the menus are common to the two windows The View menu for the 3900 software window has two choices not available on the Database Utility View menu Cycle and Archived Logs These selections will also be discussed under View Menu on page D 10 The toolbars for the two windows differ in these ways The 3900 software window has eight icons not available on the Database Import Utility window These icons will also be described under 3900 Synthesizer Window Overview on page D 5 All of the icons on the Database Import Utility window are the same as those on the 3900 software window except for presentation in a differe
50. RENA D 1 Topics Covered x ouv VPE LMLEIESLOIS Im WI Nen NEUE IR ERR ee 25 D 1 Overview of Synthesizer and Database Import Utility Windows D 3 Introduction i ebEPSenkimeRELUCNERU RE ERE EMO dee oda epe ieri keeps D 3 Main Application Windows eeeeeeeeeeee ee eee ene eee D 3 3900 Software and Database Utility Differences 0 0 00 0 D 4 3900 Synthesizer Window Overview 0 0 0 c ec eee teenies D 5 Introduction uu esto A aw b ed Rs SRR Le wt a ie ete D 5 Main Menu and Toolbar 0 0 cece Ih D 5 The Synthesizer Window 1 0 0 0 eee eee ene eee D 6 3900 Synthesizer Window Commands 00 D 7 Introduction 2 cs bs AG ee BSS hts St e da Soe RENDIR SUE UE D 7 Command Activation and Special Terms eese D 7 File Menus etre eC eb eC ex ue am V ms eats D 7 Edt Men 2 02 54 0b eb cee dete ded Veet Seach Cae Obes RN P eRe pee Resets D 9 View Menu ie GCSE RC he ER RR e ok Bates D 10 TOOlS uus eoi e ele eee he t date Res CRAM eb De D 11 Instrument fc desi CSS GESTUS RO RULES nU Eee wes D 13 Helper uet REESE IP e e ie D 14 Instrument Menu Window Details 0 00 eee A D 15 Introduction i exe Co ROC e duce d dled Rates LAUS EROR RERO D 15 Status Reporting and Status Window 0 cece eee eee ee eee D 15 Waste Report ica isos E Pee ea Penta sce ae ee EN na eS D 16 Instrument Log ees sc was ya she hes ed asus Eq Baie SA Ae ee ute ou D 16 Valve
51. RTANT Keep all reagents on or off the instrument out of direct sunlight Sunlight degrades the chemicals and elevates the temperatures within the bottles Lifetime on Reagent Description P N Store at Shelf Life Instrument 1 Methylimidazole 450 mL bottle Tetrahydrofuran 401175 Acetic Anhydride Pyridine 450 mL bottle Tetrahydrofuran 402220 Trichloroacetic acid DCM 2 L bottle Room Temperature 1yr 2 wk 401272 Tetrazole acetonitrile 450 mL bottle 401173 Acetonitrile 4L Room Temperature 401087 lodine Water Pyridine 450 mL bottle 4 C Tetrahydrofuran 401632 A 401159 Room Temperature 1 yr 1 wk G 401165 Room Temperature 1 yr 1 wk C 401160 Room Temperature 1 yr 1 wk T 401162 Room Temperature 1 yr 1 wk A A Setup Tasks Preparing and Installing Phosphoramidites and Dye Amidites Introduction to Phosphoramidites Guidelines for Dissolving Phosphoramidites The phosphoramidites are bottled as powders and sealed under argon In this state they are stable for one year from the date of shipment Powdered phosphoramidites must be dissolved in acetonitrile ACN prior to installation on the ABI 3900 DNA Synthesizer Since phosphoramidites are extremely sensitive to acid oxygen and water you must take special care when dissolving them Use the following guidelines for storing and using the acetonitrile used to dissolve the phosphoramidites CHEMICAL HAZARD Acetonitrile ACN
52. Read and understood all related MSDSs PNTA OX Avoid using this instrument in a manner not specified by Applied Biosystems Although the instrument has been designed to protect the user this protection can be impaired if the instrument is used improperly Introduction 1 5 Safe and Efficient Operating the computer correctly prevents stress producing effects such as fatigue Computer Use pain and strain 1 6 Introduction To minimize these effects on your back legs eyes and upper extremities neck shoulder arms wrists hands and fingers design your workstation to promote neutral or relaxed working positions This includes working in an environment where heating air conditioning ventilation and lighting are set correctly See the guidelines below MUSCULOSKELETAL AND REPETITIVE MOTION HAZARD These hazards are caused by the following potential risk factors which include but are not limited to repetitive motion awkward posture forceful exertion holding static unhealthy positions contact pressure and other workstation environmental factors Use a seating position that provides the optimum combination of comfort accessibility to the keyboard and freedom from fatigue causing stresses and pressures The bulk of the person s weight should be supported by the buttocks not the thighs Feet should be flat on the floor and the weight of the legs should be supported by the floor not the thighs Lumbar supp
53. Speed Counts sec slew speed Acceleration Rate Counts sec Deceleration Rate Counts sec Rev Dir Acceleration Reverse direction acceleration in Counts sec Homing Parameters Coarse Homing Speed motor accelerates to the slew speed until the Home switch state is detected Homing Fine Offset the dead band around the Home switch Fine Homing Speed the motor traverses forward until the encoder index pulse is detected Home Offset deg the number of degrees used to compensate for a Home position error Click OK to close the Service window Synthesizer Window Database Import Utility D 23 Servo Tab To look at the Servo view click the Servo tab This presents the following window Note No user changes can be made to the parameters in this view The Servo view contains factory preset values for the Servo system Servo Tuning Parameters KP damping parameter KD proportional gain parameter KI integrator parameter Proximity Arrival deg deceleration range specified in degrees upon sensing of Home postion Click OK to close the Service window D 24 Synthesizer Window Database Import Utility Database Import Utility Overview Introduction The 3900 DNA Synthesizer Database Import Utility is used to prepare sequence files for use in the synthesizer The utility converts files from Excel as well as various types of text files into Synthesizer or Bank files files with
54. Utility window so that it won t be synthesized when a file is output for the bank bnk file The table column labeled Column ID provides the user with the capability of documenting the column to be used for synthesis Note Four different views are presented for Banks 1 through 4 allowing discrete input for each bank D 6 Synthesizer Window Database Import Utility 3900 Synthesizer Window Commands Introduction Command Activation and Special Terms File Menu This section describes the commands available from the Main menu except for those on the Edit menu common to word processing programs see list in Toolbar Icons above This section provides information on the two ways commands can be activated The commands in this menu can be activated in two ways Clicking the command in the menu or Using the special key combinations shown for the command in the menu The commands in the File menu are used to open save close and otherwise manage Projects in the Project window add sample files export files control printing and log out or exit from 3900 software File New Ctrl N Open Cti 0 Save Ctrl S Save As Underscored single letters in commands are keyboard shortcuts for executing Import Column Ctrl I commands Import Bank Export Column Ctrl E Export Bank Print Ctrl P Exit Alt F4 The following table is provided as a reference for the File menu Synthesizer Win
55. aired by a party other than AB or c used in a manner not in accordance with the instructions contained in the Reference Manual or the Instrument User s Manual This Warranty does not cover the customer installable accessories or customer installable consumable parts for the Instrument that are listed in the Reference Manual or Instrument User s Manual Those items may have their own separate warranties AB s obligation under this Warranty is limited to repairs or replacements that AB deems necessary to correct those failures by the Instrument to meet the Specifications of which AB is notified prior to expiration of the Warranty Period All repairs and replacements under this Warranty will be performed by AB on site at the Customer s location at AB s sole expense No agent employee or representative of AB has any authority to bind AB to any affirmation representation or warranty concerning the Instrument that is not contained in AB s printed product literature or this Warranty Statement Any such affirmation representation or warranty made by any agent employee or representative of AB will not be binding on AB AB shall not be liable for any incidental special or consequential loss damage or expense directly or indirectly arising from the purchase or use of the Instrument AB makes no warranty whatsoever with regard to products or parts furnished by third parties such products or parts will be subject to the warranties if any of their respecti
56. and to operate the instrument The GUI allows you to easily Enter custom sequences in several ways Individually by typing or cutting and pasting from a text file Importing entire banks of sequences Importing all four banks of sequences simultaneously Use the optimized cycles that are included in the software or customize the cycles using Microsoft Excel Save up to four banks of sequences and cycle information to repeat the run without re entry Passwords and No passwords are necessary to synthesize DNA on this instrument Dexcs ob access Applied Biosystems service engineers will use the Service page on the Instrument menu to service your instrument This page is password protected to avoid accidental editing of critical instrument adjustment parameters Types of Files Used The following file types extensions are used with the 3900 instrument software File Type Created In Used For seq 3900 Software A single oligonucleotide sequence used in one column bnk 3900 Software Entire bank of sequence and cycle information txt Word Pad Note Copying and pasting a single oligonucleotide sequence Pad or Word or portions of sequences xls Microsoft Excel Spreadsheet data for cycle programs Tour of the Instrument 2 11 Conventions Used Bold Font for Software Titles of windows and dialog boxes menu choices and options you choose within lists Procedures are all in bold font
57. ant guidelines for handling reagents which are potentially Handling Reagents hazardous chemicals Read and understand all applicable MSDSs before handling hazardous chemicals When replacing reagents always install a new bottle on the instrument Do not add new solution to previously used reagent bottles Some chemicals reduce the integrity of glass bottles As a result repeated use beyond 6 weeks may result in the bottle fracturing when it is pressurized during operation Always wear gloves safety glasses and protective clothing when handling chemicals Always provide adequate ventilation when handling chemicals Some chemicals require handling only in a properly functioning fume hood Provide secondary containment for all reagent bottles Procedure FN Wear gloves when changing bottles to avoid direct contact with chemicals To change reagent bottles Step Action 1 Remove a bottle as follows a Slowly turn the bottle counterclockwise until it releases b Remove the bottle from its position and recap to minimize residual vapor release Note Kalrez gaskets have a service lifetime of 6 months to 1 year and are replaced at 6 month intervals 2 Install a new bottle as follows a Open the new bottle b Place a medium size Trap Pak P N GEN084033 into acetonitrile and acetonitrile tetrazole bottles c Make sure the Kalrez gasket is in place and did not fall off when the bottle was removed d S
58. asks A 5 Installing Phosphoramidite A 6 Setup Tasks Bottles You must dissolve the phosphoramidite before installing the bottle on the instrument For details see Guidelines for Dissolving Phosphoramidites on page A 5 Sufficient phosphoramidites must be present on the instrument to complete a run before beginning the run To replace phosphoramidite bottles Step Action 1 Remove the old bottle by firmly pulling it straight down while pressing the black button above its receptacle Note If the bottle seems to stick carefully move it from side to side while pulling down Wipe the delivery line with a lint free laboratory tissue Place a mini size Trap Pak P N GEN084034 into the phosphoramidite bottle Thread the delivery line into the bottle c1 OIN Push the bottle release button and firmly push the neck of the bottle into the bottle receptacle while rocking the bottle gently side to side 6 Release the button and let go of the bottle Changing Reagent Bottles Introduction Change the reagent bottles when your pre run check shows that the reagents will run out during the run Reagent bottles are located in two banks on the front of the instrument on two banks on the left side of the instrument and 3 bulk bottles have lines which input to the back of the instrument Each of the bottle positions on the reagent banks are labeled Guidelines for Here are some of the import
59. aste bottle before each run Empty the waste bottle using the Containers procedure below when it is 1 2 to 3 4 full To empty waste containers Step Action 1 Before emptying a waste bottle locate an extra cap for the next step 2 Unscrew the cap assembly and immediately recap the bottle with the extra cap to prevent release of vapors Place the liquid from the waste bottle into a properly labeled sealed container VN hc CHEMICAL WASTE HAZARD Wastes produced by Applied Biosystems instruments are potentially hazardous and can cause injury illness or death After disposing of the waste securely screw the cap assembly back on to the emptied waste bottle Check that the waste and vent lines are free of clogs and kinks IMPORTANT Waste bottles are the low pressure side of the delivery system and must always be kept vented to the laboratory ventilation system If a vent line is blocked back pressure will be generated and will inhibit deliveries of reagents See the ventilation requirements and graphics in the AB 3900 DNA Synthesizer Site Preparation and Safety Manual P N 4316012 for details Changing the Argon Monitor the level of argon before each run Change the tank when the pressure is less Tank than 500 psi prior to a run You cannot change a tank after beginning a run PNE EXPLOSION HAZARD Pressurized gas cylinders are potentially explosive Always cap the gas cylinder when it is not i
