Home

Primer Express® - Applied Biosystems

1. 3 20 Expanding the Search for Primers 3 20 Changing the GC Clamp 3 21 How to Select a Primer Pair 2 0 0 ee eee ee 3 22 Selecting a Primer Pait ssi eieiaeo ee eaaa EA E 3 22 How to Print Primer Express Software 3 22 Printing Primer Express Software Data 3 22 How to Calculate Volumes for PCR 3 23 Calculating Volumes for PCR Reaction 3 23 What You Have Learned eee eee 3 24 Summary of Chapter 3 3 24 About Advanced Oligo 3 24 vi 4 Oligo Design for Allele Specific PCR 4 1 Introductioti 2i ok HA en ee Ee ee ee ee mE 4 1 In Fhis Chapter esos utes RR ed anda eats 4 1 Introduction to Allele Specific 4 2 Allele Specific PCR 4 2 What are Chymases 0 cece eect eens 4 2 How You Use Chymase Alignment 4 2 How to Open an Allele Specific PCR Document 4 3 Opening an Allele Specific PCR Document 4 3 How to Import an Alignment 4 5 Importing an Alignment
2. Setting the Design Specification Design Specifications 3 2 Fine Tuning the Oligo Design For the purpose of this chapter even though the default the Primer Express software parameters found one hundred five primer pairs you will assume that the primer pairs you observed in Chapter 2 do not satisfy your needs Further assume that the purpose of your oligo design project is to find a set of primers that satisfy the following specifications Item Specification Sequence 0x208 131 GC Clamp as large a possible looking for 3 to 4 nt amplicon target region contains exactly one Alu 1 restriction site primer T match match with 1 C minimum nucleotides 25 nucleotides nt included between the Alu 1 recognition sequence and either end of the amplicon optimal primer T 59 C optimal primer length 20 nt amplicon length 200 nt As you follow the text you will experience the process of discovering whether a set of primers that satisfy the original specifications can be found The list above is something of a wish list when choosing the design specifications start with your best case then compromise a little at a time until you find acceptable primer pairs It can be useful to list specifications in order of importance so you can make parameter modifications in order of importance How to View Your Previous Results Viewing Your The following procedure describes how to view
3. 2 36 Summary of Chapter 2 2 36 What Is In Chapter 3 hae bs eee dG 2 36 3 Fine Tuning the Oligo Design 3 1 Introd CtiOnc ve e nep re tee e ete ete ee 3 1 Introduction dc eA ERES ERIS UE IE EIU 3 1 In this Chapter e inus pe Rep C Re Ru T 3 1 Setting the Design Specification 3 2 Design Specifications lees 3 2 How to View Your Previous Results 3 3 Viewing Your Previous 3 3 How to Set the GC Clamp Parameter 3 5 Introduction i Ohta DIES esas ES 3 5 Setting the GC Clamp 3 5 How to Annotate the Sequence 3 6 Introduction rc eet ree eee eee ERESDY 3 6 Annotating the Alu 1 Restriction 5 3 6 Annotating a Target Region 3 9 Adjusting the Target 3 12 Viewing the Results is ee ee a 3 12 How to Set the Parameters to the Design Specifications 3 14 Setting the Parameters llle 3 14 How to Adjust 3 18 Adjusting Parameters 3 18 How to Expand the Search for
4. TGCTRTGGRR RRCCTRTGCR TRGTCTTRGC CRCRRRGRGT NRRRGGTCRR RRGTGGCTTC RTCTRTGGHe EERFFFFRRE HHEF FFSRH RI SEE FRRRRH RHER FGRREFG HRR ETHHIRS H Figure 3 1 Sequence page with highlighted primer pair amplicon region To annotate the Alu 1 restriction site continued Step Action 3 Choose Find Sequence Cmd F from the Edit menu The Find Sequence dialog box appears Find Sequence Find the next occurence of the sequence starting at beginning of the sequence vj Sites op u and label it as pop up menu v Aat II 3 Find and label all occurences of the sequence Apa I Delete all sites previously found RpaL BamH Bcl I Bgl 11 Bsh1236 1 Bsp106 1 BspC I 4 Select Alu 1 from the Sites pop up menu The dialog box now contains the sequence AGCT and the label Alu 1 Fine Tuning the Oligo Design 3 7 3 8 Fine Tuning the Oligo Design To annotate the Alu 1 restriction site continued Step Action 5 Click OK to find all occurrences of the Alu 1 restriction site Only one Alu 1 restriction site exists in the ox208 131 sequence This satisfies the amplicon target region specification on page 3 2 However the minimum nucleotides specification requires a 25 nt cushion between the Alu 1 restriction site and either primer This requirement has not been satisfied by using the selected primer pair Fig
5. Include exclude sequences using the checkboxes View primers and primer data When you work with new alignments it is important to know what groups or subgroups the sequences fall into so that you can sort and include exclude sequences accordingly Oligo Design for Allele Specific PCR 4 13 a chymases about 4 2 alignment file importing into Allele Specific PCR document 4 5 sorting and selection sequences 4 7 to 4 9 allele specific PCR oligo design 4 2 to 4 13 about 1 3 Allele Specific PCR document about 4 2 chymases alignment using 4 2 what are 4 2 discriminatory primers finding and viewing 4 10 to 4 13 examining features 4 6 importing alignment file 4 5 opening document 4 3 to 4 4 sorting and selecting sequences 4 7 to 4 9 what you learned 4 13 alpha chymases about 4 2 Alu 1 restriction site annotating 3 6 to 3 9 annotating 3 6 to 3 13 Alu 1 restriction site 3 6 to 3 9 target region 3 9 to 3 11 adjusting 3 12 viewing the results 3 12 to 3 13 B b chymase about 4 2 C chymases alignment using 4 2 whatare 4 2 color setting highlight color 2 5 customer support e mail address 1 4 help 1 4to 1 9 internet address 1 8 telephone fax 1 5 to 1 8 D design specifications adjusting parameters 3 18 to 3 19 setting for tutorial example 3 2 setting parameters to the specifications 3 14 to 3 17 discriminatory primers finding and viewing 4 10 to 4 13 See Also primers Documents on Deman
6. 22 61 50 TAAGGCCATTGTCTCACCATOG 252 22 61 123 20 61 55 GCCATTGTCTCACCATGGCA 252 22 61 data upd ated 124 20 59 50 CCATTGTCTCACCATGGCAA 251 22 58 120 21 61 52 AAGGCCATTGTCTCACCATGOG 276 21 60 simultaneously all pages when selected or modified 118 22 58 50 CTAAGGCCATTGTCTCACCATG Primer Data Forward Primer AGCTGCCATTGTTGCTGTTGT 59 6C 48 Start 253 Length Reverse Primer GCAGCCTTGTCARTTAGGACCA Tm 60 6 50 Start 355 Length 22 Sequence Params Cord Primers Map X Recipe Results Dic Piot Optimal Primer Pairs Only Hep 100 00 300 400 Amplicon Tm 78 GC 46 Length 101 Ta 58 3 Tm Piot Primer Data window APA Map page Jp epu Figure 2 13 Sequence Primers and Map showing features connected by means of dynamic linking continued on next page Quick and Easy Oligo Design 2 25 Sorting Primers The following procedure describes how to sort primers on the Map page To sort primers on the Map page Step Action 1 Make a copy of the Map page by selecting Copy Page to Window from the Options menu 2 Move the copy of the Map page to an open area of the desktop so you can see both the Map page copy and the original DNA PCR document Figure 2 14 3 Observe the highlighting in both the original document and the copy of the map page way The origin
7. 4 5 Examining the Features of the Allele Specific PCR Document 4 6 Diagram eee ie Seer ERE eet een dune 4 6 det tat ane ARES tp Sa aig need ey chin p BOY 4 6 How to Sort and Select Sequences in the Alignment 4 7 Sorting and Selecting 4 7 How to Find and View Discriminatory Primers 4 10 Finding and Viewing Discriminatory Primers 4 10 What You Have Learned 12 0 0 iai eee 4 13 Summary of Chapter 4 4 13 About the Tutorials Introduction In This Chapter Topics in this chapter include the following Topic See page About the Tutorials 1 2 Technical Support 1 4 About the Tutorials 1 1 About the Tutorials Quick and Easy Oligo Design Fine Tuning the Oligo Design 1 2 About the Tutorials What You Will Learn Chapter 2 Quick and Easy Oligo Design guides you through the process associated with designing oligonucleotides for basic DNA PCR using Primer Express software It is very much like a guided tour of the Primer Express software and is designed for the first time user who is familiar with standard PCR techniques and feels fairly comfortable with basic oligo design You will observe many of the important features of the Primer Express software and become familiar with the process of designing oligos
8. 1 4 Hours for Telephone Technical 1 4 To Contact Technical Support by Telephone or Fax 1 5 To Reach Technical Support Through the Internet 1 8 To Obtain Documents on 1 9 Introduction cei 2 1 In This Chapter wo eee ae UOS 2 1 How to Open a Primer Express Document 2 2 Introduction aou etes nie e Ears a es Hen de 2 2 Opening a Document 2 2 How Set the Highlight Color 0 0 00 0 eee eee eee eee ee 2 5 setting the Colotis 5 Re Re dat esr e RR 2 5 Exploring the Features of the Sequence 2 6 Exploring the Sequence 2 6 How to Import a 2 8 Introduction 2 ior ats beoe thy see elena pees 2 8 Importing a Sequence 20 2 eee i eens 2 8 Exploring the Sequence Page and Imported Sequence 2 10 Exploring ze iota ETE 2 10 How to View the 2 13 IntrodUCtlOn 2 2 o ee td aye t huele S ERR ed n 2 13 Viewing the 2 13 How to View Primer Data on the Primers Page 2 16 Introduction eese
9. By the end of Chapter 2 you will have performed the following tasks Imported a file into the Primer Express software Viewed Sequence page annotations Used page tabs to manipulate Primer Express pages Viewed the parameters used for primer searches Viewed the sorting primers found by the Primer Express software Viewed and interpreted the information contained in the Map page Manipulated the Map page controls o gt o gt 9 9 9 9 Viewed the information contained in the Results and Recipe pages In Chapter 3 Fine Tuning the Oligo Design you start the Primer Express software and begin to explore the layout of the user interface of a DNA PCR document If you have not installed the Primer Express software install the software using the procedure found in Section 2 Installing Primer Express of the Primer Express Software User s Manual What You Will Learn Chapter 3 of this tutorial gives you the opportunity to get more hands on experience You will annotate the input sequence and modify the primer parameters to design primers that satisfy a set of design specifications By the end of Chapter 3 you will have performed the following tasks Used several annotation tools to annotate the sequence data Oligo Design for Allele Specific PCR Viewed and sorted the results of the sequence annotation Adjusted the primer parameters to find primers that satisfy the design specifications Created the PCR pr
10. Difference Maximum difference allowed between the TS of each primer in the primer pair Primer GC Content Re quirements Min GC Minimum percentage of G and C contained by either primer Max GC Maximum percentage of G and C contained by either primer GC Clamp Number of residues on the 3 end required to be a G or C Primer Length Require ments Min Length Minimum length allowed for either primer Max Length Maximum length allowed for either primer Optimal Length Optimal primer length desired This figure is used when calculating optimal primer pairs 5 Tail Forward Primer You can specify a sequence to search for as the forward primer Reverse Primer You can specify a sequence to search for as the reverse primer Amplicon Requirements Min Minimum amplicon melting temperature allowed Max Maximum amplicon melting temperature allowed Min Length Minimum amplicon length allowed Max Length Maximum amplicon length allowed To view the parameters continued Step Action 3 Click the Rxn Cond tab to select the Reaction Conditions page The Reaction Conditions page allows you to select the PCR enzyme from a pop up menu This page also displays the concentrations for the Template DNA salt and magnesium ion The salt and magnesium concentrations affect the T of the primers found Sequenc
11. strand legerereorr GTRTTTCCHCQQRCCRGGRTT RRCTGTTCCO TBCTRTGGRR TRCCTT RRCCTRTGCR TTGGRTRCGT TRGTCTTRGC CRCaRRGRGT NRRRGGTCRR 400 RTCRGRRTCG GAGTTTCTCA NTTTCCRGTT Reverse primer Primer Data Forward Pr RGCTGCCRTTGTTGCTGTTGT Tm 59 GC 48 253 Length E 88 Click arrow to scroll sequence data Rev P GCAGCCTTGTCAATTAGGACCA 0 gee Amplicon Tm Start Length 22 78 95GC 46 Length Ta 58 Figure 2 4 Sequence page with Double Stranded checkbox selected 6 Observe how the sequence data in the reverse primer is displayed reversed in the Primer Data window Figure 2 4 7 Click the scroll arrow to scroll the sequence data pane Observe how the Exclude annotation at the end of the sequence bottom of the page is marked on both strands of the sequence 8 Click the Double Stranded checkbox again to deselect it How to View the Parameters Introduction Viewing the Parameters This section describes how to view the Parameter page and the Reaction Conditions page The Parameters page contains the specifications for calculating primers so you will return to this page often when you are fine tuning a primer design The following procedure describes how to view the parameters To view the parameters Step Action 1 Click the Params tab to select the Parameters page The Parameters page contains data fields for specifications that affect
