Home

PRISE 2.0 User Manual - Algorithms and Computational Biology Lab

1. ATTTACAACCGTTGCT AATC TITGGGT ATTTACAACCGTTGCT AAATCTAGAGTITGGG _ CATITACAACCGTTGCT ATCTAGAGTITGGGTC M 4 gt Delete Primer Probe Sets Conditionally Delete Marked Primer Probe Sets i Non target Target oa eee ees pales cin ima of ambi ba F Delete Seleted Primer Probe Sets probe probe 2robe Probe comple comple Pipa a in target sequenc _ annealing avg pos GC Tm C mentarity mentarity ens d by aie that probe binds 1 F CCGGGCTTTACACCC 100 00 100 00 11 63 100 00 92 20 66 67 58 90 7 8 0 2 CCCGGGCTTTACACC 100 00 100 00 11 63 100 00 91 20 66 67 58 90 8 6 0 45 5 6 Mark Unmark menu Mark Selected Primer probe Sets Allows selected sets to be marked Marked primer probe sets are designated by a check mark in the box in the second column and a yellow highlighted row Marked sets can be saved in the PRISE2 program format or tab delimited format using options in the File menu Note that selected primer probe sets are designated by their rows being highlighted in blue Primer probe sets can be selected by clicking on any part of the row except the boxes in the second column Standard key commands such as shift and control can be used with the selection function allowing groups of primer probe sets to be selected Unmark Selected Primer Pairs Allows selected primer probe sets to be unmarked 46 5 7 Annealing Info menu All of the functions below need to be performed
2. Each BLAST algorithm has a number of parameters Before running BLAST analysis PRISE2 allows users to view and adjust those parameters General Parameters Max target seqgeunces Expect threshold Word size Scoring Parameters Match mismatch Scores Gap costs Filter and Masking Filter Low complexity regions Mask Mask lower case letters IV Run BLAST analysis and obtain hit table After providing above information and pressing the OK button PRISE2 will try to run local BLAST If BLAST cannot start successfully a notification message will pop up In most case this is because the BLAST path is not correct please also check if the BLAST application is correctly configured and runnable lf BLAST starts successfully the result window appears The BLAST process may take a few minutes to finish When it finishes PRISE2 will notify users with a pop up message Please wait while blast is running Save Output as Hit table file After the BLAST analysis finishes the result or error warning messages if any will show in the result dialog window as below If there are any error warning messages users can check and change corresponding settings otherwise they can save the result as a hit table file by clicking on the Save Output as Hit table file BLASTN 2 2 29 Query PochoniaS
3. Remove and dump to file Browse lt Back Next gt Cancel Help The next page is the Extract Load Primer Candidates page where users can choose from i Design primers based on the target and non target sequences and user defined primer criteria or ii Load user primer candidates to assess their properties in relation to the target and non target sequences and user defined primer criteria 20 Extract Load Primer Candidates Extract primer candidates from target sequences or load user s primer candidates Design primers based on target and non target sequences Load user s primer candidates Note IF you provide your own primer candidates the program will mot consider the primer candidates extracted From target sequences To load user primer candidates primers should be saved as text files in the following format The sequences of the primers are written 5 to 3 left to right with the forward primer placed before the reverse primer and the primer sequences separated by two periods not spaces When multiple primer pairs are analyzed they need to be written on separate lines 21 lI Primer Property Settings In the next page titled Primer Probe Design Settings the user can select i Use all default settings ii Use previous settings or ili Show change settings m T amp Primer Design Settings This primer design wizard will help you to choose most of the settings for des
4. option users can configure required paths for BLAST application and then a similar interface as NCBI website will allow users to provide inputs and adjust parameters Choose one option I have BLAST on my machine and want to run it locally Provide BLAST path blast root dir bin C dev blast 2 2 29 in Provide path to database folder C dev blast 2 2 29 db C Twill obtain the hit table from NCBI BLAST website ll Specify query sequences databases and applied algorithm Next users specify the query sequence which is the same as the seed sequence Also to let BLAST program know where to search the names of databases are required which should be separated by spaces as show in the figure below BLAST contains several different algorithms that are suitable for different similarity measures and the sequence lengths by default the megablast algorithm is applied Users can choose the desired algorithm according to the query sequence and usage Query Sequence Upload seed sequences in FASTA format file Ci dev orise sample files PochoniaSeed txt Search Set Databases other _genomic nt Entrez query optional Program Selection Highly similar sequences megablast More dissimilar sequences discontiquous megablast O Somewhat similar sequences blastn _ Blastn optimized for sequences shorter than 50 bases blastn short lll View and change parameters
5. 0 0 0 0 0 0 0 0 0 00 0 0 0 0 Non target sequence 5 1 2 3 4 5 7 8 9 10 11 12 13 14 15 SSeS ae Ea 1 ed ed a yd 2 2 2 3s 3s 4 4 49s 9s Figure 6 Default Probe Selectivity Settings 56 With the same cost function as above the setting for Non target sequences can be interpreted similar to primer sensitivity 1 No mismatch is allowed at the 6 center bases the 1 to 3 positions in the middle and their symmetric position 2 At most one C A G C T A or T G mismatch and no G A or T C mismatch is allowed on the 4 to 7 base from the center 4 5 6 7 positions and their symmetric positions 3 One G A mismatch on the 10 to 13 base with no mismatch from the 1 to 6 base or one C A G C T A or T G mismatch on the 1 to 9 base with at most one C A G C T A or T G mismatch are allowed on the 10 to 13 The allowance at the left part is symmetric Similarly PRISE2 performs a local alignment for the probe against each sequence in target and non target group and predicts the position in the sequence where it anneals or does not anneal at all according to the Probe Selectivity Settings 57 7
6. 8 Primer Probe Set Report Window File Hide Display Sort Mark Unmark Annealing Info Complementarity Primer Pair Probe Setting Instant BLAST Help ATTTACAACCGTTGCT AATC Add Primer Probe Sets Manually Delete Primer Probe Sets Conditionally TITGGGT ATITACAACCGTTGCT AAATCTAGAGTTTGGG CATTTACAACCGTTGCT ATCTAGAGTITGGGTC lt p F Delete Marked Primer Probe Sets get Non target Target hi iste ESN of target sequence p Delete Seleted Primer Probe Sets be probe probe Probe Probe comple comple of ambiguous baj in target sequenc that probe binds out of 10 sith ambiguous base covered by probe Yl CCGGGCTTTACACCC 100 00 100 00 11 63 100 00 92 20 66 67 58 90 7 8 0 F CCCGGGCTTTACACC 100 00 100 00 11 63 100 00 91 20 66 67 58 90 8 6 0 annealing avg pos GC Tm C mentarity mentarity Delete Selected Primer Probe Sets Allows selected primer probe sets to be deleted Selected sets are designated by their rows being highlighted in blue Primer probe sets can be selected by clicking on any part of the row except the boxes in the second column Standard key commands such as shift and control can be used with this function allowing groups of primer probe sets to be selected 8 Primer Probe Set Report Window File Hide Display Sort Mark Unmark Annealing Info Complementarity Primer Pair Probe Setting Instant BLAST Help T Add Primer Probe Sets Manually
7. 28 TACCATTTACAACCGTTGCT TTGT 100 100 100 0 0 16 9492 259 235 363 235 125 125 125 0 0 0 4 3 29 TACCATTTACAACCGTTGCT TTTG 100 100 100 0 0 16 9492 259 235 364 235 126 126 126 0 0 0 40 3 m Primer information window Percentage of each nucleotide in target and non target sequences in relation to primer sequences information for primer pair TACCATTTACAACCGTTGCT TTTGI 17 target sequences and 413 non target sequences m Information for target sequences annealing with primer pair 17 sequences T A C c A T A c A A c G A of 100 of of 100 of of of 100 0 100 100 of of of c 0 0 100 100 0 0 ot of of 100 of of 100 100 of G 0 0 of 0 0 0 ot og og of of of of of 100 100 of of of of 100 100 100 o 0 0 os 0 0s of Information for target sequences not annealing with primer pair 0 sequences 1 r Target Sequences Annealing with Primer Shows the target sequences that anneal to the primer using the user selected primer design criteria 32 Hide Display Sort Add Delete Mark Unmark Annealing Info Primer Complementarity Primer Setting Probes Instant BLAST Help Primer Annealing Position Information Target Target Target on targei Non targe Primer pair pair Percentage of Each Nucleotide in Target and Non Target Sequences in Relation to Primer Sequences PCR min PCR max PCRavg PCR min size size size TACCATTTACAACCGTTGCT GGT 100 Target Sequenc
8. 34 27 Primer probe set settings defined Probe length range 14 to 30 target contain a probe at least Only consider top 100 candidate probe Probe Melting temperature between 58 to 72 Salt concentration 0 1 Probe GC between 25 to 75 Max probe intra complementarity 10 Max number of insertion and deletion allowed Insertion and deletion cost Positional weight cost target sequences oooooo0o0000000N Positional weight cost non target sequences 111112223344455 17 34 27 Start primer probe design process There are 10 target and 43 non target sequences 17 34 30 Found 6770 probe candidates with Frequency 100 in target sequences 17 34 30 Start Filtering probe candidates Check continuous symbol 4008 probe candidates left Check GC content 3627 probe candidates left Check G at 3 end 2745 probe candidates left Check Tm 1654 probe candidates left 17 34 31 Check intra complementarity 1175 probe candidates left Check 3 intra complementarity 1175 probe candidates left 17 34 37 Start searching For probes in target sequences 17 34 38 Start searching For probes in non target sequences 17 35 19 Generating primer probe set report with 1175 probes d Ir t Save Report Change Criteria Ok Cancel IV Probe Report After clicking on OK the next window shows the primer probe sets The title of this window will be Primer Probe Set Report Window This report window lists primer pair seq
9. A mean mnie The designing process could take minutes to hours depending on the size and complexity of the sequences in the target and non target files After the designing process is finished a report dialog will pop up showing detailed information of this designing process such as how many candidates were left after each single step This information is useful for finding which selection criteria may be too stringent causing many primer candidates to be filtered out If no primer pair is found or users are not satisfied with the found primer pairs clicking on Change criteria button will allow users to change criteria and restart the designing process again Otherwise users can continue to see the current result by clicking OK or go back to the main menu by clicking Cancel 24 20262 primer pairs Fo The report below shows the number of candidate primers meeting each selectivity criterion You can increase the number of primers by repeating the process and relaxing these criteria in the Primer Design Settings To repeat design process using different criteria click Change Criteria To go back to main window click OK 11 15 16 Primer settings defined Primer length range 14 to 22 target contain a candidate primer at least 100 Only consider top 100 candidate primers PCR product size range 50 to 200 Melting temperature between 48 to 58 Salt concentration 0 1 Primer melting temperature of
10. California Riverside that implements several features for improving and streamlining the design of sequence selective PCR primers It can also be used to produce primer probe sets for GPCR assays such as TaqMan and probes for hybridization based assays such as FISH It is available free of charge for non commercial use at http alglab1 cs ucr edu OFRG PRISE php 1 1 System requirements PRISE2 requires a minimum of 512 MB of RAM 1 GB of RAM or more is recommended and active Internet connectivity It can be run on the following platforms e Mac OS X 10 5 or higher e Windows 2000 NT XP 2003 Server Vista 7 e Ubuntu 10 04 or higher Note In order to install PRISE2 on Mac OS X Mountain Lion or higher users may be required to change or bypass their Gatekeeper settings to allow the installation Detailed information about this process can be found at http www imore com how open apps unidentified developer os x mountain lion 1 2 Overview of the design process Designing PCR primer pairs and primer probe sets using PRISE2 involves two steps e Step 1 which is divided into two components 1 1 and 1 2 enables target and non target DNA sequences to be identified and collected and e Step 2 which generates PCR primers probes designed to amplify target but not non target sequences Probes are designed along with primer pairs as a set so primer pairs need to be generated first After generating primer pairs users can continue to gener