60. be determined by comparing the percentage values in the third column Waste Bottle Report ABI3900 OLIGONUCLEOTIDE SYNTHESIZER VASTE BOTTLE CONTENTS Instrument Name MAGNET TripleDRI Date and Time Started 12 6 00 13 58 56 Report Generated 2 20 01 15 06 28 Inportant Volumes are approximate Total Volume In Waste Bottle liters 0 00 Consumption Summary Reagent Milliliters Percent Total DEBLOCK 00 0 OXIDIZER 0 00 0 CAPA 0 00 0 CAPB 0 00 0 ACN 0 00 0 0 00 0 G 0 00 0 ACTIVATOR 0 00 0 C 0 00 0 T 0 00 0 5 0 00 0 6 0 00 0 7 0 00 0 ACT Wash1 0 00 0 8 0 00 0 3 0 00 0 0 0 00 0 ACT Wash2 0 00 0 Reset Data Refresh Instrument Log The instrument log provides a list of the system events that occurred during a synthesis run The events displayed in the log are set in the Options dialog box see page D 12 Each time a run is started a new Synthesis Log file is created Each Log file contains only the events associated with the run Log files are archived in this location C Program Files 3900 DNA Synthesizer 3900Log Instrument Log Base 04 075ul 268ms of A Valve 06 in Col Base 04 115ul 309ms of ACTIVATOR Mese ei in Col 02 Base 04 075ul 289ms of C Valve 09 in Col 02 Base 04 115ul 308ms of ACTIVATOR Valve 08 in Col 03 Base 04 075ul 268ms of A Valve 06 in Col 03 Base 04 115ul 308ms of ACTIVATOR Valve 08 in Col 04 Base 04 075ul 289ms of C Valve
61. bottle position see the Valve Bottle Position Map on page 4 15 z Delivery line ee 99 99 99 oS a Valve rack Dispense line Wash tower e Be Dispense tip GR193l 4 14 Instrument Maintenance Valve Bottle Position The following reagent map shows correspondence between 3900 instrument valves Map and bottle positions Valve Reagent 1 DEBLOCK 2 OXIDIZER Bulk Bottle 1 TCA DCM 3 CAPA top 4 CAPB top 5 ACN 6 A top 7 G top 8 ACTIVATOR top Bulk Bottle 2 ACN 9 C top 10 T top 11 ACN 12 5 13 6 14 7 15 ACT Washi 4 16 DEBLOCK 17 OXIDIZER bottom 18 CAPA bottom 19 CAPB bottom 20 ACN 21 A bottom 22 G bottom Bulk Bottle 3 ACN 23 ACTIVATOR bottom 24 C bottom 25 T bottom 26 ACN 27 8 28 9 29 0 30 ACT Wash2 Instrument Maintenance 4 15 Removing Use the following procedure to remove valves that are malfunctioning but still able to Malfunctioning dispense Valves To remove malfunctioning valves Step Action 1 Remove the cover over the valve rack by grasping along the inner edge of the cover and lifting up Determine the number of the valve to be replaced Replace the bottle served by the valve to be removed with a clean e
62. ch run If you do not know how to perform system For details Step Action see page 1 Empty the waste container if it is more than one half full Emptying The waste and vent lines must be free of plugs or kinks eels Containers on The vent line must be connected to the laboratory ventilation page A 2 Performing DNA Synthesis 3 5 To setup before each run continued Step Action For details see page 2 Check the argon tank pressure Values from the two stage regulator should be High pressure 500 psi If the value is below this change the tank before setting up the run Low pressure Between 60 80 psi If the pressure is outside this range adjust the regulator Changing the Argon Tank on page A 2 Ensure that all bottles are installed correctly with a tight seal on every position IMPORTANT Empty bottles or bottles containing acetonitrile must be placed on unused bottle positions CHEMICAL HAZARD Acetonitrile ACN is a flammable liquid and vapor that may cause eye skin and respiratory tract irritation central nervous system depression and damage to the heart liver and kidneys Please read the MSDS and follow the handling instructions Wear appropriate protective eyewear clothing and gloves 2 4 figure on page Visually inspect the valve fittings and the valve and solenoid assemblies for chemical residue that may indicate leak
63. chamber window with the lid down and the valve rack cover on is shown here Valve rack cover GRIS24 Beneath the Valve The details of the top down view with the valve rack cover removed are shown here Rack Cover 2 6 Tour of the Instrument GR1938b Delivery line Valve rack Valve beneath rack Dispense line Wash tower Dispense tip ACN wash lines Cartridge Component Function Delivery lines Tubing from the chemical bottles to the valves Dispense lines Tubing from the valves to the dispense tips Dispense tips Deliver chemicals to columns Wash towers Washes precipitate from tetrazole dispense tip ACN wash lines Tubing delivering ACN to the wash towers Valve beneath rack Gates the delivery of chemicals to each dispense tip Cartridge Holds columns and rotates to position them under dispense tips Synthesis Chamber The details of the cartridge within the synthesis chamber are shown here Bank 1 positions 1 12 Prime waste position Chamber O ring Bank 2 positions 13 24 currently empty Cartridge retaining ring Cartridge lock screw GR1925 Note Columns must be pressed completely down into the cartridge Component Function Banks 1 2 3 4 Each bank has 12 colum
64. crew the bottle snugly into its threaded receptacle on the instrument by turning it clockwise Note The reagent bottle receptacles have a ratchet cap assembly A built in torque limiting feature reduces the possibility of overtightening Do not continue to turn the bottle when clicking starts as this can cause the cap assembly to leak Setup Tasks A 7 Post Synthesis Processing In This Appendix Topics Covered This chapter provides procedures for post synthesis processing of DNA produced on the ABI 3900 High Throughput DNA Synthesizer Topic See Page Deprotection Procedures B 2 Introduction B 2 Cleavage Deprotect Option B 2 Cleavage Deprotect Option II B 4 Reconstitution B 6 Diluting Reconstituted Oligonucleotides for Quantitation B 6 Post Synthesis Processing B 1 Deprotection Procedures Introduction After synthesis in the 3900 instrument the oligonucleotides within the columns are still linked to the solid support and bound to their protective groups Many laboratories will need to cleave the oligonucleotides from the support and deprotect the bases Two procedures for this type of post synthesis processing are provided here This appendix also provides a procedure for reconstituting the DNA for quantitation by standard spectrophotometry The following procedures are covered in this section Cleavage Deprotect Option see below Cleavage Deprotect Option Il see page
65. dow File Menu Commands Item Description Enabling New Opens a new untitled Synthesis Enabled when the Ctrl N document instrument is not running If previous project has pending changes the following alert message is displayed Do you want to save the current synthesis file Yes No Cancel Open Displays the Open Synthesis Enabled when the Ctrl O dialog box instrument is not running Synthesizer Window Database Import Utility D 7 Synthesizer Window File Menu Commands continued Item Description Enabling Save If Synthesis document is untitled displays the Save dialog box Titled documents are saved to the current name syn extension files Enabled when the Synthesis document has pending changes Save As Displays the Save dialog box saves as syn extension files Always enabled Import Column Ctrl I Opens the Import sequence dialog box Box will be labeled with column selected in document seq extension files Enabled when the instrument is not running and a sequence row is selected Import Bank Ctrl M Opens the Import Bank dialog box uses bnk extension files Enabled when the instrument is not running Export Column Ctrl X Opens the Export sequence dialog box uses seq extension files Enabled when the instrument is not running anda sequence row is selected Export Bank Opens the Export Ban
66. e amidites Dye labelling with 6 Fam HEX TET TFA Aminolink Biotin Phosphalink A cycle is a protocol that tells the instrument the steps to perform in order to synthesize the DNA sequences you have entered An optimal cycle program is provided with the 3900 instrument software and is the only type of oligonucleotide production that will be covered in this manual However you can also program cycles to further customize the DNA synthesis process in your laboratory The cycle file provided is a single cycle but each customized cycle file has the capability of driving two different cycles The dual cycle program can be used interchangeably during production of the oligonucleotide At the heart of the 3900 system is the rotary cartridge which holds the open ended columns containing the solid support and the lengthening oligonucleotides Chemicals are delivered through dedicated tubing and two way valves to stationary dispense tips situated over the cartridge The cartridge rotates to position the columns under the appropriate dispense tips in the order according to the cycle s chosen by the customer The dedicated tubing eliminates the chance of cross contamination of chemicals and the rotary motion of the cartridge maximizes the efficiency of the production process The columns are arranged in the cartridge in 4 banks of 12 columns Each column may be destined to produce a different oligonucleotide sequence However the columns within
67. e dialog box allowing choice of this file type Import Tab Delimited Opens the Import Tab Always enabled Delimited File dialog box allowing choice of this file type Import Excel Opens the Import Excel File dialog box allowing choice of this file type Always enabled Synthesizer Window Database Import Utility D 31 Database Import Commands Item Description Enabling Substitute String Editor Opens the following dialog Always enabled box allowing string editing but useful only to make changes to FROM TO existing strings D 32 Synthesizer Window Database Import Utility Synthesis Bank and Sequence Files Types of Files Three types of files are used with 3900 software and the Import Utility Synthesizer files files with a syn extension Sythesizer files are created with the New command File menu They can contain sequence information needed for all four instrument banks and are output using the Save and Save As commands Bank files files with a bnk extension Bank files can be imported into and exported out of the Import Utility Note Bank 1 contains sequence information for positions 1 12 on the instrument Bank 2 contains sequence information for positions 13 24 Bank 3 contains sequence information for positions 25 36 Bank 4 contains sequence information for positions 37 48 Sequence files text files of various types used to input se
68. e directly over the center of column 1 If column 1 and Valve 1 are not aligned use the Home Offset field to adjust the position a Make an estimate of how many degrees Column 1 is offset from the Home position and change the Home Offset value b Click the Home button again and readjust the Home Offset value until Column 1 is positioned directly under dispense tip 1 c Click Done Home Offset Adjustment Rules Units are in degrees of rotation Making the number more negative rotates the cartridge counterclockwise There are about 1650 steps across a column 100 000 steps around a cartridge Change the Home Offset value in a range of 0 5 degrees for fine adjustments Instrument Maintenance 4 9 Verifying Valve Calibration About Verifying Calibration Schedule for Verifying Valve Calibration 30 Valve Calibration Verification Valves are calibrated during the manufacturing process to deliver accurate volumes over a specified range depending on the chemical being delivered Over time valves may lose calibration or begin to fail but may continue to deliver chemicals Since the deliveries will no longer be accurate oligonucleotide quality or yield may be affected Performing daily calibration verifications will ensure that malfunctioning valves are recalibrated or replaced before impacting oligonucleotide production The calibration of all 30 valves needs to be verified While se
69. e following topics are covered in this appendix Topic See Page Overview of Synthesizer and Database Import Utility Windows D 3 Introduction D 3 Main Application Windows D 3 3900 Software and Database Utility Differences D 4 3900 Synthesizer Window Overview D 5 Introduction D 5 Main Menu and Toolbar D 5 3900 Synthesizer Window Commands D 7 Introduction D 7 Command Activation and Special Terms D 7 File Menu D 7 Edit Menu D 9 View Menu D 10 Tools D 11 Instrument D 13 Help D 14 Instrument Menu Window Details D 15 Introduction D 15 Status Reporting and Status Window D 15 Waste Report D 16 Instrument Log D 16 Valve Configuration D 17 Manual Control D 18 Diagnostics D 20 Service D 21 Synthesizer Window Database Import Utility D 1 Topic See Page Database Import Utility Overview D 25 Introduction D 25 The Import Utility Window D 26 Toolbar Icons D 27 Database Import Utility Main Menu Commands D 28 Introduction D 28 Command Activation and Special Terms D 28 File Menu D 28 Edit Menu D 29 View Menu D 30 Database Import Menu D 31 Synthesis Bank and Sequence Files D 33 Overview of File Use D 33 Importing Text Files D 34 Looking at Imported File Contents D 35 File Formats D 36 Introduction D 36 Tab Delimited Text File D 36 Space Delimited Text File D 36 Comma Delimited
70. e handling instructions Wear appropriate protective eyewear clothing and gloves Using a lint free laboratory tissue moistened with acetonitrile wipe the chamber cartridge and retaining ring 3 18 Performing DNA Synthesis To perform Long term shutdown Step Action 3 Switch to acetonitrile bottles only a Remove all reagent bottles except for the bulk acetonitrile bottles b Empty the bottles and place a minimum amount of acetonitrile in each bottle Guidelines for these amounts are Amidite bottles 5 mL 450 mL bottles 10 to 15 mL TCA bottle 50 mL c Replace the two 4 L acetonitrile bottles with empty bottles Select Instrument gt Manual Control and click Prime All four times 5 Empty the reagent bottles partially filled in step 3 6 Select Instrument gt Manual Control and click Prime All until no more fluid is delivered from any delivery line into the prime waste position When no more fluid is delivered from any delivery line delivery lines are empty 7 Empty the waste container and replace the waste cap assembly For details see Emptying Waste Containers on page A 2 The waste and vent lines must be free of plugs or kinks The vent line must be connected to the laboratory ventilation system Performing DNA Synthesis 3 19 Instrument Maintenance Overview About This Chapter This chapter provides the information you will need for preventive
71. e scale of columns you will be loading Repeat steps 2 through 7 for all banks that are to be included in this run Save the current bank in a bnk file or save all four banks and their cycles in a syn file by a Select File Save As b In the Save As dialog box type the name of the file c In the drop down list of file types choose either bnk for the current bank or syn for all 4 banks in one file d Click Save 3 12 Performing DNA Synthesis Verifying Reagent Supply and Bottle Positions and Loading Columns Run Events Chart Step 3 Perform the Setup Tasks to prepare the instrument Y Enter sequences and cycle file s into the software Verify reagent supply and bottle positions load columns and start run Y Perform Setup Tasks for the next run or shutdown procedure You are here All sequences must be in all caps Performing DNA Synthesis 3 13 Verifying Reagents To verify reagents supply and bottle positions Action Verify the presence of reagents needed for a run by comparing the quantities listed on the Amidite Summary window window presented with the Amidite Summary command Tools menu with the quantities of reagents physically present on the instrument IMPORTANT The quantities physically present should be quite a bit greater than the actual quantities required to avoid delivery problems Supply and Bottle Positio