12. CTAAGGCCATTGTCTCACCATG pane bi s VES Forward Primer RGCTGCCRTTGTTGCTGTTGT Tm 59 GC 48 Start Length Reverse Primer GCAGCCTTGTCAATTAGGACCA Tm 60 GC 50 Start Length Amplicon Tm 78 BGC 46 Length 58 Primer Data window The Primers page contains a list of primer amplicon sets that satisfy the search parameters you observed earlier on the Parameters page Each primer amplicon set contains sequence and parameter information One hundred five primer amplicon sets are listed in the Primers page and the complete data for the selected highlighted set is shown in the Primer Data window The Primer Data window provides a convenient method of viewing all the information associated with any single primer amplicon set continued on next page Example The following example Figure 2 5 shows that the primer amplicon set in the Primer Data window has a forward primer with Tm of 59 C 48 GC start location of 253 length of 21bp and sequence data AGCTGCCATTGTTGCTGTTGT DNA PCR 1 Reverse Primer GCAGCCTTGTCAATTAGGACCA 60 6 50 Start Amplicon Tm 78 6 46 Length total of 105 primer pairs found Click any entry in the list to select it Details in Primer Data window Click this scroll arrow to view the rest of the primer data Figure 2 5 Corresponding locations on the Primers page and Primer Data window Using the P
13. 1768 58 52 ATCCTGGTTCTTGCTGTCACC 216 78 46 57 185 6 57 52 GCAGCCTTGTCAATT AGGACC 249 78 47 57 2158 Figure 2 6 Primers page headings 3 Click the Penalty heading to The same primer set remains sort the data in descending highlighted but moves to the order high to low bottom of the list when the list is sorted from high to low 4 Click other headings to sort the If you click a heading more than once the list sorting alternates between ascending and descending order The display changes when the primers are sorted by different parameters To use the Primers page continued Step Action Result Comment 5 Select Show Interim Results The Interim Results window from the Options menu appears Figure 2 7 and displays the results of a series of tests that narrow the search for primers The bottom of the window shows that 105 primer pairs were calculated For more information on each of the tests refer to Appendix A in the Primer Express Software User s Manual Chapter 3 Fine Tuning the Oligo Design uses the data contained in the Interim Results window as a guide to changing the design parameters I Interim Results SHEED Total Number Primers Tested 4490 Number Passing Ambig Test 3312 Number Passing Clamp Test 3312 Number Passing GC Test 1252 Number Passing Tm Test 360 Pri mer tests Number Passing Repeat Test 164 Number Passing Secondary Struc Test 96 Number Passing Primer Site Unique
14. China Beijing 86 10 64106608 86 10 64106617 Hong Kong 852 2756 6928 852 2756 6968 Korea Seoul 82 2 593 6470 6471 82 2 593 6472 Malaysia Petaling Jaya 60 3 758 8268 60 3 754 9043 Singapore 65 896 2168 65 896 2147 Taiwan Taipei Hsien 886 2 2358 2838 886 2 2358 2839 Thailand Bangkok 66 2 719 6405 66 2 319 9788 Europe Austria Wien 43 0 1 867 35 750 43 0 1 867 35 75 11 Belgium 32 0 2 712 5555 32 0 2 712 5516 Czech Republic and Slovakia Praha 420 2 61 222 164 420 2 61 222 168 Denmark Naerum 45 45 58 60 00 45 45 58 60 01 Finland Espoo 358 0 9 251 24 250 358 0 9 251 24 243 France Paris 33 0 1 69 59 85 85 33 0 1 69 59 85 00 Germany Weiterstadt 49 0 6150 101 0 49 0 6150 101 101 Hungary Budapest 36 0 1 270 8398 36 0 1 270 8288 Italy Milano 39 0 39 83891 39 0 39 838 9492 Norway Oslo 47 23 12 06 05 47 23 12 05 75 Poland Lithuania Latvia 48 22 866 40 10 48 22 866 40 20 and Estonia Warszawa Portugal Lisboa 351 0 22 605 33 14 351 0 22 605 33 15 Russia Moskva 7 095 935 8888 7 095 564 8787 South East Europe Zagreb Croatia 385 1 34 91 927 385 1 34 91 840 Spain Tres Cantos 34 0 91 806 1210 34 0 91 806 1206 Sweden Stockholm 46 0 8 619 4400 46 0 8 619 4401 Switzerland Rotkreuz 41 0 41 799 7777 41 0 41 790 0676 The Netherlands Nieuwerkerk a d IJ
15. Step Action 5 Observe the following Both of the primer pairs found on the Map page are shown in red which means that they are considered optimal primer pairs by the Primer Express software Optimal primer pairs are those that fall within 1 of the optimal primer T and optimal primer length values entered on the Params page Thefirst primer pair has an amplicon that is close to 200 nt the amplicon length specification see page 3 2 You could select this primer pair if you are satisfied that it is the closest to fulfilling the original specifications However the advantage of using software like the Primer Express software is that it is quite easy to experiment with parameters until you have explored many possible combinations Fine Tuning the Oligo Design 3 19 How to Expand the Search for Primers Expanding the Because primer length is not considered as important as other criteria Search for Primers such as primer Tm this procedure investigates the result of expanding the search for primers that are outside the current primer length range of 18 to 22 bp To expand the search for primers Step Action 1 Select the Params page 2 Change the minimal primer length value to 16 and the maximal primer length value to 25 3 Change to the Primers page Observe that eight primer pairs have now been found Several of these primers satisfy the original specifications except for a 3 bp
16. closely at hi this sectiori GC min max lines GC plot Target annotation green line Figure 3 7 GC plot with annotations Fine Tuning the Oligo Design 3 17 How to Adjust Parameters Adjusting This section describes how to change several parameters in small increments to increase the number of primer pairs found As you do this you will discover where and how much you must compromise from the original design specifications Parameters 3 18 Fine Tuning the Oligo Design To adjust the parameters Step Action 1 Choose the Show Interim Results from the Options menu The Interim Results window appears Because the Clamp test causes the largest dropoff of potential primer pairs you will reduce the clamp value in an attempt to generate more primer pair results Change to the Params page If the Interim Results window covers your view of the page drag it to a different location on the screen Change the 3 GC Clamp value to 2 Change to the Map page and observe that two primer pairs have been found Shorter amplicon but primer Tms not identical Sequence Params Rxn Cond Primers Hap Tm Pret X cc Piet liptimal Primer Pairs Only 100 200 500 j M soe Je og Tm use IT Primer T s identical but amplicon not as close to specification To adjust the parameters continued
17. evolution humans and baboons lost their B chymase genes and subsequently rats lost their genes How You Use You will use the Chymase Alignment data in this chapter to design Chymase Allele Specific PCR primers that specifically amplify any of the four Alignment sequences and none of the B chymase sequences 1 Chandrasekharan et al 1996 Angiotensin II forming Activity in a Reconstructed Ancestral Chymase Science 271 502 505 4 2 Oligo Design for Allele Specific PCR How to Open an Allele Specific PCR Document Opening an Allele This section describes how to open an Allele Specific PCR document Specific PCR To open an Allele Specific PCR document Document Step Action 1 If it is not already running start the Primer Express software by double clicking the Primer Express software icon After the splash screen appears the default PCR document opens E DNR PCR 1 HE w File Name File Loaded Import DNA File to Double Stranded Length Obp Selection To load a DNA file click the 2 Click the close box in the upper left corner to close the DNA PCR document Oligo Design for Allele Specific PCR 4 3 To open Allele Specific PCR document continued Step Action 3 Select New from the File menu and Allele Specific PCR Document from the submenu to open a new do
18. ml User 1 0 00 L ol ug ml mcz Reaction Volume uL Number Tubes L Pipeting Excess C 20 Protocol Figure 2 19 Recipe page showing the values for PCR protocol Observe the default values that the Primer Express software assigns to the Recipe page Do not make any changes to this page Chapter 3 Fine Tuning the Oligo Design of this section adjusts the component values to create a useful PCR protocol Quick and Easy Oligo Design 2 31 2 32 Quick and Easy Oligo Design To evaluate the primer results continued Step Action 3 Click the Results tab to view the Results page Sequence Params Cond Primers Map Recipe Results Forward Primer RecreccarTeTTGcTeTT T lt Hybridizing at to Tm ss Reverse Primer GCAGCCTTGTCAATTAGGACCA Hybridizing at to tm seg Cycle Params Number of Cycles ss Hot Start 20 secat 4 20 seeat ss zo se a zl Template LC solm Primer 50 5 n Salt 50 0 m Mg C rom Amplification yield average v 6 Comments test file Comments text box The Results page contains all the important specifications and allows you to summarize the results of the oligo design The primer sequence and attribute data displayed in the Results page is specific to the primer pair currently selected in the Primers page or Map page 4 Observe the values shown for the primers found using the
19. og A EO S Ree er e eee 2 16 Viewing Primer Data cess e 2 16 Contents of the Primers 2 16 pet ive ie mtem REA 2 17 Using the Page een regc ee lees aR 2 17 How to View Primer Data on the 2 20 Introd ctiohi luni au geh EE HER EL RU en ET AE XE 2 20 Viewing Map 2 20 How to Sort Primers the Map 2 25 Introduction eve ui eA US anna doy eee Roe 2 25 Dynamically Linked Pages 2 25 Sorting Primets uer erre Ne IET AM eS a Aes 2 26 How to Compare the GC Plot with Sequence Data 2 29 Introduction 21r ep te gang RE IRE b eg 2 29 Comparing the GC Plot with Sequence 2 29 How to Evaluate the Primer 2 31 Evaluating the Primer Results 2 31 How to Save Your Work 2 33 Three Ways to Save 0 0 eee eee ees 2 33 Saving the 2 33 Saving the Results isses pute EHE ede ede aed 2 34 How to Quit Primer 2 35 Quitting the Primer Express 2 35 What You Have
20. on the Sequence page to perform the following tasks Finding and annotating the Alu 1 restriction site Ensuring the Alu 1 restriction site is part of the amplified region Setting the 25 nt cushion between the restriction site and either end of the amplicon Note For full descriptions of the Annotation Tools refer to Section 6 Using the Annotation Tools in the Primer Express Software User s Manual The following procedure describes how to annotate the Alu 1 restriction site To annotate the Alu 1 restriction site Step Action 1 Click the Params tab to view the Params page 2 Observe the status bar which reports that seven primer pairs were found using the current parameters The primer pair selected appears on the Sequence page as a pair of blue outline arrows surrounding sections of the sequence text The entire primer pair amplicon region is highlighted Figure 3 1 Sequence Params Rxn Cond Primers Map Recipe Results Fite name Certus Fie Length 471 bp Selection 125 to 276 Double Stranded FEHAGEHHGS TRCCCTTTCR RRRRRRRRRR RGRRRGRRRG RRRRRGRRRT CTGCAACATA RCCTRTGRRT GRTGTGCTGR GRTGGGRRRC CCAAAATNAT GGTARATCAG RGTGGCRCTR RGGQCRTTGT CTCRCCRTGG CRRCCCRRRR RRCRGCRGTC RCRGTCTRGG TCTTTCCRGR RRGTRRRTGT RGRGCCCCTG RCRGRRCRCR TTCCTCCTTR CRGCRCTRTR RTGCTGGRGR RGTGTCTGCT GCRGCT CCR TTGTTGETGT TGTTCCRTTT GCRRCTTCTC RGTCTCRRRG GTGACAGCAR GRRCCRGGRT CRTRRRGGNG GTGGTCCTRR TTGRCRRGGC
21. page to open an untitled window containing the PCR protocol based on the quantities entered on the Recipe page Select Print from the File menu to print the protocol Select Save As from the File menu to save the protocol Fine Tuning the Oligo Design 3 23 What You Have Learned Summary of In Chapter 3 of this tutorial you have learned how to Chapter 3 About Advanced Oligo Design 3 24 Fine Tuning the Oligo Design 9 9 9 9 View your previous results Find and annotate a sequence on the Sequence page Insert a target region annotation in your sequence data View primers calculated on the Primers and Map pages Set parameters on the Params page Use the Interim Results window as a tool for understanding why too few primers are found View the T and GC plots on the Map page Modify parameters to find more primers Print the Primer Express software data Create a PCR protocol You have also learned that it is not always possible to meet all of the original design specifications When this is the case you must rethink and re prioritize the design specifications The Primer Express software has more features than you ve been introduced to in this chapter Chapter 4 Oligo Design for Allele Specific PCR introduces several new features for the advanced user as well as specific step by step instructions on how to use the Allele Specific PCR document Oligo Design for Allele S