11. Non target Non target Target Target Target Target Target Non tz Primer pair pair forward reverse pair forward reverse forward reverse PCRavg PCRmin PCR max PCRz annealing avg pos annealing avg pos size size size size GCGAGTACAGAGGCTTT TGATGC 100 00 100 00 100 00 1 78 3 31 23 92 672 25 763 25 109 00 109 109 CGAGTACAGAGGCTTTIG TGATGC 100 00 100 00 100 00 127 4 33 23 92 673 25 763 25 108 00 108 108 GAGTACAGAGGCTTITGG TGATGC 100 00 100 00 100 00 127 5 09 23 92 674 25 763 25 107 00 107 ACCGGCGAGTACAGA TGATGCGA 100 00 100 00 100 00 5 09 24 94 23 92 668 25 763 25 113 00 113 113 CCATTTACAACCGTTGCT TTGTAA 100 00 100 00 100 00 1 27 1 78 35 88 345 25 449 25 123 00 123 123 CCATTTACAACCGTTGCT TTTGTA 100 00 100 00 100 00 L27 1 78 35 88 345 25 449 25 124 00 124 124 ACCATTTACAACCGTTGCT TTTGT 100 00 100 00 100 00 1 27 1 78 35 88 344 25 449 25 125 00 125 125 CCATTTACAACCGTTGCTT TTTGT 100 00 100 00 100 00 1 27 1 78 35 88 345 25 449 25 124 00 124 124 CATTTACAACCGTTGCT TTGTAAT 100 00 100 00 100 00 1 27 6 87 35 88 346 25 449 25 122 00 122 122 CATTTACAACCGTTGCT TTTGTAA 100 00 100 00 100 00 1 27 6 87 35 88 346 25 449 25 123 00 123 123 CATTTACAACCGTTGCTT TTGTAA 100 00 100 00 100 00 1 27 6 87 35 88 346 25 449 25 122 00 122 122 CATTTACAACCGTTGCTT TTTGTA 100 00 100 00 100 00 127 6 87 35 88 346 25 449 25 123 00 123 123 GCGAGTACAGAGGCTTT TGATGC 100 00 100 00 100 00 178 3 31 39 19 672 25 764 25 109 00 109 109 CGAGTACAGAGGCT
12. as shift and control can be used with this function allowing groups of primer pairs to be selected File Hide Display Sort Mark Unmark Annealing Info Primer Complementarity Primer Setting Probes Instant BLAST Help 7 Add Primer Pair Manually l its Target Non targe Non targe on targei Target Target Target Target Target Non rimer P Delete Primer Pairs Conditionally reverse pair forward reverse forward reverse PCR avg PCR min PCR max PCF Delete Marked Primer Pairs annealing avg pos annealingavgpos size size size si 1 TACCATTTAC Delete Seleted Primer Pairs 100 0 0 2 42131 259 235 295 235 50 50 50 0 ATACCATTTAG ewer 100 0 0 2 42131 258 235 295 235 51 51 51 0 E TATACCATTTACAACCGTTGCT GG 100 100 100 0 0 2 42131 257 235 295 235 52 52 52 0 4 CCATTTACAACCGTTGCT TTTGTA 100 100 100 0 0 15 4964 261 235 363 235 124 124 124 0 js ACCATTTACAACCGTTGCT TTTGT 100 100 100 0 0 15 4964 260 235 363 235 125 125 125 0 6 B TACCATTTACAACCGTTGCT TTTG 100 100 100 0 0 15 4964 259 235 363 235 126 126 126 0 7 E ATACCATTTACAACCGTTGCT TTT 100 100 100 0 0 15 4964 258 235 363 235 127 127 127 0 8 TATACCATTTACAACCGTTGCT TT 100 100 100 0 0 15 4964 257 235 363 235 128 128 128 0 9 CCATTTACAACCGTTGCTT TTTGT 100 100 100 0 0 15 4964 261 235 363 235 124 124 124 0 10 ACCATTTACAACCGTIGCTT TTTG 100 100 100 0 0 15 4964 260 235 363 235 125 125 125 0 T
13. close to 1 By choosing Binary the function is simple if two bases contain any common nucleotide then they are considered match with cost 0 otherwise it s a mismatch with cost 1 This scheme guarantees that no possible binding will be missed However selectivity may be lost Two bases R A C and B C G T are very different but Binary scheme will consider them as a match Since target non target sequences contain lots of N bases that represent unknown nucleotides we recommend using the Distance scheme in which only similar bases are considered a match 3 Positional Mismatch Allowance Settings This component captures the cost allowance of the insertion deletion and mismatched nucleotides for position range in primer template duplex In the basic Primer Selectivity Settings the exact Positional Mismatch Allowance for the three 3 end positions of primer can be specified for target and non target sequences respectively If the 53 setting is set to xyz then only primer template pairs that satisfy this xyz match mismatch configuration and those above will be considered as producing a PCR product xyz is the maximum allowed accumulated number of mismatches counting from right hand side i e 3 end of primer fi A Primer Probe Design Wizard nt eS Primer Selectivity Settings Basic window This window allows selection of the primer selectivity settings The following pictures depict t
14. gt gi 13160418 emb AJ292397 1 VCH292397Verticillium chlamydosporium var 44 59 gt gi 11933096 emb AJ291800 1 VCH291800Verticillium chlamydosporium 18S gt gi 118627604 emb AM412780 1 Verticillium chlamydosporium partial 18S gt gi 59797389 gb AY912487 1 Pochonia chlamydosporia isolate Pc 472 18S gt gi 58892741 gb AY903605 1 Pochonia chlamydosporia 18S ribosomal RNA g 56 72 gt gi 11933103 emb AJ291803 1 VCH291803Verticillium chlamydosporium 18S gt gi 13508841 emb AJ303054 1 VCH303054Verticillium chlamydosporium var 45 60 gt gi 49424886 gb AY555966 1 Verticillium catenulatum strain IMI 113078 gt gi 4836220 gb AF108468 1 Pochonia chlamydosporia isolate ARSEF 2218 i 48 63 94 109 82 97 92 107 94 109 40 55 48 62 75 89 125 139 113 127 123 137 87 101 125 139 76 90 71 85 79 93 Primer probe set annealing position information ATTTACAACCGTTGCT CCCGGGCTTTACACC AATCTAGAGTTTGGGT Rv primer PCR size 88 103 87 115 130 87 165 180 87 153 168 87 163 178 87 127 142 87 165 180 87 116 131 87 111 126 87 119 134 87 Percentage of Each Nucleotide in Target and Non Target Sequences in Relation to Primers and Probe Sequences Provides the percentage of each nucleotide at each position in the target and non target sequences in relation to the nucleotides in each position of the primers and probe 47 Settings for the percentage of each nucleotide in non target sequences in relation to the pri
15. user to select a number of parameters such as the length of gaps between the primers and the probe the GC content the probe length complementarity properties and other In the current version of the program designing probes for FISH analyses requires primers to be designed first even though they will not be used The criteria for probe selectivity are quite different than those for the primers For example for probes the nucleotide mismatches near the center of the probe are more destabilizing than near the ends Thus in the probe design wizard users can specify the threshold value for the number of matches in both directions from the center of the probe that are required for the probe to be considered to match the template either a target or a non target sequence continuous matches Figure 3 Illustration of selectivity setting for probes The shaded part shows is where the exact match Is required to occur Figure 3 illustrates this feature The larger the number of required continuous matching bases the fewer template sequences will be considered to match by the probe In the default setting these numbers are set to the probe length for target sequences and to a small value for non target sequences With this setting the program will look for probes that bind to target sequences perfectly while minimizing the likelihood of it binding to non target sequences If no probes are found to meet such stringent criteria the user can rela
16. 00 100 00 100 00 5 09 24 94 23 92 668 25 763 25 113 00 113 113 41 Load Primer List Allows previously created primer lists which are PRISE2 generated and formatted files to be uploaded into the software Save Primer List Allows primer lists to be saved in the format used by the PRISE2 software Save Primer List as Tab Delimited File Allows primer lists to be saved in a tab delimited format which can be used in standard spread sheet software Save Primer Information Window Content Saves information in the Primer Information Window as a text file Save Primer Pairs Only Saves primer pairs as a text file Such files can be used for a variety of purposes including being loaded in the Extract Load Primer Candidates window see above in future experiments Exit Closes the Design Primer module 2 4 3 Hide Display menu Display All Columns Allows all data columns to be viewed This function is only needed if the user had previously hidden columns Hide Display Columns Allows selected data columns to be hidden or displayed Hide Display Primer Pairs Allows selected primers to be hidden or displayed 4 4 Sort menu Sort Primer List Allows the primers in the list to be sorted by a variety of user selected criteria One parameter that we find particularly useful is the Selectivity Formula which is 100 of target sequences estimated to be amplified 1 2 of non target sequences estimated to anneal with forward p
17. 50 0 0 2 P ATACCATTTACAACCGTTGCT GGT 100 100 295 235 51 51 51 0 0 2 m TATACCATTTACAACC SCTICLT Co mn ara a mw A n 2 PE i MNE 22c c n n n Primer Inter complementarity Provides information on the inter complementarity of the entire primer Primer 3 Inter complementarity Provides information on the inter complementarity of the last eight 3 primer nucleotides Note that this value can be customized in the Standard Primer Property Settings window Primer Intra complementarity Provides information on the intra complementarity of the entire primer Primer 3 Intra complementarity Provides information on the intra complementarity of the last eight 3 primer nucleotides Note that this value can be customized in the Standard Primer Property Settings window 4 9 Primer Setting menu space samr ee Neat A L File Hide Display Sort Add Delete Mark Unmark Annealing Info Primer Complementarity Probes Instant BLAST Help View Primer Design Setting A Target Target Target Non targe Non targ Target Target Target Target Non targei Non targe rimer Primer pair pair forward reverse pair forward reverse forward reverse PCR avg PCR min PCR max PCRavg PCR min annealing avg pos annealing avg pos size size size size size 1 E TACCATTTACAACCGTTGCT GGT 100 100 100 0 0 2 42131 259 235 295 235 50 50 50 0 0 2 e ATACCATTTACAACCGTTGCT GGT 100 100 100 0 0 2 42131 25
18. 8 235 295 235 51 51 51 0 0 3 TATACCATTTACAACCGTTGCT GG 100 100 100 0 0 2 42131 257 235 295 235 52 52 52 0 0 4 o CCATTTACAACCGTTGCT TTTGTA 100 100 100 0 0 15 4964 261 235 363 235 124 124 124 0 0 5S S ACCATTTACAACCGTTGCT TTTGT 100 100 100 0 0 15 4964 260 235 363 235 125 125 125 0 0 le E TACCATTTACAACCGTTGCT TTTG 100 100 100 0 0 15 4964 259 235 363 235 126 126 126 0 0 a ATACCATTTACAACCGTTGCT TTT 1M 10n 10n n n 15 4964 25K 235 PAZ 235 127 127 127 n n View Primer Design Setting Show all settings used for current primer list but users will not be able to change the settings at this time 34 4 10 Probe menu File Hide Display Sort Add Delete Mark Unmark Annealing Info Primer Complementarity Primer Setting Instant BLAST Help Design Probes for marked primer pairs Target Target Target Non target Non target Non target arget Target Non target Non target rimer Primer pair pair forward reverse pair forward reverse forward reverse PCRavg PCRmin PCRmax PCRavg PCR min annealing avg pos annealing avg pos size size size size size 1 M TACCATTTACAACCGTTGCT GGT 100 100 100 0 0 2 42131 259 235 295 235 50 50 50 0 0 2 ATACCATTTACAACCGTTGCT GGT 100 100 100 0 0 2 42131 258 235 295 235 51 51 51 0 0 3 M TATACCATTTACAACCGTTGCT GG _ 100 100 100 0 0 2 42131 257 235 295 235 52 52 52 0 0 4 v CCATTTACAACCGTTGCT TTTGTA 100 100 100 0 0 15 4964 261 235 363 235 124 124 124 0 0 eml ACCATTTACAA
19. 964 294 235 363 235 91 91 91 115 333 91 163 64 3 14 GGGACCCAAACTCTAGATTT TTT 100 100 100 0 484262 5 08475 15 4964 331 235 363 235 54 54 54 545 54 55 45 3 15 GGACCCAAACTCTAGATTT TTTGT 100 100 100 0 484262 5 56901 15 4964 332 235 363 235 53 53 53 53 5 53 54 42 3 16 CCATTTACAACCGTTGCT TTGTAA 100 100 100 0 0 16 9492 261 235 365 235 123 123 123 0 0 0 44 3 17 CCATTTACAACCGTTGCT TTTGTA 100 100 100 0 0 16 9492 261 235 365 235 124 124 124 0 0 0 44 3 18 CCATTTACAACCGTTGCT TGTAAT 100 100 100 0 0 16 9492 261 235 363 235 122 122 122 0 0 0 44 4 19 CCATTTACAACCGTTGCT TTGTAA 100 100 100 0 0 16 9492 261 235 363 235 123 123 123 0 0 0 44 3 20 CCATTTACAACCGTTGCT TTGTAA 100 100 100 0 0 16 9492 261 235 364 235 123 123 123 0 0 0 44 3 25 l CCATTTACAACCGTTGCT TTTGTA 100 100 100 0 0 16 9492 261 235 364 235 124 124 124 0 0 0 44 3 22 ACCATTTACAACCGTTGCT TTTGT 100 100 100 0 0 16 9492 260 235 365 235 125 125 125 0 0 0 42 3 23 ACCATTTACAACCGTTGCT TGTAA 100 100 100 0 0 16 9492 260 235 363 235 123 123 123 0 0 0 42 4 24 ACCATTTACAACCGTTGCT TTGTA 100 100 100 0 0 16 9492 260 235 363 235 124 124 124 0 0 0 42 3 25 ACCATTTACAACCGTTGCT TTGTA 100 100 100 0 0 16 9492 260 235 364 235 124 124 124 0 0 0 42 3 26 ACCATTTACAACCGTTGCT TTTGT 100 100 100 0 0 16 9492 260 235 364 235 125 125 125 0 0 0 42 3 27 TACCATTTACAACCGTTGCT TGTA 100 100 100 0 0 16 9492 259 235 363 235 124 124 124 0 0 0 40 4
