Home

Calligrapher™ MiniArrayer - Bio-Rad

1. BioOdyssey MiniArrayer Table of Contents Chapter 1 introduction svcsnaceceasiensinnacesnvasaressensaten covieecseusuvectesnndernveanecusencneedesvenevescsesovensewnvensevenss 1 Key Features of the BioOdyssey Calligrapher Miniarrayer ccccccssccccseseccceseeceeeseccseseecsasesesseessaeeessneeesenseessags 1 Features and Benefits gc sctsciececis tients deoctennns dasigs datas smenanwrnalsciledtnmoss dew dnsines anos danodebens eadueceenanedsesede seas dendnenas Haseanmneenmedenecbsmeddsct 1 Oy Sed DESCON oases esas ces E E cenit aes et N eases conioseat anaes essa E E E 2 An Overview of the Printing Procedure Using the BioOdyssey Calligrapher Miniarrayer cccceeeeeeeeeeeeeeeeeeeeeeees 2 Chapter 2 BioOdyssey Calligrapher miniarrayer Software cccsecseeeeeeeeeeseeeeneeeeeeeneeeseeenseeeseenseeeseneaes 4 TOO Man WINAOW oso scieetteseateacrcssestecaacasiscceadeaseneqaceacunessieamsysiecs vaceetenacoaecteiaroesiecab nes ceqe a E RS E S E E E e EEE e ee 4 Kenu ONIONS se mee meee er E EE EE E AE E E E ee 4 PE ME e a E E E E E E E E E E E E E 4 I MEM e i e E eam seo ces a E E E E E E 5 SetU MENU isere E EEEE ude RE E a EE E EEE E EEEE G EREE EE E EEEE 5 Manual Control MenUssersissmaiii enen aaa aa aE AEN EENAA Success AANE ERE EAEE E EN E AEEA 5 AE L a E E E EN EEA E EE O umbee tine 6 eD MENU ee a A EE E eee eee 6 TODA E E vain E E EE E E E E EE E a A 6 See ere ates ceca E E E E E E E T
2. Step2 x Time 9 o Wash Selection ee C NeverWash r mee pone a i C Different Samples Dips Cycle Wash Always Wash Dips Redips Step 1 Wash2 yi Time 5 Cycles 0O Sepziivaum Selo S Step3 Wash v Time 5 I Washi Passive Bath Step4 Vacuum Time 12 Wash2 Flow Through Bath Final Wash Step 1 None Time nerd Step 2 None v Time b s Step 3 None v Time bo s Cancel If you select Never Wash the pins will not be washed during a print run cycle If you select Different Samples the pins will be washed when you move to a new sample in your source plate By selecting Always Wash the pins will be washed before every dip into the source plate Note The more extensive your wash parameters the longer the print run will take Options Window Your BioOdyssey Calligrapher miniarrayer has default parameters whose performance has been optimized in our facility You may need to adjust these parameters in order to obtain the highest quality spot morphology in your laboratory setting The options menu allows you to vary the speed and time settings for the arrayer You can also set the pin oscillations during washing Varying these parameters will help you to fine tune your print runs and obtain the highest quality spots possible e Source Plate Varying the Z Down Offset Approach Speed Dwell Time and Withdraw Speed for the Source Plate will optimize sample uptake in the p
3. 4500 4500 Superard Print Direction Left to Right Top to Bottom Barcode Available No Next gt Cancel Help 3 The file will load and the arraying parameters are displayed in the Selected file parameters window 4 Click Next to continue The Select Source Plates window opens see image on next page 5 Browse to the folder containing your Plate Files normally in your user name Plate Librarian folder All plate text files plt contained within the Plate Library folder that are properly formatted are displayed on the left side of the window Note It is critical to select the plate files that were used in your robot arraying run in the proper ORDER that they were printed Files can be added to the right window by double clicking on the file name with your mouse or by selecting a single or multiple files hold down Ctrl Shift key while selecting and pressing Add To remove a file select the file name and press Remove To insert a file select the file in the left window select the plate above the insertion in the right hand window and press Insert Page 38 Chapter 7 Generating Mapping Files Select Source Plates Plates files Browse Run Plates Read from file Format2 364 001_001 plt 6 When all plates that were used in the arraying run have been added press Next 7 The Export Files window appears allowing you to select the destination folder for the output files to select the format
4. Page 23 Chapter 5 Preparing the BioOdyssey Calligrapher MiniArrayer for Printing Chapter 5 Preparing the BioOdyssey Calligrapher MiniArrayer for Printing The BioOdyssey Calligrapher miniarrayer is designed for minimal user intervention Sensors present in many components of the unit will warn you of any problem To avoid messages or errors during your arraying run follow these few basics steps 1 Turn on the Calligrapher miniarrayer using the toggle switch on the right side of the instrument 2 Launch the software Note If you have forgotten to power on your Calligrapher miniarrayer prior to launching the software you will receive a prompt To connect to the Calligrapher miniarrayer a Open set ports through the Setup menu b Click the button on the right Establish Communication and Initialize the Calligrapher miniarrayer search tor COM ports Establish Communication aia and Initialize the Calligrapher Port for Microcontroller A COM 4 Cancel Port for Motion Controller B COM 3 l Help 3 Check the Supply bottle and ensure that it is full Note We recommend distilled water 4 Check the Waste bottle and ensure that it is empty 5 Check the HCM and ensure that the 1 Liter bottle is full and that at least 50 of the desiccant is blue See Chapter 8 for information on changing desiccant 6 Ensure the platen is free of dust and debris wipe with a Kimwipe wet with 70 ethanol
5. a File name ET Files of type prg files Cancel 4 Click Open and the Browse window disappears and the name of the program that you have selected appears in the Run Log Aun Log HCH attached in cg prg loaded e f Reminders 5 If this is the first run of the day press the Homing button and allow the robot to home Note The BioOdyssey Calligrapher miniarrayer requires homing when communication with the Calligrapher miniarrayer and computer is initiated The Calligrapher miniarrayer performs automatic homing after the door is opened or when a run is stopped 6 Press the Run button A Selection Dialog will appear to allow you to start from the beginning or define a start position for the run In most instances you will select start from the beginning 7 Click OK and the robot will start a quick wash of the pins using an optimal set of parameters The array monitor window will also appear showing the program name on the top left corner Page 32 Chapter 6 Printing with the BioOdyssey Calligrapher MiniArrayer Array Monitor cg1 par E C Info wO O OO Curent Plate H 1 Current Dip H 4 Current Slide H 22 Estimated Time D ate Blot Eschange Plate E xchange End of Aun 15 57 58 ri 2005 Remaining Time 00 25 33 PO BEBE ERR Current Humidity 72 532 6 Curent Temperature C 33 0 Note The Array Monitor window shows a representation of the source pla
6. 7 Fill the passive wash bath with 10 ml of print buffer We recommend 10 ethanol with 0 1 Tween whenprinting proteins 10 ethanol for oligonucleotides Note Ethanol is not recommended for use in the Flow Through Wash Bath Note Ensure the disposable cup is seated properly in the passive wash bath holder 8 Place the source plate substrates and blotting slides on the platen following the directions below 9 Load pins into the printhead Placement of Substrates on Platen Note Use of powder free gloves for working with all materials is highly recommended Page 24 Chapter 5 Preparing the BioOdyssey Calligrapher MiniArrayer for Printing a Slides 25 4 mm x 75 1 mm 1 x 3 The platen will hold 16 glass slides Simply place the slides on the platen as you entered in your program Secure the slides in place using the magnetic bars Note For bar coded slides the bar coded area of the slide is NOT placed against the top left corner of the slide area Rather the bar code is positioned to the right b 96 well Destination plates the platen will hold two 96 well destination plates Place the plate adaptor into the two holes on the platen see below and place magnets at the bottom and side of the plates This will enable you to correctly position the plates c Membranes the platen is designed to hold two membranes 8 x 12 cm within two OmniTrays Nunc catalog 242811 Place the plate adapter into the two holes on
7. Page 33 Chapter 6 Printing with the BioOdyssey Calligrapher MiniArrayer Defining the Start Position After a Stopped Run 1 To restart a stopped run click the run button on the console window 2 A selection dialog box will appear select Define Start Position Click OK Selection Dialog Start from the Beginning e Define Start Position Lancel 3 In the Start from the middle parameters window that appears enter the Array Monitor information provided for the current plate Source plate number dip Source well position and slide number substrate into the appropriate boxes The source plate and substrate diagrams will display the information entered Note This information is also stored in the log file in the Log directory Start from the middle parameters x Source plate number Dip number 4 a Cancel Substrate number Source Plate Note Replace the blot slides that have been used The Calligrapher miniarrayer will resume blotting on the first slide 4 Click OK 5 The Console window will appear and washing will automatically begin 6 After washing press the continue button and the run will resume with the defined start positions entered Page 34 Chapter 6 Printing with the BioOdyssey Calligrapher MiniArrayer Resuming a Print Run After a Power Outage The Calligrapher miniarrayer software will issue an error message when a power outage was experienced during a run The software
8. the time the pins spend on the substrate during printing Increasing the dwell time will increase the spot size GAL file GAL is the abbreviation for GenePix Array List file This is a type of Map file that was developed by Axon Instruments and has become an industry standard used by many microarray scanner and software providers to locate the spots on your array This file type can be generated within the SpotMapper program located under sample tracking in the arraying menu Grid Two dimensional array of spots printed on a substrate by a single pin Home position the robot position where the value for the x y and z coordinates is zero reached by pressing the Home button located in the Console Page 44 Glossary Humidity Control Module controls the humidity used when performing printing protocols In general increasing the humidity levels above 55 60 will increase spot size Low humidity lt 55 will result in misfires and donut shaped spots Joystick tool that allows you to move the printhead in the x y and z directions when using the custom calibration option Map file a Map file contains a layout of the array the organization of grids and supergrids with a list of all the genes and their position This file is created through merging source plate files plt with the arraying program file vrk using the Plate Librarian and SpotMapper functions Plate Library the folder that stores plate files plt Plate Li
9. 1 On a clean surface close to the Calligrapher miniarrayer place the magnet in the designated groove on the top side of the MCP Loading Tool 1 al G cain 4 A j gt 2 Turn over the MCP Loading Tool so that the magnet is on the bottom 3 Load the pins into the holes on the underside of the tool Page 26 Chapter 5 Preparing the BioOdyssey Calligrapher MiniArrayer for Printing 4 Allowing the magnet to hold the pins in position turn the tool upright and move to the Calligrapher printhead Page 27 Chapter 5 Preparing the BioOdyssey Calligrapher MiniArrayer for Printing Preparing the MCP Pins for Printing Please ensure that you take the time to prime the pins before use and after any extended storage 2 3 weeks To prime your pins place 10 ml print buffer e g PBST into the static wash bath Select the Wash Pins icon from the toolbar or from the ManualControl menu G BioOdyssey Calligrapher File Edit View Setup ManualControl Arraying Calibration Window Help BieaetLte s RA 2 ES Oeysey Calligrapher vari Control Panes pr JE A TE ee Sen Arre The Calligrapher miniarrayer will now wash the pins using a default wash protocol The dialog window below will appear Press yes to to continue the program Calligrapher A Do you really want to wash the pins e The default wash program can be viewed by selecting Arraying Define Washing Define Washing Pre VWash St
10. Cleaning the Printhead To clean the printhead use the load pins feature in the Calligrapher software to bring the printhead to the front of the platen Place a tissue below it and flush with 70 ethanol then use an interdental brush to clean the holes in the printhead Use compressed air to blow dry the printhead or allow to air dry Humidity Control Module HCM Changing the Dessicant The HCM contains an indicator desiccant blue to pink that must be changed at appropriate intervals The software will monitor the humidity and notify you when it is out of range However it is recommended that prior to a print run you visually check the dessicant color Dessicant can be ordered from VWR catalog CADX0017 3 Follow these easy directions to change the dessicant 1 Carefully remove the green cover of the HCM 2 Carefully release the dessicant tube from the clip holders 3 Release the quick coupler from both ends of the dessicant tube by pushing the blue collar towards the connector and then pulling the tube out 4 Hold the tube upright and unscrew the end cap Pour the dessicant into a glass beaker Page 42 Chapter 8 Maintaining the BioOdyssey Calligrapher MiniArrayer and MCP Spotting Tools Note The dessicant can be reused by heating in a 120 C oven until the color is blue Fill the tube with fresh dessicant Replace the end cap and tighten Reconnect both quick couplers Replace the dessicant tube in the cl
11. Yes when printing onto FAST slides or other nitrocellulose coated slides adjust the Z axis height in the Options window to 0 5 If results are not satisfactory adjust another 0 5 Protein Printing What would you recommend as a standard protocol to print a protein array There are several ways to print protein arrays Please refer to our Tech note 5480 Proteomic Analysis of Tumor Biomarkers in Human Clinical Specimens Using the BioOdyssey Calligrapher MiniArrayer Can we print crude protein extracts or must we use purified protein You can print either the Calligrapher miniarrayer is a tool to allow spotting of any soluble molecule onto a surface However you will likely want to review our Tech notes Special applications may require optimizing the spotting parameters What is the sensitivity for an ELISA type assay using microarray This will varying depending upon many factors In general with the proper antibody sets down to fmol amounts of protein can be detected What temperature would you recommend for a protein array print run We recommend setting the chiller to 0 C which will cool the Calligrapher miniarrayer to 10 C If you are printing proteins denatured with SDS guanidine or other detergent use of the chiller is unnecessary UNLESS you are planning on long print runs If print runs are greater than 3 hours then use the chiller to maintain a temperature of 22 24 C to keep everything solubilized and reduce the