22. plot GC Plot T minimum maximum plots and the GC minimum maximum plots Primer pane 2 20 Quick and Easy Oligo Design To view primer data on the Map page continued Step Action Comment Result 2 Observe the Exclude red This marking corresponds with annotation Figure 2 8 the Exclude annotation on the Sequence page the red cross out marking You can return to the Sequence page and compare these annotations with their counterparts Primers Hap Recipe Results x Tm Prot Piet optimal Primer Pairs Only T T T T 100 200 300 400 Exclude annotation red Figure 2 8 Exclude annotation page 3 As shown in Figure 2 9 observe the T plot solid magenta line and parameter min max lines dotted magenta lines 4 Tm 100 Tm min max lines 450 dotted magenta lines T scale 5 AA ERR e v plot 25 solid magenta line Figure 2 9 T plot and min max lines Quick and Easy Oligo Design 2 21 2 22 Quick and Easy Oligo Design To view primer data on the Map page continued Forward primer m Figure 2 10 Map page primer pair graphic Step Action Comment Result 5 As shown in Figure 2 9 The T4 min max parameters are observe the T scale at the set for 57 and 63 It is not upper left magenta scale with important to be able to estimate 25 50 and
23. the primers displayed in the Map page then observe how the results of the sorting action affect other pages in the Primer Express software Dynamically The pages of the Primer Express software are dynamically linked so Linked Pages that when a calculation or sort is performed on one page the results are reflected on all pages Figure 1 24 Sequence page Sequence Params YRsn Cond Y Primers Map Y Recipe Results l FileName ox208 131 import DNA File Hel Length 471 bp Selection 253 353 Double Stranded FEHAGEMHGG TRCCCTTTCR RRRRRRRRRR RGRRRGRRRG RRRRRGRRRT CTGCARCATA RCCTRTGRRT GATGTGCTGA GRTGGGRRRC CCRRRRTHRT 100 GGTRRRTCRG RGTGGCRCTR RGGCCRTTGT CTCRCCRTGG CRRCCCRRRR 150 RRCRGCRGTC ACAGTCTAGG TCTTTCCAGA AAGTAAATGT AGAGCCCCTG 200 ACAGRACACA FFEEFEETIACABCACTATA RTGCTGGRGR RGTGTCTGCT 250 TTGTTGETGT TGJTCDATTT GCRRCTTCTC AGTCTCAAAG 300 IIGRCROERR SAACERGEATCATARAGONG 350 ATGOGA RRCCTRTGCR TAGTCTTAGC CRCRRRGRGT NARAGGTCAA 400 RTCTRTGGHE EER FFHRRE HHEFFFGRER GEE HHRRRHE 450 471 Primers page Sequence Params YRsn Cond Y Primers Y Map Recipe Y Results Forward Primer Reve m P Start Length Tm 9 59 48 AGCTGCCATTGTTGCTGTTGT 358 Start Length m ATGCTGGAGAAGTGTCTGCTGC 258 20 59 50 AGCTGCCATTGTTGCTGTTG 353 22 60 120 21 61 52 AAGGCCATTGTCTCACCATGG 252 22 61 Forward primer sequence 119
24. then click Open The forward strand of the 0x208 131 sequence appears in the Sequence page Select Find Primers Now Cmd from the Options menu to find printer pairs Within a few seconds the Primer Express software calculates primers and highlights the amplified region that includes one of the calculated pairs of primers the highlighted region shown in Figure 2 1 Amplified region Figure 2 1 Sequence page with imported sequence ox208 131 Forward primer Reverse primer CRTTGT CRRCD CCR TGTTCC DNR PCR 1 Rxn Cond Primers Recipe Results l FileName ox208 131 _ import DNA File _ Length 471 bp Selection 253 to 353 Double Stranded FEHAGEMHGS TRCCCTTTCR RRRRRRRRRR RGRRRGRRRG RRRRRGRRRT CTGCRRCRTR RCCTRTGRRT GRTGTGCTGR GRTGGGRRRC CCRRRRTHRT 100 GGTARATCAG AGTGGCACTA RGGCCRTTGT CTCRCCRTGG CRRCCCRRRR 150 RRCRGCRGTC ACAGTCTAGG TCTTTCCRGR RRGTRRRTGT RGRGCCCCTG 200 RCRGRRCRCR TTCCTCCTTR CRBCRCTRTR RTGCTGGRGR RGTGTCTGCT 250 GAGCTGCCA TTGTTGCTGT menm BCRRCTTCTC RGTCTCRRRG 300 HE GAACCAGGAT CRTRRRGGNG GTGGTCCTRR TTGRCRRGGC 350 RTGGRR RRCCTRTGCR TRGTCTTRGC CRCRRRGRGT NRRRGGTCRR 400 RRGTGGCTTC RTCTRTGGHe EER FFFFRRE HHEF FFERHFRI GEETRRRRHHE 450 RHER GRR FG HRR ETHHHRS HE E Primer Data Forward Primer RGCTGCCRTTGTTGCTGTTGT Tm 59 6 48 Start 255 Length 21 Reverse Primer GCAGCCTTGTCAATTAGGACCA Tm 60 gGc 5
25. 0 Start 555 Length 22 Amplicon Tm 789 6 46 Length 101 Ta 58 Primer Data window Quick and Easy Oligo Design 2 9 Exploring the Sequence Page and Imported Sequence Exploring 2 10 Quick and Easy Oligo Design In this section you will become familiar with features of the Primer Express software that are available after a sequence has been imported To explore the Sequence page and imported sequence Step Action 1 Observe the red lines crossing out the first 10 and the final 54 base pairs Figure 2 2 These lines indicate sequence data that is excluded when the Primer Express software calculates primers The 0x208 131 file contains these annotations because the sequence has been processed by Factura software This type of annotation can also be made by hand using the Exclude tool on the Annotation Tools palette Exclude annotations Base sequential red strike through numbers EM DNR PCR 1 Params Rxn Cond Primers Results fa FileName ox208 131 _ import DNA File IC Hel bl Length 471 bp Selection 253 to 353 O Doui le Stranded FEHAGEHHGG TACCCTTTCA RRRRRRRRRR RGRRRGRRRG RRRRRGRRRT CTGCRRCRTR RCCTRTGRRT GRTGTGCTGR GRTGGGRRRC CCRRRRTHRT GGTRRRTCRG RGTGGCRCTR RGGCCRTTGT CTCRCCRTGG CRRCCCRRRR RRCRGCRGTC RCRGTCTRGG TCTTTCCRGR RRGTRRRTGT AGAGCCCCTG TTCCTCCTTR RTGCTGGRGR RGTGTCTGCT TTGTTGCTGT TGTTCCRTTT
26. 332 with a Tm of 6l The reaction contained 50 nM of template and 500 uM of primer in 50 mM salt and 1 mM Mg three step PCR was performed for 35 cycles Denaturation was at 94 for 20 seconds Annealing wa performed at 55 for 20 seconds Extension was performed at 72 for 30 seconds The PCR yield was average Click the scroll arrows to view the rest of the summary data or picture Click the Open Related Document button to open the saved DNA PCR document How to Set the GC Clamp Parameter Introduction This section describes how to set the GC Clamp parameter A GC clamp is a series of Gs and Cs positioned at the 3 end of a primer The triple hydrogen bonds in Gs and Cs cause stronger hydrogen bonding than As or Ts Scientists have traditionally used a GC clamp to reduce mispriming Because design specification specifies as large a GC clamp as possible a starting value of 2 could be appropriate Setting the GC To set the GC Clamp Parameter Clamp Parameter Step Action 1 Click the Params tab to view the Params page 2 Select the GC Clamp value by dragging through or double clicking the current value 3 Type the number 2 in the GC Clamp data field Fine Tuning the Oligo Design 3 5 How to Annotate the Sequence Introduction Annotating the Alu 1 Restriction Site 3 6 Fine Tuning the Oligo Design You will use several annotation tools
27. 421 8 J TGGCYTTCTCCTTCAACTTY 5 4 Oligo Design for Allele Specific PCR 4 11 4 12 To find and view discriminatory primers continued Step Action 4 Click on the Sequence page to view the positions of the best primer pair based on Penalty score in the Consensus sequence The Forward and Reverse Primers are indicated by open arrows Figure 4 6 You can use this primer pair to preferentially amplify the a chymase sequences over b chymase sequences Forward primer scroll to the right to view dida primer Recipe Results File Name Chymase Alignment nport Alic Total Sequences 10 Included 4 2 ExcWided 6 Discrim Res 92 Figure 4 6 Sequence page after primers are calculated You must have a large monitor and resize the Allele Specific PCR document Figure 4 7 to view both primers at the same time on the Sequence page Oligo Design for Allele Specific PCR Sequence Params Cond Primers Map Recipe Results File Name Chymase Alignment Import Alignment File Total Sequences 10 2 Included 4 Excluded 6 DiscrimRes 92 Primers open arrows Figure 4 7 Sequence page after resizing What You Have Learned Summary of In chapter 4 of this tutorial you have learned how to Chapter 4 Open a new Allele Specific document and import an alignment file Sort alignment sequences to group them for inclusion exclusion
28. 75 markings these values in the Map page Look closely at where the You can precisely set these min max lines almost intersect values in the Params page You the T scale and try to visually can return to the Params page estimate the minimal and to observe where the Tm maximal T values minimal and maximal values are specified Note The optimal T and optimal GC parameters are not shown on the Map page 6 As shown in Figure 2 10 With the window at its original observe the graphic size only four primer pairs are representations of the primer completely visible at any one pairs found and the numerical time on the Map page attributes associated with each 3 To view more primers you can primer Click the scroll arrows on the right edge of the Primer pane or Resize the window to a larger size Forward primer Reverse primer Reverse primer Amplicon length start location 5 end Forward 152 bp primer start 125 296 location Tm 60 58 Reverse primer m To view primer data on the Map page continued Step Action Comment Result 7 Select the second primer pair Do not click any of the attribute graphic shown in the pane numbers To do this click any open space If you do this causes the primer between the dotted grey lines pairs to sort and change between primer graphics position in the Primer pane 8 Observe that the highlighted The highlighting in
29. DI TOF Biospectrometry and Mariner ESI TOF Mass Spectrometry Workstations 1 800 899 5858 then press 13 1 508 383 7855 Biochromatography BioCAD Workstations and Poros Perfusion Chromatography Products 1 800 899 5858 then press 14 1 508 383 7855 Expedite Nucleic acid Synthesis Systems 1 800 899 5858 then press 15 1 508 383 7855 Peptide Synthesis Pioneer and 9050 Plus Peptide Synthesizers 1 800 899 5858 then press 15 1 508 383 7855 PNA Custom and Synthesis 1 800 899 5858 then press 15 1 508 383 7855 FMAT 8100 HTS System and Cytofluor 4000 Fluorescence Plate Reader 1 800 899 5858 then press 16 1 508 383 7855 Chemiluminescence Tropix 1 800 542 2369 U S only or 1 781 271 0045 1 781 275 8581 Applied Biosystems MDS Sciex 1 800 952 4716 1 650 638 6223 Outside North America Telephone Fax Region Dial Dial Africa and the Middle East Africa English Speaking and West Asia Fairlands South Africa 27 11 478 0411 27 11 478 0349 South Africa Johannesburg 27 11 478 0411 27 11 478 0349 Middle Eastern Countries and North Africa Monza Italia 39 0 39 8389 481 39 0 39 8389 493 Telephone Fax Region Dial Dial Eastern Asia China Oceania Australia Scoresby 61 3 9730 8600 61 3 9730 8799 Victoria
30. DNA PCR document If you have not installed the Primer Express software install the software using the procedure in Section 2 Installing the Primer Express software in the Primer Express Software User s Manual The following procedure describes how to open a Primer Express document To open a Primer Express document Step Action 1 Double click the Primer Express software icon The Primer Express software splash screen appears Primer Express Serial no 5 licenced to Applied Biosystems Technical Support All Reserved AB If you are starting the Primer Express software for the first time a dialog box appears with the message to create or open an archive file Please select a Primer Express Archive file to open or click New to create a new one S Primer Express Appl Y c Hard Drive Desktop To open a Primer Express document continued Step Action 2 Click New to create a new Primer Express software archive If you have already started the Primer Express software and created the archive file go to Exploring the Features of the Sequence Page on page 2 6 Click Save to save the new Primer Express software archive as PXArchive S Primer Express Appl Y c Hard Drive i Primer Express Eject C3 Sample Sequences Desktop Create a new PHArchive PHRrchive o Select New from the File menu and DNA PCR from
31. GC clamp Document window Forward Primer Start Length Tm SGC Prim GACAGAACACATTCCTCCTTACAGC z 25 59 48 24 58 46 24 58 46 55 21 5 52 AATCAGAGTGGC ACT A AGGCC 121 20 59 55 AGGCC TTGTCTCACCATGG 125 21 60 52 CATTSTCTCACCATGGCAACC 115 22 60 55 GCALTAAGGCCATTGTCTCACC 105 21 57 52 AWMICAGAGTGGC ACT A AGGCC BRCRGRRCRCRTTCCTCCTTRCRGC 2 __4 art 200 Length 25 CCATAGCAGCCTTGTCAATTAGG Tm 59 6 48 Start Amplicon Tm 79 47 Primer Data window 5 Click on each primer pair in turn and observe each primer pair s Tm 96 GC primer length and amplicon length attributes in the Primer Data window 3 20 Fine Tuning the Oligo Design To expand the search for primers continued Step Action 6 Click the Optimal Primer Pairs Only checkbox in the lower left corner of the Params page Observe that two primer pairs satisfy the requirements to be optimal Change to the Map page to view the primer pairs graphically Observe the two optimal red primer pairs Click the Optimal Primer Pairs Only checkbox deselect it to view all eight potential primer pairs As you have seen by changing the 3 GC Clamp value this parameter is one of the most limiting in the Primer Express software Observe that most of th
32. GCRRCTTCTC RGTCTCRRRG GRRCCRGGRT CATARAGGNG G GGTCCTRR TTGACAAGGC RRCCTRTGCR TRGTCTTRGC CRCRRRGRGT NAAAGGTCAA RRGTGGCTTC RTCTRTGSeMe EER FFFRRE HHBEF TFSFFFR BEE HIRREHHE ERE Primer Data Forward Primer RGCTGCCRTTGTTGCTGTTGT Tm 59 6 48 Start Length 21 Reverse Primer GCAGCCTTGTCAATTAGGACCA Tm 60 GC 50 Start Length 22 Amplicon Tm 78 BGC 46 Length Ta 58 Figure 2 2 Sequence page indicating Exclude annotations To explore the Sequence page and imported sequence continued Step Action 2 Observe the numbers at the right of the Sequence page Figure 2 2 These numbers indicate the sequential number of the final residue in each line of the sequence According to the last number listed the sequence 0x208 131 contains 471 base pairs Observe the hollow arrows contained within the highlighted region Figure 2 3 These arrows indicate a pair of primers calculated by the Primer Express software This set of primers is one of 105 primer pairs that the software has calculated for the 0x208 131 sequence using the default parameters The sequence inside the two primers is the amplicon Note X You will view all the primer sets later in this chapter Forward primer Em DNR PCR 1 EE Rxn Cond Primers Recipe Results FileName ox208 131 mportDNAFile Length 471 bp Selection 253 to 353 Double Stranded TACCCTT