20. ACACC 100 00 100 00 11 63 100 00 91 20 66 67 58 90 8 6 0 Blast Probe Allows the selected probe to be subjected to a BLAST analysis by opening the BLAST page at NCBI and loading the probe Note that this function only works when one probe is selected 5 12 Help menu PRISE2 Manual Opens this PRISE2 Manual PRISE2 Tutorial Opens the PRISE2 Tutorial which provides a step by step protocol showing how the software was used to create sequence selective PCR primers or primer probe sets for a specific fungal rRNA gene 52 Appendix I Primer and Probe Selectivity Settings Mis priming happens often in PCR experiments and it may or may not affect the PCR result The efficiency of the polymerase to recognize and extend a mismatched duplex is not only sensitive to the number of mismatched nucleotide bases but also to the nucleotide composition and location of the mismatches Our Primer Selectivity Settings wizard pages are composed of the mismatch cost matrix positional mismatch allowance settings and two different ambiguous base cost functions to accurately evaluate the selectivity of a primer pair Users can use default settings or customize the settings to suit their specific application We now explain the fundamentals of our Primer Selectivity Settings 1 Mismatch cost matrix To capture various effects of mismatched nucleotides the users are allowed to assign different penalties on the mismatched nucleotides in the
21. ACCATTTACAACCGTTGCTT TTT 100 100 100 0 0 15 4964 259 235 363 235 126 126 126 0 ATACCATTTACAACCGTTGCTT TT 100 100 100 0 0 15 4964 258 235 363 235 127 127 127 0 B3 Mm CCCGGGCTTTACAC TTTGTAATG 100 100 100 0 726392 3 38983 15 4964 294 235 363 235 91 91 91 115 3 29 4 6 Mark Unmark menu Mark Selected Primer Pairs Allows selected primer pairs to be marked Marked primer pairs are designated by a check mark in the box in the second column and a yellow highlighted row Marked primers can be saved in the PRISE2 program format or tab delimited format using options in the File menu Note that selected primers are designated by their rows being highlighted in blue Primers can be selected by clicking on any part of the row except the boxes in the second column Standard key commands such as shift and control can be used with the selection function allowing groups of primer pairs to be selected Unmark Selected Primer Pairs Allows selected primer pairs to be unmarked 30 4 7 Annealing Info menu All of the functions below need to be performed on one primer pair Before the function is performed exactly one primer pair must be selected Selected primers are designated by their rows being highlighted in blue Primer pairs can be selected by clicking on any part of the row except the boxes in the second column Primer Annealing Position Information Provides information on where the primers anneal to the t
22. CCGTTGCT TTTGT 100 100 100 0 0 15 4964 260 235 363 235 125 125 125 0 0 6 TACCATTTACAACCGTTGCT TTTG 100 100 100 0 0 15 4964 259 235 363 235 126 126 126 0 0 7 v ATACCATTTACAACCGTTGCT TTT 100 100 100 0 0 15 4964 258 235 363 235 127 127 127 0 0 Design Probes for marked primer pairs To design probes for selected primer pairs for TaqMan type assays for example users can mark some primer pairs and then continue to design probes for these primer pairs The intention is that all three sequences two primers and one probe should bind to same target sequences We note that probes can also be designed for hybridization based assays such as FISH by simply ignoring the primers from the primer probe sets After clicking this option a wizard will pop up to help users to generate probes The settings and the designing process are very similar to those for primer pairs There are two differences however 1 Nucleotide mismatches in probes are more destabilizing in the middle than the ends So the selectivity setting process is different For probes we do alignment from the center of probe toward both ends See the next section for more details 35 4 11 Instant BLAST menu DsWorkspace sample ES File Hide Display Sort Add Delete Mark Unmark Annealing Info Primer Complementarity Primer Setting Probes Instant BLAST Help L a an res kane Sy Fee E BLAST Forward Primer T lees a Target Target Target on tar
23. F Delete Primer Pairs Conditionally reverse pair forward reverse forward reverse PCRavg PCRmin PCR max pci Delete Marked Primer Pairs annealing avg pos annealing avg pos size size size s TACCATTTAC 2 42131 259 235 295 235 50 50 50 ATACCATTTA ower 2 42131 258 235 295 235 51 51 51 TATACCATTTACAACCGTTGCT GG 100 2 42131 257 235 295 235 52 52 52 CCATTTACAACCGTTGCT TTTGTA 100 15 4964 261 235 363 235 124 124 124 ACCATTTACAACCGTTGCT TTTGT 100 15 4964 260 235 363 235 125 125 125 TACCATTTACAACCGTTGCT TTTG 100 15 4964 259 235 363 235 126 126 126 ATACCATTTACAACCGTTGCT TTT 100 15 4964 258 235 363 235 127 127 127 TATACCATTTACAACCGTTGCT TT 100 15 4964 257 235 363 235 128 128 128 CCATTTACAACCGTTGCTT TTTGT 100 15 4964 261 235 363 235 124 124 124 ACCATTTACAACCGTTGCTT TTTG 100 15 4964 260 235 363 235 125 125 TACCATTTACAACCGTTGCTT TTT 100 15 4964 259 235 363 235 126 126 ATACCATTTACAACCGTTGCTT TT 100 15 4964 258 235 363 235 127 127 Delete Seleted Primer Pairs O youn wn ef 090 90 0o0 O0 090 0 0 0 0 0 O oie oio oi io a o o o co co 090 90 9o 0 0 0 0 0 0 0 0 O Delete Selected Primer Pairs Allows selected primers to be deleted Selected primers are designated by their rows being highlighted in blue Primers can be selected by clicking on any part of the row except the boxes in the second column Standard key commands such
24. PRISE 2 0 User Manual UC Riverside January 2012 Table of Contents 1 General Information 1 1 System requirements 1 2 Overview of the design process 1 3 Starting the program 2 Step 1 1 Identify Seed Sequences and Create Hit Table 2 1 Overview 2 2 Create hit table using NCBI blast website 2 3 Create hit table by local BLAST application and database 3 Step 1 2 Select Target and Non target Sequences 3 1 Using the module 3 2 File menu 3 3 Mark Unmark menu 3 4 Move Delete menu 3 0 Clear menu 3 6 Find menu 3 7 Re alignment menu 3 8 Compare Seq Lists menu 39 Help menu 3 10 Right click options 4 Step 2 Design Primers Probes Choosing Primers 4 1 Using the module 4 2 File menu 4 3 Hide Display menu 4 4 Sort menu 4 5 Add Delete menu 4 6 Mark Unmark menu 4 7 Annealing Info menu 4 8 Primer Complementarity menu 4 9 Primer Setting menu 4 10 Probe menu 4 11 Instant BLAST menu 4 12 Help menu 5 Step 2 Design Primers Probes Choosing Probes 5 1 Using the module D2 File menu 5 3 Hide Display menu OO AHN BW WH W 5 4 5 5 5 6 5 7 5 8 5 9 5 10 5 11 5 12 Sort menu Add Delete menu Mark Unmark menu Annealing Info menu Complementarity menu Primer Pair menu Probe Setting menu Instant BLAST menu Help menu Appendix I Primer and Probe Selectivity Settings 44 45 46 47 50 51 51 52 52 53 1 General Information PRImer Selector 2 PRISE2 is a software package developed at the University of
25. TACAGAGGCTTTGG TTCCCTCGGCGCCGCCCCCGAAATGAATTGGCGGTCTCGTCGCGGCCTCCTCTGCGTAGTAGCACAACCTCGCATCAGGAGCGCGGC PEPEPU EP EP EEE ET EP EE EEE PEEP EEE EEE EEE EEE EEE EEE EEE EEE EEE EEE EEE EEE TTCCCTCGGCGCCGCCCCCGAAATGAATTGGCGGTCTCGTCGCGGCCTCCTCTGCGTAGTAGCACAACCTCGCATCAGGAGCGCGGC TAAAACGCCCAACTTTTTTTTAAGAG 499 PEPEPEEPETEUEETEUETEEEEe TAAAACGCCCAACTTTTTTTTAAGAGTTGACCTCGAATCAGGTAGGAATACCCG 554 e nstant Blast Allows the sequence to be subjected to a BLAST analysis by opening the BLAST page at NCBI and loading the sequence Note that this function only works when one sequence is selected 17 4 Step 2 Design Primers Probes Choosing Primers PRISE2 allows selection of both standard PCR primer parameters such as GC content primer length inter and intra complementarity as well as criteria for sequence selectivity Selectivity is accomplished by identifying primers that should amplify target sequences but not non target sequences The prediction as to whether a PCR product will be made is based on a number of criteria that can be customized by the user to suit the application at hand One of the criteria used in this process is a scoring scheme that is used to define the likelihood that specific primer template combinations will produce a PCR product This scheme allows the user to set the design criteria for each position in the primer Here we describe only a simple version of this scheme that focuses on last three 3 positions F
26. TTIG TGATGC 100 00 100 00 100 00 z 4 33 39 19 673 25 764 25 108 00 108 108 GAGTACAGAGGCTTITGG TGATGC 100 00 100 00 100 00 2 5 09 39 19 674 25 764 25 107 00 107 107 16 CATTTACAACCGTTGCT TTTGTAA 100 00 100 00 100 00 6 87 39 44 346 25 45125 123 00 123 123 4 we Primer Information Window h Below is a description of all of the functions in this module organized by the pull down menu they reside in Note that some of the functions are also available by right clicking on a row See the PRISE2 Tutorial for a few examples of how they can be used 26 4 2 File menu A D Workspace sample file PochoniaTarget_mac txt Primer Repot e Hide Display Sort Add Delete Mark Unmark Annealing Info Primer Complementarity Primer Setting Probes Instant BLAST Help Load Primer List primer File SS Save Primer List primer File get Target Target Non target Non target Non target Target Target Target Target Target Non tz l l ee ir forward reverse pair forward reverse forward reverse PCRavg PCRmin PCRmax PCRz Save Primer List as Tab Delimited File Excel annealing avg pos annealing avg pos size size size size SAO Serer Dae eee Me 1o0 00 10000 100 00 178 331 2392 672 25 763 25 10900 109 10 x Save Primer Pairs Only 00 00 100 00 100 00 127 4 33 23 92 673 25 763 25 108 00 108 108 1 Exit 00 00 100 00 100 00 1 27 5 09 23 92 674 25 763 25 107 00 107 107 1c 4 fl acceeceactacaca Teatacaa 100
27. arget and non target sequence File Hide Display Sort Add Delete Mark Unmark Annealing Info Primer Complementarity Primer Setting Probes Instant BLAST Help Primer Annealing Position Information Target Target Target Non targe on targei rimer Primer pair pair Percentage of Each Nucleotide in Target and Non Target Sequences in Relation to Primer Sequences PCR min PCR max PCRavg PCRmin size size size size TACCATTTACAACCGTTGCT GGT 100 Target Sequences Not Annealing with Primer 50 aa S Ls Si SE t emia Non Target Sequences Annealing with Primer TATACCATTTACAACCGTTGCT GG 100 pie ee 52 Non Target Sequences Not Annealing with Primer CCATTTACAACCGTTGCT TTTGTA 100 124 ACCATTTACAACCGTTGCT TTTGT 100 15 4964 260 235 363 235 125 TACCATTTACAACCGTTGCT TTTG 100 15 4964 259 235 363 235 126 ATACCATTTACAACCGTTGCT TTT 100 15 4964 258 235 363 235 127 TATACCATTTACAACCGTTGCT TT 100 15 4964 257 235 363 235 128 CCATTTACAACCGTTGCTT TTTGT 100 15 4964 261 235 363 235 124 ACCATTTACAACCGTTGCTT TTTG 100 15 4964 260 235 363 235 125 TACCATTTACAACCGTTGCTT TTT 100 15 4964 259 235 363 235 126 ATACCATTTACAACCGTTGCTT TT 100 0 15 4964 258 235 363 235 127 13 15 4964 294 235 363 235 91 115 333 Target Sequences Annealing with Primer 090 0 9 0 0 0 O00000 O 0 090 90 0 90 0 0 0 090 0 o 4 mm Primer information window Primer annealing
28. ate probes corresponding to specific primer pairs from the menu option In the current version of the program designing probes for FISH analyses requires primers to be designed first even though they will not be used A detailed step by step protocol PRISE2 Tutorial which demonstrates how the software was used to create sequence selective PCR primers and probes for a specific fungal rRNA gene can be accessed via the Instructions or Help links 1 3 Starting the program When the program is started a window with four buttons appears This window links to instructions and modules for performing steps in the primer probe design process Detailed information for each module will be described in following sections Identify Seed Sequences and Create Hit Table Select Target and Non target Sequences Design Primers Probes Figure 1 Opening window with links to instructions and modules of PRISE2 2 Step 1 1 Identify Seed Sequences and Create Hit Table 2 1 Overview The first step in the design process is to identify the seed sequences and to create the hit table The button Identify Seed Sequences and Create Hit Table opens a wizard page which guides users through this step Seed sequences represent the DNA sequences that the primers are designed to amplify The hit table is a list of DNA sequences with various degrees of similarity to the seed sequences from which the target and non target sequences can be derived I