12. bottles require attention e BioOdyssey MCP Pins optimized for multiple sample types e Humidity control option to maintain constant humidity levels e SourceSelect proprietary software that allows cherry picking of samples Once you have performed a global survey of your gene set this feature allows you to select the individual samples of interest from the source plate to print saving time and effort e Cooled platen and source plate option e Software upgrade option for printing onto custom substrates e Optional MCP Loading Tool for easy pin loading Page 1 Chapter 1 Introduction lt i BioOdyssey MCP Pins MCP Loading Tool The BioOdyssey Calligrapher miniarrayer shown with optional Humidity Control Module System Description The BioOdyssey Calligrapher miniarrayer is shipped with 3 pins 1 of each style MCP100 MCP360 MCP310S a user manual an instructional DVD and two CDs that contain BioOdyssey Calligrapher miniarrayer 2 0 application software a simple yet comprehensive software BioOdyssey Calligrapher miniarrayer has been carefully tested with source plates that meet the ANSI SBS standards For further information see Appendix A If you plan to use plates from other providers or any type of custom substrates an optional software upgrade is available This option includes a training course to teach you how to calibrate the robot for your printing needs An Overview of the Printing Procedure Using
13. do adjust the platen temperature Temperature adjustments are made on the refrigerated circulator Set the chiller at 0 C to obtain a platen temperature of 10 15 C which is suitable for most protein applications Please allow approximately 45 60 minutes for cooling to equilibrate depending on the difference between the ambient temperature and the desired temperature The humidity should be set at 40 to assure adequate dehumidification Where can I see the platen temperature in the software The Control Panel and Array Monitor windows display a chamber temperature and an estimated temperature on the cooled platen The chamber temperature is a real measurement taken by a sensor located within the chamber but not on the platen To calculate the platen temperature a series of measurements were taken to yield the following equation y 1 29x 8 6322 See Tech note This value is automatically calculated by the softwarae and displayed in both windows Page 50 FAQ What does communication not established mean This indicates that the Calligrapher miniarrayer is not on or not being recognized by the software First check that you have followed the installation guide and installed the hardware software and drivers correctly go to the Setup Menu gt select Set Ports gt click on Search for COM Ports followed by Establish Communication Custom Calibration Software Upgrade How can I adjust the Calligrapher miniarrayer calibrati
14. extensions See page 6 in the program folder Define Parameters for Arraying Substrates GridLayout Blot Wash Options Source Plate Z Down Offset mm Approach Speed mm s Dwell Time ms Withdraw Speed mm s Printing Parameters Wash Bath 1 Passive Oscillate Pins Distance in X mm Number of Times Wash Bath 2 Flow Through Oscillate Pins Distance in Z mm Z Down Offset mm Number of Times Approach Speed mm s Vacuum Dwell Time ms PEN Oscillate Pins Yes No of Substrates between Redips Cancel Open an Existing Run Select Open an Existing Run in the Selection dialog window to open an existing par file to view or edit A window opens that lets you browse to the file Select and open the desired file and the Define Parameters for Arraying window opens with each of the tabbed windows containing the parameters from the existing file If you change any parameters be sure to press Apply and then press OK Rename the file to save it without overwriting the existing file Selection Dialog CO Create new arraying run C Create SourceS elect run rc ance Open an existing run Page 16 Chapter 3 Defining Print Parameters Predefined Protocols We have designed predefined array parameter protocols for you to use when spotting onto commonly used substrates such as Whatman FAST slides with discreet pads or Schott MPX16 microarray slides N
15. in image analysis software such as Bio Rad s VersArray Analyzer 5 0 The BackTracker format btk files can be used as a tracking spreadsheet for creating your own source plates The process of generating these map files can take place before or after the print run Plate Librarian Software To use Plate Librarian Software you need a tab delimited text file that has the source plate data arranged in one of the formats shown in Table Format 1 has a separate column for Plate Row and Column Format 2 has a separate column for Plate and a combined column for both row and column Position Format 3 has all the location information in a single column see examples below If you are using a file obtained from a vendor all information prior to these headings must be removed No empty spaces should be left between the headers of the Excel sheet and the headers that describe the plate information In addition no blank spaces should be left between adjacent rows The program will maintain the information from a total of eight columns Table 1 Formats available to arrange source plate data Format 1 Format 2 Format 3 Plate Row Column Plate Position Address 100 a 1 300 al 200a1 100 a 2 300 a2 200a2 100 a 3 300 a3 200a3 Creating a text file txt to be imported to the Plate Library 1 Open the file provided by the content vendor or provider Usually these files contain header information regarding plate position row column oligo ID gene
16. of output files required and to enter additional information that will be shown in the file Export Files Select output files to generate Select destination folder V GAL format hest2gal M Back Tracker format test2bte General format test2tt Array Name Array Revision Slide Barcodes Comment Sl lt Back Cancel Helo 8 To specify a location for your file click Select destination folder and a window opens to allow you to browse to a specific location The default location is your Users file in the Map files folder Page 39 Chapter 7 Generating Mapping Files Browse for Folder ect destination folder Select destination Folder gt Bio Rad BioOdyssey Calligrapher 0 6 H Software HHC users EH default C Log files Co DEMES O Original plate O Plate library gt Power Test z I b ceric 5 g Back Finish Cancel Help 9 Press Finish A box will appear listing the files generated and the location Press OK Calligrapher Task successfull 3 file s generated 1 C Program Files Bio R ad BioOdyssey Calligrapher 0 3 Users jamie Map files og gal 2 C Program Files Bio Riad BioOdyssey Calligrapher 0 3 Users jamie Map files og btk 3 C Program Files Bio Rad BioOdyssey Calligrapher 0 3 Users amie Map files og txt Examples of each file type are shown in Appendix C BackTracker Files For researchers who are creating their own source pl
17. printing a grid A supergrid maintains the grid configuration while printing all samples Withdraw speed Source plate the average speed for the pins to exit the source plate wells Again for more viscous samples slowing down the withdraw speed will allow for optimal sample uptake Z down offset Printing parameters used to adjust the z height of the pin during printing The Z down offset is used to optimize spot morphology and troubleshoot pin contact on the substrate surface i e nitrocellulose slides We recommend that you make minor adjustments at 0 5 mm intervals Note adjusting the Z down offset by 0 5 will raise the pin upwards away from the platen Page 45 FAQ Frequently Asked Questions General Instrument Information Does my new Calligrapher miniarrayer come pre calibrated Yes the Calligrapher miniarrayer comes pre calibrated from manufacturing and is optimized with default settings that are applicable for many frequently used applications You only have to set up array parameters i e choose the type of source plate 96 384 or 1536 well plates preferred substrate slides membranes or 96 well plate choose the pin style quill stealth or solid the number of pins up to 8 pins and design the array The default wash parameters are sufficient for many applications however with extended use you may wish to tweak these parameters to optimize for different sample types What are the options available for the Calli
18. provides assure consistent cleaning Our R amp D team has performed extensive tests with the Calligrapher miniarrayer using a number of samples with varying viscosity to ensure that the default wash parameters offer excellent pin cleaning and little or no car ryover contamination What solutions do you recommend using in the static wash bath Type Solution Protein 0 1 Tween in 10 ethanol DNA 10 ethanol Final Wash 10 ethanol NOTE ONLY use water in the flow through bath Why am I not getting the spot size that the manufacturer states is specific for my pin type When reviewing the expected spot size of a pin be careful to note the sample and buffer used to validate these recommendations The consistency and viscosity of the sample as well as the substrate surface can have a significant effect on the spot size printed For example with the Telechem SMP3 pins we expect to see a 100 um spot feature when printing oligos in 3xSSC buffer onto Corning UltraGAPS slide we observe a 130 um spot On membranes or plain glass slides the spots will tend to spread and appear larger Page 49 FAQ Software In the Calligrapher miniarrayer software what is the difference between a grid and a supergrid e A grid is generated by the printing of a single pin on the substrate i e slide membrane or 96 well plate e A supergrid is a group of grids printed on the substrate by all the pins loaded into the printhead maximum of 8 pins How do
19. source Plate Type C g6 well fe a0d well C 1536 well select Input File Input File Row Description Read from file x Look in Plate Library si c Er Format2_384_001_001 plt Output File ert sample Flate_Narme Files oftype Plate file pit l Cancel Total Number of Samples Delete Total Number of Plates Dave Save and Close Cancel Help 5 Select the file to open and click on the Open button The samples are loaded into the top Input File window with the file name appearing as the Input File Note Sample files are available for use by browsing to user default plate library Examples of each plate type and format are included see Chapter 7 Page 19 Select Input File source Plate Type 3 Input File Output File Delete Chapter 4 SourceSelect Mode J6 well fe 3o4 yell Format 304 _001_001 pit Column ID 001 01 001 02 001 03 001 04 001 05 001 06 nni n7 Save Name _ a01_sarmple_O al sample_U aQ3_sample_ ald_sample_l alh_sample_l alb_sample_l al camnile M Accession o 1536 well Co O001 Co 0002 cs 0003 Cs 0004 cCs 0005 Cs 0006 rS Nnn select Input File Add Symbol DS 0001 Ds 0002 0s 0003 DS 0004 DS 0005 DS 0006 ms nnan Fycitina aenea n gt Insert Total Number of samples Total Murmber of Plates Save and Close Cancel Help A
20. the run in user friendly manner vrk Stores parameters of the run to use to generate gal files for mapping your array prg Stores the robot program generated upon defining a run rig Stores information describing all the steps that actually occurred in the arraying run These are named with the date and time of each run log Stores the parameters of the run and the plate number the first dip time last dip time last dip number last slide number and Plate ID Folders ssr SourceSelect file for a cherry picking run gal Used in downstream image analysis to generate a grid and supply location information btk Generates a spreadsheet from your robot program that assists you in creating a source plate txt Tab delimited text file generated in SpotMapper plt Created by Plate Librarian for use in Sample Tracking Page 7 Chapter 3 Defining Print Parameters Chapter 3 Defining Print Parameters The BioOdyssey Calligrapher miniarrayer default parameters are optimized for printing onto glass surfaces or either inactive activated or coated with nitrocellulose eg FAST slides Whatman membranes or into 96 well plates using PBST print buffer and the MCP360 capillary pin These parameters will also perform adequately for the MCP100 capillary pin and MCP310S solid pin on different substrates but to ensure optimal performance we have included in the software several robot files with parameters that are optimal for printing under various co
21. will display error boxes and guide you to resume the print run 1 Click OK on the error boxes until power is restored Once power is restored click the Run button A message Serial line communication for controller is broken appears Click OK Click the homing button If communication is not established with the Calligrapher miniarrayer go to the next step 6 Go to Setup Set Port and click on the Establish Communication and Initialize Calligrapher button Click OK see page 8 for more details 7 Click the Home button and a dialog box appears containing information about the aborted run 0O A WwW PP Calligrapher Aborted run Found User Name default Date Time Jul 25 2005 07 05 59 Position Plate Number 1 Dip Number 2 Substrates 2 2 Name of the rum cg Do you want bo continue Yes Mo 8 Click Yes to continue the run from this position 9 The run begins with a wash cycle Note In the Console Reminders window a message will be displayed This run starts from the mid dle If necessary exchange blot slides load appropriate source plate and press Continue button The print run will resume after the pins have been automatically washed Note At the end of the run we recommend that you wash your MCP pins using the Wash icon on the tool bar prior to storage Ethanol 10 should be used in the Static wash bath See Chapter 8 for further information regarding pin cleani
22. 02609 2 POGFRB 76144 lblood_inflammation GGATCCCCAGAGTIGETCCAAGGAGEGAGAGTESEETICTI b a sm 2 m xrm e nan i j j ts i j s oo a a7 m oy _ om oa m m e o a m a Se Image 1 Example of a plate file obtained from a vendor To import into the Plate Librarian software the first two rows must be removed and the file saved as a tab delimited text file Page 54 Appendix C SpotMapper File Formats Seles E Microsoft Excel cwpa gal iE Gle gdt Mew rset Format Tools Deta Window Help E Li is fo ARTS Arial 10 i Ti E ala I m ee Type a question for help mA an X FE fo oo ia so EE E Eee B ow ie ar ee te ae aE Bee amas i x i a I i _ ery 118 al e ear Ti Type GenePix ArrayList V1 0 4 BlockCount ii 7 BlockType 0 amp Block1 29070 2000 120 4 200 12 200 7 Block2 213570 2000 120 4 200 12 200 8 Block3 218070 2000 120 4 200 12 200 Block4 222570 2000 120 4 200 12 200 10 Block5 29070 6500 120 4 200 12 200 Block6 213570 6500 120 4 200 12 200 Block7 218070 6500 120 4 200 12 200 Block8 222570 6500 120 4 200 12 200 E Block Column Row ID Name 1 1 1 blank Randomized negative control t 2 1 NM_00687 Receptor interacting serinethreonine kinase 3 1 3 1 NM_00626 Protein tyrosine phosphatase non receptor type 13 APO 1 CD95 Fas associated phosp