33. GGRRRC CCRRRRTHRT BGTRRRTCRG RGTGGCRCTR RGGQERTTGT CTCRCCRTGG CRRCUCRRRR RRCRGCRGTC RCRGTCTRGG TCTTTCCRGR RRGTRRRTGT AGAGCCCCTG RCRGRRCRCR TTCCTCCTTR CRGCRCTata atgetggaga agtgtetget Alu I v gcagetQooa ttgttgctat tgttedhtyt gCARCTTCTC AGTCTCARAG GTGRCRGCRR GAACCAGGAT CRTRRRGBIJG GTGBTCCTRR TTGRCRRGGC TGCTRTGGRR RRCCTRTGCR TAGTCTTAGC CRCRRRGRGT HRRRGGTCRR RRGTGGCTTC RTCTRTGEHECEERTFFFRHGTHHNTFFEGRTA GEETARRATE RHERTSRRTCTURRESTRARS H Target region annotation green lower case letters Figure 3 3 Sequence page with target region annotation This annotation tells the software to include this portion of the sequence in the amplified region which will require that any primer pairs have an amplified region that includes at least 25 nt to either side of the Alu 1 recognition sequence Observe that the Target annotation turns the text to green lower case letters To annotate a target region continued Step Action 6 If your Target annotation is off by several bases you can correct the annotation by using either the a Eraser tool to erase the annotation and doing the annotation again or b Select tool to adjust the end of the annotation For more information about adjusting the target annotation see page 3 12 Note The 25 nt cushions start at both ends of the four nucleotides AGCT that make up the Alu 1 recognition site Select Find Primers Now from the Options menu to ca
34. O Hybridizing at to eg Cycle Params Number of Cycles ss Hot start 20 secat 94 7 20 se at ssl zo secat 72 Template C 50 Primer 50 5 nM Salt 50 0 m Mg C irom Amplification yield Comments test fil Save Results Attach PICT Comments text box Click the Attach PICT button to attach a picture screen capture or scan If you don t have a picture and you want to see how this feature works drag or copy any PICT file into the Attach PICT Window Attach PICT Window Paste or drag a PICT here Close the Attach PICT Window after pasting or dragging a picture 2 34 Quick and Easy Oligo Design To save the results continued Step Action 4 Click the Save Results button The dialog box shows the name under which the Results are being saved Click OK to save the Results The information shown on the Results page is saved in the Results Archive along with the PICT file if you selected one Chapter 3 Fine Tuning the Oligo Design views the results you have just saved Note This section does not discuss exporting sequence data For information on exporting files refer to Appendix C in the Primer Express Software User s Manual How to Quit Primer Express Quitting the To quit the Primer Express software Primer Express Software Step Action 1 Choose Quit from the File me
35. Plot 3 GC Plot aLe Area of low GC content Map page Sequence data high percentage of A and T first line of Sequence page I TCNAGCNNGG TRCCCTTTCR RRRRRRRRRR RGRRRGRRRG RRRRRGRRRT 50 Figure 2 18 Effect of sequence data on the GC Plot Change the view scale to observe in greater detail the relationship of the T4 and GC Plots For information on how to change the view scale see step 9 on page 2 23 Click the close box in the upper left corner to close the copy of the Map page How to Evaluate the Primer Results Evaluating the This section describes how to view the contents of the Recipe and Primer Results Results pages After you have selected which primer pair to use you can set the proportions of components required for the PCR reaction mixture This information is displayed on the Recipe page which operates like a spreadsheet application To evaluate the primer results Step Action 1 Click the Recipe tab to view the Recipe Page Figure 2 19 Sequence Params Rxn Cond Primers Map Recipe Results Component Stock Concentration Volume Final Concentration Distilled water 75 3 uL Buffer Stock 10 0 1 dATP 20 200 uM mM dCTP 20 200 uM mM dGTP 20 200 uM mM dTTP 20 200 uM Forward Primer 0 1 56 5 nM uM Reverse Primer 0 1 56 5 nM U ul Taq Polymerase 05 L zs U mL 25 mm MgCl2 40 15 mM ug ml Template DNA 20 L 3l ug
36. Primer Express Applications Based Primer Design Software Applications Tutorials Applied KS Biosystems Copyright 2001 Applied Biosystems For Research Use Only Not for use in diagnostic procedures ABI PRISM and its design Applied Biosystems GeneScan Primer Express and Sequence Navigator are registered trademarks of Applera Corporation or its subsidiaries in the U S and certain other countries ABI and Factura are trademarks of Applera Corporation or its subsidiaries in the U S and certain other countries AmpliTaq TaqMan and UITma are registered trademarks of Roche Molecular Systems Inc Macintosh is a registered trademark of Apple Computer Inc All other trademarks are the sole property of their respective owners P N 4303015B Contents 1 About the 1 1 Inttoductior d 1 1 In This Chapter cV eere t eek SSA Ee ese 1 1 About the Tutorials 3 24 45 1 2 Quick and Easy Oligo 1 2 Fine Tuning the Oligo 1 2 Oligo Design for Allele Specific PCR 1 3 Technical Support e Ee Wa e eC rectos 1 4 Contacting Technical 1 4 To Contact Technical Support by
37. TCA RRRRRRRRRR RGRRRGRRRG RRRRRGRRRT RCCTRTGRRT GRTGTGCTGR GRTGGGRRRC CCRRRRTHRT RGTGGCRCTR RGGCCRTTGT CTCRCCRTGG CRRCCCRRRR RCRGTCTRGG TCTTTCCRGR RRGTRRRTGT RGRGCCCCTG TTCCTCCTTR CAGCACTATA RTGCTGGRGR RGTGTCTGCT TTGTTGCTGT TGVTCCRTTT GCRRCTTCTC RGTCTCRRRG GRRCCRGGRT CRTRRRGGNG GTGGTCCTRR TTGRCRRGGC RRCCTRTGCR TRGTCTTRGC QRCRRRGRGT NRRRGGTCRR RRGTGGCTTC RTCTRTGGHe EER FFFFRRE HHEF FFSRHHRI SEE TRRRRH E n Forward Primer RGCTGCCRTTGTTGCTGTTGT Tm 59 6 48 256 Length 21 Reverse Primer GCAGCCTTGTCAATTAGGACCA Tm 60 6C 50 Start 356 Length 22 Amplicon Tm 78 6 46 Length 10 Ta 58 Reverse Figure 2 3 Sequence page indicating primer pair annotations and data Click the checkbox named Double Stranded located at the upper right of the sequence page Quick and Easy Oligo Design 2 11 2 12 Quick and Easy Oligo Design To explore the Sequence page and imported sequence continued Step Action 5 When this checkbox is selected both strands of the sequence are displayed Figure 2 4 along with their existing annotations Forward primer Sequence Params Rxn Cond Primers Map Recipe Results hath 471 bp Selection 253 to 353 K Double Stranded Forward GCAECTGCCA TTGTTGETGT TGPTCCATTT GCRRCTTCTC RGTCTCRRRG 300 strand CGTCGACGGT RRCRRCGRCR RCRRGGTRRR CGTTGRRGRG TCAGAGTTTC Reverse TGRCRGCRR GRRCCRGGRT CRTRRRGGNG GTf TIGACAAGGE 350 CTTGGTCCTR
38. Test 96 Total Number Primer Pairs Tested 1196 Number Passing Amplicon Length Test 186 Number Passing Avoid Excludes Test 186 E Number Passing Tm Match Test 133 Primer pair tests Number Passing Amplicon Tm Test 133 Number Passing Target Test 133 Number Passing Primer Dimer Test 105 Figure 2 7 Interim Results window 6 Click the close box to close the Interim Results window or move the window to an open location on the desktop Quick and Easy Oligo Design 2 19 How to View Primer Data on the Map Page Introduction The Map page displays much of the same information contained in the Sequence Params and Primers pages but in a graphical display that is easier to read Frequently you can discover the solution to an oligo design problem more easily if the primer amplicon data is viewed graphically Viewing the Map The following procedure describes how to view primer data on the Map Page page To view primer data on the Map page Step Action Comment Result 1 Click the Map tab to change to The features of the Map page the Map page are in color to let you discern each feature more easily Click this tab to view Feature pane the Map page Sequence Params Cond Primers Hap X Tm Pret C cc Piet Optimal Primer Pairs Only Primer pane Click arrow to scroll down The Map page is divided into two main areas Feature pane Contains the sequence annotations T
39. ach sequence in the imported alignment file is approximately 680 bases long Oligo Design for Allele Specific PCR 4 5 Examining the Features of the Allele Specific PCR Document Diagram The following is an example of an Allele Specific PCR document Allele Specific PCR 1 otal Sequences 10 Included 10 Excluded DiscrimRes Q Features The following table describes the features of the Allele Specific PCR document Call out Description 1 The boxes next to the sequence names are all checked The Primer Express software calculates primers that specifically amplify the checked sequences Unchecked sequences are not amplified Data indicates that there are a total of 10 sequences in the alignment 10 sequences are included with zero excluded and zero discriminatory residues The third base position in the consensus sequence in labeled with a Y This is the first differentiating position in the alignment because there are four sequences that have a C residue in this position and the rest have a T residue in this position 4 6 Oligo Design for Allele Specific PCR How to Sort and Select Sequences in the Alignment Sorting and This section describes how to sort the sequences the Chymase Selecting Alignment This action is not strictly necessary to find primers but it is a Sequences Convenient way of viewing the two diff
40. age The following procedure describes how to use the Primers page To use the Primers page Step Action Result Comment 1 Observe the status bar at the The status bar displays bottom of the document information about the status of a Figure 2 5 primer calculation for example how many primers were found or what you need to do to find primers Quick and Easy Oligo Design 2 17 2 18 Quick and Easy Oligo Design To use the Primers page continued data by a different parameter Step Action Result Comment 2 Click the right scroll arrow to Observe the Penalty heading at view the remaining primer data the far right of the Primers page Figure 2 6 Note Use Penalty scores as a relative indication of primer The underline indicates that the quality Penalty scores are not list of data is sorted by Penalty absolute score The list is initially sorted in ascending order low to high The Penalty Score is a measure of how well a primer amplicon set matches the parameters defined on the Parameters page The smaller the Penalty score the closer a primer pair is to optimal Click a heading to change the sorting Sequence Params Rxn Cond Primes Map Recipe Results Reverse Primer Amplicon h Tm 6 Primer Length Tm 6 Penalty 58 50 GGAACAACAGCAACAATGGC 152 79 47 57 1222 40 57 55 CAACAGCAACAATGGC AGC 168 79 47 57 1348 58 52 ATCCTGGTTCTTGCTGTC ACC 206 78 46 57
41. al document shows the primer graphic highlighted by an outline only All inactive documents display their highlighting in this DNA PCR 1 1 Inactive document Sequence Params Rxn Cond Primers Recipe Results EJ Tm Piot o GC Plot Optimal Primer Pairs Only T T T 100 200 500 400 has title bar grayed Highlight Active document has dark title bar Disc Piet Optimal Prime 1 Map Pairs Only 100 total of 105 primer pairs found Click on any primer pair in the DNA PCR document inactive document Jp epu Copy of Map page active document Figure 2 14 Copy of Map page and original Map page 4 2 26 Quick and Easy Oligo Design Click on the original DNA PCR document to make it active To sort primers on the Map page continued Step Action 5 Click the Primers tab to select the Primers page The primer amplicon set on the Primers page is highlighted Figure 2 15 This primer amplicon set corresponds to the primer pair graphic on the Map page Eri DNA PCR 1 Ee Sequence Params Cond Primers Results Forward Primer Reve Start Le
42. an e mail reply to your question from one of our technical experts within 24 to 48 hours To Obtain Free 24 hour access to Applied Biosystems technical documents Documents on including MSDSs is available by fax or e mail or by download from our Demand Web site To order documents Then by index number a Access the Applied Biosystems Technical Support Web site at http www appliedbiosystems com techsupp b Click the Index link for the document type you want then find the document you want and record the index number c Use the index number when requesting documents following the procedures below by phone for fax delivery a From the U S or Canada call 1 800 487 6809 or from outside the U S and Canada call 1 858 712 0317 b Follow the voice instructions to order the documents you want Note There is a limit of five documents per request through the Internet for fax or e mail delivery a Access the Applied Biosystems Technical Support Web site at http www appliedbiosystems com techsupp b Under Resource Libraries click the type of document you want c Enter or select the requested information in the displayed form then click Search d In the displayed search results select a check box for the method of delivery for each document that matches your criteria then click Deliver Selected Documents Now or click the PDF icon for the document to download