29. ction After clicking on the BLAST button click on Formatting options Under the section Show set Alignment as Plain text and set Alignment View to Hit Table In addition in the Limit results section set Alignments to the value that was used for the Max target sequences Click View report and save the output as a text file This file is the Hit Table 2 3 Create hit table using local BLAST application and database Note There is an issue with BLAST that occurs if you do not select the alignment view to be a hit table and after the blast analysis is completed you attempt to re format the BLAST run via the formatting options We found that in this situation the hit table option is often not available The following work around has been provided by a BLAST technician 1 Click Download then right click the Hit Table text link to copy it 2 Open a new window tab in the browser paste in the link and save the Hit Table as a text file For users that have the BLAST command line application installed on their machine PRISE2 provides an option to run BLAST locally using their own databases and settings and get results through PRISE2 s interface A designated wizard page will help users through this process l Provide paths to BLAST and databases To run BLAST locally users need to provide the path to BLAST folder and databases as shown in the figure below After selecting the I have BLAST on my machine and want to run it locally
30. default settings and start designing probes now Use previous settings O Show change settings lt Back Cancel Help The last option allows users to review and change the current used probe settings it opens the Probe Properties Settings window showing various probe properties such as probe length gap between the probe and the primers binding positions Tm range Tm difference between the primers and the probe and complementary 38 8 Primer Probe Design Wiza o aX Probe Properties Settings Probe length range 14 Probe Tm Min of target sequences containing candidate probe 100 m aia a Na concentrations Onl ider t 100 si andidate prob y consider top single c e proves Tm of probe exceeds Tm of primer pair by bases between each of the primers and the probe Max primer probe inter complementarity Avoid continuous 4 A s or C s or T s Avoid continuous 4 G s Max probe intra complementarity Avoid G at the first base from 5 end lll Probe Selectivity Settings The probe selectivity settings are located in the next two windows These two successive windows are ordered by increasing user complexity and control In the Basic Probe Selectivity Settings page users can select to either use the default settings or adjust the binding criteria described earlier for both target and non target sequences metodo cm Basic Probe Selectivity Settings This window allows selecti
31. e on targei j rimer Primer pair pair Percentage of Each Nucleotide in Target and Non Target Sequences in Relation to Primer Sequences PCR min PCR max PCRavg PCRmin PCRmax Fw F Target Sequences Annealing with Primer size size size size size GC C 1 TACCATTTACAACCGTTGCT GGT 100 Target Sequences Not Annealing with Primer 50 50 0 0 0 40 6 2 ATACCATTTACAACCGTTGCT GGT 100 Rice Thaget Sequences Annasing wilh Prater 1 51 0 0 0 38 6 3 TATACCATTTACAACCGTTGCT GG 100 52 52 0 0 0 36 6 Non Target Sequences Not Annealing with Primer 4 CCATTTACAACCGTTGCT TTTGTA 100 124 124 0 0 0 44 3 5 ACCATTTACAACCGTTGCT TTTGT 100 100 100 0 0 15 4964 260 235 363 235 125 125 125 0 0 0 42 3 je i TACCATTTACAACCGTTGCT TTTG 100 100 100 0 0 15 4964 259 235 363 235 126 126 126 0 0 0 4 3 7 ATACCATTTACAACCGTTGCT TTT 100 100 100 0 0 15 4964 258 235 363 235 127 127 127 0 0 0 38 3 8 TATACCATTTACAACCGTTGCT TT 100 100 100 0 0 15 4964 257 235 363 235 128 128 128 0 0 0 36 3 9 CCATTTACAACCGTTGCTT TTTGT 100 100 100 0 0 15 4964 261 235 363 235 124 124 124 0 0 0 42 3 10 ACCATTTACAACCGTTGCTT TTTG 100 100 100 0 0 15 4964 260 235 363 235 125 125 125 0 0 0 4 3 aji TACCATTTACAACCGTTGCTT TTT 100 100 100 0 0 15 4964 259 235 363 235 126 126 126 0 0 0 38 3 12 ATACCATTTACAACCGTTGCTT TT 100 100 100 0 0 15 4964 258 235 363 235 127 127 127 0 0 0 36 3 Baji CCCGGGCTTTACAC TTTGTAATG 100 100 100 0 726392 3 38983 15 4
32. e Selectivity Formula which is 100 of target sequences estimated to anneal with whole primer probe set of non target sequences estimated to anneal with whole primer probe set 100 of non target sequences estimated to anneal with probe 0 25 of non target sequences estimated to anneal with probe The smaller the value generated by the Selectivity Formula the more likely the primer probe set will amplify target sequences and not amplify non target sequences n E Sort Sort by Ascending Selectivity Formula Descending Then by Ascending Target pair z Descending Then by Ascending Descending Then by Ascending A Descending cance 44 5 5 Add Delete menu Add Primer Probe Sets Manually Allows an individual probe to be added to the list of probes for the selected primer pair and its properties determined in relationship to the target and non target sequence and user defined primer probe set design settings Delete Primer Probe Sets Conditionally Allows primer probe sets to be deleted from the list by user specified criteria Delete Marked Primer Probe Sets Allows marked primer probe set to be deleted Marked sets are designated by a check mark in the second column and a highlighted row Primer probe sets can be marked by clicking on the boxes in the second column or by using the Mark Unmark functions below
33. e to default mismatch allowance setting The values in the left and right halves are symmetric and non decreasing away From the center To make changes enter a desired value in the right half Other values will be adjusted automatically lt Back Cancel Help The designing process could take minutes to hours depending on the size and complexity of the sequences in the target and non target files After the designing process is finished a report dialog will pop up showing detailed information of this designing process such as how many candidate probes were left after each single step This information is useful for finding which selection criteria may be too stringent causing many probe candidates to be filtered out If no probes are found or if the user is not satisfied with the found probes clicking on Change criteria button will allow users to change criteria and restart the designing process again Otherwise users can continue to see the current result by clicking OK or go back to Primer Report Window by clicking Cancel 40 E Report Primer Probe Set Design Report The report below shows the number of candidate probes meeting each selectivity criterion A You can increase the number of probes by repeating the process and relaxing these criteria in the Primer Probe Set Desigr To repeat design process using different criteria click Change Criteria To go back to main window click OK 17
34. ectivity Setting page and Figure 6 shows the default setting for probes The allowed accumulated cost of mismatches is symmetric and calculated from the center of probe to both ends B Primer Probe Design Wizard Basic Probe Selectivity Settings This window allows selection of the probe selectivity settings The following options depict the selectivity settings For the middle part of the probes Theoretically highly selective probes should be obtained when both Target settings are set to High and both Non target settings are set to Low If no primer probe sets are produced using these settings consider re running the program after lowering the target settings and or increasing the non target settings This problem will be most noticeable when designing primer probe sets for highly conserved sequences such as rRNA genes continuous matches Selectivity settings for target sequences Selectivity settings for non target sequences Target Non target Continuous 15 matches at the center to bind to target sequences Continuous 0 matches at the center to bind to non target sequences f Low High Low High Select from the Following choices Use default mismatch settings and start designing probes now Show change mismatch settings lt Back Cancel Help Figure 5 Basic Probe Selectivity Setting Page Target sequence 5 123 4 5 6 7 9 10 11 12 13 14 15 3 0 10 1010 10 0 0 0 10 10 10 10 10 0 0 10
35. eed Database other_genomic nt Fields query id subject id identity alignment length mismatches gap opens c 510 hits found i EE gi 533735121 dbj AB709845 1 99 60 gi 533735114 dbj AB709843 1 99 60 gi 533735111 dbj AB709842 1 99 60 gi 39543969 1 ob 10647436 1 99 60 gi 27884304 dbj AB100362 1 99 60 gi 13160418 emb AJ292397 1 99 60 gi 11933096 emb AJ291800 1 99 60 gi 11933098 jemb AJ291801 1 99 60 i 533735127 dbj AB7093847 1 99 40 i 38566356 1 gb J0435954 1 99 40 gi 118627604 emb AM412780 1199 40 gi 49424884 gb AY555964 1 99 60 gi 430769399 qb KC291612 1 99 40 gi 442774206 qb KCO07316 1 99 40 gi 441037499 gbIKC171356 1 99 40 gi 257286 123 dbj AB378548 1 99 40 gi 257286 118 dbj AB378543 1 99 40 gi 66796173 dbj AB214654 1 99 40 gi 59797389 gb AY912487 1 99 40 gi 58892741 gb AY903605 1 99 40 gi 13508841 emb AJ303054 1 99 40 ee a a a 3 Step 1 2 Select Target and Non target Sequences Once the seed sequences and hit table are created the next step is to identify and collect the target and non target sequences in the Select Target and Non Target Sequences module 3 1 Using the module Load Sequences After opening the module users can input the seed sequences and hit table files into the software by selecting the Load Seed Sequence and Hit Table option from the File menu This option opens a window titled Load Seed Sequence and Hit Table where the appropriate files can be input N
36. es Not Annealing with Primer 50 ATACCATTTACAACCGTTGCT GGT 100 Le Sacquseico a with Petsreur 51 TATACCATTTACAACCGTTGCT GG 100 52 Non Target Sequences Not Annealing with Primer CCATTTACAACCGTTGCT TTTGTA 100 124 ACCATTTACAACCGTTGCT TTTGT 100 260 235 125 TACCATTTACAACCGTTGCT TTTG 100 259 235 126 ATACCATTTACAACCGTTGCT TTT 100 258 235 127 TATACCATTTACAACCGTTGCT TT 100 257 235 128 CCATTTACAACCGTTGCTT TTTGT 100 261 235 124 ACCATTTACAACCGTIGCTT TTTG 100 260 235 125 TACCATTTACAACCGTTGCTT TTT 100 259 235 126 ATACCATTTACAACCGTTGCTT 1TT 100 258 235 127 CCCGGGCTTTACAC TTTGTAATG 100 294 235 91 GGGACCCAAACTCTAGATTT TTT 100 331 235 54 GGACCCAAACTCTAGATTT TTTGT 100 332 235 53 CCATTTACAACCGTTGCT TTGTAA 100 0 261 235 123 CCATTTACAACCGTTGCT TTTGTA 100 261 235 124 OP aT A Pk A POT A TOTAAT AA AA AAA ls Y 221 NP 4 1 aa m Target Sequences Annealing with Primer 9 0 90 0 90 0190 0 90 0 o 090 0 090 0 0 0 090 0 090 0 o J Primer information window gt gi 49424885 gb AY555965 1 Pochonia chlamydosporia strain IMI 113169 internal transcribed spacer 1 5 8S ribosomal RNA gene and internal tra CCGAGTTTTCAACTCCCAAACCCCATGTGAACTTATACCATTTACAACCGTTGCTTCGGCGGGTTCTCGCCCCGGGCTTTACACCCCGGAACCAGGCGGCCCGCCGGGGGACCCAAACTCTAGATTTTTATTTTAGCATGT gt gi 11933108 emb AJ291805 1 VCH291805Verticillium chlamydosporium 18S rRNA
37. es in a GenBank file Note that these sequences will be compared by their GenBank Accession number not their nucleotide sequences Load GenBank gb File to be Compared to Current Sequence List Allows the GenBank file to be loaded into the software Display Sequences Not in Sequence List Displays the sequences that are in the GenBank file but not in the Sequence List Display Sequences Not in GenBank File Displays the sequences that are in the Sequence List but not in the GenBank file 3 9 Help menu PRISE2 Manual Opens the PRISE2 Manual PRISE2 Tutorial Opens the PRISE2 Tutorial which provides a step by step protocol showing how the software was used to create sequence selective PCR primers and probes for a specific fungal rRNA gene 16 3 10 Right click options l File Mark Unmark Move Delete Clear Find Re Alignment Compare Seq Lists Help ji Seq NCBI GI Accession Identity Length Definition 1 SEED Pochonia 100 499 PochoniaSeed 2 27884304 AB100362 99 5992 2327 Cordyceps chlamydosporia genes for 18S rRNA ITS1 Eukaryc 13160418 AJ29 Verticillium chlamydosporium var chlamydosporium Eukaryc Display Pairwise Alignment ica 4 a 11933096 AJ29 5 Verticillium chlamydosporium 18S rRNA gene partial Eukaryc 5 m 11933110 AJ29 Verticillium chlamydosporium 18S rRNA gene partial Eukaryc 6 11933098 AJ291801 99 5992 634 Verticillium chlamydosporium 18S rRNA gene partial Eukar