72. ectly To test chamber pressure Step Action 1 Status of the system Instrument and computer on 3900 software running Does not matter if the cartridge or columns are present Instrument lid closed and locked 2 Select Instrument gt Diagnostics This presents the Diagnostics window r Chamber Pressure Test Close and lock lid Click Run Test Watch chamber pressure gauge Passing Less than 1 psi drop Release pec Pressure to end test r Calibration Verification Test ios coors rio Pen 1530 Enter volume into text box i Run Test specifications See your ABI 3900 DNA Synthesizer User s Manual for container and volume options 3 Under Chamber Pressure Test click Run Test to pressurize the synthesis chamber A timer will appear in the Test window 4 Watch the Chamber pressure gauge Passing Less than 1 psi drop in one minute 5 Click Release Pressure to end test 4 6 Instrument Maintenance Calibrating Valves About Calibrating Valves When to Calibrate Valves Calibrating Valves By Weight of Reagent Dispensed Valves can be calibrated by the weight or volume of reagent dispensed Since calibration by weight is much more accurate Applied Biosystems recommends this method Both protocols are listed in the following sections Valves need to be calibrated After being replaced Whenever a valve calibration verification shows that the valve
73. ee list in Toolbar Icons above File Edi View Database Import This section provides information on the two ways commands can be activated The commands in this menu can be activated in two ways Clicking the command in the menu or Using the special key combinations shown for the command in the menu The commands in the File menu are used to open save close and otherwise manage Projects in the Project window add sample files export files control printing and log out or exit from the GeneMapper application File New Ctrl N Open Cti O Save Ctrl S Save As Underscored single letters in commands are keyboard shortcuts for executing Import Column Ctrl l commands Import Bank Export Column Ctl E Export Bank Print Ctrl P Exit Alt F4 The following table is provided as a reference for the File menu Project Window File Menu Commands Item Description Enabling New Opens a new untitled Synthesis Always enabled Ctrl N document If previous project has pending changes the following alert message is displayed Do you want to save the current synthesis file Yes No Cancel Open Displays the Open Synthesis Always enabled Ctrl O dialog box Save If Synthesis document is untitled Enabled when the displays the Save dialog box Titled Synthesis document documents are saved to the has pending current name syn extension changes files
74. ely 13 10 If any of the dispensed volumes appears high or low note the valve affected and perform an individual valve dispense test See Single Valve Calibration Verification on page 4 12 Instrument Maintenance 4 11 Single Valve This test is run to check the volume dispensed from a single valve Calibration Verification To verify calibration of single valve Step Action 1 Status of the system Instrument and computer on with 3900 software running All Positions Primed Select Instrument gt Manual Control In the Manual Control window Motion and Dispensing field select the valve you want to test from the drop down list In the microliters text field enter 288 5 Position an appropriate collection container directly under the dispense tip for the valve you are testing 6 Click Dispense 7 Measure the volume dispensed If the valve is correctly calibrated the volume should be no more than 5 different than the volume entered If calibration is needed see Calibrating Valves on page 4 7 If valves need to be replaced see Replacing Valves on page 4 13 The part number for the valve is P410323 4 12 Instrument Maintenance Replacing Valves Valve Part Number About Valves Valve Graphic The valves replaced by this procedure have the following Part number P410323 Since the valves control the delivery of reagents they should be c
75. er O Ring Step 1 2 If the O ring still does not hold pressure replace it Replacing the To replace the synthesis chamber O ring Synthesis Chamber O Ring Remove it by grasping it with a gloved hand and pulling it out of the groove Push the new O ring into the groove with your fingers Replacing Follow the procedure below to replace the phosphoramidite O ring P N 221014 Phosphoramidite Bottle O Rings TO replace bottle O rings Step Action 1 Remove the O ring by gripping it with a gloved hand or hemostat and pulling it away from its groove Be careful not to mar the white Teflon insert that holds the O ring IT a Check that the Teflon is free of particulates before inserting the new O ring b Push the new o ring into the groove with your fingers If after a period of use a white precipitate appears on an O ring clean it with a cotton tipped swab moistened with acetonitrile Replacing the To replace the gasket P N 4318893 between the cartridge and the drainplate Synthesis Chamber 4 Pull the old gasket out and put the new gasket in its place Make sure that the new Gasket gasket lies flat against the drainplate Perform a pressure check after replacing the gasket to ensure that the seal is adequate Instrument Maintenance 4 21 Replacing EPR and Note EPR gaskets for 4 L bottles are replaced on an as
76. er RR P e d RR rU EUR 4 19 Changing the Dispense Lines leeeeeeeeeeeeee e 4 20 Dispense Lines Part Number 2 0 0 0c 4 20 Procedure eie bRRSERS SERRE ACER MERE ERE ee oleracea 4 20 Maintaining O Rings Gaskets and Bottle Seals 0 0 00 0 02 ee eee eee 4 21 Checking the Synthesis Chamber O Ring 0 00 0 eee ee eee eee 4 21 Replacing the Synthesis Chamber O Ring 00 0 0 ee eee eee ee 4 21 Replacing Phosphoramidite Bottle O Rings 0 0 00 000s eee eee 4 21 Replacing the Synthesis Chamber Gasket 00 0 0 eee eee eee 4 21 Replacing EPR and Kalrez Gaskets 2 2 eee eee nee 4 22 Setup Tasks Tn This Appendix os Rea ERR RR CROSSOVER DOR SUR e Rn A 1 TOPICS Covered eb VUL a WHERE MONT AER LR rue A 1 Preparing the Instruments 2 2 uv COLE E AAE E AA E Sue ra eh e e e HS A 2 Emptying Waste Containers eseseeeeeeeeeee eens A 2 Changing the Argon Tank ssesleseeleeeeeee eens A 2 Storing Phosphoramidites Reagents and Dyes 0 0 cece eee A 4 WntrOdUC TOM zoe DRE D Lanes renee GU WU HIE E A 4 Storage Conditions c oe ee ee hs See a Say eee bee eee A 4 Preparing and Installing Phosphoramidites and Dye Amidites 0 0 A 5 Introduction to Phosphoramidites 2 2 0 0 00 ccc eee eee eee A 5 Guidelines for Dissolving Phosphoramidites llle eese A 5 Quantities of Acetonitrile for Dissolving P
77. esses LIMITED WARRANTY STATEMENT Applied Biosystems Molecular Biology Division Applied Biosystems AB warrants to the customer that for a period ending on the earlier of one 1 year from the completion of installation or thirteen 13 months from the date of shipment to the customer the Warranty Period the ABI 3900 High Thoughput DNA Synthesizer the Instrument purchased by the customer will be free from defects in material and workmanship and will perform in accordance with the specifications set forth in the ABI 3900 Specification Sheet the Specifications During the Warranty Period if the Instrument s hardware becomes damaged or contaminated or if the Instrument otherwise fails to meet the Specifications AB will repair or replace the Instrument so that it meets the Specifications at AB s expense However if the Instrument s valves or reagent lines become damaged or contaminated or if the chemical performance of the Instrument otherwise deteriorates due to solvents and or reagents other than those supplied or expressly recommended by AB AB will return the Instrument to Specification at the customer s request and at the customer s expense After this service is performed coverage of the parts repaired or replaced will be restored thereafter for the remainder of the Warranty Period This Warranty does not extend to any Instrument or part which has been a the subject of an accident misuse or neglect b modified or rep
78. ext File D 35 file types Index 2 extensions used with software 2 11 First run of the day procedure for setup 3 3 Free 1 12 Fume Hood Assembling and using E 2 G Guidelines for using columns and banks 3 8 H Hardware list part numbers C 3 Help see technical support 1 8 High throughput production recommendations 3 17 Home position procedure for verifying 4 9 I Import Bank icon 2 12 information types document to lookin 1 2 Instrument Log icon 2 12 Instrument Maintenance log purpose of 4 5 Instrument Menu Window details Diagnostics D 20 Instrument Log D 16 Manual Control D 18 Service D 20 status reporting and Status window D 15 Valve Configuration D 17 Waste report D 16 Instrument operation instruction required before 1 5 Instrument Safety Labels 1 5 instrument setup list of tasks 3 3 Internet technical support 1 12 Internet address Documents on Demand 1 12 lodine Water Pyridine Tetrahydrofuran storage conditions A 4 L Leaving instrument idle recommendations to prepare for 3 17 Loading columns procedure 3 15 Long Term shutdown tasks to perform before operation 3 7 Long term shutdown procedure to prepare for 3 18 when to perform 4 4 M Main Menu and Toolbar contents 2 12 maintenance items list of required items 4 3 maintenance schedule 4 3 MSDSs general information 1 4 ordering 1 4 O Optical Eye and Homing screw location 2 8 Options command D 12 Outside 1 9 P Passwords and level
79. for 1 min The oligonucleotide should now have been cleaved from the support material and eluted into the ammonium solution 5 Using clean tweezers remove each column from its vial and recap the vial B 2 Post Synthesis Processing To perform cleavage deprotection by Option continued Step Action 6 Place the capped vials into an oven or heat block at 65 C for 1 5 hr The oligonucleotides should now be deprotected 7 Remove the vials from the heating apparatus and allow to cool to room temperature When the vials are cool to the touch remove the caps 9 Place the uncapped vials into the rotary evaporator at room temperature for 1 hr or until dried down with the vacuum on to dry down the oligonucleotides 10 If you want to Then Reconstitute the oligonucleotide within the vials Add 1 mL of DI water to each vial Quantitate the oligonucleotide within the vials a Add 1 mL of DI water to each vial b Use the chart Diluting Reconstituted Oligonucleotides for Quantitation on page B 6 Post Synthesis Processing B 3 Cleavage Deprotect Materials Required Option II 2 mL Nalgene plastic vials P N 140099 with red screw caps P N 201579 1 vial per oligonucleotide 9 9 9 9 Fresh concentrated 3096 ammonium hydroxide Tweezers Rotary evaporator Deionized water PVC cutters To perform cleavage deprotection by Option II
80. ft Note Clicking off the row will display the sequence in 3 letter groups and the color code of the column for the 3 base will display Cutting and pasting each a Choose File Open and use the Open File sequence from a txt file dialog box to navigate to and open the file or word processing file containing the appropriate sequence s doc b Highlight one sequence and select Edit gt Copy All sequences must be in all caps c In the Synthesis window click on the sequence field row and select Edit Paste Note Clicking off the row will display the sequence in 3 letter groups and the color code of the column for the 3 base will display Importing each sequence a In the Synthesis window click on a sequence from a seq file created field row to highlight it in the 3900 software b Click the Import Column icon All sequences must be in all caps Bl EH c Use the Import Column navigation window to select the seq file containing the appropriate sequence and click Open Importing a bank of a Be sure the tab of the current bank is selected sequences from a bnk b Click the Import Bank icon All sequences file created in the 3900 must be in all caps software ow ii c Use the Import Bank navigation window to select the bnk file containing the appropriate bank information d Click Open Importing information from This is done using the Import Utility See Appendix a database D for informati
81. h need to be corrected before the command can be executed Synthesizer Window Instrument Menu Commands Item Description Enabling Prime Ctrl G Initiates the Instrument priming process Displays the Priming window Enabled when an instrument is connected and is not running Start Ctrl R Starts the instrument to perform DNA synthesis or resumes a paused synthesis Note Menu item changes to Resume when the instrument is paused Enabled when an instrument is connected and is not running or when the instrument is paused Pause Ctrl Y Pauses the instrument The instrument is allowed to resume from the pause point Enabled when the instrument is running Stop Ctrl T Stops the instrument and the synthesis Enabled when the instrument is running or paused Status Ctrl F5 Displays the Status window Always enabled Waste Report Ctrl W Displays the Waste Report window Always enabled Synthesizer Window Database Import Utility D 13 Synthesizer Window Instrument Menu Commands continued Item Description Enabling Instrument Log Displays the Instrument Log Always enabled Ctrl F6 window Valve Displays the Valve Configuration Enabled when the Configuration dialog box instrument is not running Manual Control Displays the Manual Control Enabled when the Ctrl M window instrument is not running Diagnos
82. hanged whenever a leak is noted or the calibration values fall outside of your laboratory s dispensing accuracy specifications Leaks can be detected by looking for chemical residue either moisture or white crystals below valves and at the junction of the two halves of the valve body Leaks can also be detected by monitoring drips from the dispenser tips Two procedures are provided for removing valves one for valves that are malfunctioning but still able to dispense and one for valves that are completely non functional This entire apparatus is a valve B m Two way valve Inlet and Outlet Port Plugs Solenoid EE Electrical connector GR1980 Component Function Two way valve Mechanical gating device that opens and closes according to signals from its solenoid allowing chemicals to flow along the pressure gradient Inlet and Outlet Port Plugs Connect to the reagent delivery and dispense lines Electrical connector Connect the instrument and the solenoid Instrument Maintenance 4 13 Valve Numbering Valves are mounted beneath the valve rack Valves are numbered consecutively 1 to 30 from your left to your right as you face the front of the instrument All of the instrument bottle positions are served by a single valve The bulk bottles are attached by lines to the back of the instrument and are served by more than one valve To determine which valve serves which