43. ce 3 6 to 3 13 Alu 1 restriction site 3 6 to 3 9 target region 3 9 to 3 11 adjusting 3 12 viewing the results 3 12 to 3 13 calculating volumes for PCR reaction 3 23 design specifications setting 3 2 expanding search for primers 3 20 to 3 21 changing GC clamp value 3 21 GC clamp parameter setting 3 5 printing 3 22 selecting a primer pair 3 22 Index 3 setting parameters to the specifications 3 14 to 3 17 viewing previous results 3 3 to 3 4 what you learned 3 24 oligo design quick and easy 2 2 to 2 36 after importing sequence 2 10 to 2 12 comparing GC plot with sequence data 2 29 to 2 30 evaluating primer results 2 31 to 2 32 importing sequence 2 8 to 2 9 opening Primer Express document 2 2 to 2 4 quitting 2 35 saving 2 33 to 2 35 saving the document 2 33 saving the results 2 34 to 2 35 three ways to save 2 33 Sequence page exploring 2 6 to 2 7 setting highlight color 2 5 sorting primers Map page 2 25 to 2 28 how to sort 2 26 to 2 28 linked pages when sorting 2 25 viewing parameters 2 13 to 2 15 table of parameters 2 14 viewing primer data Map page 2 20 to 2 24 Primers page 2 16 to 2 19 what you learned 2 36 WwW www address Applied Biosystems 1 8 Documents on Demand 1 9 Index 4 Headquarters 850 Lincoln Centre Drive Foster City CA 94404 USA Phone 1 650 638 5800 Toll Free 1 800 345 5224 Fax 1 650 638 5884 Worldwide Sales Offices Applied Biosystems vast distribution and service network compose
44. cument DNA PCR Document RT PCR Document Nested PCR Document Allele Specific PCR Document Multiplex PCR Document TaqMan Probe Document Cycle Sequencing Document Sequencing Primer Document Batch Processing Document Primer Test Document Open 360 Open Results Close 36 Save 868 Save fis Import Export Page Setup Print Send Mail 38M The new Allele Specific document appears Allele Specific PCR 1 File Name Total Sequences 0 Included Excluded 0 Discrim Res o To load a alignment file click the Import Alignment File button 4 4 Oligo Design for Allele Specific PCR How to Import an Alignment File Importing an To import an alignment file Alignment File Step Action 1 Click Import Alignment File on the new Allele Specific PCR Document The standard Macintosh file navigation dialog box appears 2 Navigate to the Sample Sequences folder click the sequence named Chymase Alignment to highlight it then click Open The Allele Specific PCR document looks like the figure below after the Chymase Alignment file is imported Alignment data Allele Specific PCR 1 20 30 RYDG RKSVRDD D v V GH V Consensus sequence The Sequence Page displays 10 sequences in the alignment file along with a consensus sequence displayed at the top E
45. d 1 9 E e mail address for technical support 1 4 F Factura importing sequence from 2 8 to 2 9 Feature Map using to compare GC plot with sequence data 2 29 to 2 30 G GC clamp changing value 3 21 setting parameter 3 5 H help e mail address 1 4 internet address 1 8 telephone hours 1 4 Index 1 telephone fax 1 5 to 1 8 highlight color setting 2 5 I importing alignment file 4 5 sequence 2 8 to 2 9 after importing sequence 2 10 to 2 12 internet address Documents on Demand 1 9 M Map page comparing GC plot with sequence data 2 29 to 2 30 sorting primers 2 25 to 2 28 how to sort 2 26 to 2 28 linked pages when sorting 2 25 viewing primer data 2 20 to 2 24 oligo design allele specific PCR 4 2 to 4 13 about 1 3 Allele Specific PCR document about 4 2 chymases alignment using 4 2 what are 4 2 discriminatory primers finding and viewing 4 10 to 4 13 examining features 4 6 importing alignment file 4 5 opening Allele Specific PCR document 4 3 to 4 4 sorting and selecting sequences 4 7 to 4 9 what you learned 4 13 fine tuning 3 2 to 3 24 about 1 2 adjusting parameters 3 18 to 3 19 annotating sequence 3 6 to 3 13 Alu 1 restriction site 3 6 to 3 9 target region 3 9 to 3 11 target region adjusting 3 12 viewing the results 3 12 to 3 13 Index 2 calculating volumes for PCR reaction 3 23 design specifications setting 3 2 expanding search for primers 3 20 to 3 21 changing GC clamp value 3 21 GG clamp
46. d of highly trained support and applications personnel reaches into 150 countries on six continents For international office locations please call our local office or refer to our web site at www appliedbiosystems com www appliedbiosystems com AR Applied NB Biosystems Applera Corporation is committed to providing the world sleadingtechnology andinformationforlife Scientists Applera Corporation consists of the Applied Biosystems and Celera Genomics businesses Printed in the USA 01 2001 Part Number 4303015B an Applera business
47. default input values How to Save Your Work Three Ways to The following table lists the three ways you can save your work Save IF you want to save the THEN use document in the document archive Save Save As command primer results in the results archive Save Results command sequence data to your hard disk Export command Saving the This section describes how to save your document so that you can Document retrieve and view your primer results later To save the document Step Action 1 Choose Save or Save As from the File menu A dialog box appears that shows your name and the name the document will be saved under Save Document using Document Name User Name Make any changes you wish to the names in the dialog box then click the Save button This action saves your DNA PCR document in the Document Archive file continued on next page Quick and Easy Oligo Design 2 33 Saving the Results This section describes how to recall the document that you just saved so that you can make changes to the design To save the results Step Action 1 Type any comments that you wish to make in the Comments text box at the bottom of the Results page Sequence Params Cond Primers Map Recipe Results Forward Primer RecreccarTeTTGcTeTT T Cid Hybridizing at to Tm ss Reverse Primer ScAGcCTTGTCAATTAGGACCA
48. dicates area in the Feature pane where in the sequence the changes when you select a selected region is located different graphic in the Primer pane 9 Click the increase magnification The scale of the T plot in the button Figure 2 11 to Feature pane changes change the magnification to 2X Decrease Increase magnification magnification View scale Figure 2 11 Magnification controls 10 Change the view scale between The greater detail in the T Plot 1X and 2X while you observe the change shows more clearly the changes in T from nucleotide to nucleotide The primer pair graphics in the Primer pane have doubled in size along with the T Plot You can increase the magnification further to see even greater detail Use the left and right arrows at the bottom of the Map page to scroll the Primer pane Quick and Easy Oligo Design 2 23 To view primer data on the Map page continued Step Action Comment Result 11 Return the magnification scale to 1X by clicking the decrease magnification button You can also do this by a Clicking and holding the cursor over the view scale b Selecting the number 1 from the pop up menu Figure 2 12 The magnification returns to 1X Figure 2 12 View scale pop up 2 24 Quick and Easy Oligo Design How to Sort Primers on the Map Page Introduction This section describes how to copy of the Map page sort
49. e Params Rxn Cond Primers Map Recipe Results PCR Enzyme Concentrations Template DNA Approx MW x10 L 7 C o1 00260 sojug m 0 nM Forward Primer MY 0 C ooo 00260 50 0 nM Reverse Primer MY C ooo 00260 ooolug m 50 0 nM Salt 50 0 mM Mg 10 mM 4 Observe the reaction condition values that the Primer Express software uses as defaults You will use these values for many of your oligo designs so do not change any numbers for now For more information about the Params and Rxn Cond pages parameters refer to Section 5 Primer Express Pages in the Primer Express Software User s Manual Quick and Easy Oligo Design 2 15 How to View Primer Data on the Primers Page Introduction Viewing Primer Data Contents of the Primers Page 2 16 Quick and Easy Oligo Design This section describes how to examine the list of primers that the Primer Express software has calculated and how to become familiar with the relationship between the Primers page and the Primer data window To view primer data Click the Primers tab to view the Primers page Click this tab to view the Primers page Forward Primer Primer 253 AGCTGCCATTGTTGCTGTTGT 253 AGCTGCCATTGTTGCTGTTGTT 221 ATGCTGGAGAAGTGTCTGCTGC 253 AGCTGCCATTGTTGCTGTTG 120 AAGGCCATTGTCTCACCATGG 119 TAAGGCCATTGTCTCACCATGG 128 GCCATTGTCTCACCATGGCA z 124 CCATTGTCTCACCATGGCAA Primer 120 AAGGCCATTGTCTCACCATGG m
50. e Primer pane none of the attributes is underlined This is because the primer amplicon sets are sorted by Penalty score which is not displayed on the Map page Quick and Easy Oligo Design 2 27 2 28 Quick and Easy Oligo Design To sort primers on the Map page continued Step Action 7 Click the amplicon length attribute of the first primer graphic to sort by amplicon length Figure 2 16 101 bp Click here to sort 293 353 by amplicon length Se Tm 5a Tm 60 Figure 2 16 Primer pair graphic 8 Click the amplicon length attribute again to sort the graphics from high to low The sorting of the Primers page changes when you sort primer graphics on the Map page 9 Try clicking other attributes on the Map page to sort the data differently for an illustration of primer graphic attributes see Figure 2 10 on page 2 22 If you click an attribute more than once the list sorting alternates between high to low and low to high and the displays Observe how the displays on both pages change when the graphics are sorted by different parameters How to Compare the GC Plot with Sequence Data Introduction Comparing the GC Plot with Sequence Data In an earlier section you observed the T Plot on the Feature Map portion of the Map page In this section you will become familiar with the appearance and operation of the GC Plot The following procedure describes how to compare the GC P
51. e primers that fall out of contention in the Interim Results window do so because they fail the Clamp test Changing the GC Let us now say that you have changed your mind and are willing to Clamp Value accept a lower GC clamp value in exchange for a pair of primers that have identical T S To change the GC Clamp value Step Action 1 Select the Params page 2 Change the Maximal Primer T difference to 0 and the GC Clamp value to 1 Change to the Map page to view the 21 primers found using the new values Observe that many of these primer pairs satisfy the design specifications except the original GC Clamp specification Change the GC Clamp parameter value to 3 and make any other modifications necessary to find primers with a GC Clamp of 3 You will find that no primer pairs are possible using a GC Clamp of 3 residues and the 54 bp target region annotated on the Sequence page Erase the target annotation or change the GC clamp parameter to find any primer pairs using the GC Clamp of 3 residues Click Factory Defaults on the Params page to return the parameters to their default values Fine Tuning the Oligo Design 3 21 How to Select a Primer Pair Selecting a Primer After you have modified parameters and examined the primers available Pair to you select the primer pair that you feel best meets the needs of the objectives Of course since this tutorial is a simulation it
52. erentiating groups of sequences Note With any imported alignment file it may be necessary to have some prior knowledge of the differences between sequences in order for sorting to make sense To sort and select sequences in the alignment Step Action 1 Click the C residue in the Baboon sequence third base from the 5 end This action sorts the sequences in alphabetical order A C G T for that position and groups them into the a and b chymase containing sequences That is the Baboon Human Dog and Mouse 5 are a chymase sequences and the rest are b chymase sequences Note corresponding residue in this position in the consensus is a Y residue marked by a white box that indicates sort position Figure 4 1 Sort position marked by box 10 20 30 40 Consensus VGGDGGVRVDG RKSVRDD D V V GH V o chymase p chymase _ Figure 4 1 Sequence data sorted by third base position Oligo Design for Allele Specific PCR 4 7 To sort and select sequences in the alignment continued Step Action 2 Deselect all the b chymase sequences Mouse 1 2 4 L Rat 1 2 by clicking each checkbox Figure 4 2 As you deselect each sequence the value in the Included field decreases Excluded field increases st Discrim Res field discriminatory residues changes with each sequence Watch these numbers change as you deselect sequences Total Sequence amp 10 Inc