23. 1 001 27 b03_samp 1B 3 CS 0027 DS 0027 Exciting gene no 0027 23 1 6 1 001 27 b03_samp 1B 3 CS 0027 DS 0027 Exciting gene no 0027 Image 3 BackTracker format used to create source plates Delete the location information at the top of the file to fill in as a spreadsheet Once completed reinsert the location information for use as the GAL file for image analysis Note SP means source plate Page 55 Appendix C SpotMapper File Formats E3 Microsoft Excel test ct 4 laray_row array_col row cal ref Bal 1 1 1 1001 25 Ea Ll ul 1 2 001 27 1 4 1 1 1 3 001 29 5 1 1 1 4 001 31 6 1 1 1 5 001 33 1 1 1 6 001 35 Ea 7 7 ul T 001 37 9 1 1 1 6 001 39 1 ul 1 3 001 41 fl 1 1 4 10 001 43 12 ul 1 2 100145 143 1 1 2 2 00147 14 1 1 2 3 001 73 15 1 1 2 4 001 75 16 ul 1 2 5 001 77 17 1 1 2 6 001 73 1 1 2 T 001 81 19 ul 1 Z a 001 03 20 1 1 2 9 001 85 21 1 1 2 10 001 87 22 1 3 1 001 89 23 1 1 3 2 001 91 25 1 1 3 4001 35 26 1 1 3 9 001 121 27 1 1 3 6 001 123 Oe 4 4 q 7 004A Image 4 Text file created by SpotMapper software Page 56 Appendix D Sensors Appendix D Sensors The BioOdyssey Calligrapher miniarrayer is equipped with sensors to assist you in completing a print run successfully The table below lists each sensor the message that will appear if a problem is encountered and the resolution for each problem Sensor Message Resolution Door
24. 5 55 11 Brazil 55 21 3237 9400 Canada 905 712 2771 China 86 21 6426 0808 Czech Republic 420 241 430 532 Denmark 44 52 10 00 Finland 09 804 22 00 France 01 47 95 69 65 Germany 089 318 840 Greece 30 210 777 4396 Hong Kong 852 2789 3300 Hungary 36 1 455 8800 India 91 124 4029300 5013478 Israel 03 963 6050 Italy 39 02 216091 Japan 03 5811 6270 Korea 82 2 3473 4460 Mexico 55 5200 05 20 The Netherlands 0318 540666 New Zealand 64 9415 2280 Norway 23 38 41 30 Poland 48 22 331 99 99 Portugal 351 21 472 7700 Russia 7 095 721 1404 Singapore 65 6415 3188 South Africa 27 0861 246 723 Spain 34 91 590 5200 Sweden 08 555 12700 Switzerland 061 717 95 55 Taiwan 886 2 2578 7189 2578 7241 United Kingdom 020 8328 2000 Sig 1205 22 0400 0001 Rev C
25. CAAAAAGET Maja s 8 HE 01018323 NM_001348 1 DAPK3 25619 GTCECECCTETEGACECCTAGECAAGAGCEGCCCTCTECA i2zja 9 H6 01015064 NM_003824 2 FADD 86131 ETGETGAGTTGAGTCTCCTCTCTGAGACTGCTAAGTAGGGE MBa ts HG 010 21246 NM_004052 2 BNIP3 79428 CCTEGATGATCAGTITTCTECTGAAGGCACCTACTCAGTA Maja jun HE 010 20498 NM_ 0132291 APAFI 77579 GAAAGAAGAGATACCTAGTATEATEGAGCTECAAATIIC ASJA jiz He 010 03090 NM_O329821 cCAsp2 108131 CCTAGCTTATCTCCCTGCTICATATCTCTCCCTTCTITACCI je i H 00 1278 NM 033339 2 CASP7 9218 AGAGAGGGAGTGAACTETGCAAACACACAGCCAGGAGTT Mie 2 HE 010 17899 NM_000450 1 82546 blood_inflammation G66CTEAACACTESCAACEACAAAGCCAACAGTCAAAACA Fle 3 He 010_20054 NM_o00885 2 blood_inflammation GACTTGAAATACTACTTACCATATGTGCTTECCTCAGTAA 9e 4 He_o10 16966 NM_001315 1 MAPKI4 79107 blood_inflammation AGCTTCAGCAGATTATGCETCTGACAGGAACACCOCCEEC 20e 5 HE 01017271 NM_0015281 HEFAC 10a4 blood_inflammation TCCTEACCCTCCAGCGGGACACCCTGETTCCCACCATTCCC e sje s HG_ono_oz7e1 NM 001795 2 CbH5 76206 blood_inflammation CCEAGETTCCCACTCTEGGCAAAGCCCCTCACACTECAAG 22je 7 HE 010 17044 NM_ 001957 1 EDNRA 76252 blood_inflammation CAACAAGTAACTTTETAGAAATGAGCCAGAAGCCAAGGC 3je a HE 010 17601 NM_ 002574 1 PRDXI 180205 blood_inflammation TCCTTTEGTAGGAATEGCCTGAGTTEGCETTETEGGCAGE 4e 9 H6 010 17623 NM_002608 1 PDGFE 1976 blood_inflammation TCCCTTCCCACCTACTGCACTIICCCCCTICCCECCTICCAA 25e 10 H6_o10_03354 NM_O0
26. EE E E AE A E A A EE E 6 Windows File SGTUCIUIG resect iepen E E a E AE E E E a E a EA A RE EER E E ei SEES 7 Chapter 3 Defining Print Parameters cccsseecssseeceseeeenseecenseeeseecenseeenseseanseseaseseassesoaseseaneeeonsesensessons 8 Starting the BioOdyssey Calligrapher Miniarrayer 2 0 ccccsccccseseeceeseecceeseeceseecceuseeceueeecsuueeessueeesauseseeseeesssaeeesseeees 8 Open the Define Parameters for Arraying WiNCOW ccccssecccseseeceeseeceenseeceececsuueeeseuseeseueeesaueeecauseessseeesssaeeessaeees 9 A ee NEW RUN eT eats acca ee ene EE ye ce dase a oss eases nse ante awed settee eee E E 10 UD Sie S VV OW sessies adseo isna iiaiai anaie eda kA iaai RENES hE ssecatnaenneoneuseostmeauessanees 10 ATE AV OU N a a a a a E 10 Advanced Grid VIMEO incdencaatatecntarsamcannnustinedisnsysnnienanenancentianiaceania shined nauiynedinedetonienens psncentianhaceiniananetimean nnd 12 2 01 616 Aner ener erent neers enn ne E ee ee ee een ee eee ee ert a eee er oree 14 Vm VIN COW oo scsos texpesonare tan aepnonenecaewe ree iiaa nea Ea enp aa e e na aeaaea niana 15 OPERONS INGON oa E E E seneeseawem anes onseens yee 15 Open an Existing RUN serioses nne a aa iaa arai ioia anaa s aa 16 ProdeinediFrOloCOlS irren ects r A patentee E E D E E a E EEEE E EEE E E ESR 17 Chapter 4 SourceSelect Mode ssansnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn mnnn nnnnnnnnnnnn nnmnnn mnnn nnmnnn 18 Creatin
27. I program the Calligrapher miniarrayer to print into 96 well plates This is done when defining your array parameters From the Arraying menu select Define Arraying gt select Create new arraying run and then select 96 well plates as your substrate of choice in the Substrates tab e Inthe grid layout window enter the number of samples that you wish to print Note the basic window allows up to 81 samples to be printed into a single well e Replicate the grids 12 times in the x directions e Open the Advanced window and under replicate supergrids enter 12 in the y column Note when printing into a 96 well plate you can only use up to 2 pins due to the spacing of the wells in the 96 well plates Can print an array without using the Plate Librarian and or SpotMapper Yes The Calligrapher will print a run directly from the vrk prg files without having to go through the plate librarian or SootMapper tools There is no special error message or warning Instrument Use How do I use the HCM e Access the Humidity Control window in the software and set the desired humidity level We recommend 55 when printing oligos or any sample WITHOUT cooling When printing proteins or any sample WITH cooling we recommend 40 e When setting the humidity please allow 15 30 minuties for the humidity to reach the set point and leave this on for the duration of the run If have the cooled BioOdyssey Calligrapher miniarrayer system how
28. Interlock Door opened Close door robot will restore positions and resume print run Wash Bath Water bath overfilled Call Technical Support 1 800 424 6723 US Vacuum Vacuum level insufficient 1 Ensure the vacuum tubing is connected to the Calligrapher miniarrayer 2 Ensure the power cable is connected to the Calligrapher miniarrayer Supply Bottle Supply bottle is empty 1 Ensure supply bottle is filled with the desired solution 2 Ensure the sensor cable and tubing are connected to the supply bottle 3 Ensure the sensor cable and tubing are connected to the Calligrapher miniarrayer Waste Bottle Waste bottle is full 1 Empty waste bottle 2 Ensure the sensor cable and tubing are connected to the waste bottle 3 Ensure the sensor cable and tubing are connected to the Calligrapher miniarrayer HCM HCM not attached 1 Ensure the USB cable is connected to the Calligrapher miniarrayer Page 57 Catalog 169 2000 169 2001 169 2200 169 2300 169 2040 169 2050 169 2060 169 2070 169 2017 169 2018 169 2019 169 2020 169 2004 169 2002 169 2003 169 2005 169 2010 169 2011 169 2011 169 2012 169 2013 Appendix E Catalog Numbers Appendix E Catalog Numbers Description BioOdyssey Calligrapher MiniArrayer System 115 V includes the arrayer 3 pins 1 of each pin type MCP100 MCP360 and MCP3108S platen adaptor waste and supply bottles vacuum pump Training DVD User Manual BioOdyssey Calligraph
29. N E A A A A E A A E A AA A N E A 44 FAO e E E E E E E 46 Appendix A Source Plates Compatible with the BioOdyssey Calligrapher Miniarrayer 000 52 Appendix B Available Tech Notes cccccccsseeceseesesecnseecnsecesseenseeeasenenseoaseceaseonsssonsseenesonsseassonsesonsess 53 Appendix C SpotMapper File Format cccssecsesseeesseecesseeenseecensesenseseasseseaseseanseceasesensessonsesenseesons 54 Append D SNS OS watercress i ee eet ce ESTEET aA aaa EA a Eaa 57 Appendix E Catalog NUMD SS sccccesseeceseesenneecenseeenseecenseeeaseeeesseseasesensseeoaseseansecoasesonseesonsesonsessons 58 Appendix F Safety Precautions sadauscsiawsteniceanaosaisessceusssnusarerssctnesusausesnessasvetsanaseasaususnnensenuiaaneshoreesusnuenaenuas 59 Appe dpDCG L gal NOU COS seicsccceeveanancacnsetsnaneatacecasancat cde vesdevotacasiinetandcalessotupaneedete onion Ri 64 Safety A The BioOdyssey Calligrapher miniarrayer is a precision arraying instrument that should be operated with care at all times Improper use and opening parts of the instrument to which access is not permitted by the user can be hazardous to the user or to persons who later come in contact with the instrument Refer to Appendix F for additional critical safety precautions The Calligrapher miniarrayer system conforms to the requirements of FCC class A equipment for the United States The instrument can cause inte
30. Odyssey Calligrapher MiniArrayer Chapter 6 Printing with the BioOdyssey Calligrapher MiniArrayer Once you have finished preparing the BioOdyssey Calligrapher miniarrayer for the print run you are ready to begin to print Prior to printing you may want to wash your pins please follow directions in the previous chapter for preparing your MCP pins Note The Calligrapher miniarrayer is equipped with a door interlock system for safety purposes Anytime the door is opened the robot is disabled Once the door is closed the robot will rehome for positional accuracy Starting a Print Run 1 If you have just defined and loaded an arraying run skip to Step 6 2 If you do not have a run loaded open the Console window by clicking on the icon or select File Console Console Aun Log HEM attached Reminders 3 In the console window select the Load Robot program icon 1 When the window opens browse to the prg program that you wish to run and select by highlighting the name Page 31 Chapter 6 Printing with the BioOdyssey Calligrapher MiniArrayer Look irs E default l z e E cg Jdix384val2 ldix384val eS Log File ic Map Files E Default ashing dixs64yal3 C ep1536va E Original plate Files k dix384v1 k dix384val4 E epvall a Plate library Pd dixde4ve s dix384val5 E epvalz 1 Power Test Co dix384v3 M dix384val6 epval2 2 ladix384val ll dix384vall ol dix384val Jepval3 lt iiil
31. alligrapher MiniArrayer The BioOdyssey Calligrapher miniarrayer has been designed for use with source plates that are produced according to the American National Standards Institute ANSI For further information on these standards please refer to the Society for Biomolecular Standards the Microplate Standards Development Committee MSDC We have tested the following plates and found them to be satisfactory with our default programs Plate Vendor Catalog Characteristics 1 96 Corning Costar 3371 clear PP 2 96 Nunc 267334 clear PP 3 96 Nunc 249944 clear PP 4 384 AbGene AB1055 clear PP 5 384 Genetix X7020 clear PP 6 384 Genetix X7022 clear PP 7 9384 Costar 3656 clear PP 8 384 Whatman 7701 5105 clear PP 9 1536 PerkinElmer 6005228 white opaque 10 1536 Greiner 782074 white opaque Page 52 Appendix B Available Tech Notes Appendix B Available Tech Notes 5308 9309 5310 5346 5392 5403 5437 5480 DNA Microarrays Optimization of Fabrication Parameters and Control Plate Design Demonstration of Superior Printing Accuracy by the BioOdyssey Calligrapher MiniArrayer Reducing Carryover Contamination During Microarray Printing Using the Molecular Imager PharosFX System to Image Arrays Printed with the BioOdyssey Calligrapher MiniArrayer Genotyping by Arrayed Primer Extension APEX Using the BioOdyssey Calligrapher MiniArrayer Cooling Characteristics for the BioOdyssey Calligrapher Cooling Module BioOdys
32. amount of evaporation from your source plate to maintain the concentrations of your denatured proteins Do you have a list of publications by researchers performing protein arrays in the scientific field Yes see Tech note 5480 Page 47 FAQ Pins What are the differences between capillary and solid pins Solid pins require re dipping after 1 2 spots while capillary pins have a sample reservoir that when filled with sample can deposit tens or hundreds of spots dip Why should I blot Blotting is used with any type of pin that is used for repetitive spotting to eliminate excess sample on the outside of the pin and to prime the pin This results in more consistent spot morphology We recommend that you blot 5 to 10 times before printing on plain glass slides cleaned with ethanol Can Telechem quill pins be used with the Calligrapher miniarrayer lf your Calligrapher miniarrayer was designed for use with the Telechem pins then the SMP3 pins which produce a spot of approximately 120 um on glass were used for the default parameters However different sized Telechem Stealth Micro Spotting SMP pins do fit in the printhead Note If you wish to use different pins you will need to adjust the spot distance in the Advanced menu Source Plates and Substrate Will the MJ plates round bottom or v bottom work with the Calligrapher miniarrayer No these are not recommended for microarray use What kind of slides do you recommend that we
33. ard use only a fuse that meets all type voltage and current specifications For more information about these specifications see Instrument Specifications at the end of this section The fuse is removed by prying open the small cover at the back of the Power Entry Module Calligrapher miniarrayer power cord detached first Slide out the fuse tray Remove the old fuse and replace with a new fuse of exactly the same rating T type 6 3A SB Reinsert the tray the same as it was before and again snap on the Power Entry Module cover Reconnect the power cord If the Calligrapher miniarrayer still does not work the Mains Power should have already been checked call Bio Rad Technical Support Operating the Instrument This device is designed to be operated on a level desk or benchtop in an office or laboratory environment and should not be moved during operation If moving the instrument in such a way Page 59 Appendix F Safety Precautions that the instrument might be shocked or tipped is required use the shipping block and the packing material that came with the instrument If these materials have been lost contact Bio Rad Technical Service When moving the Calligrapher miniarrayer the Vacuum Pump Humidity Control Module HCM Supply and Waste bottles and Refrigerator unit should be detached For more information about detaching these units contact Bio Rad Technical Support The Calligrapher miniarrayer should not be operated in a
34. ate we have created a file format to fill a source plate based on a predefined robot printing protocol An example of the file that will be obtained is found Appendix C Note that this is a tab delimited text file that can be open with Excel for use as a spreadsheet At the top of the file is information required to create the grid which can be removed for easier manipulation of your file The column labeled Block indicates the number of pins that you have defined in your print run The information in the next two columns indicates the location of the spots on the array The space in the next two columns provides space for your information The next three columns provide information about the location of the sample in the source plate Follow these instructions to create a BackTracker file 1 Create your arraying run and save the file see Chapter 3 2 Open SpotMapper following the directions above 3 Select the robot printing program you created click on the Open button and select Next 4 In the Select Source Plates window browse to the default Plate Library file and select Back Tracker 96 384 or 1536 plate well formats are indicated as 96 384 1536 depending upon the source plate you will fill Click on theAdd button Page 40 Chapter 7 Generating Mapping Files Select Source Plates Plate Files Browse Rur Plates Backtracker 384 plt 1 Backtracker 384 plt Formate 384 001 001 plt Formate 384 O02 O02 plt Fo