83. hat trityls be left on for a sequence indicated by a blank check box in the Trityl Off column enter ON in the second column for the DMT line D 38 Synthesizer Window Database Import Utility Excel Files The format of the Microsoft Excel file is shown below X Microsoft Excel NewExcel xls 5 File Edit View Insert Format Tools Data Window Help la x x Information from an Excel file maps into the Import Utility in a straight forward way The oligo names in Column A are mapped into the column labeled Oligo ID in the Import Utility ACGTATTATTA AGATTATTATTA ACGTTGTTTGG ACTGGTGTGCTTAGTTC ACTGGTGTGCTTAGTTC ACGTTGTTTGGTGTTTCCCTCT ACTGTTACGATTAATAAAATGTCTG TTGTATGGTTAAT AGTTTGTGTATATGTACTACATGTTTA ACTGTGTTAATACGT AGTACAGTGGTGTGTTGTTGGT ACGTTGATATTGATAGCT The sequence listings in Column B are mapped into the Import Utility column labeled Sequence The default or blank entry in Column C for each sequence indicates that the trityl is to be removed and enables this check box in the Trityl Off column of the Import Utility for the sequence To leave a trityl on ON must be entered in Column Synthesizer Window Database Import Utility D 39 D 40 Synthesizer Window Database Import Utility Using the Fume Hood In This Appendix Topics Covered This appendix contains instructions for using the Fume Hood provided with the instrument during calibration or cleaning up a reagent spill The follo
84. he following procedure to change the line assembly NUAN CHEMICAL HAZARD Depending on the line you are changing there may be potentially hazardous chemicals in the line To change the dispense lines Step Action 1 Turn off instrument and wear gloves 2 Unscrew both end of the dispense line assembly Unscrew 3 Unscrew Dispense tip GR1975 Clean the connections on the valve and dispense tip with a lint free tissue using a small amount of acetonitrile Screw the connections on each end of the new assembly firmly onto the dispense tip and the valve Prime the line a Select Instrument Manual Control b Select the valve you just changed from the drop down list c Click Prime and watch the dispense tip for chemical dispensing d Continue to click Prime until fluid flows smoothly from the dispense tip 4 20 Instrument Maintenance Maintaining O Rings Gaskets and Bottle Seals Checking the Check the O Ring as follows Action Check the synthesis chamber O ring P N 4318891 for particulate matter by running a gloved hand along the O ring Ifa white precipitate appears on the O ring clean it off with a cotton tipped swab or lint free laboratory tissue moistened with acetonitrile Ifthe O ring appears to be slightly flattened or is not holding pressure well remove the O ring flip it over and reinsert it into the groove Synthesis Chamb
85. he part number or keyword s in the field on this page Keyword s c You can open and download a PDF using Adobe Acrobat Reader of the document by selecting it or you can choose to have the document sent to you by fax or email By automated telephone Use To Obtain Documents on Demand on page 1 12 service By telephone in the United Dial 1 800 327 3002 then press 1 States By telephone from Canada T order in s Dial 1 800 668 6913 and English Press 1 then 2 then 1 again French Press 2 then 2 then 1 By telephone from any other See the specific region under To Contact Technical Support country by Telephone or Fax under Technical Support 1 4 Introduction Instrument Safety Labels About Waste Profiles About Waste Disposal Before Operating the Instrument For chemicals not manufactured or distributed by Applied Biosystems call the chemical manufacturer Safety labels are located on the instrument Each safety label has three parts Asignal word panel which implies a particular level of observation or action e g CAUTION or WARNING If a safety label encompasses multiple hazards the signal word corresponding to the greatest hazard is used A message panel which explains the hazard and any user action required A safety alert symbol which indicates a potential personal safety hazard See the ABI 3900 DNA Synthesizer Site Pre
86. hosphoramidites A 5 Installing Phosphoramidite Bottles selle A 6 Changmng Reagent Bottles cue cosas MERE HERI TUE LC P hine ee A 7 Introd Cctiono s eb oh GAG ed cet SS ASE RE ie Ed a ees A 7 Guidelines for Handling Reagents 0 0 cee A 7 Procedure BP PIC A 7 B Post Synthesis Processing In Ehis Apperidix iios cece eee Hes Rte Revue er e EXER ERVARq ENG eee es B 1 Topics Covered iae ee pe PER REEL a B 1 Deprotection Procedures ans easar neuse eee ete hm B 2 Introductions Leoni nsiet seb REN oS EEES Ces bles DEDE ORETGe DER NDS sates B 2 Cleavage Deprotect Option 2 ee ak ew ee eR eM Reed B 2 Cleavage Deprotect Option I 2 0 ee eee B 4 Reconstitution Jis erede DECEDERE UB EOD E ose be tak Ee aes B 6 Diluting Reconstituted Oligonucleotides for Quantitation sellus B 6 C Parts List Inc TMs Appendix oec ebptbeeT5iIsentiegeb hee Re ERN PESE EV C 1 LOPICS Covered s LC LEE epu aod bas nC e od he e ARD ERR C 1 3900 DNA Synthesizer Parts List 0 0 00 eee ccc eee eee C 2 3900 High Throughput Columns 0 0 0 0 eee eee ee eee C 2 Chemicals tt hasty ed eo du wt ends a SRA ws teres We eg athe hues C 2 Other Consumables ob ety she bd eaa aria ei RE PHREES C 3 Hardware i ucis len sig E eE Gite tse be tee PRA ex EDS ONERE IAS C 3 D Synthesizer Window Database Import Utility Tne PhS Appendix iee oar m te RI eee nette eres e d e ICE t I ERR SE
87. ication procedure 4 12 verifying valve calibration 4 9 Cap Activator pressure gauge 2 5 Cartridge banks how columns are arranged 2 2 cartridge banks how they are processed 2 2 cascading menus convention 2 12 Chamber gasket maintenance schedule 4 3 Chamber O ring maintenance schedule 4 3 Chamber pressure gauge 2 5 Chamber Pressure test when to perform 4 4 Chemical warnings Index 1 hazard 1 3 waste 1 3 Chemicals list part numbers C 2 Cleavage Deprotect Option procedure B 2 Cleavage Deprotect Option II procedure B 4 Command activation three ways of D 7 D 27 computer use safe and efficient 1 6 customer support 1 8 to 1 12 D Database Import Utility overview D 24 toolbar icons D 26 Deblock Oxidizer pressure gauge 2 5 Delivery lines locations 2 6 Deprotection procedures general information B 2 Dispense lines locations 2 6 Dispense tips locations 2 6 Dissolving phosphoramidites acetonitrile quantities A 5 guidelines A 5 DNA synthesis cycles general definition 2 2 Documentation set 1 2 Documents on Demand 1 12 how to obtain 1 12 Drain holes location 2 8 drain plate details beneath the cartridge 2 8 E e mail address for technical support 1 8 Entering sequence and cycle information knowledge required 3 8 procedure 3 9 Export Bank icon 2 12 F File Formats Excel files D 38 Format of Comma Delimited Text file D 36 Long Format files D 37 Short Format files D 36 Space Delimited T
88. igned copy holder adjustable horizontally and vertically that allows referenced hard copy material to be placed at the same viewing distance as the screen and keyboard Keep wires and cables out of the way of users and passersby Choose a workstation that has a surface large enough for other tasks and that provides sufficient legroom for adequate movement Introduction 1 7 Technical Support Contacting Technical You can contact Applied Biosystems for technical support by telephone or fax by Support e mail or through the Internet You can order Applied Biosystems user documents MSDSs certificates of analysis and other related documents 24 hours a day In addition you can download documents in PDF format from the Applied Biosystems Web site please see the section To Obtain Documents on Demand following the telephone information below To Contact Technical Contact technical support by e mail for help in the following product areas Support by E Mail Product Area E mail address Genetic Analysis DNA Sequencing galab appliedbiosystems com Sequence Detection Systems and PCR pcrlab appliedbiosystems com Protein Sequencing corelab appliedbiosystems com Peptide and DNA Synthesis Biochromatography PerSeptive DNA PNA tsupport appliedbiosystems com and Peptide Synthesis systems CytoFluor FMAT Voyager and Mariner Mass Spectrometers Applied Biosystems MDS Sciex api3 support sciex com Che
89. ill Down Ctrl D Note The first four commands are standard commands common to text processing applications and are not described here The following table is provided as a reference for the Edit menu Project Window Edit Menu Commands Item Description Select All Ctrl A Enabling Selects all of the contents of the current bank of the Synthesis document Always Enabled Synthesizer Window Database Import Utility D 29 Project Window Edit Menu Commands continued Item Description Enabling Fill Down Fills the entry in the first selected Enabled when an entry Ctrl D table cell into all lower cells in this is made in the selected column Limited to one column table cell with each use Can be used in the Oligo ID Sequences and Column ID table columns View Menu The View menu is used to hide show the Project window toolbar and switch between the three Project window views v Bank CubFl Underscored single letters in commands Bank 2 Ctrl F2 are keyboard shortcuts for executing Bank 3 Ctl F3 commands Bank4 Ctl F4 The following table is provided as a reference for the View menu Project Window View Commands Item Description Enabling Bank 1 Switches to Bank 1 of the Always enabled Ctrl F1 Synthesis document from other banks Bank 2 Switches to Bank 2 of the Always enabled Ctrl F2 Synthesis document from other ban
90. incoln Centre Drive Foster City California 94404 1128 USA P N 4316015 Rev A2
91. ing the necessary maintenance procedure schedule will help Ensure proper instrument operation Prevent service calls Prevent instrument downtime Prevent reagent wastage Required The maintenance schedule required for the 3900 instrument is listed in the table Maintenance Items below Maintenance Items or Tasks Perform Perform at First Perform Instrument Part at Each Run of Perform Perform Every See or Test Run the Day Weekly Monthly 6 Months Perform as Needed Page Amidite O rings Examine Inspectand Replace If pressure test s or 4 21 P N 221014 clean inspections show a leak 4 L Cap Assembly Inspect and Examine with every 4 21 Gasket replace as bottle change P N 004498 needed Gaskets Kalrez Kalrez gaskets are not renewable with each Replace 4 21 bottle change since they have a service lifetime Ee Te for of 6 months to 1 year 450 mL bottles P N004297 for 2 L TCA bottle Chamber Gasket If cartridge is Inspect Inspect and Examine whenever 4 21 P N 4318893 removed to insert or and replace as cartridge is removed remove columns replace needed examine at each as Note Remove columns removal needed before removing cartridge Weekly or monthly inspections apply when cartridge is not routinely removed Replace as needed Chamber O ring Examine Replace as needed 4 21 P N 4318891 30 Valve Perform Perform Before first run of the day 4 10 Calib
92. intenance Log 0 0 ee e 4 5 Pressure Tests oos op she ah des vhi e WC ae Soar eames nash Seabed 4 6 Introduction Lco be ae aol HP Pere Shs gas ok Soe ees 4 6 Testing Chamber Pressure 4 6 Calibrating Valves tesserae Nee ed deem e RE ee rie Aere 4 7 About Calibrating Valves lsleeeeeeeeeee eee nee 4 7 When to Calibrate Valves 2 sez ex dh eb RUE PA 4 7 Calibrating Valves By Weight of Reagent Dispensed 004 4 7 Verilying Home Position sk nue GE IRR Reet Rtas Pon d Ri OE Rs 4 0 Procedure eod ba OPES IE ee eat 4 0 Verifying Valve Calibration 0 0 0 ee ccc e 4 10 About Verifying Calibration sso 00 0 eee ee eee 4 10 Schedule for Verifying Valve Calibration 0 0 0 eee eee eee eee 4 10 30 Valve Calibration Verification 0 0 eee ects 4 10 Single Valve Calibration Verification 0 0 2 eee eee eee eee 4 12 Replacing Valves sirit echt bt Lb RUN GURE IMP PERENNE erede Pe PE edes 4 13 Valve Part NUMBER soe 003 5 ecact node pmi ew IEbRG deka sd D eve IET PRREROLD 4 13 About Valves zi vcre ET Brat e testen tens 4 13 Valve Graphic 005 o ee eee ACER MAL EV que Er Se Ra 4 13 Valve Numbermng eR C es PEDE S MIB A ee tae beetles 4 14 Valve Bottle Position Map lleeeeeeeeeee ee ete eee 4 15 Removing Malfunctioning Valves 0 0 0 cece cece nets 4 16 Removing Non Functional Valves 0 cece eee een eh 4 17 Installing New Valves isset e
93. ion 2 10 components on the front 2 5 front and left side views 2 4 overview 2 2 top view 2 6 3900 software and Database Import Utility windows differences D 4 3900 Synthesizer window Edit menu D 9 File menu D 7 Help menu D 14 Instrument menu D 13 introduction D 5 main menu and toolbar D 5 View menu D 10 3900 Synthesizer Window commands command activation and special terms D 7 introduction D 7 3900 system components 2 3 how it works 2 2 types of chemistry supported 2 2 4 L Cap Assembly Gasket maintenance schedule 4 3 5 6 7 8 9 0 bottle positions 2 5 A A G C T bottle positions 2 5 A G C T storage conditions A 4 ABI 3900 DNA Synthesizer order of events during a run 3 2 types of information entered by software interface 2 11 Acetic Anhydride Pyridine Tetrahydrofuran storage conditions A 4 Acetic anhydride pyridine THF bottle position 2 4 Acetonitrile storage conditions A 4 ACN wash lines location 2 6 Amidite O rings maintenance schedule 4 3 Amidite Summary icon 2 12 Amidite ACN pressure gauge 2 5 Archived Log Viewer D 10 argon tank procedure for changing A 2 B Before each run procedure for setup 3 5 bold font convention 2 12 Bottle positions front details 2 5 Bottle release buttons location 2 5 C Calibrating valves by weight 4 7 calibration 30 valve verification procedure 4 10 procedure for calibrating valves by reagent delivery 4 7 schedule for valve calibration 4 3 single valve verif
94. ion Ratio ODU Per for Standard Scale Reconstituted Oligo DI water Base 20 mer 40 nmol 1 10 0 25 5 200 nmol 1 50 1 0 20 1 umol 1 200 5 0 100 B 6 Post Synthesis Processing Parts List In This Appendix Topics Covered This appendix contains lists of parts and chemicals needed to operate and maintain the 3900 instrument Topic See Page 3900 DNA Synthesizer Parts List C 2 3900 High Throughput Columns C 2 Chemicals C 2 Other Consumables C 3 Hardware C 3 Parts List C 1 3900 DNA Synthesizer Parts List 3900 High Throughput Columns Chemicals C 2 Parts List High Throughput Columns List Item Pkg Size P N 40 nmol columns dAbz 200 4316671 dGemf 200 4316673 dCbz 200 4316672 T 200 4316674 0 2 umol columns dAbz 200 4316675 dGdmf 200 4316677 dCbz 200 4316676 T 200 4316678 1 umol columns dAbz 200 4316679 dGemf 200 4316681 dCbz 200 4316680 T 200 4316682 Chemicals List Item Pkg Size P N Phosphoramidites dAbz 2g 401159 dGemf 2g 401165 dCbz 2g 401160 T 2g 401162 Reagents Tetrazole Acetonitrile 450 mL 401173 Acetic anhydride pyridine THF 450 mL 402220 1 Methylimidazole THF 450 mL 401175 0 02 M lodine water pyridine THF 450 mL 401632 Trichloroacetic acid DCM 2L 401272 Acetonitrile 4L 401087 Other Consumables Other Con