53. ers page and observe the Sequence page to see if the requisite 25 nt cushion has been achieved b Use the Target annotation tool to specify a 25 nt cushion between the Alu 1 restriction site and either primer Note Using alternative method a could be time consuming if there are many primers sets to examine and using alternative method b is quick and easy no matter how many primer sets there are Annotating a Because design the minimum nucleotides specification requires a 25 nt Target Region cushion between the Alu 1 restriction site and either end of the amplicon you can use the Target tool to specify a particular portion of the sequence that must be included in the amplified region To annotate a target region Step Action 1 Select Show Annotation Tools from the Options menu if the palette is not already displayed Click the Target tool RITGTTT Target Position the cursor over the sequence text and the arrow cursor changes into a green l beam cursor Y Fine Tuning the Oligo Design 3 9 3 10 Fine Tuning the Oligo Design To annotate a target region continued Step Action 4 Use the I beam cursor to highlight the portion of the sequence from nucleotides 228 through 281 Figure 3 3 Look here to make sure you have the correct region selected f File Name Length 471 bp FEHAGEMHGS TRCCCTTTCR RRRRRRRRRR RRRRRGRRRT CTGCRRCRTR RCCTRTGRRT GATGTGCTGA GRTG
54. es the specificity of the primers 4 10 Oligo Design for Allele Specific PCR To find and view discriminatory primers continued Step Action 3 Click the Primers tab to view the Primers page The Primer Express software calculates and after a few seconds displays a total of 19 primer pairs that are sorted by an ascending order of penalty scores the rightmost column For more information about Penalty score refer to Appendix B in the Primer Express Software User s Manual The Discrim column indicates True False whether a particular primer discriminates the two groups of sequences Figure 4 5 Theoretically only one primer in a primer pair is required for discrimination but having both primers discriminatory is more powerful Discriminatory residues headings Sequence Discrim Start Length Tm 6 Primer CDiscrim ength Tm 6C Ta Penalty Figure 4 5 Primers page showing Discrim headings Params Rxn Cond Primers Map Recipe Results Reverse Primer Amplicon TGGCYTTCTCCTTCAACTTY TGGCYTTCTCCTTCAACTTY GGCYTTCTCCTTCAACTTY AGT GGCYTTCTCCTTCAACTTY AGT GGCYTTCTCCTTCAACTTY AGT AGCTYCTGCC ABGTGTCTTCTT CAAGCTYCTGCCABGTGTCTT TGGCYTTCTCCTTCAACTTY GGCYTTCTCCTTCAACTTY AGT GATTCKGGTR AG AC AGC AGG GATTCKGGTR AG AC AGC AGG GATTCKGGTR AG AC AGC AGG GATTCKGGTR AG AC AGC AGG GGAGATTCKGGTR AG AC AGC A GGAGATTCKGGTR AG AC AGC A GGAGATTCKGGTR AG AC AGC A
55. ested Number Passing Amplicon Length Test Number Passing Avoid Excludes Test Number Passing Tm Match Test 4 1 1 1 Number Passing Amplicon Tm Test 1 Number Passing Target Test 0 0 Number Passing Primer Dimer Test The Interim Results window displays a variety of tests and primer calculations Study the numbers on the right side of the window These numbers give you a clue as to which of the input parameters is causing potential primer pairs to drop out of consideration For example 3312 primers passed the Ambiguity Test but only 115 primers passed the Clamp Test a 97 dropoff This indicates that a lower clamp value might generate a greater number of acceptable primer pairs 67 primers passed the GC Test but only 23 primers passed the Tm Test a 66 dropoff This indicates that a wider range of Tm values minimal to maximal would probably generate more acceptable primer pairs Before making any changes on the Params page we will take a look at the Map page to get a better idea of what the T and GC parameters look like Click the Map tab to view the Map page Sometimes you can get a better idea about the quantity or location of primers found or the reason they are lacking by looking at the Tm and GC plots on the Map page Fine Tuning the Oligo Design 3 15 3 16 Fine Tuning the Oligo Design To make changes to the parameters continued Step Action 6 Observe how the T
56. iscriminatory Primers Finding and The following procedure describes how to find and view discriminatory Viewing primers To find and view discriminatory primers Action Click the Params tab to view the Params page Figure 4 4 Discrim Res parameter Sequence Params Rxn Cond Primers Results Primer Tm Requirements Min Tm s Max Tm Optimal Tm Leo Maximal Tm difference 5 Primer GC Content Requirements Min 6 6 55 s GCclamp 0 residues Primer Length Requirements Min length 18 Max length Optimal length 20 Primer Composition Requirements Max Base Repeat residues Max Num Ambigs _2 residues Discriminatory residue must be within the last residues from 3 end Primer Secondary Structure Requirements Max consec base pair Max total base pair 8 Primer Site Uniquene equirements Max consec Match Max Smatch Max 5 consec match 5 Tail Forward primer Reverse primer Amplicon Requirements Min Tm 75 Max Tm zs Min length Max length 2000 Defaults Factory Defaults Figure 4 4 Allele specific Parameters page Discriminatory Primers Step 1 2 Click the Default button to set all values to their default The discrimatory residue parameter Figure 4 4 specifies that each primer found must contain at least one discriminatory residue within eight residues of the 3 end Locating the discriminatory residue near the 3 end increas
57. it immediately e Fill in the information form if you have not previously done so then click Deliver Selected Documents Now to submit your order Note There is a limit of five documents per request for fax delivery but no limit on the number of documents you can order for e mail delivery About the Tutorials 1 9 Quick and Easy Oligo Design Introduction In This Chapter IMPORTANT The Primer Express document window must be displayed on a color monitor for you to see all the color features of the software Topics in this chapter include the following Topic See page How to Open a Primer Express Document 2 2 How Set the Highlight Color 2 5 Exploring the Features of the Sequence Page 2 6 How to Import a Sequence 2 8 Exploring the Sequence Page and Imported Sequence 2 10 How to View the Parameters 2 13 How to View Primer Data on the Primers Page 2 16 How to View Primer Data on the Map Page 2 20 How to Sort Primers on the Map Page 2 25 How to Compare the GC Plot with Sequence Data 2 29 How to Evaluate the Primer Results 2 31 How to Save Your Work 2 33 How to Quit Primer Express 2 35 What You Have Learned 2 36 Quick and Easy Oligo Design 2 1 How to Open a Primer Express Document Introduction Opening a Document 2 2 Quick and Easy Oligo Design In this section you start the Primer Express software and begin to explore the layout of the user interface of a
58. lculate the primers based on the new Target annotation The Primer Express software calculates primers and highlights the best primer pair on the Sequence page Figure 3 4 Note The best primer pair is determined by Penalty Score For more information refer to Appendix B in the Primer Express Software User s Manual Sequence Params Rxn Cond Primers Map Recipe Results Length 471 bp Selection 121 to 319 Double Stranded TACCCTTTCA RRRRRRRRRR RGRRRGRRRG RRRRRGRRRT CTGCRRCRTR RCCTRTGRRT GATGTGCTGA GRTGGGRRRD CCRRRRTHRT GGTRRRTCRG AGTGGCACTA CRRCCCRRRR RRCRGCRGTC ACAGTCTAGG TCTTTCCAGA RRGTRRRTGT AGAGCCCCTS RCRGRRCRCR TTCCTCCTTR CRGCRCTata atgctggaga agtgtctgct Alu I Y ttgttgctgt tgttccattt gCRRCTTCTC RGTCTCRAR GTGRCRGCRR GRRCCREGR CRTRRRGGNG GTGGTCCTRR TTGRCRRGGC TGCTRTGGRR RRCCTRTGCR TRGTCTTRGC CRCRRRGRGT HRRRGGTCRR RRGTGGCTTC RTCTRTGEHG EERFFFFRRE HH FFGRR GEETRRRRTT RHERTERATG MAFEREHHHRR ES Figure 3 4 Sequence page after finding primers continued on next page Fine Tuning the Oligo Design 3 11 3 12 Adjusting the This section describes how to adjust your target annotation if it is not Target Annotation exactly in the right location To adjust the target location Step Action 1 Click the Select tool on the tool palette k Select If any sequence text is highlighted click anywhere in the text to eliminate the highlighting No
59. lot with sequence data To compare the GC Plot with sequence data Step Action 1 Click the checkbox named GC Plot to display a graphic plot of the GC solid green line and the GC parameter min max lines dotted green lines Observe that the changes in the GC Plot reflect roughly those of the T Plot Also observe that the GC Plot at the far left region of the sequence drops down all the way to zero and is outside the min max lines Figure 2 17 T Plot solid magenta line 200 300 GC Plot solid green line GC Scale drops to zero Figure 2 17 T and GC Plots Because the GC content requirements parameters used for the primer search specify a GC percentage between 45 and 55 percent no primer pairs will be found for this region Click the original DNA PCR 1 document to make it active Quick and Easy Oligo Design 2 29 2 30 Quick and Easy Oligo Design To compare the GC Plot with sequence data continued Step Action 4 Click the Sequence tab to return to the Sequence page Observe the high percentage of As and Ts that make up the first 50 base pairs the top line of the displayed sequence This high percentage of A and T is the reason that the GC Plot line displays at or near zero in this area and explains why there are no primer pairs found for this region of the sequence Figure 2 18 CO Tm Plot 3 GC Plot 200 SIL CO Tm
60. luded 10 Excluded Discrim Res 0 10 zu E Consensus vocDGGVRVDG RKSVRDD D v V GH V Click these checkboxes EE to deselect Ee them GG GG G GGG Figure 4 2 Descelecting the B chymase containing sequences 4 8 Oligo Design for Allele Specific PCR To sort and select sequences in the alignment continued Step Action 3 After you have deselected all six b chymase containing sequences there are now four sequences included six sequences excluded and 92 discriminatory residues Figure 4 3 Discriminatory residues annotated with an asterisk Total Sequences 10 Included 4 Excluded 6 DiscrimRes 92 Consensus Selected Deselected Figure 4 3 Alignment showing discriminatory residues The Discrim Res field shows that there are 92 different base positions that distinguish the a chymase and B chymase sequences These residues are indicated by an asterisk in the Consensus sequence The Primer Express software uses one or more of these discriminatory residues to calculate primers that amplify any of the four included sequences but none of the excluded sequences Note Any further selecting or deselecting sequences decreases the number of discriminatory residues This maximum number of 92 discriminatory residues represents the optimal grouping of sequences into and D chymase sequences Oligo Design for Allele Specific PCR 4 9 How to Find and View D
61. n 1 3 GC Clamp Set the clamp value to 3 for now If there are plenty of primer pairs to choose from you can try changing the clamp value to 4 later Primer length Leave these values intact Minimal amplicon length Enter the minimal amplicon length of 54 25 cushion 4 nt restriction site 25 nt cushion Maximal amplicon length Set the maximal amplicon length to 300 Our target is 200 but it would be beneficial to see as big a list of primers as possible that have an amplicon length of approximately 200 Amplicon length is usually of lesser importance when selecting primer pairs 3 14 Fine Tuning the Oligo Design To make changes to the parameters continued Step Action 3 Click the Primers tab to view the Primers page The status bar message states that no primer pairs can be found that now satisfy all of the original design specifications Choose Show Interim Results from the Options menu B Interim Results ii Total Number Primers Tested 4490 Number Passing Ambig Test 3312 Number Passing Clamp Test 115 Test that causes largest dropoff of potential primer pairs note how the number shows a large reduction compared to the previous test Number Passing GC Test 67 Number Passing Tm Test 23 Number Passing Repeat Test T Number Passing Secondary Struc Test T Number Passing Primer Site Unique Test Total Number Primer Pairs T
62. ngth Tm GC Primer Start Length Tm 258 21 59 48 AGCTGCCATTGTTGCTGTTGT 353 22 60 H Ig hl 19 ht 258 2 61 45 AGCTGCCATTGTTGCTGTTGTT 353 22 60 231 22 55 ATGCTGGAGAAGTGTCTGCTGC 353 22 60 253 20 59 50 AGCTGCCATTGTTGCTGTTG 355 22 60 120 21 61 52 AAGGCCATTGTCTCACCATGG 252 2 22 50 TAAGGCCATTGTCTCACCATGG 252 22 61 1227 20 55 GCCATTGTCTCACCATGGCA 252 2 61 124 20 59 50 CCATTGTCTCACCATGGCAA 251 22 58 120 2 61 52 AAGGCCATTGTCTCACCATGG 206 21 60 118 22 58 50 CTAAGGCCATTGTCTCACCATG 251 22 58 DNA PCR 1 Map 2 50 TAAGGCCATTGTCTCACCATGG 276 21 60 imal Pr mer Pairs Only 121 20 59 55 AGGCCATTGTCTCACCATGG 251 22 58 T 124 20 59 50 CCATTGTCTCACCATGGCAA 272 20 59 300 400 116 22 59 50 CACTAAGGCCATTGTCTCACCA 251 22 58 125 2 60 52 CATTGTCTCACCATGGCAACC 251 22 58 k 114 21 59 52 GGCACTAAGGCCATTGTCTCA 251 2 124 AIIBICICACDATGGC AA so el m 57 optimal Primer Pairs Only Order Save List J display Hep d total of 105 primer pairs found Click any primer pair in the lower pane to select it DNA PCR document active document Copy of Map page inactive document Figure 2 15 Copy of the Map page and original document primers page 6 Click on the copy of the Map page to make it active You can sort the graphics in the Primer pane by clicking any of the numerical attributes The sorting attribute is underlined Note When you first look at the attributes in th