35. ates that can be accommodated by the parameters entered Substrates Grid Layout Blot Wash Options Blot Pins before Printing C Yes No Blot Distance micron 450 Number of Blots per Sample 5 All Blotting Slides are Sufficient for 11 667 Plates Cones Hep Page 14 Chapter 3 Defining Print Parameters Wash Window Your BioOdyssey Calligrapher miniarrayer has default washing parameters whose performance has been optimized in our facility using the MCP pins You may need to adjust these parameters in order to obtain the highest quality pin cleaning in your laboratory setting The wash window lets you adjust the wash parameters for your print run You can select to never wash your pins only wash between different samples or dips or always wash the pins between dips and redips There are three wash cycles available a Pre Wash a Cycle Wash and a Final Wash Each of these is used during the entire print run Note The Calligrapher miniarrayer performs an initial prewash of your pins prior to starting the run Within each cycle are various steps that can be altered through pull down menus Each step can be programmed for the Vacuum Wash 1 passive bath or Wash 2 Flow Through bath The time for each step is adjusted using the up down arrows If you change any parameters press apply Define Parameters for Arraying Substrates GridLayout Blot Wash Options Pre Wash step SEEM Time
36. brarian tool used to reformat text files txt containing plate content information into new files compatible with SpotMapper files contain a plt extension The newly created plate files are then stored in the Plate Library Platen work surface that holds the different types of substrates used for printing microarrays Printhead the part of the robot in which pins are loaded before starting a printing protocol The printhead guides the movement of the pins with high precision during the microarray printing procedure SourceSelect Editor is a novel feature included in the Calligrapher miniarrayer that allows users to select and print sample from selected locations in the source plate The SourceSelect Editor creates a file ssr that can be imported into the printing program SpotMapper tool used to generate Map files The SpotMapper combines a plt file with a vrk file to generate a Map file gal otk and txt Substrate different types of solid supports used for immobilization of sample oligonucleotides CDNA proteins etc Glass slides nitrocellulose and nylon membranes and 96 well plates are the most commonly used substrates for printing microarrays In general you will observe larger spots or spot spreading on plain glass slides or membranes compared to coated glass slides e g Corning UltraGAP or Whatman FAST Slides Supergrid cluster a group of grids printed on a substrate by all the pins loaded in the printhead when
37. ccession symbol Description Exciting gene n Exciting gene n Exciting gene n Exciting gene n Exciting gene n Exciting gene n Description Plate_Name 6 Select the samples that you wish to print by highlighting the row or rows Select Input File source Plate Type Input File Output File Sample Sample Row Column Row Coum Nam CO Sb ywell ie 3od well Formatz_384_001_001 pht ie 0 001 03 001 04 001 05 001 06 all sample_t al sample_ a03_sample_ al4_sample_ a05_sample_ alb_sample_t al camnle f UU ale samp al3_samp a04_ samp alS samp aUb_sarnip 1536 well CS 000 cs 0002 Cs 0003 cs 0004 Cs 0005 C5 0006 rS Nnn cs no02 Co O003 Cs 0004 C5 0005 CS O006 Symbol Name Accession AE Description Plate Name Exciting qe Exciting qe Exciting qe Exciting qe Exciting ge Ds 0002 Ds 0003 Ds 0004 DOS 0005 Ds 0006 DS 0001 DS 0002 DS 0003 Ds 0004 DS 0005 DS 0006 mis nnin Description Exciting gene n Exciting gene n Exciting gene n Exciting gene n Exciting gene n Exciting gene n Fyrcitinna aana n gt Insert Formate 3 Formate 3 Formate 4 Formate 3 Formate 3 Fe Total Number of Samples Delete Total Number of Plates Seve save and Clase Cancel Help 7 Click add Note multiple adjacent r
38. check the phase of the printing run and the estimated remaining time for the completion of the run The estimated run time is presented after 2 full print cycles as the pins approach for the third dip Backtracker files file format that allows you to create your own plate content file based on your source plate and the printing protocol used to print these samples Blot removal of excess sample from the outside of capillary pin MCP100 MCP360 to ensure homogeneous spots We do not recommend blotting with solid pins Blot distance the distance in microns between blotted spots in both x and y coordinates As this distance increases it also increases the number of slides needed for blotting a certain number of samples Calibration procedure used to define the x y and z coordinates of different points in the Calligrapher miniarrayer that are important for the printing process Access is limited to Bio Rad Service personnel Console allows you to established an interactive dialog with the embedded instrument controller The console is used to home load start pause continue and stop printing programs In addition messages are displayed about the current arraying run in the console window Dwell time Source plate the time the pins spend in the source plate This feature is useful when dealing with viscous samples as a longer dwell time in the source plate will enable maximal uptake of viscous samples Dwell time Printing parameters
39. ction Replicate Supergrid Clusters No of Replicate Supergrids Distance between Replicate Supergrid Clusters mm Sample Picking Direction in Source Plate Full Grids Require 400 Samples Left right Top down Accept Grid Layout e Top bottom margins These values will determine the overall X and Y positions of the grids on the substrate e Distance between Spots micron These values will affect the spacing between each spot Page 12 Chapter 3 Defining Print Parameters e No of Spots per Grid Number of spots in each grid in the x and y directions e No of Replicate Spots per Grid Number of replicate spots in each grid These are printed adjacent to each other and in immediate succession i e no wash step is involved e No of Reprints of the Same Spot This value sets the pin to respot at the same location the chosen number of times e Grid Printing Direction Use the pull down menu to enter the direction the grid is printed Default is bottom up left right e Supergrid Cluster If you have more samples to spot than the grid that you have defined will accommodate supergrid clusters should be selected This option will maintain your grid dimensions and spot all samples in that configuration Supergrids can be created in the x or y direction depending upon the configuration of the grids For example if you have 400 samples to print and 2 pins to print with you may wish to create 10 x 10 grids I
40. e BioOdyssey Calligrapher miniarrayer is designed for use with source plates meeting the ANSI SBS standards Specific source plates that are compatible with the BioOdyssey Calligrapher miniarrayer are found in Appendix A e Pins Select the pin type MCP100 MCP360 capillary or MCP310S solid 1 each supplied with the BioOdyssey Calligrapher miniarrayer Also select the distance between the pins Note For 96 well plates the distance is automatically set at 9 mm to match the distance between the wells For 384 and 1536 well plates the distance between individual wells is 4 5 mm e Printhead Use the pull down menus to enter the number of pins that you will place in the printhead in the X and Y directions Load the pins in exactly the way you indicate e Number of Samples Enter the number of samples you will be printing Page 11 Chapter 3 Defining Print Parameters e Replicate Spots Enter the number of replicates of each spot that you want to print Spots will be replicated in only the Y direction e Replicate Grids Enter the number of replicates of each grid that you want to print Grids will be replicated in only the X direction e Number of Spots to be Printed This number is calculated automatically based on the number of samples and the number of replicates entered The default grid printing direction on the substrate is bottom up left right In the lower left window an image of the pattern of the grid that will be
41. easesoasesoensesonseess 36 Plate Librarian SOM AC oss cots decocecies cetscc cues soendnpassdinasdeqas aaia aa aeiaai aeaa Dadia indiai Ea ad a Eed ia a Eoia iaia 36 Creating a Text File txt to Be Imported to the Plate Library ec ccccceececeeeeceeeeeceeeceeeeseeeseueeseeeesaeessageeseneess 36 Importing a txt File to Plate Librarian Software ccccccseeccccessecceeseeceeeeeeceueeeceseessueeessueeecseeeeseueeessaeeeeseeeeeseas 37 Creating a Map File with SpotMapper Softwar e cccccsscccssececeececeececeeeeseueeceuseeseeeeseueeseeessueesaueeesaeesseneeseneess 38 Back racker SON Wale FilES simarras aieeaa naii eaa a aa a aE Aaaa aeeti Aai Aaa E kaaa Eaa aaa RE Nea aiaa 40 Chapter 8 Maintaining the BioOdyssey Calligrapher MiniArrayer ccccsssccceesseseeeseeseesseeseesseneeeeees 42 ECP GED eiee E carats uid E A Satine banish R saath oeag E 42 MCP Loading Tool Cleaning costes es peace ret oad fat nn eens ete orden tsi hms aah esd oak census tenn naaa EAA EEEa ion tee ints diiestnsaeinetaace sh 42 Gl aning the PHANG A os sxiccsancctmeastecieasin o a E E EREE REEERE E eea a TER RE ica ET EEE E 42 Humidity Control Module HCM 001n00nnnannnannnannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnrennnennrronrennrrnnrrnnrnnnrrnrrnnrrrnrrnnnrnnrrnnrrnnrenrrrenene 42 MATA ine Desie aNieesses ni a tahoe clone EEEa idiot aE EEEE dca samen EE E a dy satte 42 Seme iS PUM e E A E A A E A E E E sete 43 MNOS i E AEE AA
42. ections 1 Highlight the row you wish to insert in the Input File window Multiple adjacent or nonadjacent rows can be inserted by selecting as described above 2 Highlight the location in the Output File that you want to insert your samples The sample to be inserted will appear above the highlighted row 3 Press Insert 4 Save the file by clicking on the Save button Deleting Samples in Your SourceSelect File 1 Highlight the row you wish to delete in the Output File window and press Delete Multiple adjacent or nonadjacent rows can be deleted by selecting as described above then pressing the Delete key Page 21 Chapter 4 SourceSelect Mode 2 Save the file by clicking on the Save button The file is saved as an ssr extension in the user s directory Open an Existing SourceSelect File 1 O oo A W N T Select Arraying SourceSelect Editor and the Selection window appears Select Open an existing SourceSelect file In the Open window that appears select the ssr file to edit The Select Input File window opens with your ssr file in the bottom window To add or delete from this file follow the directions described previously When you have completed your SourceSelect file press Save and enter a file name in the window that opens A pop up window appears giving you the location of the ssr file that was created Define a SourceSelect Run j Selection Dialog Select Array
43. ep 1 iE a Wash Bath 1 Oscillate Pins me a s Time a s Time fa s Distance in X mm Number of Times Wash Bath 2 m Cycle Wash Step 1 wash Step 2 Vacuum Step 3 wasi Step 4 Vacuum v Time b Ho Time ho 46 Time 5 241 63 Time fiz Oscillate Pins Distance in Z mm Cycles Number of Times Vacuum Oscillate Pins Yes Final Wash Pin Type Step 1 None l Step 2 None v Step 3 None v Time a s Time fa s Time fa s C MCP3805 fe MCP100 C MCP360 Wash1 Passive Bath Default Cancel Help Washe Flow Through Bath Page 28 Chapter 5 Preparing the BioOdyssey Calligrapher MiniArrayer for Printing Operating the Humidity Control Module HCM The HCM has been designed to maintain constant humidity within your BioOdyssey Calligrapher miniarrayer Turn on the HCM by clicking the HCM icon or selecting Setup Humidity Control Fill in the desired values in the window that appears The window will also display the current humidity the current temperature in the chamber and the estimated temperature on the platen Hint We suggest printing DNA at a humidity value between 55 and 60 unless you are cooling the platen Using the Cooled Platen To use the cooled platen option follow these directions carefully Note Overcooling of the Calligrapher miniarrayer w
44. er MiniArrayer System 230 V BioOdyssey Calligrapher MiniArrayer System with Cooling Module 115 V includes a refrigerated circulator with digital control Humidity Control Module 169 2040 the arrayer 3 pins 1 of each pin type MCP100 MCP360 and MCP310S platen adapter waste and supply bottles vacuum pump Training DVD User Manual BioOdyssey Calligrapher MiniArrayer System with Cooling Module 230 V Humidity Control Module HCM includes the module water bottle filter and dessicant Cooled Platen Upgrade 115 V includes refrigerated circulator with digital control Humidity Control Module 169 2040 not included but required Cooled Platen Upgrade 230 V includes refrigerated circulator with digital control Humidity Control Module 169 2040 not included but required Custom Calibration Software Upgrade includes on site training User Manual and password MiniArrayer Accessories MCP100 capillary pin MCP360 capillary pin MCP310S solid pin MCP Loading Tool Plate amp Membrane adaptor Wash Bottle 2 L Waste Bottle 2 L Static Bath Cups 10 ea Magnets small Magnets large HCM Accessories Dessicant Tube Dessicant 250 g Filter Page 58 Appendix F Safety Precautions Appendix F Safety Precautions A Observe the following precautions to ensure your personal safety and to prevent damage to either the instrument or the equipment connected to it Failure to observe these precautions may resul
45. es See Chapter 4 SourceSelect Mode Once you have generated a Source Select file ssr follow Steps 3 5 Page 3 Chapter 2 BioOdyssey Calligrapher MiniArrayer Software Chapter 2 BioOdyssey Calligrapher MiniArrayer Software This section describes the features of the BioOdyssey Calligrapher miniarrayer user interface The software runs on Windows based operating systems and has several pull down menus and easy to understand icons Use this section to familiarize yourself with the screen layout and the functions of buttons and menus The Main Window When you start the BioOdyssey Calligrapher miniarrayer software the Main Window in the user interface opens It is composed of three parts the menu the toolbar and the information bar This chapter details the functions of each of these Menu Options The BioOdyssey Calligrapher miniarrayer software has nine menu headings six are designed to be used for printing and mapping These are File View Setup Manual Control Arraying and Help Access to the Calibration menu is only acessible to Bio Rad Service personnel You can modify the calibration settings via the Define Array Parameters window by clicking on the Modify Calibration button with purchase of the Custom Calibration Upgrade detailed training is included with purchase Although the Edit and Window headings are standard in Windows programs they are not available in the BioOdyssey Calligrapher miniarrayer so