38. ge of target and non target sequences predicted to be amplified PCR product size etc To assist the process of selecting optimal primers the primer pairs in the table can be sorted by their parameters and by a formula that identifies primers that are most likely to amplify target but not non target sequences the Selectivity Formula In addition primers can be sorted by clicking on the column headings This module also provides tools enabling the user to obtain detailed information about the selectivity of the primer pairs These data include the percent of each nucleotide at each position in the target and non target sequences in relation to the nucleotides in each position of the primers In addition the user can identify the target and non target sequences that should or should not be amplified by each primer pair He she can also load additional primer pairs not necessarily created by PRISE2 enabling the properties of these primers to be examined in relation to the target and non target sequences and compared to the PRISE2 generated primers The primers and their properties can be saved in a tab delimited format so that the user can import the data into other programs such as spreadsheet software a D Workspace sample file PochoniaTarget_mac txt Primer Report File Hide Display Sort Add Delete Mark Unmark Annealing Info Primer Complementarity Primer Setting Probes Instant BLAST Help Target Target Target Non target
39. gei Non targe Non targe Targe t Target Target on targei Non targei rimer Primer pair pair forward reverse pair forward reverse forwat BLAST Reverse Primer g PCRmin PCRmax PCRavg PCR min size size size size 1 TACCATTTACAACCGTTGCT GGT 100 100 100 0 0 2 42131 259 235 295 235 0 0 2 ATACCATTTACAACCGTTGCT GGT 100 100 100 0 0 2 42131 258 235 295 235 51 51 51 0 0 Blast Forward Primer Allows a single forward primer to be subjected to a BLAST analysis by opening the BLAST page at NCBI and loading the primer Note that this function only works when one primer pair is selected Blast Reverse Primer Allows a single reverse primer to be subjected to a BLAST analysis by opening the BLAST page at NCBI and loading the primer Note that this function only works when one primer pair is selected 4 12 Help menu PRISE2 Manual Opens this PRISE2 Manual PRISE2 Tutorial Opens the PRISE2 Tutorial which provides a step by step protocol showing how the software was used to create sequence selective PCR primers or primer probe sets for a specific fungal rRNA gene 36 5 Step 2 Design Primers Probes Choosing Probes After choosing the desired primer pairs the user can select probes for each primer pair The three sequences the forward primer the reverse primer and the probe are referred to in the program as a primer probe set While designing probes similar as in the primer design process PRISE2 allows the
40. gene partial ITS1 5 8S rRNA gene ITS2 28S rRNA gene partial GGAAGTAAAAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTTCAACTCCCAAACCCCATGTGAACTTATACCATTTACAACCGTTGCTTCGGCGGGTTCTCGCCCCGGGCTTTACACCCC gt gi 34420181 gb AY273334 1 Uncultured ascomycete clone T7B12 18S ribosomal RNA gene partial sequence internal transcribed spacer 1 5 8S ri _ ATTACCGAGTTTTCAACTCCCAAACCCCATGTGGACTTATACCATTTACAACCGTTGCTTCGGCGGGTTCTCGCCCCGGGCTTTACACCCCGGAACCAGGCGGCCCGCCGGGGGACCCAAACTCTAGATTTTTATTTTAGC 4 m Target Sequences Not Annealing with Primer Shows the target sequences that do not anneal to the primer using the user selected primer design criteria Non Target Sequences Annealing with Primer Shows the non target sequences that anneal to the primer using the user selected primer design criteria Non Target Sequences Not Annealing with Primer Shows the non target sequences that do not anneal to the primer using the user selected primer design criteria 33 4 8 Primer Complementarity menu Sex Primer Inter Complementarity Target Target Tar Target Target Target Target Target on targei Non targe rimer Primer pair pair forward revi Primer 3 Inter Complementarity forward reverse PCRavg PCR min PCR max PCRavg PCR min Primer Intra Complementarity aling avg pos annealing avg pos size size size size size 1 ia TACCATTTACAACCGTTGCT GGT 100 100 100 Primer 3 Intra Complementarity 9 235 295 235 50 50
41. gs may not produce PCR primers that meet these criteria Therefore for such analyses we recommend using the middle 2 1 0 or the third from the bottom setting 2 1 1 for the Base 1 3 on 3 end option for non target sequences In the Advanced Primer Selectivity Settings page the user can adjust the scoring function for ambiguous bases mismatch cost matrix and Insertion Deletion costs More detailed information about the selectivity settings is listed above and in Appendix I E Primer Probe Design Wizard Advanced Primer Selectivity Settings The mismatch cost matrix determines the penalties on Mamatch cost matrix Insertionjdeletion costs the mismatched nucleotides in primer template duplex The larger the value the less likely a PCR product will Di nage 0 be made Max gaps allowed Insertion deletion cost Ambiguous base cost Function Distance More likely to penalize ambiguous bases from target non target sequences Binary Less likely to penalize ambiguous bases From target non target sequences Positional mismatch allowance settings i Target sequence 7 30 29 28 27 26 25 24 23 22 21 20 19 18 17 16 15 14 13 12 11 10 313 3 13 A3 3 3 WS 2 2 2 2 2 2 il i Wi i i i i Non target sequence OOoBAKHHAMKNABHLA1D 1 18 17 16 HB 4 1G iW 11 10 A ee eee 1 6 116 116 6 16 1 6 16 16 116 16 16 15 15 115 115 15 114 14 14 14 14 4 33 43 1 3 2 Wil Restore to default mismatch allowance setting eae
42. he sequence 5 CTAACTACTGGGAA 3 more precisely anneal to the reverse complement strand of this sequence since the cumulative positional cost is 5 2 2 2 2 0 0 0 3 which satisfies the Positional Mismatch Allowance Settings Note that in this example we didn t count the effect of insertion deletion costs The calculations with these effect considered are similar 99 According to the fixed Primer Selectivity Settings PRISE2 performs a local alignment for the primer against each sequence in target and non target group and predicts the position in the sequence where this primer anneals or does not anneal at all Users can use different Positional Mismatch Allowance settings for primer design and primer probe set design processes Actually since the different sensitivity properties of primers and probes two different settings should be applied A primer requires higher sensitivity on 3 end which means it allows more mismatches on 5 end For a probe the sensitivity decreases from middle to both ends since we prefer continuous matches in the middle Once a probe can bind to target sequences with that fragment of continuous matches in the middle some mismatches at two ends are tolerable and will not affect its function Currently PRISE2 provides 16 sets of default settings for target and non target selectivity each corresponding to each possible number of continuous matches in the middle Figure 5 shows the Basic Probe Sel
43. he compound mismatch values are counted starting from the center with the left and right directions symmetric so the changes are only allowed on the left hand side the right hand side will be adjusted automatically In the default setting shown below the probe is considered to match the target sequence if all its bases match perfectly those in the target sequence To match a non target sequence one mismatch is allowed in the first 5 bases to the right of the center two mismatches in the first 8 bases to the right from the center and so on and symmetrically on the left hand side A Primer Probe Design Wizard Advanced Probe Selectivity Settings The mismatch cost matrix determines the penalties on the Mismatch cost matrix Insertion deletion costs mismatched nucleotides in primer template duplex The A larger the value the less likely a PCR product will be made Max gaps allowed Insertion deletion cost The mismatch cost matrix and the positional mismatch a _ N mani s n n Ambiguous base cost Function Distance More likely to penalize ambiguous bases from target non target sequences Binary Less likely to penalize ambiguous bases from target non target sequences Positional mismatch allowance settings Target sequence 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 q 0 10 0 110 10 10 10 00 0 110 0 0 0 n0 110 ra R Re a hee 10 11 12 13 14 15 y D1 1 1 a i n2 2 2 Ws Ws 114 n4 475 sS Restor
44. he selectivity settings for the last three 3 nucleotides of the primers Theoretically highly selective primers should be obtained when both Target settings are set to High and both Non Target settings are set to Low However when making primers from conserved sequences such as rRNA genes such settings may not produce PCR primers that meet these criteria Therefore For suc analyses we recommend using an intermediate setting 2 1 0 or the third From the bottom setting 2 1 1 on the Base 1 3 on 3 end option For non target sequences For more detailed information on these settings see the PRISE Manual Selectivity settings for target sequences Selectivity settings for non target sequences Base 4 to Base 1 3 Base 4 tor Base 1 3 5 end on 3 end 5 end on 3 end High High High High Drimef primer E el a y 5 gi E ul IL tal IL Low Low Low Low Select from the following choices Use default settings and start designing primers now Show advanced settings lt Back Emish cancel _ Hep M Figure 3 An example of basic Primer Selectivity Settings An example of these settings for Primer Design is given in Figure 3 in which 0 0 0 setting is set for target sequences and 2 1 0 setting is set for non target sequences This means that e For target sequences no mismatch is allowed on the three 3 end positions of primer Thus only exact matches at all these three
45. igning primers Select From the following choices Use all default settings and start designing primers now Use previous settings Show change settings The last option allows users to review and change the current used primer settings it opens the Primer Properties Settings window showing primer properties such as primer length PCR product size GC content and melting temperature The melting temperature Tm is calculated with the following formula Tm 81 5 16 6 log Na 41 G C length 500 length _ 5 ie ip la Primer Properties Settings Primer Tm Primer length range Na concentrations Minimum of target sequences containing candidate primers Max primer Tm difference Only consider top 100 single candidate primers Primer GC PCR product size range Max primer inter complementarity Max primer 3 inter complementarity Avoid continuous 4 A s or C s or T s ae Avoid continuous 4 Max primer intra complementarity Avoid more than 3 C G at last 5 bases From 3 end Max primer 3 intra complementarity on last bases at 3 end a a Ge 22 lll Primer Selectivity Settings The primer selectivity settings are located in the next two windows These two successive windows are ordered by increasing user complexity and control The purpose of the selectivity settings is to identify highly selective primers those that will bind to most target se
46. le comple ith pa atas i in target sequenc annealing avg pos GC Tm C mentarity mentarity speci E AA that probe binds t Exit covered by probe CCGGGCTTTACACCC 00 00 11 63 100 00 92 20 66 67 58 90 7 8 0 I COCOCOOCCCOTTTAC ACF 10n An 10nn 11 f3 10nn 9120 fAA7 SRAN R fi n I Save Primer Probe Set List Allows primer probe set lists to be saved in the format used by the PRISE2 software Save Primer Probe Set List as Tab Delimited File Allows primer probe set lists to be saved in a tab delimited format which can be used in standard spread sheet software Save Information Window Content Saves information in the Primer Probe Set Information Window as a text file Save Primer Pair and Probe Segs Only Saves primer probe sets as a text file Such files can be used for a variety of purposes including being loaded in the Extract Load Probe Candidates window see above in future experiments Exit Closes the Design Probe module 43 5 3 Hide Display menu Display All Columns Allows all data columns to be viewed This function is only needed if the user had previously hidden columns Hide Display Columns Allows selected data columns to be hidden or displayed Hide Display Primer Probe Sets Allows selected sets to be hidden or displayed 5 4 Sort menu Sort Primer Probe Set List Allows the probes in the list to be sorted by a variety of user selected criteria One parameter that we find particularly useful is th