95. is a flammable liquid and vapor that may cause eye skin and respiratory tract irritation central nervous system depression and damage to the heart liver and kidneys Please read the MSDS and follow the handling instructions Wear appropriate protective eyewear clothing and gloves Use anhydrous acetonitrile with less than 100 ppm water After opening acetonitrile keep it blanketed with argon to avoid contamination with alr When transferring acetonitrile to a phosphoramidite bottle use a clean dry glass syringe with a needle The syringe should be dedicated to acetonitrile transfer Dry the syringe in a 100 to 120 C oven Store the syringe in a 100 to 120 C oven to prevent atmospheric moisture contamination Cool down in a dissicator to room temperature before using Rinse the syringe with acetonitrile Do not use water Do not allow the syringe needle to contact the phosphoramidites as this will contaminate other phosphoramidite bottles Shake bottle well until no crystals are visable on the bottom Quantities of When preparing 05 M phosphoramidites add the correct amount of acetonitrile to Acetonitrile for Dissolving Phosphoramidites each phosphoramidite as shown in the table below Weight g Add either P N Phosphoramidite ACN mL ACN g 401159 dAbz 2 0 44 8 35 2 401165 dGemf 2 0 46 2 36 3 401160 dC5z 2 0 47 2 37 1 401162 T 2 0 52 8 41 5 Setup T
96. is chapter provides procedures for performing the various tasks required to synthesize DNA on the ABI 3900 High Throughput DNA Synthesizer Topic See Page Overview of DNA Synthesis Events 3 2 Run Events Chart Step 1 3 2 Setup Task Lists 3 3 Which Task List to Perform 3 3 Setup Tasks First Run of the Day 3 3 Setup Tasks Before Each Run 3 5 Setup Tasks After Long Term Shutdown 3 7 Entering Sequence and Cycle Information into Software 3 8 Run Events Chart Step 2 3 8 Overview 3 8 Guidelines for Using Columns and Banks 3 8 Synthesis Window 3 9 Synthesis Window Details 3 9 About Entering Sequence and Cycle Information 3 10 Verifying Reagent Supply and Bottle Positions and Loading Columns 3 13 Run Events Chart Step 3 3 13 Verifying Reagents Supply and Bottle Positions 3 14 Loading Columns 3 15 Perform Setup Tasks for the Next run or Shut Down Procedure 3 17 Run Events Chart Step 4 3 17 High Throughput Production 3 17 To Leave Instrument Idle 3 17 Short Term Shutdown 3 18 Long Term Shutdown 3 18 Performing DNA Synthesis 3 1 Overview of DNA Synthesis Events Run Events Chart A run refers to complete simultaneous synthesis of up to 48 oligonucleotide Step 1 sequences The chart below shows the order of events required for an ABI 3900 DNA Synthesizer run Perform the Setup Tasks to Y h prepare the instrument Sate nare Y Enter sequences
97. ited txt Notepad OF Xx File Edit Search Help OLIGO1 TCTAGTTACAGATTAGGCTTA ON OLIGO2 TCTTGTTTGTGTGGETGTCCAGAGATCT OLIGO3 TCTATACTCATA en IGO4 TATATATTAATAACGCET ON Like the space delimited text file this type of text file appears very similar to the tab delimited except that commas are used to organize information rather than tabbed columns The contents of each field are mapped the same as described for the tab delimited text file on page D 36 Short Format Files The short format text file is shown below B IMO Short format txt Notepad Ioj Xx File Edit Search Help SYNTHHOSFORMAT 41128 48 A1 AACTCTCTCCCAAGAGCGAAAGTCACACAGCA 41128 56 A1 AACTCTCTCCCAAGAGCGATCTGCCACTCCCT 41128 55 A1 AACTCTCTCCCAAGAGCGACCAAAGTCACACAGCA 41128 66 A1 AACTCTCTCCCAAGAGCGATCCTCTGCCACTCCCT 41141 48 A1 AACTCTCTCCCAAGAGCGACTCACATGAAAATCAT 41141 56 A1 AACTCTCTCCCAAGAGCGATCCAAACTCTAGAATCA 41141 55 A1 AACTCTCTCCCAAGAGCGACAT TCCAAACTCTAGAATCA 41141 66 A1 AACTCTCTCCCAAGAGCEACAT TAAGCTCACATGAAAATCAT Note The name SYNTHMOSFORMAT is essential on the first line to identify a file as a short format file In this type of text file instead of being presented on a single line like the tab space and comma delimited text files information for each sequence is presented on two lines Importing this type of file results in all boxes in the Trityl Off column being checked by default Synthesizer Window Database Import Utility D 37 Whe
98. k dialog box uses bnk extension files Enabled when the instrument is not running Print Ctrl P Displays the Print dialog box The standard Print Setup dialog is opened from the Print dialog Always enabled Exit Exits the Program Displays Save alert dialog if document has pending changes If instrument is running displays alert Exit the program This will stop the instrument which will impact the synthesis Noj Yes Always enabled a Except when standard Windows functions or instrument function prevents access such as when a modal dialog box is displayed or when an instrument is running D 8 Synthesizer Window Database Import Utility Edit Menu The commands in the Edit menu are used to manage the contents of the Project window by performing standard actions like undo delete select etc and by enabling access to settings for Preferences Edit Cut Copy Paste Delete Ctrl Ctrl C Ctre commands Select All Ctri Fill Down Ctrl D Note The first four commands are standard commands common to text processing applications and are not described here Underscored single letters in commands are keyboard shortcuts for executing The following table is provided as a reference for the Edit menu Synthesizer Window Edit Menu Commands Item Description Enabling Select All Ctrl A Selects all of the contents of the current bank of
99. ks Bank 3 Switches to Bank3 of the Always enabled Ctrl F3 Synthesis document from other banks Bank 4 Switches to Bank 4 of the Always enabled Ctrl F4 Synthesis document from other banks D 30 Synthesizer Window Database Import Utility Database Import The Database Import menu is used to import specified text files into the Database Ment inport Wali Jatabase Import Import Prepfile into Column Import Multiple Order Short Format Import Multiple Order Long Format Underscored single letters in commands are keyboard shortcuts for executing Import Space Delimited commands Import Comma Delimited Import T ab Delimited Import Excel Substitute String E ditor Note The file types listed in this menu are described in File Formats on page D 36 Database Import Commands Item Description Enabling Import Prepfile into Column This is an ABI in house format not intended for customers Import Multiple Order Short Format Opens the Import M O Short Always enabled Format dialog box allowing choice of this file type Import Multiple Order Long Format Opens the Import M O Long Always enabled Format dialog box allowing choice of this file type Import Space Delimited Opens the Import Space Always enabled Delimited File dialog box allowing choice of this file type Import Comma Delimited Opens the Import Comma Always enabled Delimited Fil
100. le IMPORTANT The exception to the above point is if 1 umol scale columns are being used tandem banks must be dedicated to this scale To use 1 umol scale columns either Banks 1 and 2 or Banks 3 and 4 must be loaded with 1 umol scale columns The columns within any one bank are processed with the same customer defined cycle The cycle dictates the scale of production and the steps used to synthesize that bank of oligonucleotides Note The cycle must be appropriate for the scale of columns loaded in that bank Abank may only be completely filled with other columns of the same scale during a run If a bank contains any columns all 12 positions must be filled Positions in which no DNA will be synthesized must contain a placeholder column of the same scale Placeholders should be plug columns 3 8 Performing DNA Synthesis Two banks are processed in parallel by the instrument Banks 1 and 2 are processed together followed by Banks 3 and 4 together If only 2 banks will be used in a run it is most efficient to use Banks 1 and 2 Synthesis Window The 3900 software opens to the Synthesis window upon launching You will use this window to Enter all oligonucleotide sequences in caps and cycle information Monitor the instrument during a run Access other windows and dialog boxes Synthesis Window The components of the Synthesis window are shown on the graphic below Details 3900 DNA Synthesizer 0 51 beta 7
101. llow to cool to room temperature Place them in a freezer at 15 to 20 C for 10 minutes if necessary NUNNA CHEMICAL HAZARD Warm ammonium hydroxide will spatter if the vials are opened while they are still warm b Once the vials are cool to the touch remove the caps B 4 Post Synthesis Processing To perform cleavage deprotection by Option Il continued Step Action 6 Remove the caps from the vials then place the vials back into the rotary evaporator 7 Spin until almost dry about 45 minutes at 65 C with the vacuum ON 8 Use clean tweezers to remove the columns from the vials Since there is very little liquid in the vials the tweezers will not cross contaminate the samples 9 The samples can be put back into the rotary evaporator for about 0 5 hour to complete the drying process if dried oligonucleotide is required 10 If you want to Then Reconstitute the oligonucleotide Add 1 mL of DI water to each vial within the vials Quantitate the oligonucleotide a Add 1 mL of DI water to each within the vials vial b Use the chart Diluting Reconstituted Oligonucleotides for Quantitation on page B 6 Post Synthesis Processing B 5 Reconstitution Diluting Use the table below to determine the dilution for quantifying the oligonucleotides via Reconstituted Standard spectrophotometry Oligonucleotides for Quantitation Expected Expected ODU Dilut
102. m a bnk file created in 3900 software or the Import Utility File gt Export Bank Allows you to save an entire bank of sequences and cycles from the Import Utility as a bnk file Instrument Status Displays the status of the synthesis Instrument Instrument Log Displays the Synthesis Log window Instrument Waste Report Displays the Waste Report window Tools Amidite Summary Displays the Amidite Summary window Instrument Prime Initiates the instrument priming process displaying the priming alert dialog box Instrument Start Starts the instrument to perform DNA synthesis or resumes a paused synthesis Instrument Pause Pauses the instrument Allows the synthesis to resume from the pause point Instrument Stop Stops the synthesis Synthesizer Window Database Import Utility D 5 The Synthesizer The 3900 Synthesizer window has tabs for four panes Each tab provides the Window capability to set up sequences for a single bank of a Synthesizer file for use in the instrument Except for Disable and Column ID the individual table columns listed below are mapped to individual text file input as described under File Formats on page D 36 Trityl Off checked position Oligo ID Bases Sequence Note The Disable column check box provides the capability of disabling a particular sequence after entry into the Import
103. miluminescence Tropix tropix appliedbiosystems com Hours for Telephone n the United States and Canada technical support is available at the following times Technical Support Product Hours Chemiluminescence 8 30 a m to 5 30 p m Eastern Time Framingham support 8 00 a m to 6 00 p m Eastern Time All Other Products 5 30 a m to 5 00 p m Pacific Time To Contact Technical In North America Support by T5 contact Applied Biosystems Technical Support use the telephone or fax numbers Telephone or Fax given below To open a service call for other support needs or in case of an emergency dial 1 800 831 6844 and press 1 Product or Telephone Fax Product Area Dial Dial ABI PRISM 3700 DNA Analyzer 1 800 831 6844 1 650 638 5981 then press 8 DNA Synthesis 1 800 831 6844 1 650 638 5981 then press 21 Fluorescent DNA Sequencing 1 800 831 6844 1 650 638 5981 then press 22 Fluorescent Fragment Analysis includes 1 800 831 6844 1 650 638 5981 GeneScan applications then press 23 Integrated Thermal Cyclers ABI PRISM9 1 800 831 6844 1 650 638 5981 877 and Catalyst 800 instruments then press 24 1 8 Introduction Product or Product Area Telephone Dial Fax Dial ABI PRISM 3100 Genetic Analyzer 1 800 831 6844 then press 26 1 650 638 5981 Biolnformatics includes BioLIMS BioMerge and SQL GT applications 1
104. mited Text File 0 cece eee nen D 37 Short Format Files 6 Sade fad mes grees Cae alates DERG AAR ate UR OE LES D 37 Long Format Files 3 8 0shoe giackg phase ete ee iba aaa aids D 38 Excel Pues sic en TORRENS ot e dau en ERE PORN D 39 E Using the Fume Hood In This Appendix 54e bn REPRE PRSE Ee REC Mentre a PL E e SERI E 1 Topics C vered kisesi iweb tek ner ee akere nti aii ee TUE EM SR eb epos E 1 Assembling and Using the Fume Hood 0 0 0 eee eee eee E 2 lainaa S LETCA DTS a e327 ag bs het neste ease abate a eed Satie lane NUS UEM EE eU bane E 2 Unfolding and Assembling the Fume Hood 0 0 0 cee eee eee E 2 Inserting and Using the Fume Hood 0 eee eee E 3 Index Introduction Overview About This Chapter This chapter provides an overview of the ABI 3900 High Throughput DNA Synthesizer documentation safety considerations and technical support resources available Topic See Page ABI 3900 DNA Synthesizer Documentation 1 2 Background Needed 1 2 About the Documentation Set 1 2 Safety 1 3 Documentation User Attention Words 1 3 Chemical Hazard Warning 1 3 Chemical Waste Hazard Warning 1 3 Site Preparation and Safety Guide 1 4 About MSDSs 1 4 Ordering MSDSs 1 4 Instrument Safety Labels 1 5 About Waste Profiles 1 5 About Waste Disposal 1 5 Before Operating the Instrument 1 5 Safe and Efficient Computer U
105. mpty bottle 4 Clear the delivery and dispense lines of reagent a Select Instrument Manual Control b Select the correct valve number from the drop down list c Click Prime 3 times or until you have constant flow Then watch the dispense tip until no more reagent is dispensed 5 Turn the 3900 instrument OFF and then unplug the power cord for the instrument 6 Detach the electrical connection from the valve to be replaced To solenoid Pul gt To instrument 7 Unscrew both the delivery line and dispense line connections to the valve VNDE There may be some residual chemicals in the tubing of the valves you are replacing Wear appropriate protective gloves and clothing Valve under valve rack 2 BA us Delivery line SONS Dispense line from bottle Hl to dispense tips SU dd Unscrew amp 9 Unscrew GR1973 4 16 Instrument Maintenance To remove malfunctioning valves continued Step Action 8 Unscrew the two screws holding the valve onto the valve rack and the valve will release Removing Non functional valves will not allow you to purge chemicals from the delivery line prior Non Functional to valve removal so a different procedure is required to remove them Valves ROUEN CHEMICAL HAZARD Be aware that there will be potentially hazardous chemicals in the line that can leak out during this procedure and take appropriate precautions