46. ftware In the tables below you will find details of each available heading subheading and a brief description of each File Menu The following options are available on the File menu OPTION DESCRIPTION Op Select this option to open an existing program prg parameters par define def or log file log rlg View Menu The following options are available on the View menu OPTION DESCRIPTION Toolbar Select this option to display the toolbar Status Bar Select this option to display help information Array Monitor Select this option to display the Array Monitor to monitor a printing procedure in real time Page 4 Chapter 2 The BioOdyssey Calligrapher MiniArrayer Software Setup Menu The following options are available on the Setup menu OPTION DESCRIPTION Set Ports Select this option to change the serial communications port for the instrument and to reestablish communication with the robot Note This procedure occurs automatically each time you start the BioOdyssey Calligrapher miniarrayer software program You only need to select this option if the instrument has been turned off and on without exiting the software Humidity Control Select this option to open the humidity control window to adjust the humidity to the desired level Temperature is also displayed Manual Control Menu The following options are available on the Manual Control menu OPTION DESCRIPTION Joystick The option is availab
47. g a SourceSelect FS aa seis ates tate he ce datcecenssiieasc Gusiiauinsn hen taicsies salenbaind hearanidasueu union anteaje Bead diimce guint ances Uuexietedcnes Uanceamietaanans 18 Inserting Samples in Your SourceSelect File cn wuiisnistescvcinesssitcowouin snserriconvincdosaaeianddws cies snitdreuiguntedusiddewadniwtaniimds ahecaiioie eres wlbrnnes 21 Deleting Samples in Your SourceSelect File ccccccssceccececceeeeeceessecceseecsaseeceeeeeeeseessaueeesegeeessuseessaseeeseeeesseeeeess 21 Open an Existing SourceSelect File scconssesssisesasics snsdsasiesisuiids antinatigets ose sicsilonieiahinibna edivadidddendienehtisensiivetiielfs wan Veindelsmdeetanna ode aseiede odews 22 Define a SourceSelect Run asecse sides repens detec eeu cies putts aie Bates otic van ctdtnes tates asede Mentiootcatileat a sa Gutta denanena sinc Gees heoates Wiestecttest anes 22 Chapter 5 Preparing the BioOdyssey Calligrapher Miniarrayer for Printing sccssssseesessseeeeeeees 24 Placement of Substrates on Platen c ccccceccccecesceeecceeeeceeeecceeeeceneeceneeceneeseaeecanceseeecneesaneesceeesoeaesoeseeceaeesousesoess 24 Flacement OF BIOTIC GIG SS scissa Er aa EE aE a EN E a e a Ra EEEa 25 Placement of the Source Plate iecis sandnnsintncorniesasuwersaunsncsibned stone ruses iwemtinnhadwetiarsinnduantusinadd pudy uniienedenbavanbianimeenianasieentonnilds 25 Load Fins MO Teh AS AG erreser e e aa AE EA EE EEE Ea 25 Load ine MCP PINS a sacs de
48. grapher miniarrayer e Humidity control module HCM e Cooling module cooled platen slide and source plate area external chiller unit and HCM e Custom Calibration Software e MCP Loading Tool Can use a laptop to run the Calligrapher miniarrayer No we strongly recommend a dedicated PC desktop computer as detailed in the product literature and user guide How much bench space is required for safe operation of the Calligrapher miniarrayer One of the nice features of the Calligrapher is its small footprint 52 1 x 55 x 39 4 cm however you should allow for at least 5 cm clearance behind the instrument The Calligrapher miniarrayer door opens upwards and therefore you will require approximately 30 cm clearances on top of the machine The power switch is on the right side so please allow at least 5 cm clearance on the right side in order to access the power switch General Printing How long will it take to print my microarray using the Calligrapher miniarrayer The length of the print run will depend upon the number of samples replicates blotting options type and quantity of pin type of source plate but MAINLY the washing parameters With the Calligrapher miniarrayer it will take less than 2 hours to print 384 spots on 16 slides using 8 pins with minimal to no contamination It will also take approximately 2 hours and 45 minutes to print 10 x 10 arrays with two replicates into all the wells of a 96 well plate What are the ma
49. hatase 1 4 1 NM_00331 Tumor suppressing subtransferable candidate 3 40 4 4 F hlanl Dandamivadl nanstiva rantral Image 2 GAL file output generated by SpotMapper software OX Type a question for heap Six E Microsoft Excel tstest btk it Fle gt Edit few Insert Format Tools Data Window SSAPDM Help Adobe PDF iid z NA shy Sy 2 ll F a A a 0 B U REST Fp 0 9 PO Renai Changes End Review EEN La aad SE A _ A A a SS SS eS See xl ale na 2 14 j Type GenePix ArrayList V1 0 BlockCount 8 5 BlockType 0 EJ Supplier Bio Rad Laboratories ArrayerSoftwareName BioOdyssey Calligrapher ry ArrayerSoftwareVersion 1 1 1000 9 Block1 28325 6000 120 15 300 15 300 10 Block2 012825 6000 120 15 300 15 300 11 Block3 28325 10500 120 15 300 15 300 12 Block4 212825 10500 120 15 300 15 300 13 Block5 38325 15000 120 15 300 15 300 Block6 012825 15000 120 15 300 15 300 15 Block7 28325 19500 120 15 300 15 300 16 Block8 212825 19500 120 15 300 15 300 ATF Block Column Row ID Name SP_no SP_row SP_col Accession Symbol Description 18 1 1 1 001 25 b01_samp 1B 1 CS 0025 DS 0025 Exciting gene no 0025 19 1 2 1 001 25 b01_samp 1B 1 CS 0025 DS 0025 Exciting gene no 0025 20 1 3 1 001 25 b01_samp 1B 1 CS 0025 DS 0025 Exciting gene no 0025 214 1 4 1 001 27 b03_samp 1B 3 CS 0027 DS 0027 Exciting gene no 0027 22 1 5
50. he Supply and Waste Bottles DB9 cable between Calligrapher miniarrayer and HCM Humidity Control Module Dimensions W x D x H 30 5 x 49 x 30 5 cm 12 x 19 3 x 12 Weight 8 4 kg 18 5 Ib Maintains 20 63 RH Cooling Module Cooling capacity 10 15 C Page 62 System Requirements PC requirements Minimum Recommended Screen requirements Minimum Recommended Appendix F Safety Precautions Windows 2000 or Windows XP operating system CD ROM drive USB port Adobe Acrobat 6 0 or higher 800 MHz processor 128 MB RAM 1 GB hard drive 1 GHz Pentium processor 256 MB RAM 20 GB hard drive 1 024 x 768 pixel resolution 256 colors True color mode 24 bits A dedicated IBM compatible desktop PC is recommended for use with the Calligrapher miniarrayer Page 63 Appendix G Legal Notices Appendix G Legal Notices Acrobat is a trademark of Adobe Systems Costar is trademark of Corning Costar Corporation Excel Windows Windows 2000 and Windows XP are trademarks Microsoft Corporation Omni is a trademark of Nalge Nunc International Pentium is a trademark of Intel Corporation Stealth Microspotting Pin SMP is a trademark of Telechem International Inc Tween is a trademark of ICI Americas Inc UltraGAPS is a trademark of Corning Inc Page 64 Life Science Group Bio Rad Laboratories Inc Web site www bio rad com USA 800 4BIORAD Australia 02 9914 2800 Austria 01 877 89 01 Belgium 09 38
51. id enters those components Quickly unplug the Calligrapher miniarrayer the vacuum pump and or the computer if such occurs Contact Bio Rad Technical Support for cleaning procedures 4 Do not operate the Calligrapher miniarrayer or any of its attached components if electrical cords or fluid vacuum hoses become frayed or damaged 5 Do not use the Calligrapher miniarrayer or any of its components if case cracks large enough to see internal components occur Mechanical Use Cautions The Calligrapher miniarrayer is heavy Use caution when lifting or otherwise moving Bodily injury can occur if the Calligrapher miniarrayer the HCM the vacuum pump or the computer are allowed to drop on anyone in proximity to the system Cleaning the Instrument To clean the instrument externally use a soft rag dampened only with soap and water or glass cleaner Internal cleaning other than routine platen and printhead cleaning should be done by a Bio Rad technician only Precautions Regarding Failures 1 Do not operate the Calligrapher miniarrayer if the door interlock fails to stop the Calligrapher miniarrayer when the door is opened contact Bio Rad Technical Support 2 Use of magnets to defeat the door interlock is done at the customers risk 3 If for any reason the door does not slowly drop to the closed position when released do not use the Calligrapher miniarrayer contact Bio Rad Technical Support 4 If for any reason the door does
52. ight Grid Margin mm 6 o5 Distance between Spots micron 270 4 270 No of Spots per Grid io lt 4 10 No of Replicate Spots per Grid 1 l 1 p Lf No of Reprints of the Same Spot Grid Printing Direction Bottom up Left right Supergrid Cluster e No of Different Supergrids Sa 2 Distance between Supergnds mm 45 45 Supergnid Printing Direction Left right T op dowr Replicate Supergrid Clusters No of Replicate Supergrids gE Distance between Replicate Supergrd Clusters mm oie Sample Picking Direction in Source Plate Full Grids Require 400 Lett right T op down Samples Substrate Accept Grid Layout Cancel e No of Different Supergrids use the up down arrows to change the number of supergrids They will appear on the substrate image to the right e Distance Between Supergrids use the up down arrows to change the distance between the supergrids The distance is measured from the top left column in the first grid to the top right column in the next e Supergrid Printing Direction use this pull down menu to indicate the direction your grids are printed on the substrate Page 13 Chapter 3 Defining Print Parameters e Replicate Supergrid Cluster Once you have defined your grids and supergrids this is a quick way to replicate them at different locations on the substrate e No of Replicate Supergrid Clusters Use the up down arr
53. ill result in excess condensation which may require a service call 1 Ensure that your dessicant is adequate Note We strongly recommend beginning a cooled print run with NEW or regenerated dessicant 2 Fill the refrigerated circulator with 50 ethylene glycol 3 Set the refrigerated circulator to 0 C one hour before you plan to print 4 Turn on the Calligrapher miniarrayer and launch the software 5 Open the Humidity Control Window and set the desired humidity to 40 Note This setting is required to remove condensation from the instrument 6 Load your substrate blot slides and pins Caution Do not Home the robot until you are ready to begin your print run Note Leaving the door open for long periods of time will result in condensation forming in the instrument and on your slides To maintain the proper humidity work quickly any time the door is open 7 Prepare your source plate and define your arraying run Page 29 Chapter 5 Preparing the BioOdyssey Calligrapher MintArrayer for Printing 8 After approximately one hour the chamber temperature should register between 15 and 17 C the cooled platen temperature 10 C and the humidity between 40 and 45 9 Quickly load your source plate 10 Home the robot 11 Begin your print run 12 When the print run is complete turn off the refrigerated circulator open the door and remove your slides and source plate Page 30 Chapter 6 Printing with the Bio
54. in and minimize droplet formation on the outside of the tip The Z Down Offset will allow you to make incremental changes in the z axis to ensure that the pin is able to reach the source plate bottom to collect the sample Page 15 Chapter 3 Defining Print Parameters e Printing Parameters Varying the Z Down Offset Approach speed and Dwell Time for the Printing Parameters will optimize sample output onto the substrate The Z Down Offset is especially important since this dictates the downward motion of the pins in order to reach the substrate surface This must be adjusted based on the type of substrate that you are printing Coated surfaces such as nitrocellulose slides will require fine adjustment of this parameter Note A negative value moves the printhead up and away from the platen e Varying the Approach Speed and the Dwell Times will result in soot morphology differences e Wash Baths Oscillating the pins will assist in washing by reducing carryover from sample dip to sample dip e No of Substrates between Redips This dictates the number of substrates to print from a single dip into the well of source plate This allows the pin to redip into the source plate for additional sample Once you have entered all of your chosen parameters on the Define Parameters for Arraying Window first click Apply and then click OK A dialog box appears requesting a file name Enter a name and click OK The file is saved with several file
55. ing Define Arraying C Create new arraying run Create Source Select run Cancel Open an existing run 2 In the Selection dialog select Create SourceSelect run press OK 3 The Define Parameters for Arraying window opens 4 Select the Grid Layout window De fine Parameters for Arraying Substrates Grid Layout Blot Wash Options Source Plate Printhead Pins e MCP100 MCP360 MCP310S iE SourceSelect file __Browse wy O O Number of Samples Number of Spots to be Printed 384 Replicate Spots in Y E re Replicate Supergrids in X 1 ET Substrate Ez 5 Help Enter the pin type MCP100 MCP360 or MCP310S Note In the SourceSelect mode printing is done with a single pin 6 Browse to the ssr file that you wish to run and click on Open Page 22 Define Parameters for Arraying Substrates Grid Layout Blot Wash Options Source Plate C si 384 C 153 Printhead Browse kara Lookin jamie a IB Log files Map files IO Original plate files d Plate Library E test ssr ssr Number of S sites stones ea OK Cancel Any Help Chapter 4 SourceSelect Mode 7 The number of samples spots and replicates to be printed appears and a grid is automatically generated 8 For all other parameters in the Define Parameters for Arraying window follow the directions in Chapter 3
56. ip holders 9 Replace the green cover of the HCM Changing the Filter The HCM contains a filter used in adding humidity to the system It is recommended that this filter be changed every three months The filter can be ordered from Bio Rad catalog 169 2013 Follow these instructions to change the filter ON OO Locate the filter cover at the top rear of the HCM Using the finger grip remove the cover by sliding to the rear Unfasten the two thumbscrews to release the clear cover Carefully remove the filter and replace with a new filter Replace the clear lid with the guide facing away from the instrument Tighten the thumbscrews N OF BR WDB Replace the lid by sliding it in place Page 43 Glossary Glossary Approach speed source plate the speed that can be selected for the pins to enter into the source plate wells For more viscous samples you may wish to slow down the approach speed for maximal sample uptake by the pins Approach speed printing parameters the speed that can be selected for moving the printhead towards the slides membranes or 96 well plates Adjusting varies spot morphology If the approach speed is increased the pin will tap the substrate more forcibly and produce a smaller spot The converse is also true decreasing the approach speed will produce larger spots Array Monitor a graphical representation of the current state of execution of an arraying run It allows you to