63. nu 2 If you have any unsaved documents a dialog box appears with a prompt to save the documents If you do not save your documents you lose any changes you have made to the default parameters Quick and Easy Oligo Design 2 35 What You Have Learned Summary of In Chapter 2 of this tutorial you have learned how to do the following Chapter 2 What Is In Chapter 3 2 36 Quick and Easy Oligo Design 9 9 Open Primer Express document Work with the palette and windows Import a sequence into a Primer Express document View and interpret primer data on the Primers page View and interpret primer graphics on the Map page Sort primers on the Primers and Map pages Save your work Most users however will not be satisfied with the results of a primer search using the Primer Express software default parameters The process of designing oligos requires the scientist to make a series of changes to the input parameters to obtain a set of primers suitable for a particular application The Primer Express software allows you to make changes easily and see the results of the changes very quickly Chapter 3 of this tutorial guides you while you change a number of the input parameters and observe how these changes affect the quantity and quality of the primer pairs calculated by the Primer Express software Fine Tuning the Oligo Design Introduction Introduction This chapter guides you th
64. otocol Chapter 4 Oligo Design for Allele Specific PCR provides step by step instructions on how to find primers for Allele Specific PCR using the Allele Specific PCR document Before starting this section the following table lists what you are expected to know about This section assumes that you IF not then see are familiar with the page and menu structure of the Primer Express software Chapter 2 Quick and Easy Oligo Design Chapter 3 Fine Tuning the Oligo Design installed the Primer Express software and created the PXArchive file Refer to the following sections in the Primer Express Software User s Manual Section 2 Installing Primer Express Software for information on how to install the software Section 3 Getting Started for information on how to create the Primer Express software Archive File What You Will Learn By the end of this section you will have performed the following tasks Opened a new Allele Specific document Imported an alignment file 9 9 Viewed primers and primer data Sorted alignment sequences to group them by allele Used the checkboxes to include exclude sequences About the Tutorials 1 3 Technical Support Contacting Technical Support To Contact Technical Support by E Mail Hours for Telephone Technical Support 1 4 About the Tutorials You can contact Applied Biosystems for technical support by
65. parameter setting 3 5 printing 3 22 selecting a primer pair 3 22 Setting parameters to the specifications 3 14 to 3 17 viewing previous results 3 3 to 3 4 what you learned 3 24 quick and easy 2 2 to 2 36 about 1 2 after importing sequence 2 10 to 2 12 comparing GC plot with sequence data 2 29 to 2 30 evaluating primer results 2 31 to 2 32 importing sequence 2 8 to 2 9 opening Primer Express document 2 2 to 2 4 quitting 2 35 saving 2 33 to 2 35 saving the document 2 33 saving the results 2 34 to 2 35 three ways to save 2 33 Sequence page exploring 2 6 to 2 7 setting highlight color 2 5 sorting primers Map page 2 25 to 2 28 how to sort 2 26 to 2 28 linked pages when sorting 2 25 viewing parameters 2 13 to 2 15 table of parameters 2 14 viewing primer data Map page 2 20 to 2 24 Primers page 2 16 to 2 19 what you learned 2 36 opening Allele Specific PCR document 4 3 to 4 4 Primer Express document 2 2 to 2 4 P parameters adjusting 3 18 to 3 19 GC clamp parameter setting 3 5 setting to the specifications 3 14 to 3 17 viewing 2 13 to 2 15 table of parameters 2 14 PCR reaction calculating volumes 3 23 primers evaluating results 2 31 to 2 32 expanding search 3 20 to 3 21 changing GC clamp value 3 21 printing 3 22 selecting a primer pair 3 22 sorting Map page 2 25 to 2 28 how to sort 2 26 to 2 28 linked pages when sorting 2 25 viewing primer data 2 16 to 2 19 See Also discriminatory primers finding and viewing Q qui
66. pecific PCR Introduction In This Chapter Topics in this chapter include the following Topic See page Introduction to Allele Specific PCR 4 2 How to Open an Allele Specific PCR Document 4 3 How to Import an Alignment File 4 5 Examining the Features of the Allele Specific PCR Document 4 6 How to Sort and Select Sequences in the Alignment 4 7 How to Find and View Discriminatory Primers 4 10 What You Have Learned 4 13 Oligo Design for Allele Specific PCR 4 1 Introduction to Allele Specific Allele Specific The Allele Specific PCR document is designed to facilitate choosing PCR Document primers from DNA sequence alignments Sequence Navigator PHYLIP formats only that preferentially amplify a subset of target sequences and exclude the rest This section is designed using the Chymase Alignment data file included with the Primer Express software What Chymases are a family of closely related mast cell serine proteases that Chymases are involved in diverse functions such as peptide hormone processing the inflammatory response and parasite expulsion Within the chymase group of enzymes a subgroup called alpha chymases includes Human chymase Baboon chymase Dog chymase Mouse chymase 5 The remaining chymases the rest of the mouse and rat chymases are loosely classified as B chymases beta chymases It is hypothesized that in early vertebrate
67. plot line remains outside the T min max lines most of the time Figure 3 6 Tm Min max lines T T T 100 200 300 400 T plot line Target annotation green Figure 3 6 T plot with annotations The T min max parameters have been set to a somewhat narrow range of 57 to 61 C This narrow range of acceptable T may be too narrow to allow primer pairs to be found The lack of primer pairs indicates that you might have to change the min T parameter to a lower value such as 53 to see how that affects the number of primers found You will adjust a few of the values on the Params on page 3 18 If it is not already selected click the GC Plot checkbox The resulting display of both Tm and GC plot lines can look very jumbled and confusing especially if the plot lines are close together Click the T Plot checkbox to turn off the Plot display Now you can see the GC plot more clearly To make changes to the parameters continued Step Action 9 Observe how the GC plot line crosses through the GC min max lines Look closely at the section just above the Target annotation Figure 3 7 The GC plot line falls between the min max lines twice in that area This should be good enough to allow primer pairs to be found A GC plot line that stays within the min max lines much of the time indicates that you really don t need to change the GC parameters much if at all Look
68. press software a sequence to use as the template for the primer design The software lets you enter a sequence by typing it at the keyboard but the most accurate method is to import a file that contains the sequence data In this section you will import a sequence file processed by Factura software then look at the sequence data in both single stranded and double stranded views Note Primer Express software recognizes Factura processed files as well as files in the Sequence Navigator software format and the ABI 373 ABI PRISM 377 and ABI PRISM 310 instrument software formats The software also recognizes the following formats GeneWorks GenBank sequence EMBL FASTA GCG PHYLIP PRIMER and ASCII text Importing a The following procedure describes how to import a sequence Sequence To import a sequence 2 8 Quick and Easy Oligo Design Step Action 1 Click the Import DNA File button to import a sequence The Import DNA File button is located next to the Help button on the Sequence page ela DNA PCR 1 a3 w File Name File Loaded Import DNA File to Length Obp Selection Double Stranded To load a DNA file click the The standard Macintosh file navigation dialog box appears To import a sequence continued Step Action 2 Navigate to the ABI Sample Files folder click the sequence named 0x208 131 to highlight it
69. quence Params Rxn Cond Primers Map Reverse Primer h Tm GC Primer 58 52 ATCCTGGTTCTTGCTGTCACC 58 52 ATCCTGGTTCTTGCTGTCACC 57 52 GCAGCCTTGTCAATTAGGACC mplicon SGC Ta Pena Primer pane oO Optimal Primer Pairs Only Amplicon Click arrow to lengths scroll to the right Figure 3 5 Primers page showing three primers found Note three amplicons are longer than 200 nt the amplicon length specification One of the amplicons is 206 nt long which is close to the target specification In order to satisfy the rest of the design specification the next step is to set the T parameters the primer T match specification Fine Tuning the Oligo Design 3 13 How to Set the Parameters to the Design Specifications Setting the This section describes how to make a number of changes to the Parameters parameters with the objective of finding primers that satisfy the original design specifications To make changes to the parameters Step Action 1 Click the Params tab to view the Params page 2 Enter the parameters that satisfy the original design specifications To select any value drag through or double click a number For this field Take this action Primer Tm Enter optimal primer of 59 then minima and maxima 2 away from the optimum min 57 max 61 Maximal T difference Enter 1 to require that the two primer T S match withi
70. really doesn t matter which primer pair you select But when you use the Primer Express software for a real project select the primer pair that most meets your needs How to Print Primer Express Software Data Printing Primer You can print the data from the Sequence Primers and Map pages E fi Xpress PORA To print Primer Express software data Data Step Action 1 Select the Primers page 2 Select Page Setup from the File menu The Page Setup dialog box appears 3 Select 85 reduction and landscape mode Click OK to save Page Setup 5 Select Print from the File menu and then click Print 3 22 Fine Tuning the Oligo Design How to Calculate Volumes for PCR Reaction Calculating After you are satisfied with the primer pair you have selected the Volumes for PCR Primer Express software gives you a quick way to calculate the volumes Reaction needed for your PCR reaction The Recipe page is designed to let you enter the concentrations of the reaction components along with the number of tubes you ll use and then the Primer Express software calculates all the values To calculate volumes for PCR reaction Step Action 1 Select the Recipe page The Recipe page is a spreadsheet for calculating reaction concentrations Make some changes to the values on the Recipe page and observe how your changes affect the final concentrations Click the Create Protocol button bottom of
71. rough a series of changes to the parameters used in the Primer Express software These changes cause the software to calculate primer pairs that have attributes different from those you observed in Chapter 2 Quick and Easy Oligo Design In this Chapter Every user will have different needs and goals when it comes to designing oligos as a result this chapter describes a simple example of oligo design Because of the power and complexity of the Primer Express software this chapter does not discuss every software feature available For more information about all the features of the software refer to Section 5 Primer Express Pages and Section 7 Primer Express Menus in the Primer Express Software User s Manual Topics in this chapter include the following Topic See page Setting the Design Specification 3 2 How to View Your Previous Results 3 3 How to Set the GC Clamp Parameter 3 5 How to Annotate the Sequence 3 6 Annotating the Alu 1 Restriction Site 3 6 Annotating a Target Region 3 9 Adjusting the Target Annotation 3 12 How to Set the Parameters to the Design Specifications 3 14 How to Adjust Parameters 3 18 How to Expand the Search for Primers 3 20 How to Select a Primer Pair 3 22 How to Print Primer Express Software Data 3 22 Fine Tuning the Oligo Design 3 1 See page How to Calculate Volumes for PCR Reaction 3 23 What You Have Learned 3 24
72. rs Highlight color Close box E Color Highlight color Window color Standard v Select a lighter highlight color such as turquoise or pink from the Highlight color pop up menu Click the close box to close the Color control panel Quick and Easy Oligo Design 2 5 Exploring the Features of the Sequence Page Exploring the This section describes how to use many of the important features of the Sequence Page Primer Express software and the Sequence page To explore the Sequence page Step Action 1 Observe the layout of the DNA PCR document Seven tabs are arranged across the top of the DNA PCR document Each of these tabs is connected to a separate page of the document In the course of this chapter you will view each of the pages and make a number of changes to the data contained in these pages The Sequence tab is unshaded which indicates that the Sequence page is at the front of the document Sequence Params Rxn Cond Primers Recipe Results Active page unshaded 2 Observe the Annotation Tools palette to the left of the DNA PCR document E i Tools i puru Line Sauda v R3 Site The Annotation Tools palette is one of four floating windows in the Primer Express software and contains twelve tools that let the user annotate the data on the Sequence page Note You will not use any of the annotation tools during