47. mentarity Primer Pair Probe Setting Instant BLAST Help ATITACAACCGTIGCT AATCTAGAGTITGGGT B ATTTACAA Primer Probe Set Annealing Position Information Percentage of Each Nucleotide in Target and Non target Sequences in Relation to Primers and Probe Sequences a Target Sequences Annealing with Primer Probe Set Probe ier probi Target Sequences Not Annealing with Primer Probe Set s Non target Sequences Annealing with Primer Probe Set E CCGGGCTTTACACCC 100 00 Non target Sequences Not Annealing with Primer Probe Set C CCCGGGCTTTACACC 100 00 T J Primer Probe Set Information Window A gt gi 11933103 emb AJ291803 1 VCH291803Verticillium chlamydosporium 18S rRNA gene partial ITS1 5 8S rRNA gene I GGAAGTAAAAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTTCAACTCCCAAACCCCATGTGAACTTATACCATTTACAACCGTTGCTTCGGCGGGTTCTCGCC gt gi 13508841 emb AJ303054 1 VCH303054Verticillium chlamydosporium var chlamydosporium 5 8S rRNA gene CATTACCGAGTTTTCAACTCCCAAACCCCATGTGAACTTATACCATTTACAACCGTTGCTTCGGCGGGTTCTCGCCCCGGGCITT and ITS 1 an ACACCCCGGAACCAGGCGGCCCGCCGGGGGACCCAAACTC gt gi 49424886 gb AY555966 1 Verticillium catenulatum strain IMI 113078 internal transcribed spacer 1 5 8S ribosoma CCGAGTTTTCAACTCCCAAACCCCATGTGAACTTATACCATTTACAACCGTTGCTTCGGCGGGTTCTCGCCCCGGGCTTTACACCCCGGAACCAGGCGGCCCGCCGGGGGACCCAAACTCTAGAT gt gi 4836220 gb AF108468 1 Pochonia chlamydosporia isolate ARSEF 2218 internal tra
48. mer sequences Note that these primer annealing settings should be less stringent than those used For primer design Divide primer into two parts and set the minimum match percentages primer 5 atleast 50 Yo matches on 5 end File Hide Display Sort Add Delete Mark Unmark Complementarity Primer Pair Probe Setting Instant BLAST Help Primer Probe Set Annealing Position Information Percentage of Each Nucleotide in Target and Non target Sequences in Relation to Primers and Probe Sequences Target Sequences Annealing with Primer Probe Set Target Sequences Not Annealing with Primer Probe Set Non target Sequences Annealing with Primer Probe Set 1 CCGGGCTTTACACCC Non target Sequences Not Annealing with Primer Probe Set 2 CCCGGGCTTTACACC D3 00 00 JLZ20 66 07 38 7 ATTTACAACCGTTGCT AATCTAGAGTITGGGT E ATTTACAA Primer Probe Set Information Window Percentage of each nucleotide in target and non target sequences in relation to primer and probe sequences information for pr 10 target sequences and 43 non target sequences Information for target sequences annealing with primer probe set 10 sequences c A 0 100 100 0 0 0s 0 0 Target Sequences Annealing with Primer Probe Set Shows the target sequences that anneal to the whole primer probe set using the user selected design criteria 48 Primer Probe Set Report Window CS L X File Hide Display Sort Add Delete Mark Unmark Annealing Info Comple
49. mismatch cost matrix Each entry in the matrix specifies the penalty level of the corresponding mismatch in the primer template duplex Here the larger value of cost in the matrix the more unlikely for a duplex with this mismatch to be predicted to be stable and therefore a PCR to be made The Mismatch Cost Matrix has entries for each nucleotide base A C G and T The mismatch cost of ambiguous bases represented by IUPAC code such as N R and Y etc will be obtained automatically by the average of mismatch cost between the non ambiguous bases represented by the corresponding ambiguous bases For example in IUPAC codes ambiguous base R denotes A G and base Y denotes T C so the mismatch cost of R and Y can be calculated by the formula mc R Y mc A T mc A C mc G T mc G C 4 2 Ambiguous base cost function To deal with ambiguous bases in target non target sequences users are allowed to choose from two different schemes to measure match mismatch By choosing the Distance scheme PRISE2 will calculate the mismatch cost using mismatch cost matrix described above This way ambiguous bases in target non target Sequences are more likely to be penalized since this scheme will penalize every two different bases even if they contain several common possible nucleotides For example base N denotes all nucleotides A C G T When we consider two bases N and T although T is a possible nucleotide in N the cost 3 4 is still high
50. nath range Probe Tm Min of target sequences containing candidate probe 100 Yo i Na concentrations Only consider top 100 single candidate probes Tm greater than the corresponding primer pair by Have minimum of 2 bases between each of the primers and the probe Probe GC Avoid continuous 4 A s or C s or T s Avoid continuous 4 G s Max probe inter complementarity Avoid G at the first base from 5 end Ambiguous base cost function _ Distance More likely to penalize ambiguous bases from target non target sequences Binary Insertion deletion costs Less likely to penalize ambiguous bases from target non target sequences Max gaps allowed 0 Insertion deletion cost 5 Max primer intra complementarity Mismatch cost matrix Target sequence 30 29 28 27 2 5 2A B 2 2 2 19 18 17 16 25 14 83 12 12 10 9 5 lo lo lo lo lo lo lo lo lo lo lo lo lo lo lo lo lo lo jo jo jo jo Non target sequence 30 29 28 27 26 25 24 23 22 21 20 19 18 17 16 15 14 13 12 11 10 9 5 5 4 4 4 3 3 ele e fa taf taf bey bey te fe al a 2 2 2 5 11 Instant BLAST menu T Target Target on targei on targei Target i Seran ann of ambiguous ba Probe ier probe probe ner probe probe probe obe Probe comple comple rith e in target sequenc annealing avg pos GC Tm C mentarity mentarity Te t that probe binds T CCGGGCTTTACACCC 100 00 100 00 11 63 100 00 92 20 66 67 58 90 7 8 0 E CCCGGGCTTT
51. nd non target sequence files Unmark Sequences Allows sequences to be unmarked if they possess user defined criteria Reverse Marked and Unmarked Sequences designations Mark All Selected Sequences Mark All Sequences Mark Sequences Satisfying Selected Conditions Mark Within All sequences Sequence length between AND Reverses the marked and unmarked Mark All Selected Sequences Selected sequences only Identity For PochoniaSeed v between AND em contains Sequence definition does not contain AND contains Sequence organism does not contain AND 9 contains C does not contain AND contains does not contain 12 3 4 Move Delete menu E Select Target and Non target Sequences ian File Mark Unmark Move Delete Clear Find Re Alignment Compare Seq Lists Help Move Marked Sequences to FASTA Sequence Box Delete Marked Sequences Delete Selected Sequences Move Marked Sequences to FASTA Sequence Box Moves marked sequences to the FASTA Sequence Box Marked sequences are designated by a check mark in the box in the second column Sequences that are marked can be moved to the FASTA Sequence Box and then saved or merged with other FASTA files to make target and non target sequence files Delete Marked Sequences Deletes marked sequences from the sequence list Marked sequences are designated by a check mark in the box in the
52. nge the settings used for the pairwise identity analyses The resulting changes in the alignment values for individual sequences can be viewed by using the Display Pairwise Alignment option which is accessed via a right click Note that these settings will not be saved unless the Update Identity for All Sequences option is used see immediately below Update Identity for All Sequences Allows the user to change the settings used for the pairwise identity analyses and then perform a new pairwise analysis on all sequences in the list Note that any changes made with this option will be automatically saved in the Sequence List file A Sequence Alignment Settings for Pairwise Identity Analysis When aligning two sequences When computing identity percentage of two sequences Reward for a match Count end and internal gaps Count internal gap only Penalty for a mismatch Don t count gaps Internal gap open penalty Internal gap extension penalty End gap penalty e Set All Parameters as Default 15 3 8 Compare Seg Lists menu B Select Target and Non target Sequences File Mark Unmark Move Delete Clear Find Re alignment Help Load GenBank gb File to be Compared to Current List Display Sequences not in Sequence List Display Sequences not in GenBank File These functions allow the user to compare sequences in the Sequence List which is currently loaded in the PRISE2 software to sequenc
53. nscribed spacer 1 complete seque AGGACATTACCGAGTTTTCAACTCCCAAACCCCATGTGAATTATACCATTTACAACCGTTGCTTCGGCGGGTTCTCGCCCCGGGCTTTACACCCCGGAACCAGGCGGCCCGCCGGGGGACCCAAA ba lt m Target Sequences Not Annealing with Primer Probe Set Shows the target sequences that do not anneal to the whole primer probe set using the user selected design criteria Non Target Sequences Annealing with Primer Probe Set Shows the non target sequences that anneal to the whole primer probe set using the user selected design criteria Non Target Sequences Not Annealing with Primer Probe Set Shows the non target sequences that do not anneal to the whole primer probe set using the user selected design criteria 49 5 8 Complementarity menu Primer Probe Set Report Window Primer Pair Probe Setting Instant BLAST Help Probe Intra Complementarity Primer Probe Set Inter Complementarity probe probe Target Target on targei on targei Target Inter Probe intra of target ier probe probe ner probe 2robe Probe comple comple rith annealing avg pos GC Tm C mentarity mentarity pai wy I 1 F CCGGGCTTTACACCC 100 00 100 00 92 20 66 67 58 90 7 8 0 CCCGGGCTTTACACC 100 00 100 00 11 63 91 20 66 67 58 90 8 6 0 Primer Probe Set Information Window Probe intra complementarity Probe probe intra complementarity 6 5 CCCGGGCTTTACACC 3 OS ie ae 3 CCACATTTCGGGCCC 5 Probe Intra complementarit
54. o Complementarity Primer Pair Probe Setting Instant BLAST Help ATTTACAACCGTTGCT AAATCTAGAGTITGGGT E ATTTACAACCGTTGCT AAATCTAGAGTITGGG CATTTACAACCGTTGCT ATCTAGAGTITGGGTC _ CATTTACAACCGTTGCT AATCTAGAGTITGGGTC 4 Ic Target Target Non target Non target Target Inter Probe intra kof brie rae of ambiguous ba Probe ver probe probe mner probe probe probe Probe Probe comple comple touto in target sequenc annealing avg pos GC Tm C mentarity mentarity aa RIN that probe binds t 7 8 0 7 6 0 1 E CCGGGCTTTACACCC 100 00 100 00 11 63 100 00 92 20 66 67 58 90 2 E CCCGGGCTTTACACC 100 00 100 00 11 63 100 00 91 20 66 67 58 90 Primer Probe Set Information Window Below is a description of all of the functions in this module organized by the pull down menu they reside in Note that some of the functions are also available by right clicking on a row 42 5 2 File menu Hide Display Sort Add Delete Mark Unmark Annealing Info Complementarity Primer Pair Probe Setting Instant BLAST Help Save Primer Probe Set List ppset File TGCT AAATCTAGAGTITGGGT ATTTACAACCGTTGCT AAATCTAGAGTITGGG CATTTACAACCGTTGCT ATCTAGAGTITGGGTC gt Save Primer Probe Set List as Tab Delimited File Excel ee get Non target Non target Target Inter Probe intra Ent eee pro ial Pot ambiguous a Save Primer Pair and Probe Seqs Only be mner probe probe probe Probe Probe comp
55. on of the probe selectivity settings The Following options depict the selectivity settings for the middle part of the probes Theoretically highly selective probes should be obtained when both Target settings are set to High and both Non target settings are set to Low IF no primer probe sets are produced using these settings consider re running the program after lowering the target settings and or increasing the non target settings This problem will be most noticeable when designing primer probe sets For highly conserved sequences such as rRNA genes continuous matches Selectivity settings for target sequences Selectivity settings for non target sequences Target Non target Continuous 15 matches at the center to bind to target sequences Continuous 0 matches at the center to bind to non target sequences Low High Low High Select From the Following choices Use default mismatch settings and start designing probes now Show change mismatch settings Theoretically highly selective probes should be obtained when target setting is high and non Target setting is low If no primer probe sets are found these criteria can be relaxed to increase the likelinood of finding primer probe sets 39 In the Advanced Probe Selectivity Settings page the user can adjust the scoring function for ambiguous bases mismatch cost matrix and Insertion Deletion costs These features are similar to those for the primers except that for probes t
56. on one set Before the function is performed exactly one set must be selected by choosing the tab with the primer pair and selecting one probe in the table Selected probes are designated by their rows being highlighted in blue Probes can be selected by clicking on any part of the row except the boxes in the second column Primer Probe Set Annealing Position Information Provides information on where the primer probe set anneal to the target and non target sequence Primer Probe Set Report Window File Hide Display Sort Add Delete Mark Unmark Annealing Info Complementarity Primer Pair Probe Setting Instant BLAST Help ATTTACAACCGTTGCT AATCTAGAGTITGGGT J ATTTACAACCGTTGCT AAATCTAGAGTTTGGGT ATTTACAACCGTTGCT AAATCTAGAGTITGGG CATTTACAACCGTTGCT ATCTAGAGTITGGGTC ai gt gt Target Target on targei on targei Probe ver probt probe ner probe probe 1 CCGGGCTTTACACCC 100 00 10000 1163 100 00 j2 ccceeectttacacc 100 00 100 00 1163 100 00 Target annealing avg pos GC Tm C mentarity mentarity ie eaabigenes bees that probe binds probe Inter 2robe Probe comple 92 20 66 67 58 90 91 20 66 67 58 90 Probe intra target sequence of ambiguous ba comple 7 8 8 6 out of 10 int t al covered by probe 0 0 4 Primer Probe Set Information Window Target sequences gt Seed sequence PochoniaSeed Fw primer Probe 17 32