57. is humidity simply set the desired humidity to 55 in the Control Panel window When using the cooling option the chamber requires dehumidification Set the desired humidity to 40 in the Control Panel window You may also consider decreasing the dwell time Finally adjusting the z height may improve morphology Please note that these parameters are dependent upon the sample and substrate type Why do I see inconsistent spot sizes in my membrane array Several things can lead to inconsistent spots in your array This can include inadequate maintenance of pins or inefficient pin cleaning an uneven substrate surface or printing parameters that have not been adequately optimized e To increase the consistency of spot size ensure that your pins are cleaned e f printing on membranes e Adhere them to the OmniTray with a small piece of double stick tape which will reduce the fluctuation in the substrate surface e Adjust the printing parameters the approach speed should be at 10 mm s the dwell time can then be varied from 50 msec to 5 msec to minimize the amount of wicking of the sample from the pins e Adjust the z down height so that the pin barely touches the membrane to avoid too much of the sample wicking off the pin onto the membrane Why am I observing carryover between spots in my array In most cases sample carryover is a result of inadequate washing of the pins between dips The inert surface of the MCP capillary pins
58. itor window L 2 Available only to Bio Rad service personnel and via Custom Calibration option To open the Humidity Control window To wash the pins automatically with the default program To automatically move the print head to the proper position to load the pins A To open the window to define your arraying run To open the Calibration window To open the BioOdyssey Calligrapher miniarrayer User Manual To open the Control Panel Accessible only to Bio Rad Service personnel Status Bar This bar is found at the bottom of the main window and is used to display help information Page 6 Chapter 2 The BioOdyssey Calligrapher MiniArrayer Software Windows File Structure When the program is initiated it asks for a username Each user is assigned a file in which their programs and sub files are stored Files used with your arrayer are saved in several formats listed below Each of these can be opened by a text program such as Microsoft Notepad The ssr gal btk txt plt files can be open with Microsoft Excel Calligrapher File Edit View Favorites Tools Help Back ei S Search Wes Folders Ezz Address C Program Files BIO RAD A Calligrapher El 5 Bio Rad A i software C BioOdyssey Calligrapher 2 0 Software L Temp El users Faq ICi Log files C Map files C Original plate files O Plate Library File Extension par Stores the parameters of the run def Stores parameters of
59. le must be defined Open the Define Arraying Selection Dialog by choosing Arraying Define Arraying from the main menu or clicking on the Define Arraying button The Selection Dialog has three options for defining an arraying run These are 1 Create new arraying run 2 Create SourceSelect run or 3 Open an existing run Options 1 and 3 are described in detail below option 2 SourceSelect is described in Chapter 4 Within the program you will find a basic window that will automatically create a grid for you based on the number of samples and the number of pins that you enter If you would rather create your own grid layout an advanced window is available that allows you to alter many parameters see page 11 Selection Dialog f Create new araying run C Create Sources elect run Cancel f Open an existing run Page 9 Chapter 3 Defining Print Parameters Create a New Run First select the Create new arraying run option in the selection dialog box Click on the OK button and the tab selectable Define Parameters for Arraying window opens There are 5 tab selectable windows containing parameters that can be adjusted to fulfill the requirements of your arraying run Note For basic print runs it is only necessary to enter parameters into the substrate and basic grid layout windows Define Parameters for Arraying Substrates Grid Layout Blot Wash Options Substrates i Slides lO Membrane C 96 We
60. le only to Bio Rad service personnel Control Panel Select this option to open the control panel to manually control the vacuum and wash baths Select this option to automatically prepare the pins for printing prime and wash the pins Select this option to automatically move the printhead forward to load the pins Arraying Menu The following options are available on the Arraying menu OPTION DESCRIPTION Define Select this option to create a new arraying run open an existing run or create a Arraying SourceSelect run Sample Select this option to generate files to map the spots on your arrays to the samples in Tracking your source plates Define Select this option to open a window that allows you to define a manual wash Washing program SourceSelect Select this option to create or open a SourceSelect file Editor Page 5 Chapter 2 The BioOdyssey Calligrapher MiniArrayer Software Help Menu The following options are available on the Help menu OPTION DESCRIPTION Calligrapher Select this option to open the user manual in searchable pdf format Help Calibration Help Calligrapher Toolbar The toolbar consists of eleven icons that allow you to control the robot Many of these functions are also found in the main menu The table below shows each icon and briefly describes its function Icon Function To open a new window to select a file to open m To open the console dialog window La To open the Array Mon
61. ll Plates Size of Substrates x Standard C Custom 25 495 75 5 mm Modify Calibration Substrates Window Enter the type size and number of substrates that you will be printing your array onto in this window see image above e Enter the type of substrate you will be printing This will be a slide a membrane ora 96 well plate e Select the size of the substrate Standard size for slides is 25 4 x 75 5 mm for membranes 65 x 105 mm for 96 well plates 62 9 x 98 9 mm e Using the up down arrows on the right side of the screen adjust the number of substrates in the x and y position e When you have finished entering your parameters press the Apply button to save the information e Modify Calibration is active only if you have purchased the Custom Calibration software upgrade Please refer to the Custom Calibration Use Manual for more information Note To use custom sizes you must have the Custom Calibration upgrade package which allows access to the calibration parameters Contact your Bio Rad sales representative for more information for US Customers call 1 800 4BIORAD Grid Layout Window The Grid Layout Tab opens the window to enter parameters for your arraying grid The window is divided in half In the upper portion enter your printing parameters Select the Source Plate the type number and orientation of Pins and the number of Samples and Replicates to be printed Page 10 Chapter 3 Defini
62. motiv 001 05 5 sa C5S0005 05 0005 3100005 Excitin Demotiv 001 06 CS0006 DS5 0006 3100006 Excitin Demativ 001 07 D7 sa CS O007 DS 0007 3100007 Excitin Demativ Accession Symbol Description Select destination folder Back Cancel Help Page 37 Chapter 7 Generating Mapping Files 5 Browse to the destination folder to save the file s that you have created If you do not browse to a specific folder the file will be saved in the users folder in the Plate Library file See page 7 6 Press Finish to close the program Creating a map file with SpotMapper Software The next step in creating your Gal file requires merging the arraying file with your plate file 1 From the main menu select Arraying gt Sample Tracking SpotMapper 2 In the Arraying Parameters File Name window browse to the folder that contains the printing protocol required to create the gal file The arraying file is normally stored in your user file and has a vrk extension Arraying Parameters File Name Enter the Araying file name log wrk Selected file parameters SourceSelect No Plate Pickup Direction Left to Right Tap te Bottom PinHead 2 2 Number of Dots per Grid 10 10 Dot Spacing 300 300 Duplicated Dots per Grid 1 1 Print Direction Bottom to Top Left to Right Number of Supercrd 1 1 Superard Spacing 4500 4500 Duplicated Super Grid 1 1 Duplicated Supertand Spacing
63. n environment where heavy airborne particles are present Use the instrument only as specified in this document use other than as specified may cause impairment of the safety precautions of the system This instrument is for indoor use only Do not place the bottles or other parts of the Calligrapher miniarrayer system on a high shelf due to the potential of operator injury The bottom of the bottles should not be placed higher than the shelf on which the Calligrapher miniarrayer sits Do not operate the instrument with loose or disconnected tubing unless specifically indicated as permissible in this manual Do not mix the drain and fill lines as this could result in the application of contaminated fluid within the Calligrapher miniarrayer printing compartment Avoid running out of water from the Supply bottle and expect cross contamination if such occurs Do not use the vacuum pump on the same table or benchtop as the Calligrapher miniarrayer The vibration can modify the quality of printing The vacuum pump openings should not be blocked Do not put the vacuum pump close to the wall maintain at least two inches of separation Do not operate the Calligrapher miniarrayer system if the vacuum pump tube is not attached The Calligrapher miniarrayer openings at the rear of the instrument should not be blocked Do not put it close to the wall maintain at least two inches of separation lf the cooling option is present and turned off
64. n the basic window you would select 2 pins In the Advanced window you would enter the number of spots in the grid 10 x10 grid The first two grids printed would accommodate 200 samples which is reflected in the Full Grids Require box in the bottom of the window See image on the left below Samples In order to print all 400 of your samples you would select 2 in the number of different Supergrid Clusters You now would have 2 pins printing 2 different 10 x 10 grids or all 400 unique samples See image on the right below Grid Top Left Grid Margin mrm Supergnid Printing Direction i Replicate Supergrid Clusters 6 1054 4 Bottom Right Grid Margin mm 6 l O05 Distance between Spots micron 270 44 270 44 No of Spots per Grid 10 10 4 No of Replicate Spots per Grid 1 i 1 7 No of Reprints of the Same Spot J Grid Printing Direction Bottom up Lefttight Supergnd Cluster No of Different Supergrids a i Distance between Supergnids mmn 45 45 Ho of Replicate Supergrids 1 1 Distance between Replicate Supergrid Clusters mm Sample Picking Direction in Source Plate Full Grids Require 200 Samples Left right Top down ik Substrate Accept Grid Layout Cancel Advanced Grid s y Grid nee Top Left Grid Margin mrm amp 3 169 i Bottom R
65. nce dtinze mania inenen aeni n ia raa a da aaa Naai eraai a teas naa sanada iniii 26 Howto Use the MCP Loading WOO iisipan iinne a D E a nE aE A E EA SEE 26 Preparing the MOP Pins for POE scsstadnaseesteeatcasedacatieaestane pean tamemtoontadencia neta raieantaadd pusiebaneneas hagemeus phnaea tan prtiacdueuenimen 28 Operating the Humidity Control Module HCM sissdiccsveccceneccduenadcexdetectnecccsenndaativostddeecencadeawsedacanedexdetenanceddescedacincsadionieua 29 Using the Cooled Platen eas tcsirimectanssencnanseciatenaimndnioratqndanespanatioteanesncanednssetepbandtigndmaedpkinrsuawas eravieaxadnslnge teas inehenennbtnadenstninses 29 Chapter 6 Printing with the BioOdyssey Calligrapher Miniarrayer sssccceessesseeseesesseeseenseneeenees 31 PANOA PAN RU cece etwas secs wine S paces oe E ane Heid sen eects oneicten See neces aeieee pee E E E 31 PSO a P ATDI R ea sc E E R E E E a rade canes 33 Stopping a PAINING RUN ise occ eisccs sin as A aise STNA eee main EE REENE A OERE EESE EEE eae EERE R EENE ater 33 Defining the Start Position After a Stopped Run cccceccccssceccececceceseececeueeceueessaeecsueecsaeeecaeeeseaeessueeseueessueeeseessages 34 Resuming a Print Run After a Power QUIA GCs ssccciuiinivecsundowiacevadarencavindteneddnbimescainindvonssiiadwssiosevitenansniiinldy secdainbiaenesivudirnre 35 Chapter 7 Generating Mapping Files cssccceeseecsseecenseeenseeeeneeecaseeeeasesonseesenseseasses
66. nditions Starting the BioOdyssey Calligrapher MiniArrayer Prior to launching the BioOdyssey Calligrapher miniarrayer software turn the instrument on using the toggle switch located on the right side of the unit Launch the software either through the Start menu or by selecting the desktop icon 74 A splash screen appears followed by a log in window Type in your username to create your own directory Once your name has been entered it will appear automatically each time you relaunch the program or can be selected in a pull down menu Login Dialog Fie Edt Menusiontal dereyang Celbrason Window Hek Saez eraL RBA om Chapter 3 Defining Print Parameters Note If the Calligrapher miniarrayer is not powered on the error message below will appear Calligrapher Ed A Mo COM ports Found For Calligrapher To connect to the Calligrapher miniarrayer power on the unit and select Set Port from the Setup main menu di i S Establish Communication and Initialize the Calligrapher Search for COM ports Port for Microcontroller A COM 4 7 eT Port for Motion Controller E COM 3 ha Help Click Search for COM ports and then click Establish Communication and Initialize the Calligrapher miniarrayer The software will automatically connect to the Calligrapher miniarrayer Open the Define Parameters for Arraying Window In order to run the Calligrapher miniarrayer an arraying program fi
67. ng Print Parameters Define Parameters for Arraying Substrates Grid Layout Blot Wash Options Source Plate C 96 384 1536 Printhead 2 E Pins ce MCP100 MCP360 MCP310S Pin Distance C 9mm 45mm Number of Samples 384 Number of Spots to be Printed Replicate Spots in Y B 4 Replicate Supergrids in X P Substrate q p Cancel Apply Help Once you have entered the parameters in the top portion of the window the program automatically generates a grid and displays it in the bottom panel Images of both the grid and the substrate pattern as well as the dimensions of each are displayed Note A grid is created by a single pin Each unique sample is represented by a unique color The substrate image shows the pattern of printing based on the number of pins and samples that you have entered The grids are color coded to the pins Replicate grids will be printed by the same pin and will be the same color e Source Plate Enter the type of source plate that you are using This can be a 96 384 or 1536 well plate The default sample picking direction from the source plate is left right top down If using 1536 well plates a volume of 10 ul is required to use the default settings If you have less please adjust the Z Down offset in the Options window by 0 5 mm increments Note adjusting the Z Down in negative increments e g 0 5 moves the pins up and away from the platen Note Th