73. ssel 31 0 180 331400 31 0 180 331409 About the Tutorials 1 7 Technical Support Through the Internet 1 8 About the Tutorials Telephone Fax Region Dial Dial United Kingdom 44 0 1925 825650 44 0 1925 282502 Warrington Cheshire All other countries not 44 0 1925 282481 44 0 1925 282509 listed Warrington UK Japan Japan Hacchobori 81 3 5566 6006 81 3 5566 6505 Chuo ku Tokyo Latin America Del A Obregon Mexico 305 670 4350 305 670 4349 We strongly encourage you to visit our Web site for answers to frequently asked questions and for more information about our products You can also order technical documents or an index of available documents and have them faxed or e mailed to you through our site The Applied Biosystems Web site address is http www appliedbiosystems com techsupp To submit technical questions from North America or Europe Step Action 1 Access the Applied Biosystems Technical Support Web site 2 Under the Troubleshooting heading click Support Request Forms then select the relevant support region for the product area of interest 3 Enter the requested information and your question in the displayed form then click Ask Us RIGHT NOW blue button with yellow text 4 Enter the required information in the next form if you have not already done so then click Ask Us RIGHT NOW You will receive
74. te You cannot modify an annotation when any sequence text is highlighted Position the Select tool cursor over the beginning or end of the annotation When in the correct position the arrow or l beam cursor changes to the transparent open hand cursor lt Click and hold the cursor The end piece of sequence data highlights with a small highlight box Drag the highlight box in any direction to change the length of the annotation After the annotation is in the correct location select Find Primers Now from the Options menu to calculate the primers based on the new Target annotation Viewing the The following procedure describes how to view the results of the Results sequence annotations Fine Tuning the Oligo Design To view the results Step Action 1 Click the Primers tab to view the Primers page The status bar at the bottom of the Primers page shows that only three primer pairs were found that can amplify the annotated target region using the default parameters The design minimum nucleotides specification has been satisfied because any of the three primer pairs will have at least a 25 nt cushion between the Alu 1 restriction site and either primer pair To view the results continued Step Action 2 Click the bottom scroll bar to view the amplicon data on the right side of the Primer pane Figure 3 5 Amplicon Data headings Se
75. telephone or fax by e mail or through the Biosystems user documents MSDSs certificates of analysis and other Internet You can order Applied related documents 24 hours a day In addition you can download documents in PDF format from the Applied Biosystems Web site please see the section To Obtain Documents on Demand following the telephone information below Contact technical support by e mail for help in the following product areas Product Area E mail address Genetic Analysis DNA galab appliedbiosystems com Sequencing Sequence Detection Systems and pcrlab appliedbiosystems com PCR Protein Sequencing corelab appliedbiosystems com Peptide and DNA Synthesis Biochromatography PerSeptive tsupport appliedbiosystems com DNA PNA and Peptide Synthesis systems CytoFluor FMAT Voyager and Mariner Mass Spectrometers Applied Biosystems MDS Sciex api3 support sciex com Chemiluminescence Tropix tropix appliedbiosystems com In the United States and Canada technical support is available at the following times Product Hours Chemiluminescence 8 30 a m to 5 30 p m Eastern Time Framingham support 8 00 a m to 6 00 p m Eastern Time All Other Products 5 30 a m to 5 00 p m Pacific Time To Contact Technical Support by Telephone or Fax In North America To contact Applied Biosystems Technical Support use the telephone or fa
76. the Tm GC percentage and length of the primers and amplicon Click this tab to view the Params page Sequence Params Rxn Cond Primers Map Recipe Results Primer Tm Requirements MinTm sz ss Optimal Tm 60 Maximal Tm difference 2 Primer GC Content Requirements Min 6 6C 55 3 GC clamp of 6 residues Primer Length Requirements Min length Max length Optimal length 20 5 Tail Forward primer Reverse primer Amplicon Requirements Min Tm 25 Max Tm 85 Min length length 2 Observe the parameter values that the Primer Express software uses as defaults Table 2 1 shows the purpose of each of the parameters on the Params page The default parameters are provided as a starting point for finding primer solutions Do not make any changes to these values now You return to the Params page in Chapter 3 Fine Tuning the Oligo Design to make adjustments to the default values Quick and Easy Oligo Design 2 13 2 14 Quick and Easy Oligo Design To view the parameters continued Step Action Table 2 1 Primer Express parameters Primer T Requiremen ts Min T Minimum melting temperature allowed for either primer Max Maximum melting temperature allowed for either primer Optimal Optimal melting temperature desired This figure is used when calculating optimal primer pairs Maximum
77. the submenu to open a new DNA PCR document Note The topic of this chapter is DNA PCR and does not offer any instruction about RT PCR Nested PCR Multiplex or any other PCR application For information about these applications refer to the Primer Express Software User s Manual For a more advanced tutorial on Primer Express see Chapter 4 Oligo Design for Allele Specific PCR Quick and Easy Oligo Design 2 3 2 4 Quick and Easy Oligo Design To open a Primer Express document continued Step Action Sequence tab DNA PCR 1 m File Name No File Loaded Length Obp Selection import DNA File to Li Double Stranded Forward Primer 6 Reverse Primer Tm Length Tm SGC Start Length Amplicon Tm o GC Length Annotation Primer Data Sequence page Tools palette window How Set the Highlight Color Setting the Color The Primer Express software uses the Macintosh system highlight color when displaying the locations of amplified regions You can see all the features of the software best if you use a lighter highlight color especially turquoise or pink To set the highlight color Step Action 1 Select Control Panels from the Apple menu 2 Select Color from the Control Panels folder The Color control panel appea
78. this part of the tutorial Chapter 3 Fine Tuning the Oligo Design will show you how to use some of these tools to make sequence annotations However the next few steps will help you to become familiar with manipulating and displaying the Annotation Tools palette and the other Primer Express software floating windows 2 6 Quick and Easy Oligo Design To explore the Sequence page continued Step Action 3 Move the Annotation Tools palette to a different location on your Macintosh desktop To do this a Click and hold the mouse button on the title bar of the palette b Drag the palette to a different location on the desktop 4 Hide the Annotation Tools palette by clicking the close box located in the upper left hand corner of the palette 5 From the Options menu select Show Annotation Tools to again display the Annotation Tools palette Options Link to PH Server Turn RutoFind OFF Find Primers Now Show finnotation Tools Hide Primer Data Show Interim Results Show Primer Secondary Structure Hide Status Bar Copy Page To Window Turn PH Assistant ON You can move hide or show all the floating windows in the Primer Express software in the same manner as the Annotation Tools palette Try moving hiding and showing the Primer Data window Quick and Easy Oligo Design 2 7 How to Import a Sequence Introduction The first step in designing primers is to give the Primer Ex
79. tting Primer Express 2 35 R Recipe page using to evaluate primer results 2 31 to 2 32 Results Archive window using to view previous results 3 3 to 3 4 Results page recalling the results 2 34 to 2 35 using to evaluate primer results 2 31 to 2 32 S saving 2 33 to 2 35 saving the document 2 33 saving the results 2 34 to 2 35 three ways to save 2 33 Sequence page after importing sequence 2 10 to 2 12 exploring features 2 6 to 2 7 sequences after importing sequence 2 10 to 2 12 annotating 3 6 to 3 13 Alu 1 restriction site 3 6 to 3 9 target region 3 9 to 3 11 adjusting 3 12 viewing the results 3 12 to 3 13 comparing GC plot with sequence data 2 29 to 2 30 importing 2 8 to 2 9 sorting and selecting in the alignment 4 7 to 4 9 sorting primers Map page 2 25 to 2 28 how to sort 2 26 to 2 28 linked pages when sorting 2 25 T tables Primer Express parameters 2 14 technical support 1 4 to 1 9 e mail address 1 4 internet address 1 8 telephone fax 1 5 to 1 8 tutorials about 1 2 1 3 oligo design for allele specific PCR 4 2 to 4 13 Allele Specific PCR document about 4 2 chymases alignment using 4 2 whatare 4 2 discriminatory primers finding and viewing 4 10 to 4 13 examining features 4 6 importing alignment file 4 5 opening Allele Specific PCR document 4 3 to 4 4 sorting and selecting sequences 4 7 to 4 9 what you learned 4 13 oligo design fine tuning 3 2 to 3 24 adjusting parameters 3 18 to 3 19 annotating sequen
80. ure 3 2 Alu 1 site annotation Sequence Params Rxn Cond Primers Map Recipe Results ox208 131 port File ength 471 bp Selection 53 to 53 Double Stranded HAGEMMGS TACCCTTTCA RRRRRRRRRR RGRRRGRRRG RRRRRGRRRT CTHCAACATA RCCTRTGRRT GRTGTGCTGR GRTGGGRRRC CCAAAATNAT bG RRRTCRG RGTGGCRCTR AGGCCATTGT CTCACCATGG CAACCCAAAA RR RGCRGTC RCRGTCTRGG TCTTTCCRGR RRGTRRRTGT AGAGCCCCTG ACHGAACACA TTCCTCCTTR CRGCRCTRTR RTGCTGGRGR RGTGTCTGCT Ald I GCAGERGCCA TTGTTGCTGT TGTTCORTTT GCRRCTTCTC AGTCTCAAAG GTGRCRGCRR GRRCCRGGRT CRTRRRGGNG GTGGTCCTRR TTGRCRRGGC TGCTRTGGRR RRCCTRTGCR TRGTCTTRGC CRCRRRGRGT HRRRGGTCRR RRGTBGCTTC RTCTRTGEHE GERTFFFRRG HHNFFEGRTR SGETARRATET RHEREGRREEHRBEEEERRE H Recognition sequence AGCT highlighted nucleotides Figure 3 2 Sequence page with Alu 1 restriction site annotation If the Alu 1 recognition sequence was not found you may have inadvertently highlighted some text before doing the search To make sure no text is highlighted a Click anywhere in the upper left corner of the Sequence to place the cursor make sure no text is highlighted b Go back to step 3 on page 3 3 To annotate the Alu 1 restriction site continued Step Action 7 There are two alternative methods for finding whether a primer pair with the requisite 25 nt cushion has been calculated The methods are a Select a primer set on the Prim
81. x numbers given below To open a service call for other support needs or in case of an emergency dial 1 800 831 6844 and press 1 Product or Product Area Telephone Dial Fax Dial ABI PRISM 3700 DNA Analyzer 1 800 831 6844 then press 8 1 650 638 5981 DNA Synthesis 1 800 831 6844 then press 21 1 650 638 5981 Fluorescent DNA Sequencing 1 800 831 6844 then press 22 1 650 638 5981 Fluorescent Fragment Analysis includes GeneScan applications 1 800 831 6844 then press 23 1 650 638 5981 Integrated Thermal Cyclers ABI PRISM 877 and Catalyst 800 instruments 1 800 831 6844 then press 24 1 650 638 5981 ABI PRISM 3100 Genetic Analyzer 1 800 831 6844 then press 26 1 650 638 5981 Biolnformatics includes BioLIMS BioMerge SQL GT applications 1 800 831 6844 then press 25 1 505 982 7690 Peptide Synthesis 433 and 43X Systems 1 800 831 6844 then press 31 1 650 638 5981 Protein Sequencing Procise Protein Sequencing Systems 1 800 831 6844 then press 32 1 650 638 5981 PCR and Sequence Detection 1 800 762 4001 then press 1 for PCR 2 for the 7700 or 5700 6 for the 6700 or dial 1 800 831 6844 then press 5 1 240 453 4613 About the Tutorials 1 5 1 6 About the Tutorials Product or Product Area Telephone Dial Fax Dial Voyager MAL
82. your previous results Previous Results To view your previous results Step Action 1 Start the Primer Express software by double clicking the Primer Express software icon Close the default DNA PCR document Choose Open Results from the File menu The Results Archive window appears The Results Archive contains all results saved by means of the Save Results button Saved results file Em Results firchive LE User Date Amplicon Yield Type John McKay 8 21 95 0x208 131 253 353 Average Otto Fishbein jonne Bell 3 27 96 11 8 95 Long Read Taq Std on 310 72 176 Poor DROGNBPS A3 gb 127 227 TaqMan Probe Very Go RT PCR Fine Tuning the Oligo Design 3 3 3 4 Fine Tuning the Oligo Design To view your previous results continued Step Action 4 Click the first entry in the Results Archive to select it then click the Open button The results you saved open in a special window that shows you a summary of the results along with the picture if you included one I 0208 131 7 15 96 Results Open Related Document Results Sequence Name ox208 131 User Name Manuel Glynias Date 7 15 96 Forward Primer AGCTGCCATTGTTGCTGTTGT Anneals between residues 253 and 273 with Tm of 5 Reverse Primer GCAGCCTTGTCAATT AGGACCA Anneals between residues 353 and

Primer Express® - Applied Biosystems

Contents

Download Pdf Manuals

Related Search

Related Contents

Primer Express&reg; - Applied Biosystems

Contents

Download Pdf Manuals

Related Search

Related Contents

Primer Express® - Applied Biosystems