106. n diameter 3 in diameter 4 in diameter Determine the proper size for the exhaust duct used in your laboratory and remove the perforated circle corresponding to your exhaust duct diameter For example remove the 2 in circle for this size of duct E 2 Usingthe Fume Hood Inserting and Using The fume hood is now ready for insertion under the top cover the Pume Hood To insert and use the fume hood Step Action 1 Lift the top cover of the instrument to its upper position 2 Insert the fume hood with the two triangular sections pointing to the rear and the exhaust opening oriented to the right The instrument with the fume hood installed should appear as shown below 3 Connect the duct from your laboratory exhaust system to the opening you prepared on the right side 4 Turn on the laboratory exhaust system and continue with calibration or spill cleanup Using the Fume Hood E 3 Index Numerics 0 02 M lodine water pyridine THF bottle position 2 4 1 Methylimidazole Tetrahydrofuran storage conditions A 4 1 Methylimidazole Tetrahydrofuran THF bottle position 2 4 30 Valve Calibration Verification when to perform 4 3 30 valve verification procedure schedule for verification 4 10 3900 High Throughput Columns part numbers C 2 3900 instrument back view 2 9 beneath the valve rack cover 2 6 Bottle positions 2 4 column color coding 2 10 column descript
107. n positions 48 positions in all Prime waste position Small metal tube that collects fluid when lines are primed and delivers fluid to waste Cartridge retaining ring Holds the cartridge firmly against the drain plate when screwed down Cartridge lock screws Locks the retaining ring into place Tour of the Instrument 2 7 Beneath the The details of the drain plate beneath the cartridge are shown here Cartridge Prime Waste Position Optical eye Homing screw Waste trough bank 2 Drain hole bank 2 Threaded hole GR1937 Component Function Optical Eye and Homing screw The optical eye senses the screw on the edge of the cartridge to establish the cartridge home position Waste trough Collects the waste fluid from each bank of columns Drain holes Pathway for waste to exit the waste trough Prime waste position Small metal tube that collects fluid when lines are primed and delivers fluid to waste Threaded holes Accept cartridge retaining ring locking screws Seating pin non threaded holes Accept seating pins from cartridge retaining ring 2 8 Tour of the Instrument Back View o Argon input Motor control Power ACN Serial port GR1922 Waste lines
108. n the text file on the facing page is compared with the imported version shown on page D 34 it has the following characteristics Line 1 of the two lines for each sequence is mapped into the column labeled Oligo ID in the Import Utility Line 2 of the two lines for each sequence is mapped into the column labeled labeled Sequence Note The short file format only provides the two lines described above If you want to specify that trityls are to be left on use one of the delimited type files or use the long format file described in the next section Long Format Files The long format text file is shown below Ai IMO Long format txt Notepad Imi xi File Edit Search Help SYNTHMOLFORMAT Happy Smilin User class 33mer 7 You look mahuelous dahling TGACCATTAGATCAAGCTTGTATCTTTCTCAGG Happy Smilin User class 33mer 11 TGA CCA TTA GAT CAA GCT TGT ATC TTT CTC AGG User class 33mer 12 TGA CCA TTA GAT CAA GCT TGT ATC TTT CTC AGG Note The name SYNTHMOLFORMAT is essential on the first line to identify a file as a long format file The above text file provides three examples separated by blank lines As is shown in the third example above in this type of file only the information in the SEQ NAME and SEQ_TEXT files is essential for the Import Utility The third line shown in the first example above is optional If the DMT line is not present or has a blank in the second column the trityls will be removed To request t
109. n use and attach it firmly to the wall or gas cylinder cart with approved brackets or chains A 2 Setup Tasks To change the argon tank Step Action 1 Turn the 3900 instrument off 2 Close the tank valve The chamber pressure gauge will read 0 psi when the tank valve is properly turned off Disconnect the regulator from the tank Cap the empty tank Remove the cap from the full tank For maximum gas lifetime wrap the threads with Teflon tape Attach the full tank to the regulator both customer supplied OINI o0 01 C0 When the regulator is tightly attached to the tank turn the regulator knob counterclockwise To change the argon tank continued Step Action 9 Open the tank valve 10 Turn the regulator knob clockwise until the inlet pressure gauge reads approximately 60 80 psi Setup Tasks A 3 Storing Phosphoramidites Reagents and Dyes Introduction This section gives guidelines for storing chemicals and lists the storage conditions recommended expected shelf life and expected lifetime of each chemical used on the 3900 instrument Please follow the storage recommendations and change reagent bottles when they have reached their expected lifetime Improper storage of chemicals can impair product quality and can compromise reagent bottle integrity when pressurized under normal instrument operation Storage Conditions IMPO
110. needed basis see maintenance Kalrez Gaskets Schedule on page 4 3 Kalrez gaskets have a lifetime of 6 months to 1 year and are replaced at 6 month intervals To replace EPR and Kalrez gaskets part numbers listed below Pull the old gasket out and put the new gasket in its place Make sure the new gasket lies flat in the cap assembly P N Description 004498 EPR gasket acetonitrile bottle 4 L 004297 Kalrez gasket trichloroacetic acid bottle 2 L 1212 Kalrez gasket 450 mL 4 22 Instrument Maintenance Setup Tasks In This Appendix Topics Covered This appendix contains detailed instructions for the setup tasks summarized in Chapter 4 Performing DNA Synthesis The following topics are covered in this appendix Topic See Page Preparing the Instrument A 2 Emptying Waste Containers A 2 Changing the Argon Tank A 2 Storing Phosphoramidites Reagents and Dyes A 4 Introduction A 4 Storage Conditions A 4 Preparing and Installing Phosphoramidites and Dye Amidites A 5 Introduction to Phosphoramidites A 5 Guidelines for Dissolving Phosphoramidites A 5 Quantities of Acetonitrile for Dissolving Phosphoramidites A 5 Installing Phosphoramidite Bottles A 6 Changing Reagent Bottles A 7 Introduction A 7 Guidelines for Handling Reagents A 7 Procedure A 7 Setup Tasks A 1 Preparing the Instrument Emptying Waste Check the level of the w
111. ns SteP 1 2 IMPORTANT The positions of the bottles on the instrument must be consistent with the valve configuration recorded in the software To verify the bottle positions a Choose Instrument gt Valve Configuration b Check the positions of the reagents and amidites on your instrument against the map shown on the Valve Configuration window Note Applied Biosystems recommends using the default settings to optimize instrument performance Positions 5 6 7 8 9 and 0 can be customized according to the needs of your laboratory To restore the settings from the original installation of the instrument click Default Settings Valve Configuration pg nu Ut Reagerit DEBLOCK OXIDIZER CAPA CAPB ACN DEBLOCK OXIDIZER CAPA CAPB ACN ACTIVATOR ACT Wash2 22 G 23 24 t 27 8 28 3 28 0 30 b Default Settings f Cancel 3 14 Performing DNA Synthesis Loading Columns To load columns Step Action 1 Choose the columns to load into each bank of the cartridge The scale of column to use depends on the cycle you loaded into that bank The type color of column to use is determined by the 3 base of each sequence and is shown by the column color code in the Synthesis window for that bank 3 base of sequence Use column color A dAbz Green G dGamt Yellow C dC Red T Blue Load the columns
112. nt order The 3900 software window has the Cycle field which is used to select a cycle for synthesis Note For both 3900 software and Database Import Utility windows four different views are presented for Banks 1 through 4 allowing discrete input for each bank D 4 Synthesizer Window Database Import Utility 3900 Synthesizer Window Overview Introduction This section provides general information on the 3900 Synthesizer window as well as detailed descriptions of menus toolbar icons and other interface elements Main Menu and Toolbar The elements that are unique to the 3900 Synthesizer software main menu and toolbar are shown and explained in the graphic and table which follow For information on menu and toolbar items that are common to most word processing programs New Open Save Cut Copy Paste Delete Print consult a word processing user s guide File Edit View Tools Instrument Help Dam le sleek S anim al 3 gt mE Note The last term in the second column below is the Toolbar Icon label Icon Toolbar Menu Alternative Tool Bar Icon Label Function ow m File gt Import Column Allows you to enter a single sequence from a seq file created in 3900 software or the Import Utility i File gt Export Column Allows you to save a single sequence as a seq file iz File gt Import Bank Allows you to enter an entire bank of sequences and cycles fro
113. on on using the utility 5 Identify the oligonucleotide and the column if required by your laboratory by filling in the Oligo ID and Column ID fields Note You can fill any number of sequential rows with identical input by Highlighting clicking and dragging over the text to be copied at the top of the vertical group of fields to be filled Selecting Edit gt Fill Down Performing DNA Synthesis 3 11 To enter sequence and cycle information continued Step Action 6 In the Trityl Off column a check in the row of a sequence means that the trityl will be removed from that oligonucleotide A clear check box means that the trityl will be left on that oligonucleotide If you need the trityls either on or off the entire bank of sequences use the Trityl Off check box at the top of the column Choose the cycle appropriate for the current bank To do this a Be sure the appropriate Bank tab is selected b Click Browse c In the Open Cycle navigation window select the cycle program xls for the current bank The cycle provided by Applied Biosystems is at Look in Ey 3900 Software Version 0 51 M fes ek E seit 39005 ystem 3900WasteReports Femme Files of type Cycle Files xls m Cancel Open as read only d Highlight the appropriate file click Open and the program will load into the Cycle field of the current bank Note Be sure that the cycle chosen is appropriate for th
114. ort should be provided to maintain the proper concave curve of the spine Place the keyboard on a surface that provides The proper height to position the forearms horizontally and upper arms vertically Support for the forearms and hands to avoid muscle fatigue in the upper arms Position the viewing screen to the height that allows normal body and head posture This height depends upon the physical proportions of the user Adjust vision factors to optimize comfort and efficiency by Adjusting screen variables such as brightness contrast and color to suit personal preferences and ambient lighting Positioning the screen to minimize reflections from ambient light sources Positioning the screen at a distance that takes into account user variables such as nearsightedness farsightedness astigmatism and the effects of corrective lenses When considering the user s distance from the screen the following are useful guidelines The distance from the user s eyes to the viewing screen should be approximately the same as the distance from the user s eyes to the keyboard For most people the reading distance that is the most comfortable is approximately 20 inches The workstation surface should have a minimum depth of 36 inches to accommodate distance adjustment Adjust the screen angle to minimize reflection and glare and avoid highly reflective surfaces for the workstation Use a well des
115. paration and Safety Guide for an explanation of all the safety alert symbols provided in several languages A waste profile was provided with this instrument and is contained in the AB 3900 DNA Synthesizer Site Preparation and Safety Guide Waste profiles list the percentage compositions of the reagents within the waste stream during a typical user application although this application may not be used in your laboratory The profile assists users in planning for instrument waste handling and disposal Read the waste profile and all applicable MSDSs before handling or disposing of waste IMPORTANT Waste profiles are not a substitute for MSDS information As the generator of potentially hazardous waste it is your responsibility to perform the actions listed below Characterize by analysis if necessary the waste generated by the particular applications reagents and substrates used in your laboratory Ensure the health and safety of all personnel in your laboratory Ensure that the instrument waste is stored transferred transported and disposed of according to all local state provincial or national regulations Note Radioactive or biohazardous materials may require special handling and disposal limitations may apply Ensure that everyone involved with the operation of the instrument has Received instruction in general safety practices for laboratories Received instruction in specific safety practices for the instrument
116. peaking and West Asia Fairlands South Africa 27 11 478 0411 27 11 478 0349 Africa French Speaking Courtaboeuf Cedex France 33 1 69 59 85 11 33 1 69 59 85 00 South Africa Johannesburg 27 11 478 0411 27 11 478 0349 Middle Eastern Countries and North Africa Monza Italia 39 0 39 8389 481 39 0 39 8389 493 Introduction 1 9 1 10 Introduction Region Telephone Dial Fax Dial Eastern Asia China Oceania Australia Scoresby Victoria 61 3 9730 8600 61 3 9730 8799 China Beijing 86 10 64106608 or 86 10 64106617 86 800 8100497 Hong Kong 852 2756 6928 852 2756 6968 India New Delhi 91 11 653 3743 3744 91 11 653 3138 Korea Seoul 82 2 593 6470 6471 82 2 593 6472 Malaysia Petaling Jaya 60 3 758 8268 60 3 754 9043 Singapore 65 896 2168 65 896 2147 Taiwan Taipei Hsien 886 2 2358 2838 886 2 2358 2839 Thailand Bangkok 66 2 719 6405 66 2 319 9788 Europe Austria Wien 43 0 1 867 35 750 43 0 1 867 35 75 11 Belgium 32 0 2 532 4484 32 0 2 582 1886 Czech Republic and Slovakia Praha 420 2 35365189 420 2 35364314 Denmark Naerum 45 45 58 60 00 45 45 58 60 01 Finland Espoo 358 0 9 251 24 250 358 0 9 251 24 243 France Paris 33 0 1 69 59 85 85 33 0 1 69 59 85 00 Germany Weiterstadt 49 0 6150 101 0 49 0 6150 101 101 Hungary Budapest 36 0 1 270 8398 36 0