68. ng and maintenance Page 35 Chapter 7 Generating Mapping Files Chapter 7 Generating Mapping Files Scanning the slides with a microarray scanner generates the quantitative information needed for microarray data analysis To complete the analysis this quantitative information has to be linked to a file with information about the name location source and identity of the molecules used to create each spot on the slide This linked file known as a GAL file is normally used during image analysis after scanning The BioOdyssey Calligrapher miniarrayer has integrated mapping software to create map files such as gal files The software possesses two programs used in generating map files Plate Librarian and SpotMapper The Plate Librarian reformats text files txt containing plate content information into new files with a plt extension which are used by SpotMapper software In some instances the files containing plate content information are obtained from vendors with ready to print plates or can be downloaded from a content provider s internet web site Your reformatted files are stored ina Plate Library file SpotMapper lets you select plate files plt from the Plate Library and merge them with a robot file vrk containing the arraying protocol As a result of the merge SpotMapper creates several map files GenePix Array List GAL BackTracker btk and tab delimited text txt The GAL files generated can be used
69. not hold in the up position still drops slowly when released the Calligrapher miniarrayer can be used However Bio Rad Technical Support should be contacted Label Locations Refer to the interconnect illustration to see the location of the various instrument labels Instrument Specifications AC Specifications 90 132 and 198 264 VAC 50 60 Hz 850 VA Fuses The system contains the following fuse Slow acting 5 x 20 mm style fuse 6 3 A 250 VAC Bussmann GDC 6 3A Dimensions Depth 21 5 inches 55 cm Width 20 5 inches 52 1 cm Height 15 5 inches 39 4 cm Page 61 Appendix F Safety Precautions Weight Approximately 60 Ib 27 3 kg Environmental This equipment is intended for indoor use only Use the equipment only under the following environmental conditions _ Installation category I _ Pollution degree 2 _ Operating temperature range 18 35 C _ Maximum relative humidity 90 RH _ Maximum altitude 2000 m Site Wiring The instrument must not share any circuit that contains heavy inductive starting loads such as electric motors heavy machinery or air conditioners The site wiring must comply with all the local applicable Electrical Code directives External Connections AC Power IEC 320 power inlet This is the operating power input connector It connects to 90 132 VRMS or 198 264 VRMS 50 60 Hz Data Cables USB cable to PC Other Cables Two cables connecting the Calligrapher miniarrayer to t
70. o the Printhead The instrument is designed to hold up to 8 BioOdyssey MCP pins with 4 5 mm spacing When printing from a 96 well source plate the distance between each pin is 9 mm Therefore you may only Page 25 Chapter 5 Preparing the BioOdyssey Calligrapher MiniArrayer for Printing use two pins when printing from a 96 well plate but 8 pins when printing from a 384 well or 1536 well source plate Note Pins are critical to the success of your print run Take care to clean them thoroughly after each print run as detailed below select ManualControl gt Load Pins The robot will move the printhead to a position to let you easily load Properly loaded pins will drop into the printhead but remain free floating i e move up and down easily Note Load the pins into the printhead in the same way specified in the arraying program The top left pin should always be loaded Load the MCP Pins For easy loading of the MCP pins into the printhead please use the MCP Loading Tool catalog 169 2020 to assure proper placement of your pins in the printhead If you do not have the MCP Loading Tool use forceps to grasp each pin by the stainless steel head and position the pins into the printhead The stainless steel head of the MCP Pins have a flat edge which is used to align the pins Orient the flat edge of each pin towards the center of the printhead for precise alignment of the pins in the printhead How to Use the MCP Loading Tool
71. obotic precision demanded of larger and more expensive arrayers 1 um motion increment is executed by the actuators and 5 or 8 micron print repeatability The Calligrapher miniarrayer printhead is specifically designed to hold the BioOdyssey MCP Pins and one pin of each style type MCP100 MCP360 and MCP310S is included The software is icon driven and very easy to use The BioOdyssey Calligrapher miniarrayer has several optional upgrades to select from a humidity control module HCM to increase and reduce humidity a cooling module for chilling the platen both substrates and source plate and upgradable software to give total control of the robot The MCP Loading Tool is available as an option to assist with easy pin loading The instrument is calibrated at the factory and requires NO field engineering support A training DVD and quick start guides are included with the unit allowing you to easily begin the printing process Features and Benefits The BioOdyssey Calligrapher miniarrayer has been designed for use by all levels of scientists from those with no microarray experience to the seasoned veteran The BioOdyssey Calligrapher miniarrayer features are numerous and include unique hardware and software components Key features include e Prints onto slides membranes and into the wells of 96 well microplates e Easy to use software that automatically creates grids e Sized to fit onto the benchtop e Sensors to notify when supply and waste
72. on settings myself Purchase the Custom Calibration software upgrade part number 169 2070 The package will include a Training c 2 calibration pins MCP310S d DVD ROM training video e Certificate of successful completion of training With the activation of the Custom Calibration option you can adjust source plate slide vacuum wash blot membrane and 96 well destination plate parameters How do I use the Custom Calibration Module to adjust the calibration settings Once the Custom Calibration option has been activated you can adjust source plate slide vacuum wash blot membrane and 96 well destination plate parameters The parameters are changed in the array parameter windows select Define Arraying from the Array menu gt choose to Create new arraying run gt in the substrates tab select Modify Calibration from here you will have access to the calibration settings Note Each calibration file is specific to the defined arraying protocol If you wish to use the modified calibration settings again you must open this specific array protocol par file If you create a new print array run the calibration parameters will default back to the original factory calibration values This ts a safety feature to protect the Calligrapher miniarrayer from damage Page 51 Appendix A Source Plates Compatible with the BioOdyssey Calligrapher MiniArrayer Appendix A Source Plates Compatible with the BioOdyssey C
73. ote Always perform a test experiment to check that these parameters meet your specific substrate size and sample type As with all default parameters they may require fine adjustment to optimize for your specific needs Once you have adjusted the parameters for your print run rename them to save to your User file The dimensions of these slides are equivalent to the spacing of a 96 well plate and have been entered into the arraying program Three predesigned protocols are available and are based on the pin type you select see the table below for nomenclature Each is designed to allow you to print 32 samples in duplicate on each of the 16 pads A total of 16 slides have been entered for the default print run this number can be changed The protocol requires the uses of two pins with 9 mm spacing For use with a single pin see the note that follows pad_mcp310S MCP310S pad_mcp360 MCP360 pad_mcp100 MCP100 Follow these easy steps to use this file e Select Open an Existing Run see page 16 e Navigate to the default user s folder and open the Predefined Protocols file Select the pad slide protocol that you wish to use and the Define Parameters for Arraying window will open with the parameters preset for use with this format e To change the number of spots printed open the Advanced window and use the up down arrows change the Number of Spots per Grid the Number of Replicates Spots per grid For more information see Cha
74. ows can be added by pressing the shift key while selecting the rows Non adjacent rows can be selected pressing the CTRL key while selecting the rows Page 20 Chapter 4 SourceSelect Mode 8 The samples are added to the output file in the bottom window As you add the samples to the output file the total number of samples that you have selected will appear in a box at the bottom right 9 Once you are satisfied with your selections you can browse to open the next plate file and repeat the steps above to add samples to your output files The total number of selected plates will appear in the bottom right box 10 When you have completed your SourceSelect file press Save and enter a file name in the window that opens Select Input File source Plate Type C Sb well fe 304 vell 0o 1536 well Select Input File Input File Formate _364_007_001 plt Fe Save As citing gene n Save ini jamie o ci EY i Log files G Map files Original plate files a 9 Plate Library Eo Plate _Name A Formate 4 00 Formate 3 Save as type SourceSelect file format ssr hal Cancel Formate_3 J Form at 3 fea ee sca dn Total Number of Samples Delete Total Number of Plates Save save and Close Cancel 11 A pop up window appears for you to save the ssr file that was created Inserting Samples in Your SourceSelect file Samples can be inserted within the output file by following these dir
75. ows to change the number of supergrids They will appear on the substrate image to the right e Distance between Replicate Supergrids Clusters Use the up down arrows to change the distance between the grids e Sample Picking Direction in Source Plate Use the pull down menu to select the direction of printing from your source plate Default is right left top down Once all parameters have been adjusted press the Accept Grid Layout button A window will pop up showing the number of spots that will be printed based on your new layout If you accept this value the information is passed to the basic window If you decline this window you will return to the Basic window and the parameters that you entered prior to the Advanced Grid Window will appear Pressing the default button in the Basic Window will regenerate the values you originally entered Blot Window Your Calligrapher miniarrayer has been programmed with optimal settings for blotting the pins prior to printing Up to four 1 x 3 slides are used for blotting Blotting eliminates excess liquid from the outside of the pin to maintain high quality spots Note we do not recommend blotting with solid pins MCP310S and the default setting is No e Select Yes to use this function e Enter the distance the printhead should move between each blot e Enter the number of times to blot per sample e Click on the Apply button e The program will automatically calculate the number of pl
76. printed by each pin is shown Each sample is represented by a unique colored square replicated spots are the same color To the right of the grid is an image of the pattern that will be printed on the substrate This shows the printing pattern of the entire printhead and the color pattern corresponds to the color of the pins in the printhead Once you have entered all the parameters click Apply to save these values Note the grid pattern created may have more spots than you have samples These spots will be blank on your substrate If you would prefer a different grid pattern simply open the Advanced Grid window to make adjustments Advanced Grid Window If you would like to refine the grid that is generated automatically you can enter the Advanced Grid window and change parameters A graphical view of the grid and substrate appears on the right and adjusts as the parameters are changed Note One 1 indicates a single spot grid supergrid or replicate supergrid will be printed To produce duplicates increase the value to 2 for triplicates 3 etc Advanced Grid Grid Top Left Grid Margin mm Bottom Right Grid Margin mm Distance between Spots micron No of Spots per Grid No of Replicate Spots per Grid No of Reprints of the Same Spot Grid Printing Direction Supergrid Cluster Substrate No of Different Supergrids a Distance between Supergrids mm Supergrid Printing Dire
77. pter 3 Defining Print Parameters Advanced Grid Window See page 12 Note Altering the Grid margins or the distance between Supergrids will result in incorrect printing parameters e Save any changes by pressing Apply e Rename the file and save it Note The advanced parameters for using this with a single pin are found in the image below Advanced Grid x 3 Grid Top Left Grid Margin mm Bottom Right Grid Margin mm 3 r Distance between Spots micron 300 300 No of Spots per Grid s g H No of Replicate Spots per Grid No of Reprints of the Same Spot i z Grid Printing Direction Bottom up Left right vl i Substrate 1 E Distance between Superarids mm 9 g Supergrid Printing Direction Left right T ai n Replicate Supergrid Clusters No of Replicate Supergrids JE 9 34 6613 Distance between Replicate Supergrid Clusters mm Sample Picking Direction in Source Plate Full Grids Require 32 Samples Left right Top down Fd Page 17 Chapter 4 SourceSelect Mode Chapter 4 SourceSelect Mode The BioOdyssey Calligrapher miniarrayer s SourceSelect mode allows you to select and print samples from specific locations in your source plate cherry picking Arraying is performed with a single pin The SourceSelect Editor is used to create a plate file ssr that you then import into the arraying program The steps to create a SourceSelect r
78. rfering electromagnetic emissions while still meeting the requirements of FCC Class A The Calligrapher miniarrayer system also conforms to the requirements of the EMC Directive for the European Union as part of compliance to EN61326 laboratory equipment The instrument meets Class A can cause interfering electromagnetic emissions and be susceptible to the same while still meeting the requirements of EN61326 The Calligrapher miniarrayer system provides a protective ground connection through the grounding conductor of the power cord Do not use a cord that appears frayed or otherwise damaged Bio Rad is available to answer any questions that you have about the Calligrapher miniarrayer and the Custom Calibration software Your questions will be addressed promptly so you can focus on what is most important your research Your Calligrapher miniarrayer serial number will be request ed when you contact technical support using any of the following methods Bio Rad Technical Support Department Phone 800 424 6723 option 2 option 4 FAX 510 741 5802 E mail LSG TECHSERV US Bio Rad com US LSG TechServ Intl Bio Rad com International Chapter 1 Introduction Chapter 1 Introduction Key Features of the BioOdyssey Calligrapher Miniarrayer The BioOdyssey Calligrapher miniarrayer is a benchtop arrayer that prints up to 16 slides with 8 pins from a single source plate The BioOdyssey Calligrapher miniarrayer has the same r