57. or more detailed information on Primer Selectivity Settings please refer to Appendix I 3 TII 3 1 0 0 3 TTI 3 e 2 1 0 BE a 2 1 1 T a DE 2 2 1 0 00 3 T 3 2 1 E E Figure 2 Scoring scheme for the sequence selectivity component of the Design Primers module On the left side are depictions of the last three 3 nucleotides of a primer and its corresponding template The primer is the top strand Base paired nucleotides are designated by solid lines Non based paired nucleotides are designated by dashed lines The score 3 digits assigned to each type of template primer pair is shown to the right Figure 2 shows various match mismatch configurations and corresponding parameter settings If the setting is set to xyz then only primer template pairs that satisfy this xyz match mismatch configuration and those above will be considered as producing a PCR product For example for 18 0 0 0 setting only exact matches at all three positions will be scored as creating a PCR product lf the setting is 2 1 0 then any primer template pair with match mismatch configurations of 0 0 0 1 0 0 1 1 0 and 2 1 0 will be counted as producing a PCR product One match mismatch setting does not appear in the figure for technical reasons see Appendix for details This scoring scheme can be set separately for target and non target sequences This useful feature gives a user the flexibility to define different stringency requirements fo
58. ote that this window also allows FASTA files to be input instead of or along with the hit table allowing sequences other than those generated by a BLAST analysis to be utilized In the next window titled Sequence Alignment Settings for Pairwise Identity Analysis users can select settings for the pairwise identity analyses which will be performed between the seed sequences and the hit table sequences and or FASTA sequences if there are any Load Seed Sequence and Hit Table 5 1 Load seed sequence s GenBank sequence annotations Enter accession for seed sequence s one line per accession number Extract simple annotations Faster GI ACCESSION LENGTH DEFINITION ORGANISM _ Extract complete annotations slower All above plus SOURCE FEATURES AUTHORS and TITLE p Or load seed sequence s in FASTA format 2 Load hit table and or FASTA File sequence s Load hit table Browse Load FASTA sequence s Browse lI Collecting and Parsing the Sequence Data After the sequences are uploaded the software downloads all of the GenBank records associated with the seed sequences and hit table sequences parses the data contained within them into separate components performs pairwise identity analyses between the seed sequences and hit table sequences and displays these data in tabular form in a report window The title of this window will be the hit table file name followed by Select Target and Non Targe
59. position information for primer pair TACCATTTACAACCGTTGCT TTTGTAATGATTCCACTCAGAC Target sequences Rv primer gt Seed sequence PochoniaSeed 117 138 gt gi 27884304 dbj AB100362 1 Cordyceps chlamydosporia genes for 18S rRN 1781 1800 1885 1906 gt gi 13160418 emb AJ292397 1 VCH292397Verticillium chlamydosporium var 40 59 144 165 gt gi 11933096 emb AJ291800 1 VCH291800Verticillium chlamydosporium 18S 90 109 194 215 Percentage of Each Nucleotide in Target and Non Target Sequences in Relation to Primer Sequences Provides the percentage of each nucleotide at each position in the target and non target sequences in relation to the nucleotides in each position of the primers 31 Settings For the percentage of each nucleotide in non target sequences in relation to the primer sequences Note that these primer annealing settings should be less stringent than those used For primer design Divide primer into two parts and set the minimum match percentages primer 5 oo atleast 50 EA at least 62 5 matches on 5 end matches on 3 end File Hide Display Sort Add Delete Mark Unmark Primer Complementarity Primer Setting Probes Instant BLAST Help Primer Annealing Position Information Target Target Target Non targe Non targ
60. positions will be scored as creating a PCR product e For non target sequences there is no mismatch on the first base on 3 end and at most two mismatches are allowed on the 2 and 3 bases on 3 end of primer Thus any primer template pair with match mismatch configurations of 0 0 0 1 0 0 1 1 0 and 2 1 0 for will be counted as producing a PCR product In this basic version of Primer Selectivity Settings the approximate match mismatch from the fourth base of primer s 3 end to 5 end can be specified as well This is illustrated by the example in Figure 3 in which high match percentage is required on the region from the fourth base to 5 end for target sequences while medium match percentage is required on the segment from the 4th base to 5 end for non target sequences By moving the slider bars on the side of two pictures these settings can be changed Note that there are in total 8 different combinations of match mismatch choices for the three 3 end positions but only 7 pictures can be shown in this window and they represent the settings 0 0 0 1 0 0 1 1 0 2 1 0 2 1 1 2 2 1 3 2 1 The picture below which represents the 1 1 1 setting is left out because the 1 1 1 and 2 1 0 settings are not compatible More specifically all of the above 7 settings are ordered strictly from more to 54 less stringent in considering the likelinood of getting a PCR product However the 1 1 1 and 2 1 0 settings cannot be ordered by our Prime
61. primers differ no more than 2 Primer GC between 25 ta 75 Max primer inter complementarity 1 Max primer 3 inter complementarity 4 E 1 Number of bases to count at 3 end inter Max primer intra complementarity Max primer 3 intra complementarity 4 Number of bases to count at 3 end intra 8 Max number of insertion and deletion allowed 0 Insertion and deletion cost 5 Positional weight cost target sequences Sod dg gg o222727272721111111111000000 Positional weight cost non target sequences BEG5G66666655 5504 4444443995521 11 15 16 Start reading target and non target sequences Read 15 target sequences Read 450 non target sequences 11 15 17 Start Filtering target and non target sequences 3 duplicated target target sequences were Filtered out 57 duplicated non target target sequences were Filtered out 11 15 17 Start primer design process There are 12 target and 393 non target sequences 20 IV Primer Report After the design process is finished a dialog titled Display Primer List pops up Here users have the options of Display all primer pair Display top primer pairs or Display partial primer pair list according to user defined conditional constraints The next window shows the primer pairs The title of this window will be the Target sequence file name followed by Primer Report The primer report window is a table that displays the primer pairs and their properties including the percenta
62. quences but to as few as possible non target sequences In these settings the user defines what constitutes a match between a primer and a sequence These settings can be defined separately for target and for non target sequences Roughly stringent high settings correspond to nearly perfect matches while more flexible settings low represent inexact matches The more stringent the settings the more likely the primer is to bind at a position where a match occurs At the same time more stringent settings result in fewer sequences matching the primer Thus an ideal primer would be such that it e Matches most of target sequences with respect to very stringent settings e Matches very few non target sequences with respect to very flexible settings However good judgment needs to be exercised when choosing the settings as using too high settings for target sequences and too low settings for non target sequences can actually result in filtering out highly selective primers This can happen for example if there is a primer that binds to all target sequences in spite of a single base mismatch at the 5 end of the primer but the settings for target Sequences require a perfect match In the Basic Primer Selectivity Settings page the user can select to either use the default settings or adjust the scoring scheme described above and in Appendix for both target and non target sequences This window allows users to set the selectivity settings for two
63. r Selectivity Settings system Default positional mismatch allowance settings should be suitable for most applications but they also can be customized using the advanced option In this setting the cumulative mismatch cost allowance for each primer position from 3 end can be specified Each entry of positional mismatch array represents the maximum allowed cost for the region from 3 end to the corresponding point of the primer We give an example to describe the use of these advanced settings Consider the mismatch cost matrix and the positional mismatch allowance settings for non target sequences in Figure 4 Non target sequence 32W 29 2 3 26 2 4 23 2 A 19 1B 17 16 15 14 13 2 1 1t 9 E 7 e gt 4 3 2 1 HL F 5 0s 15 s fs s fs fs fs fs Hs fs As 5 15 115 Ma 4 Oe Me ne Me fe fa Oa fa Ma fa M o Figure 4 An example of Mismatch Cost Matrix and Positional Mismatch Allowance Setting This combination setting can be interpreted as 1 No mismatch is allowed at the first base on 3 end 2 At most one C A G C T A or T G mismatch and no G A or T C mismatch is allowed on the second to the third base on 3 end 3 One T C mismatch on the fourth base with no mismatch from the first to the third base on 3 end or one G A mismatch on the fourth base with at most one C A G C T A or T G mismatch is allowed on the second to the third base on 3 end Under this setting the primer 5 CTAACTACTGAGAA 3 will be predicted to amplify t
64. r primer annealing within these two classes of sequences 19 4 1 Using the module l Loading the Sequences After opening the Design Primers Probes module the Primer Probe Design Wizard will help users to go through this step First is the Load or Design New List page where users can load a previously created primer list file or initiate a new primer design project Next is the Input Target Non Target Sequences page On this page users can load the target and non target sequence files and select options to remove duplicate sequences and those that do not meet user selected size criteria Note that size selection could have a dramatic impact on the quality of the primers produced For example if one included sequences with a large size range a primer could be scored as not being present in a given sequence only because that sequence was relatively short and therefore did not contain the region that the primer was targeting i oe Primer Probe Design Wizard p_a o e Input Target Non target Seqences Input target and non target sequences FASTA file Format Target sequence D Workspace sample file PochoniaTarget_mac txt Browse Non target sequence D Workspace sample File PochoniaNonTarget_mac txt Duplicate sequences Remove duplicate sequences Remove and dump to file Browse Sequence length range Sequences must have length between 60 and 4000 nucleotides Remove sequences not within this length range
65. rimer 12 of non target sequences estimated to anneal with reverse primer The smaller the value generated by the Selectivity Formula the more likely the primers will amplify target sequences and not amplify non target sequences Sort by Ascending Selectivity Formula Y Descending Then by Ascending Target pair v Descending Then by Ascending Descending Then by Ascending 7 Descending em 28 4 5 Add Delete menu Add Primer Pair Manually Allows an individual primer pair to be added to the primer list and its properties determined in relationship to the target and non target sequence files and user defined primer design settings The primer pair must be entered in the format given earlier Delete Primer Pairs Conditionally Allows primer pairs to be deleted from the primer list by user specified criteria Delete Marked Primer Pairs Allows marked primers to be deleted Marked primers are designated by a check mark in the second column and a highlighted row Primers can be marked by clicking on the boxes in the second column or by using the Mark Unmark functions below Foon Pca Pr ell NRO lH File Hide Display Sort Mark Unmark Annealing Info Primer Complementarity Primer Setting Probes Instant BLAST Help Add Primer Pair Manually Target Non target Non target Non target Target Target Target Target Target Non