117. pproximate contents of the IE waste bottle Tools gt Amidite Summary Summarizes the numbers of each type of column that will be required for the run and the volume of reagents needed for synthesis 2 12 Tour of the Instrument Main Menu and Toolbar continued Instrument gt Prime Dispenses reagents through all of the lines Instrument gt Start Begins the run SI ix ul Instrument Pause This command executed from the toolbar icon or from the Instrument menu suspends instrument operation at one of the safe points listed below It may take up to 5 minutes for the instrument to pause and the icon command will change to Resume Select Resume to continue the run Suspends the run at the following safe points Initiating a pause during pre wash the instrument pauses at the end of the pre wash Initiating a pause during synthesis before coupling the instrument pauses at the coupling step Initiating a pause after coupling is in progress the instrument pauses at the end of base addition Initiating a pause during post synthesis the instrument pauses at the end of the post synthesis Instrument gt Stop Immediately stops the run and closes the software The run cannot be resumed This button should be used only in emergencies A warning box will appear Tour of the Instrument 2 13 Performing DNA Synthesis Overview About This Chapter Th
118. priate personal protective equipment when handling chemicals e g safety glasses gloves or protective clothing For additional safety guidelines consult the MSDS Do not leave chemical containers open Use only with adequate ventilation Check regularly for chemical leaks or spills If a leak or spill occurs follow the manufacturer s cleanup procedures as recommended on the MSDS Comply with all local state provincial or national laws and regulations related to chemical storage handling and disposal VN be CHEMICAL WASTE HAZARD Wastes produced by Applied Biosystems instruments are potentially hazardous and can cause injury illness or death Readand understand the material safety data sheets MSDSs provided by the manufacturers of the chemicals in the waste container before you store handle or dispose of chemical waste Handle chemical wastes in a fume hood Minimize contact with and inhalation of chemical waste Wear appropriate personal protective equipment when handling chemicals e g safety glasses gloves or protective clothing After emptying the waste container seal it with the cap provided Dispose of the contents of the waste tray and waste bottle in accordance with good laboratory practices and local state provincial or national environmental and health regulations Introduction 1 3 Site Preparation and A site preparation and safety guide is a separate document sent to all customers who Safe
119. quences are described under File Formats on page D 36 These files have the seq extension Overview of File Use Sequence text files Bank files and Synthesizer files are generally used as follows Stage Task 1 Sequence information is entered into the appropriate file format described under File Formats Sequences must be entered using all caps Sequence files are imported into the Import Utility After sequence entry into one or more banks of a Synthesizer file with possible editing in the Import Utility the contents of the Synthesizer file can be output as follows Complete Synthesizer files with up to four banks using the Save or Save As commands Bank files containing the information for one of the four banks using the Export Bank command or toolbar button Individual sequence files files with seq extension using the Export Column toolbar button 4 Once Synthesizer Bank and Sequence files are created from the Import Utility these files can be input again into the Import Utility as follows Use the Open command to input existing Synthesizer files Use the Import Bank command or toolbar button to input existing Bank files Use the Import Column toolbar button to input existing Sequence files Synthesizer Window Database Import Utility D 33 Importing Text Files To import the sequence in a text file into the Import Utility Step Action 1 Select
120. r 0 0 ccc eect n 2 6 Synthesis Chamber pensers sitesine sient Ede Ee DER GR Ree EVADTUET ED ER 2 7 Beneath the Cartridges coc ces ule UG kx Rh ERR ae HERR 2 8 Back VIEW socau oaren natu mu tes qud un dq cat oma 2 9 3900 Instrument Columns sss enoras ea A ehe 2 10 About Col mns ilex d be le RR nU Reds PT 2 10 Color Coding of Columns 0 0c cee eee 2 10 About the Software 05 224 Mest acids en co hates Aa ed Lace eRe hea ee 2 11 OverVleWc cce Bites eis eee ie de ee EP M ae 2 11 Passwords and Levels of Access llle een eens 2 11 Types of Files Used iussu Re ere eRE Peale Sere DM RU ERE 2 11 Conventions Used for Software Procedures 0 00 llle 2 12 Main Menu and Toolbar 0 0 0 0 cc teen eee eens 2 12 3 Performing DNA Synthesis OVEIVIEW 35554 Edad eu ER pbRUIIS SL PAL eee See eS Peto ER CLER 3 1 About This Chapters vor soe es sas CES IPIE RR e in DEUS 3 1 Overview of DNA Synthesis Events llle 3 2 Run Events Chart Step To cee ioei meme pied oe dane pees IRE 3 2 Setup Task Liastsien 28 as sha heh Ce kd eee Se Ee hades qum pd creare CRA 3 3 Which Task List to Perform 0 0 0 eee eee eens 3 3 Setup Tasks First Runiof the Day ioco oot eas ar eee UE ERE Ne 3 3 Setup Tasks Before Each Run 2 0 eee eee ee 3 5 Setup Tasks After Long Term Shutdown 0 0 00 0 0 e eee eee eee eee 3 7 Entering Sequence and Cycle Information into Software 00 00 0
121. ration Verification Valve Calibration Only when 30 Valve 4 7 Calibration Verification Test indicates a problem Instrument Maintenance 4 3 Maintenance Items or Tasks Perform Perform atFirst Perform Instrument Part at Each Run of Perform Perform Every See or Test Run the Day Weekly Monthly 6 Months Perform as Needed Page Short Term When instrument will be Shutdown idle for 2 5 days leave acetonitrile at trichloroacetic acid tetrazole acetonitrile and amidite positions Long term When instrument will be 3 18 shutdown idle for more than 5 days leave with acetonitrile on all positions Chamber Perform Before first run of the day Pressure Test 4 4 Instrument Maintenance Instrument Applied Biosystems recommends keeping an instrument maintenance log to ensure Maintenance Log that the required maintenance procedures are performed in a timely manner Instrument Maintenance 4 5 Pressure Tests Introduction Delivery of reagents and purging of waste fluid is dependent upon pressure gradients between the chemical bottles the synthesis chamber and the waste lines Leaks through gaskets or O rings may affect chemical delivery and oligonucleotide quality Periodically test the seal integrity with pressure tests to ensure proper instrument Testing Chamber Pressure function Use the procedure below to verify that the chamber O ring and waste valves are functioning corr
122. rument uses Amidite Re Prime Every sec the time duration in which amidite must be dispensed during synthesis Amidite Re Prime Volume uL the volume used for the Amidite Re Prime Default Pump Parameters Reps the number of times that the default purge is repeated Duration the duration of each purge in seconds Interim the period between the purge reps Factory Defaults Button this button resets edited parameters two fields in this case to their original factory default values When you are ready to close the Service window and apply changes to the two editable fields click OK If you make a change and want to revert to factory default values click the Factory Defaults button and then click OK D 22 Synthesizer Window Database Import Utility Motion View Motion and Homing Parameters To look at the Motion view click the Motion tab This presents the following window Service Dispense Motion Servo m Motion Parameters _ p Homing Parameters Smoothing Factor 002 Coarse Homing Speed 40000 Homing Fine Offset 10000 Fine Homing Speed 2000 Home Offset dea 5 0 Home Factory f 1 Defaults i B Cancel No user changes can be made to the parameters in this view The Motion view contains the following factory preset parameters Motion Parameters Smoothing Factor the coefficient used to smooth cartridge motion Speed
123. s If any residue is noted replace that valve Replacing Valves on page 4 13 Clean residue from the delivery tips in the following manner a Place a lint free absorbent barrier over the synthesis chamber bowl CHEMICAL HAZARD Acetonitrile ACN is a flammable liquid and vapor that may cause eye skin and respiratory tract irritation central nervous system depression and damage to the heart liver and kidneys Please read the MSDS and follow the handling instructions Wear appropriate protective eyewear clothing and gloves b Squirt a few drops of acetonitrile onto each delivery tip c Dry tips gently with a lint free laboratory tissue Check the cartridge and synthesis chamber for residue and or moisture and clean as necessary Clean the cartridge with acetonitrile and air dry Wipe the bowl dry with a lint free laboratory tissue If the cartridge is not already in the synthesis chamber place it into the synthesis chamber by seating the pins into the drain plate and screw down the lock screws on the cartridge retaining ring 3 6 Performing DNA Synthesis Setup Tasks After lf the instrument has been idle for the last five days or more it should have gone Long Term through a Long Term Shutdown After a Long Term Shutdown all of the instrument Shutdown bottle positions contain acetonitrile which means that new chemical bottles will need to be installed in their appropriate places on
124. s process the oligonucleotides if required by your laboratory protocol using the information in Post Synthesis Processing on page B 1 When the instrument is left idle chemicals may crystallize in the lines and valves clogging them Serious clogs may necessitate replacing lines and or valves To avoid these costly repairs and down time follow these recommendations If you plan to leave the instrument idle for Then see 2 to 5 days Short Term Shutdown on page 3 18 Over 5 days Long Term Shutdown on page 3 18 Performing DNA Synthesis 3 17 Short Term lf you plan to leave the instrument idle for 2 to 5 days for instance over the weekend Shutdown perform the short term shutdown procedure to avoid line and valve clogs To shut the instrument down for 2 to 5 days Step Action 1 CHEMICAL HAZARD Tetrazole Acetonitrile is a flammable liquid and vapor that may cause eye skin and respiratory tract irritation central nervous system depression and damage to the heart blood system liver and kidneys Please read the MSDS and follow the handling instructions Wear appropriate protective eyewear clothing and gloves Replace each amidite tetrazole acetonitrile bottle and trichloroacetic acid bottle with a bottle of pure acetonitrile On the 3900 software select Instrument Manual Control Choose each of the Valves listed below from the drop down list and click Prime
125. s of access 2 11 Pause icon 2 13 Phosphoramidite bottles procedure for installing A 6 Phosphoramidites general information A 5 Phosphoramidites and dye amidites preparing and installing A 5 Phosphoramidites reagents and dyes storage conditions A 4 Preparing the instrument procedure for changing the argon tank A 2 procedure for emptying waste containers A 2 preparing the instrument for a run where to begin 3 3 Pressure gauge location 2 5 Prime icon 2 13 Prime waste position location 2 8 Project Edit menu commands D 28 Project File menu commands D 27 Project View menu commands D 29 Purge pressure gauge 2 5 R Reagents guidelines for handling A 7 Reagent banks locations 2 5 Reagent bottles general information A 7 Reagents procedure for changing bottles A 7 Reconstitution of oligonucleotides diluting reconstituted oligos for quantitation B 6 regional sales offices 1 9 to 1 12 run diagram of Run Events 3 2 Run Events Chart entering sequence and cycle information 3 8 performing setup tasks for the next run or shut down procedure 3 17 verifying reagent supply bottle positions and loading columns 3 13 S Safety labels three parts 1 5 Seating pin location 2 8 Setup task lists before each run 3 5 first run of the day 3 3 three task lists 3 3 Short Term Shutdown when to perform 4 4 Short term shutdown procedure to prepare for 3 18 site preparation and safety guide uses for 1 4 Software procedures conventions
126. se 1 6 Technical Support 1 8 Contacting Technical Support 1 8 To Contact Technical Support by E Mail 1 8 Hours for Telephone Technical Support 1 8 To Contact Technical Support by Telephone or Fax 1 8 To Reach Technical Support Through the Internet 1 12 To Obtain Documents on Demand 1 12 Introduction 1 1 ABI 3900 DNA Synthesizer Documentation Background Needed This manual assumes that you are familiar with the following Basic Windows NT operations such as using the mouse selecting commands working with windows and using the Windows NT computer file management system The general manipulation of data files Good laboratory practices and basic laboratory techniques DNA synthesis chemistry About the Use the following table to determine which 3900 instrument document you need for Documentation Set the task at hand All of the documents listed are sent to 3900 instrument customers If you want Refer to the 3900 DNA Synthesizer P N To prepare your laboratory for installation of the instrument The instruments electrical ventilation and space requirements ASite Preparation Checklist Explanations of instrument safety alert symbols in several languages Site Preparation and Safety Guide 4316012 Instructions for general instrument setup and run initiation using pre programmed cycles Routine maintenance information Operational safety information User s Manual 43
127. spense 1 in the Total Weight Measured column b Empty or discard the tube of reagent 10 Repeat steps 8 and 9 for Dispenses 2 and 3 Instrument Maintenance 4 7 4 8 Instrument Maintenance To calibrate valves continued Step Action 11 A properly calibrated valve will have a correlation value between 0 995 and 1 0 If the correlation value for this valve does not fall within this range you will need to a Ensure that no chemical residue white material is on or under the valve or visible at the line between two way valve and the solenoid This can be an indication of leaks and the valve should be replaced b Check that the appropriate reagent is installed for the valve being calibrated c Repeat the calibration procedure d Change the valve Verifying Home Position Procedure To verify Home position Home position is verified as described in the following procedure Step Action Rules 1 Open the ABI Control software and set instrument password by a Clicking Instrument b Selecting Service c Click OK to accept a blank for the user level password Prepare for testing by a Opening software b From the menu select Instrument Service Motion tab Click the Home button a Observe the cartridge moving slowly clockwise then fast counterclockwise then slowly clockwise b Check the alignment of dispense tip 1 It should b