79. rmate 384 O03 O03 plt ey poe Back Cancel Help 5 Select Next 6 In the Export Files window select your destination folder and then BackTracker file format btk Add any other pertinent information 7 Select Finish Click OK Note When complete this btk file can be saved with a gal extension and used for image analysis Page 41 Chapter 8 Maintaining the BioOdyssey Calligrapher MiniArrayer and MCP Spotting Tools Chapter 8 Maintaining the BioOdyssey Calligrapher MiniArrayer and MCP Spotting Tools The BioOdyssey Calligrapher miniarrayer has been designed to be maintenance free We recommend cleaning the platen surface with a Kimwipe prewet with 70 ethanol MCP Pin Cleaning Clean pins are essential to the performance of the instrument To maintain these pins in optimal condition we would recommend that you prime wash the pins as detailed on page 28 before initial use after extended storage 2 3 weeks and also at the end of each print run Prior to use place 10 ml 10 ethanol into the static wash bath For post run washing use water in the static wash bath to ensure that solution residue does not build up inside the capillary pins Store the pins clean and dust free in the tubes in which they were shipped MCP Loading Tool Cleaning The MCP Loading Tool should be cleaned with a tissue and 10 ethanol solution Note The magnet is quite strong this should be stored away from individual pins
80. sey Calligrapher MiniArrayer Screening for Gene Silencing Proteomic Analysis of Tumor Biomarkers in Human Clinical Specimens Using the BioOdyssey Calligrapher MiniArrayer Page 53 Appendix C SpotMapper File Formats Appendix C SpotMapper File Formats Examples of a commercially purchased oligonucleotide set file and each of the three files generated by SpotMapper software are found below Microsoft Excel 0L10101IlluminaTrialPlate XLS a Eile Edit View i Insert Format Tools Data Window Help Mate Cree Peel ee ee eee ee eee a O i EEF Ee ear N ji h Reply with Changes a a ee D J E F G REFSET OLTEOS FOR THE HUMAN GENOME TRIAL PLATE EA a Comic Sans MS mn E Draw 1s Autoshapes a 7 C83 Ml 23 fs al _ aja tt HE 010 20246 NM_000595 2 GAGAGEEGAATAATAGAAGAACATCCAAGGAGAAACAG Sa 2 H6 01015853 NM_000e25 3 NoOS2A 193788 ACACCCTGAASCAGCTES TSECTSCCAASCTIGAAAT IGA Sja 3 W6_010 18255 NM_000633 1 BCL2 79241 apoptosis AGATAGTGATEAAGTACATCCATIATAAGCTETCSCAGAL ya 4 HE 00 15601 NM 001065 2 TNFRSFIA 5S lapoptosis GEECGAGCACEGAACAATGEGECCTICAGCTEGAGCTGT faja 5 HE 010 16803 Nm_ 001881 BAKI 93213 TCCCTCATGGCTCTEGCACAGTETAATCCAGGGGTGTAGA Fa e H6 i0 o3i6 NM 001226 2 CASP6 CECCGAGTGGACTTTTECAAAGACCCAAGTGCAATTGGA MOa 7 He 010 03082 NM _o01229 2 CASP9 100641 CCASTAACECETCTICCTGAGTESTECCAAA
81. symbol etc An example of a vendor Excel file is shown in Appendix C 2 Save this file as a Tab Delimited Text file txt Page 36 Chapter 7 Generating Mapping Files Importing a txt File to the Plate Librarian 1 Open the Plate Librarian by selecting Arraying gt Sample Tracking Plate Librarian The Select Plate File window opens Select Plate File Selecttiles to be converted Select tile format C Format 1 Plate Row Column C Format 2 Plate Location C Format 3 Address mea o 2 Browse to the folder that contains the text file that describes your plate select the desired file and click Open Note To open multiple files press the shift or CTRL key while selecting the desired files 3 Select the file format that is similar to the selected files See Table Note If the wrong file format is selected an error message will appear 4 Click next and the Select fields window will appear This window allows you to assign names to each column Use the scroll window to select the name to assign to each column Select fields select columns to be exported Format 384 001 bt PlatelD Position Size Probe Probe Access Gene Start Descr Category te ali 1001 001 01 C5001 DS 0001 3100001 Excitin Demaotiv i 1002 001 02 CS0002 DS 0002 3100002 Excitin Demativ 1003 001 03 sa C5 0003 D0S 0003 3100003 Excitin Demotiv 001 04 CS 0004 D5 0004 3100004 Excitin De
82. t in improper operation of the instrument and or personal injury Internal Access and Unauthorized Adjustments There are no user serviceable parts within the instrument Avoid a shocking hazard or mechanical trauma by not attempting to gain access by means of any tool to any internal parts of the instrument Use of controls adjustments or performing procedures other than those described in this document may result in hazardous electrical shock mechanical trauma or damage to the instrument Power Source The instrument operates from an AC power source as specified in the Instrument Specifications 90 132 VAC and 198 264 VAC 50 60 Hz Mains supply fluctuations must not exceed 10 or contain undue amounts of noise A protective ground connection through the grounding conductor of the power cord is essential for safe operation of the system Operate the power switch located on the right side toward the rear of the instrument to power off the Calligrapher miniarrayer if there is ever any question that the instrument is operating safely Open the door to abort a run if there ever appears any danger of crashing the pins Grounding the Instrument The instrument is grounded through the power cord To avoid electric shock plug the power cord into a properly wired receptacle with an earth ground connection Do this before making other connec tions to the Calligrapher miniarrayer rear panel Use the Proper Fuse To avoid a fire haz
83. te lower left the grid upper right and the substrate lower right The current slide number is listed as row column indicating it s position on the platen The Calligrapher miniarrayer will perform 2 print cycles before displaying the estimated length of the print run 8 Once the BioOdyssey Calligrapher miniarrayer is done washing the pins you have a final chance to ensure everything is in place for the run A message appears in the Reminders window asking if everything is ready To continue the run press the Continue button P Note Once a run has been started do not touch the computer keyboard as it may pause or stop the run Pausing a Printing Run You may pause the BioOdyssey Calligrapher miniarrayer during the run by pressing the Pause button 39 located in the Console window When you are ready to continue the run press the Continue button Stopping a Printing Run To Stop a printing run press the Stop button located on the console window The run will abort The Console window run log will display The run stopped The Array Monitor will provide the current plate dip and slide number information Note The Array Monitor displays the information required to enter when running the Start from the middle parameters window Ensure that the current plate dip and slide numbers are available when the Define Start Position option is selected These values are also available in the Run Log file
84. the BioOdyssey Calligrapher miniarrayer Printing arrays with the BioOdyssey Calligrapher miniarrayer is very easy Below you will find an overview of the steps involved in printing an array Step 1 Obtain samples in source plates These may be purchased from vendors or you may create them yourself using Back Tracker software See Chapter 7 Generating Mapping Files Step 2 Define your array See Chapter 3 Defining Print Parameters Step 3 Prepare the Calligrapher miniarrayer for printing See Chapter 5 Preparing the BioOdyssey Calligrapher miniarrayer for Printing Step 4 Prepare the MCP Pins for Printing See Chapter 5 Preparing the BioOdyssey Calligrapher miniarrayer for Printing Step 5 Print your array See Chapter 6 Printing with the BioOdyssey Calligrapher miniarrayer Page 2 Chapter 1 Introduction Step 6 Generate your mapping files to merge your source plate files and your array files See Chapter 7 Generating Mapping Files After you have completed your first set of arrays and analyzed the data you may want to redefine your array This can be accomplished in two ways The first is to open an existing run and alter the parameters Save this as a new file and follow Steps 3 5 The second is to use one of the advanced features in The BioOdyssey Calligrapher miniarrayer software the SourceSelect mode in which you define plate files to enable you to cherry pick only the samples you wish from the source plat
85. the Humidity Control Module should be attached and set to work normally otherwise the considerable condensation may be expected Alcohol concentrations over 15 should not be used in the wash baths Avoid running out of water the robot will stop and the samples may evaporate from the plate Take care that the Calligrapher miniarrayer is properly balanced and put on a stable non vibrating table Use a level to determine that the platen robot plate is level within one degree Do not connect disconnect plug or unplug Vacuum Pump and HCM when the Calligrapher miniar rayer system is ON Doing so may cause computer system lockup or error and will require a com plete restart after power off of all components for at least 10 seconds Use After Instrument Component Trauma 1 Do not use the vacuum pump if it ever suffers a significant fall or other traumatic event Especially be careful if part of the case or power cord becomes damaged Contact Bio Rad Technical Support before use if any significant trauma to the instrument occurs 2 Do not use the Calligrapher miniarrayer or the HCM if they suffer a significant fall or other traumatic event Especially be careful if part of the case or power cord becomes damaged Contact Bio Rad Technical Support before use if any significant trauma occurs Page 60 Appendix F Safety Precautions 3 Do not use the Calligrapher miniarrayer the HCM the vacuum pump or the attached computer if flu
86. the platen and position one OmniTray such that the upper left corner is over the area labeled SLIDE 1 the second should abut the adaptor Place a magnet at the bottom and right side of each plate to hold them in place d Custom the platen will hold any size substrate required Use a series of magnets to hold the desired material in place Use of a custom sized substrate may require the Custom Calibration Software Upgrade of the BioOdyssey Calligrapher miniarrayer Call 1 800 4BIORAD for more information F Ais j f TT d y p e B Y al an lt i ee o FE ms Ku A i k 3 g gt i WO N r da a Sets Tine E SS ae amp gt Eia A a ae a Placement of Blotting Slides The platen will hold four 25 x 75 mm slides for blotting prior to printing Space is available for the blotting slides in the left front of the platen separated from the source plate holder by a raised bar see image above Place the slides on the platen and position a magnet at the side to hold them in place Note the blotting slides do not need to be held in place as securely as the substrate Placement of the Source Plate Position the Source Plate in the area designated on the platen The source plate is held in place by a raised bar on the top left and a spring on the bottom right Make sure the spring is holding the plate flat on the platen Position the plate such that well A1 is in the top left corner Load Pins int
87. un are e Use the SourceSelect Editor to select the samples from your original plate files to print e Create a SourceSelect Arraying run by opening the Define Parameters for Arraying and importing your ssr file in the grid layout window Note the SourceSelect mode allows use of only one type of source plate i e you can select samples from 384 well plates OR 96 well plates but not both 384 AND 96 at the same time Creating a SourceSelect File 1 Select Arraying SourceSelect Editor and the Selection window appears Selection OK Cancel Create a new SourceSelecttile l Openan existing Sourceselectfile 2 Select Create a new SourceSelect file to open the Select Input File window Select Input File source Plate Type C Sb well 304 yvell C 1536 well Select Inout File Input File Column ID Name Accession Symbol Description E Output File Add Insert Sample Row Column ID Name Accession symbol Description Plate Name m Total Number of Samples Delete Total Number of Plates Save save and Clase Cancel Help Page 18 Chapter 4 SourceSelect Mode 3 Select the Source Plate Type Note All source plates must be of the same type 4 Click on the Select Input File button to open the Read from file window Note You can select samples from different source plates for your output file but each plt file must be opened individually Select Input File
88. use with the Calligrapher miniarrayer The Calligrapher can use any standard slide If using a 25 X 75 mm slide note that the dimensions are slightly different from a 1 X 3 size What type of slides and buffers do you recommend for printing non modified 25 30 mer oligonucleotides The slides that are most frequently used are the Corning slides specific for short oligonucleotides including 20 mers Corning also recommends Epoxide slides in 150 mM sodium phosphate buffer OH 8 5 containing 0 005 SDS Spot Deposition Why are some of the spots in my array missing The missing spots can be a result of a clogged pin or dust debris in the printhead Make sure the pins are cleaned following the directions found in Chapter 8 For cleaning the printhead we recommend the following e Inthe Calligrapher miniarrayer software use the Load Pins option to bring the printhead to the front of the platen e Place a tissue Kimwipe below the printhead and flush the holes with 70 ethanol then use an interdental brush or small pipe cleaner to clean through the holes in the printhead Do not apply any pressure or force to the printhead e Use a can of compressed air to dry the printhead Page 48 FAQ Why do my spots look like donuts This can be caused by several factors including inadequate humidity the most common dwell time and Z height The humidity in the Calligrapher miniarrayer chamber should be 55 The HCM will maintain th
89. ximum numbers of spots that can be printed on a slide There is no real limitation on the number of spots that can be printed The parameters in the software can be adjusted to print more than 20 000 spots however this might take hours to days to print because the printhead holds just 8 pins The Calligrapher miniarrayer was designed for printing lt 5000 spots and easily 1000 Page 46 FAQ What conditions should I use to test my new Calligrapher miniarrayer system To perform a test run we recommend that you fill a source plate with red or green food coloring diluted 1 10 in PBS with 0 1 Tween 20 PBST Design a test array to print onto a single substrate such as a plain glass slide or membrane Load your pin s and print the array Image the array at 546 nm red dye or at 506 nm green dye to assess your spots NOTE spot morphology on plain glass slides will not be identical to that on microarray substrates The spots may be larger and shapes irregular If you print on membranes a plate and membrane adapter cat 169 2004 is shipped with the Calligrapher miniarrayer system The plate and membrane adaptor aligns the OmniTrays Nunc cat 242811 in place while the OmniTrays are an additional protection for your membranes The Calligrapher miniarrayer has been calibrated for the extra height requirements of the OmniTrays no adjustment of the z axis is necessary Are there any special adjustments for printing on FAST slides

Calligrapher™ MiniArrayer - Bio-Rad

Contents

Download Pdf Manuals

Related Search

Related Contents

Calligrapher&trade; MiniArrayer - Bio-Rad

Contents

Download Pdf Manuals

Related Search

Related Contents

Calligrapher™ MiniArrayer - Bio-Rad