66. second column and a yellow highlighted row Delete Selected Sequences Deletes selected sequences from the sequence list Selected sequences are designated by their rows being highlighted in blue Sequences can be selected by clicking on any part of the row except the boxes in the second column Standard key commands such as shift and control can be used with this function allowing groups of sequences to be selected Once sequences are selected they can be marked or unmarked using the functions in the Mark Unmark menu 13 3 5 Clear menu Clear FASTA Sequence Box Deletes the sequences from the FASTA Sequence Box 3 6 Find menu E Select Target and Non target Sequences File Mark Unmark Move Delete Clear Find Re alignment Compare Seq Lists Help Find Sequence Find Next Find Sequence Allows the user to search for sequences by user defined criteria l I Find next sequence satisfying selected conditions Sequence length between contains O does not contain E a 0 does not contain Find Next Allows the user to search for sequences using the criteria that were input in the last Find Sequence search 14 3 7 Re alignment menu B Select Target and Non target Seq File Mark Unmark Move Delete Clear Find Re Alignment Compare Seq Lists Help Change Sequence Alignment Settings Update Identity for All Sequences Change Sequence Alignment Settings Allows the user to cha
67. separate regions of the primers the last three 3 nucleotides and the other nucleotides p A Primer Probe Design Wizard B Basic Primer Selectivity Settings This window allows selection of the primer selectivity settings The following pictures depict the selectivity settings for the last three 3 nucleotides of the primers Theoretically highly selective primers should be obtained when both Target settings are set to High and both Non target settings are set to Low If no primers are produced using these settings consider re running the program after lowering the target settings and or increasing the non target settings This problem will be most noticeable when designing primers for highly conserved sequences such as rRNA genes Selectivity settings For target sequences Selectivity settings For non target sequences Target Non target Base 4 to Base 1 3 Base 4 to Base 1 3 5 end on 3 end 5 end on 3 end High High High High Capel imer t 3 Low i m 3 ull n 5 37e ll Low Select From the Following choices Use default mismatch settings and start designing primers now Show change mismatch settings lt Back Cancel Help 23 As explained earlier theoretically highly selective primers should be obtained when both target settings are set to high and both non Target settings are set to ow However when making primers from conserved sequences such as rRNA genes such settin
68. sting File Exit M l Load Seed Sequence and Hit Table Allows Seed Sequences and hit tables to be loaded This window also allows the user to load a FASTA file instead of or along with a hit table allowing sequences from sources other than a BLAST analysis to be utilized Load Sequence List Allows previously created sequence lists which are PRISE2 generated and formatted files to be loaded into the software Save Sequence List Allows sequence lists to be saved in the format used by the PRISE2 software Save Sequence List as Tab Delimited File Allows sequence lists to be saved in a tab delimited format which can be used in standard spreadsheet software Save FASTA Sequences As Saves the sequences in the FASTA Sequence Box in FASTA format as a text file Add FASTA Sequences To Adds the sequences in the FASTA Sequence Box to another text file typically one that contains other sequences in FASTA format 11 3 3 Mark Unmark menu f Mark Sequences Unmiark Sequences Reverse Marked and Unmarked File Mark Unmark Move Delete Clear Find Re Alignment Compare Seq Lists Help Mark Sequences Allows sequences to be marked if they possess user defined criteria Marked sequences are designated by a check mark in the box in the second column and a yellow highlighted row Sequences that are marked can be moved to the FASTA Sequence Box and then saved or merged with other FASTA files to make target a
69. t Sequences After the program finishes processing the data which could take minutes to hours depending on the number of sequences in the seed sequence and hit table files the speed of the internet connection and the capabilities of the computer a sequence downloading report dialog appears This report lists the accession number of sequences from the hit table that are too large to be analyzed The information in the report can be saved as a text file for later Ill Sequence Selection Once these actions have been completed users can identify and collect the target and non target sequences by applying sorting tools to the sequences assembled in the table This task is primarily done by using tools that allow the sequences to be selected by parameters including sequence length sequence identity or GenBank parameters such as Definition or Source Sequences can also be sorted by clicking on the column headings Below is a description of all of the functions in this module organized by the pull down menu they reside in See the PRISE2 Tutorial for a few examples of how they can be used 10 3 2 File menu E Select Target and Non target Sequences E Mark Unmark Move Delete Clear Find Re alignment Compare Seq Lists Help Load Seed Sequence and Hit Table Load Sequence List sequence File Save Sequence List sequence File Save Sequence List as Tab Delimited File Excel File Save FASTA Sequences as Add FASTA Sequences to An Exi
70. t is created by subjecting the seed sequences to an analysis using BLAST blastn Note Although steps 1 1 and 1 2 are designed to identify and collect target and non target DNA sequences there are certainly other strategies for accomplishing this task which users may decide to use instead of or in combination with our steps The only requirement for using the primer design module of PRISE2 step 2 is that the target and non target sequences be available in separate FAST A formatted text files dentify Seed Sequences Identify the sequences that the primers are intended to amplify and save them in FASTA format as a text file Use of large numbers of seed sequences requires longer processing times Create the Hit Table Subject the seed sequences to a nucleotide BLAST analysis To create a hit table BLAST analysis is required this can be done by either using the program on the NCBI website hitp www ncbi nim nih gov BLAST or running BLAST command line application on local machine It is essential for BLAST analysis to select the appropriate database and the maximum number of target sequences which in our experience will typically be at least 500 2 2 Create hit table using NCBI BLAST website The hit table can be created by utilizing the NCBI BLAST website users can adjust BLAST settings and get results through the web interface For users information the Max target sequences option is located in the Algorithm parameters se
71. uences in the tabs near the top of the window For each tab the table below displays the corresponding probes and the properties of the whole primer probe set including the percentage of target and non target sequences predicted to be amplified PCR product size etc To assist the process of selecting optimal probes the probes in the table can be sorted by their parameters and by a formula that identifies probes that are most likely to amplify target but not non target sequences the Selectivity Formula In addition probes can be sorted by clicking on the column headings This module also provides tools enabling the user to obtain detailed information about the primer probe sets These data include the percent of each nucleotide at each position in the target and non target sequences in relation to the nucleotides in each position of the probes In addition the user can identify the target and non target sequences that should or should not be amplified by each probe He she can also load additional probes not necessarily created by PRISE2 enabling the properties of these probes to be examined in relation to the target and non target sequences and compared to the PRISE2 generated probes The probes and their properties can be saved in a tab delimited format so that the user can import the data into other programs such as spreadsheet software 41 a Primer Prot Set Repor File Hide Display Sort Add Delete Mark Unmark Annealing Inf
72. x them by lowering the threshold for the matches for target sequences and or increase the threshold for non target sequences The remainder of this chapter explains the probe design process in more detail 37 5 1 Using the module Loading the Sequences After marking the desired primer pairs and clicking on the Design Probes for Marked Primer Pairs a wizard window similar to that for the primer design process will appear The first page is titled Extract Load Probe Candidates Here users can choose from i Design probes based on the target and non target sequences or ii Load user s probe candidates to assess their properties in relation to the target and non target sequences and user defined probe criteria Extract Load Probe Candidates Extract probe candidates from target sequences or load user s probe candidates Design probes based on target and non target sequences 0 Load user s probe candidates Browse Note IF you provide your own probe candidates the program will not consider the probe candidates extracted from target sequences Cancel Help ll Probe Property Settings In the next page titled Probe Design Settings the user can select i Use all default settings ii Use previous settings or ili Show change settings Probe Design Settings This probe design wizard will help you to choose most of the settings for designing probes Select from the following choices Use all
73. y Provides information on the intra complementarity of the probe Primer Probe Set Inter complementarity Provides information on the inter complementarity of the primers and probe 50 5 9 Primer Pair menu Show Primer Pair Info Shows detailed information about the current primer pair Primer Probe Set Report Window File Hide Display Sort Add Delete Mark Unmark Annealing Info Complementarity Primer Pair Probe Setting Instant BLAST Help ATITACAACCGTTGCT AATCTAGAGTITGGGT EJ ATITACAACCGTTGCT AAATCTAGAGTITGGGT F T Target Target on targei on targei Target i i pept of ambiguous ba Probe ver probt probe ner probe probe probe obe Probe comple comple rith Maas in target annealing avg pos GC Tm C mentarity mentarity Rh I that probe binds 1 E CCGGGCTTTACACCC 92 20 66 67 58 90 7 8 0 2 cccecectttacacc 91 20 66 67 58 90 8 6 0 Primer Probe Set Information Window Primer TM Left 49 025 Right 49 025 Primer GC Left 37 5 Right 37 5 Complementary Left Intra 8 Left Intra 3 end 8 Right Intra 2 Right Intra 3 end 0 Inter 6 Inter 3 end 1 5 10 Probe Setting menu View Probe Design Setting Show all settings used for computing the current collection of probes but users will not be able to change the settings at this time To change these settings the user needs to exit the window and redo the probe design process 51 ete eg Sg Probe le
74. yc 2 m 11RA TANA AMdA1 7RN aq 5999 S72 Verticilliim chlamudncnnriim nartial 125 rRNA nene Fukarur e Display Pairwise Alignment Opens a window showing the alignment of the selected sequence and the Seed Sequence Note that this function only works when one sequence is selected and the seed sequence contains one sequence i a Pairwise Alignme Seed sequence PochoniaSeed V S subject sequence AJ292397 99 5992 identity Identity 497 Mismatch 2 Internal gaps 0 End gaps 55 CATGTGAACTTATACCATTTACAACCGTTGCTTCGGCGGGTTCTCGCCCCGGGCTTTACA PEEEUEET EEE E PEPE PEEP EEE EEE TEEPE EEE EEE EEE EEE ATTACCGAGTTTTCAACTCCCAAACCCCATGTGAACTTATACCATTTACAACCGTTGCTTCGGCGGGTTCTCGCCCCGGGCTTTACA CGGCCCGCCGGGGGACCCAAACTCTAGATTTTTATTTTGGCATGTCTGAGTGGAATCATTACAAAATGAATCAAAACTTTCAACAAC PEPEP EET EEE PEEP EEE EEE EEE EEE EEE EEE EEE TEEPE EE EEE EEE TEE EEE EEE EEE EEE EEE CGGCCCGCCGGGGGACCCAAACTCTAGATTTTTATTTTAGCATGTCTGAGTGGAATCATTACAAAATGAATCAAAACTTTCAACAAC CTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAACTCAGTGAATCATCGAATCTTTGAACGCACATTG PEPEPU ET EP EEE PTET EEE EE EEE PEE EE EEE EEE EEE EEE EEE EEE TEEPE PEEP EEE EEE EEE CTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTG TCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCCAGCGGTTTGGTGTTGGGGACCGGCGAGTACAGAGGCTTTGG PEP EE PEP ET EE EEE ETE EEE PEPE EEE PEPE EEE EE EEE EEE EEE EEE EEE EEE EEE EEE TCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCCAGCGGTTTGGTGTTGGGGACCGGCGAG

PRISE 2.0 User Manual - Algorithms and Computational Biology Lab

Contents

Download Pdf Manuals

Related Search

Related Contents