128. sumables List Item Pkg Size P N Plug columns 50 each 4324072 MicroAmp reaction tubes without 2000 N8010533 cap 0 2 mL MicroAmp reaction tube caps 1000 N8010540 Trap Packs Medium size 1 each GENO084033 Trap Packs Mini size 1 each GENO084034 Chamber Gasket 1 each 4318893 Valve and solenoid 2 way NC 1 each P410323 24 VDC Dispense tip assembly 1 each P440042 O Ring hollow 0 25 in x 25 in 1 each 4318891 Silicon 50 Duro Filter inlet bottle bottom 1 8 in 1 each 4323693 Amidite Filter HD Polyethylene 1 each 4323968 Fume Hood 1 each P4324014 Hardware List Item P N O rings and Gaskets O ring Kalrez 5 16 in ID x 1 2 in OD for 221014 amidite bottles Gasket EPR 1 38 x 88 x 030 4498 for ACN Gasket Kalrez 1 38 x 775 x 06 4297 for TCA DCM Gasket Kalrez 1 08 x 37 x 0 03 1212 for sealing of 450 mL bottles Bottle Assemblies Cap assembly for 4 L bottle 1 8 in fitting 602458 Lid receptacle ratchet 3560 Receptacle ratchet 16 oz 3559 Safety carrier with lock handle for 4 L bottle 140041 Spring wavy nickel plated 1 80 OD 2571 Parts List C 3 Synthesizer Window Database Import Utility In This Appendix Topics Covered This appendix describes the interfaces of the 3900 software and the Database Import Utility and provides information on how to use these applications Th
129. the bnk extension which can be imported into 3900 software for use in the synthesizer This section provides general information about the Import Utility under The Import Utility Window see page D 26 Toolbar Icons see page D 27 The main purpose of the material supporting the Database Import Utility is to describe the formats needed for the Excel and text files to be used as input for the Import Utility File types that can be converted by the Import Utility include Tab delimited text files Space delimited text files Comma delimited text files Short format text files 9 9 9 Long format text files Excel files The formats of the file types listed above are described in this appendix under File Formats Sequence information must be prepared in one of the above formats before it can be imported into the 3900 Synthesis window Synthesizer Window Database Import Utility D 25 The Import Utility When you compare the Import Utility window shown below with the Synthesizer Window window presented by 3900 software see Chapter 3 Performing DNA Synthesis you will find that it is very similar Once you have learned how to use the 3900 software Synthesizer window it is easy to learn how to use the Import Utility window E 3900 DNA Synthesizer Database Import Utility x Eile Edi View Database Import Clos lea selek a el Bank2 Bank3 Banka E I i mimi n Hn D m n
130. the map shown on the Valve configuration window CHEMICAL HAZARD Tetrazole acetonitrile is a flammable liquid and vapor that may cause eye skin and respiratory tract irritation central nervous system depression and damage to the heart blood system liver and kidneys Please read the MSDS and follow the handling instructions Wear appropriate protective eyewear clothing and gloves Note If the instrument was idle for 2 to 5 days the bulk TCA and amidite bottles may have been changed to acetonitrile to avoid line clogs Ensure that a bottle of TCA is attached to the correct line at the back of the instrument and tetrazole acetonitrile and amidites are attached at the proper positions Make the following reagent checks using information listed to the right a Add reagents and amidites if necessary b Check the dates of installation of all reagent and amidite bottles and replace outdated chemicals c Mark dates of opening amidite and reagent bottles Expected chemical lifetimes see Storage Conditions pg A 4 Procedures for dissolving amidites and changing amidite bottles see page A 5 Procedures for changing reagent bottles see page A 7 3 4 Performing DNA Synthesis To setup for the first run of the day continued For details see Step Action topic page 5 Check that amidite and tetrazole acetonitrile
131. tics Hierarchical menu Items Enabled when the include instrument is not Verify Calibration i Verify Pressure Each items displays a dialog box containing the procedure and controls for the test Service Displays the Service Password Enabled when the window instrument is not running Help The Help command presents the About 3900 DNA Synthesizer window This window provides information identifying the instrument the software application is used with the software version number and date of release About 3900 DNA Synthesizer ABI3900 High Throughput DNA Synthesizer Version 1 00 3 Applied AS Biosystems D 14 Synthesizer Window Database Import Utility Instrument Menu Window Details Introduction T he windows presented by the Status Waste Report Instrument Log Valve Configuration Manual Control Diagnostics and Service commands are described in some detail in this section Status Reporting T he Status window shown below is one of three ways to monitor the status of and Status Window synthesis Synthesis can be monitored In the main 3900 software window through the ndication presented on the end of each row of the table for a sequence indicated by underscore and by number of couplings completed Status line at the bottom of the window for various synthesis steps in progress In the Synthesis Instrument Log window described under Instrument Log on page D
132. tion Time This indicates that these are the only parameters that can be edited The Dispense view contains factory preset values for a number of parameters Activator Rinsing Parameters Activator Rinsing bases number of bases upon which activator rinsing is performed during synthesis ACN Volume uL the volume of acetonitrile to be used Activator Re Prime uL the activator re prime volume terations the number of times activator rinsing will be performed nterim sec the wait time between rinsing Synthesizer Window Database Import Utility D 21 Timing Parameters Chamber Dry Time sec this is one of the two parameters for which user entry is allowed This parameter is the argon purge time before start of synthesis Range 0 to 20 Default 20 sec Min Valve Time msec the minimum valve opening time Pre Move Delay msec the delay time between movements Purge Increment Vial sec the extra time that will be added to the purge time for each missing vial Purge Pressurization Time sec this is the second of the two parameters for which user entry is allowed This parameter is the time for pressure to build during purging Range 0 to 5 Default 1 00 Chamber Vent After Purge sec the time that the chamber is vented after purge is complete Miscellaneous Parameters Wash Volume uL the volume of the washes Prime Volume uL the prime volume that the inst
133. tting up the first run of the day After recalibrating a valve Whenever oligonucleotide yield is lower than expected The calibration of all 30 valves can be tested simultaneously with the procedure below To verify valve calibration on all 30 valves Step Action 1 Status of the system Instrument and computer are on and 3900 Software is running Column positions 1 30 contain 200 uL MicroAmp Reaction Tubes P N N8010540 It does not matter what is in the remaining positions The cartridge retaining ring and instrument lid are locked into position 2 Verify that the cartridge reaches the home position properly a Look directly down through the synthesis chamber window use a step stool if necessary b Check to be sure that dispense tip 1 is directly over column 1 3 a Select Instrument Manual Control b In the Manual Control window click Prime All 4 Watch the delivery tips to see that each tip delivers reagent straight into the prime waste position 5 Click Done 4 10 Instrument Maintenance To verify valve calibration on all 30 valves continued Step Action 6 Select Instrument gt Diagnostics This presents the Diagnostics window Chamber Pressure Test Close and lock lid Click Run Test Watch chamber pressure gauge Passing Less than 1 psi drop Release over 1 minute Pressure Click Release Pressure to end test 288
134. ttons will turn back to grey Click the Done button to exit the Valve Control window and return to the main Manual Control window Click the Done button on the Manual Control window to close this window Diagnostics The Diagnostics window is used to perform two system tests Chamber Pressure Test Calibration Verification Test r Chamber Pressure Test Close and lock lid Click Run Test Watch chamber pressure gauge Passing Less than 1 psi drop Release over 1 minute Pressure Click Release Pressure to end test m Calibration Verification Test Verify cartridge homes properly Place containers into positions 1 to 30 288 Close and lock lid Enter volume into text box Click Run Test Run Test Verify that volume dispensed meets lab specifications See your ABI 3900 DNA Synthesizer User s Manual for container and volume options Done To perform the Chamber Pressure Test follow the instructions on the upper left side of this window A more detailed procedure is provided in Testing Chamber Pressure on page 4 6 To perform the Calibration Verification Test follow the instructions on the lower left side of this window A more detailed procedure is provided in on page 4 9 D 20 Synthesizer Window Database Import Utility Service Clicking the Service command presents the Service Password dialog box Clicking OK without entering a password allows a user to view all of
135. ty Guide have purchased an Applied Biosystems instrument Refer to the guide written for your instrument for information on site preparation instrument safety chemical safety and waste profiles About MSDSs Some of the chemicals used with this instrument may be listed as hazardous by their manufacturer When hazards exist warnings are prominently displayed on the labels of all chemicals Chemical manufacturers supply a current MSDS before or with shipments of hazardous chemicals to new customers and with the first shipment of a hazardous chemical after an MSDS update MSDSs provide you with the safety information you need to store handle transport and dispose of the chemicals safely We strongly recommend that you replace the appropriate MSDS in your files each time you receive a new MSDS packaged with a hazardous chemical NUAN CHEMICAL HAZARD Be sure to familiarize yourself with the MSDSs before using reagents or solvents Ordering MSDSs You can order free additional copies of MSDSs for chemicals manufactured or distributed by Applied Biosystems using the contact information below To order MSDSs Then Over the Internet a Go to our Web site at www appliedbiosystems com techsupport b Click MSDSs If you have Then The MSDS document Enter one of these number or the Document numbers in the appropriate On Demand index number field on this page The product part number Select Click Here then enter t
136. ve manufacturers This Warranty is limited to the original site of installation and is not transferable THIS WARRANTY IS THE SOLE AND EXCLUSIVE WARRANTY AS TO THE INSTRUMENT AND IS IN LIEU OF ANY OTHER EXPRESS OR IMPLIED WARRANTIES INCLUDING WITHOUT LIMITATION ANY IMPL ED WARRANTY OF MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE AND OF ANY OTHER OBLIGATION ON THE PART OF AB Printed in the USA 03 2001 Part Number P N 4316015 Rev A2 Contents 1 Introduction Ove Me W oie ebutosenet WebegseRbiesnt eben gebe EL EBMEBEEWERBNUBER 1 1 About Ths Chapteis esserne Re t bre et ot BENS SER ER REV ER RENE RES 1 1 ABI 3900 DNA Synthesizer Documentation 0 00 0 1 2 B ckeround Needed esce oth ithe Rer Xa Ra AUR ERR MERE 1 2 About the Documentation Set 0 0 eee ee eee 1 2 Safety esci ep ipee at nae BINE Ux dee aarp eee 1 3 Documentation User Attention Words 0 0 0 eee 1 3 Chemical Hazard Warming scono pance eb eee dae we be eR be eee es 1 3 Chemical Waste Hazard Warning 0 0 0 cece cee eee eee 1 3 Site Preparation and Safety Guide 1 4 About MSDSS 25 3 0 ast Shaw ILI eee b ct ees 1 4 Ordenng MSDSS teret aean aran aart tbe e eerie eee 1 4 Instrument Safety Labels ss 0000 5 6c ki ede d ee eae base IPS 1 5 About Waste Profese coU BP ECRIRE ERU date ee heehee 1 5 About Waste Disposal usse Reti ve eR d CEDE ROME ES 1 5 Before Operating the Instrument 00 00 eee e 1 5 Safe
137. ves on the instrument are represented graphically at the top of the window Synthesizer Window Database Import Utility D 17 The two tables in the window are associated with the valve array above The reagent for each valve position may be specified in the Reagent columns for each portion of the table The buttons on the bottom enable these settings Default Settings button clicking this button returns setting to the factory defaults Calibrate button clicking this button presents the Calibration dialog box see Calibrating Valves on page 4 7 Calibration Summary clicking this button presents the Calibration Summary document reporting the results of the last valve calibration OK clicking this button closes the dialog box while accepting any changes made to the valve configuration settings Cancel clicking this button closes the dialog box discarding any changes made to the valve configuration settings Manual Control The Manual Control window allows various instrument elements to be manually controlled r Motion and Dispensing T Pime Valve Reagent 1 DEBLOCK E Column 7 Dispense microliters 42 Not Dispensing into milliseconds 102 Cartridge Ail Prime m Instrument Bak DEFAULT Bank Rinse Activator Tips Purge Wash Valve Control Prime All Home UE i Moved column 1 to valve 1 The Manual Control window has the following
138. wing topics are covered in this appendix Topic See Page Assembling and Using the Fume Hood E 2 Introduction E 2 Unfolding and Assembling the Fume Hood E 2 Inserting and Using the Fume Hood E 3 Using the Fume Hood E 1 Assembling and Using the Fume Hood Introduction The fume hood is a polypropylene insert that is placed under the open top cover of the instrument to protect the user or service person during instrument calibration or chemical spill cleanup The fume hood provides the connection to the laboratory fume exhaust system to remove fumes and protect the person performing work Unfolding and The fume hood comes folded up with the two triangular sections secured together with Assembling the velcro strips Fume Hood To unfold and assembly the fume hood Step Action 1 Unfasten the top triangular flap from the velcro patch on the lower flap and swing it open so that the flap is oriented at about a right angle to the front section 2 Secure the flap using the two support flaps with velcro patches Support flaps 3 Swing the second flap up and secure as described in step 2 The fume hood should now look like this o 4 As can be seen on the triangular section on the right side above the fume hood can be prepared for connection to any of three sizes of exhaust ducts in the laboratory 2 i

Download Pdf Manuals

Related Search

Related Contents

ALK Technologies S60 User's Manual  TDP-245 取扱説明書 感熱バーコードプリンタ  Guia do administrador da série VSX, Versão 8.5  MicroStorage External USB 2.0 and FireWire with 2,5" harddrive. 20GB  MTL 1000 - WORK PRO Audio  HydroSurge 400A-60 User's Manual  國クリンカラーリベスト    COLORado Batten Quad-9 Tour Quick Reference Guide Rev. 3 Multi  

Copyright © All rights reserved. Failed to retrieve file