Home

ViraPower™ Promoterless Lentiviral Gateway® Kits

1. ssssssssssseeseeeeeeenn entente tenete tenente tenete tenete 8 Experimental Outline oett enea e E E E AA REE ae a RAR abort tistttatutdn 10 MethodS me cit ce oc sachsen saved ct tacduss aden cute and uoeceunucauasseenesadnscadgeadshcescesseshnsbdeneesnamastove 11 Generating Entry Clones Spodee eena e e gelatin deae ent acd i arent 11 Guidelines to Generate Expression Clones ccscsescscssesetetesesesesneneneseseseseececseeenesesesesesnsnenssesesesnaneceeeenenenees 14 Performing the MultiSite Gateway LR Recombination Reaction sse 17 Transforming One Shot Stbl3 Competent E colto seno o sw ita a o usas 21 Producing Lentivirus in 293FT Gels sokeri enan e a onea nennen tenete tenente nennen 24 Titering Your Lentiviral Stock ci ethuteecletieeiqeitnede ue dene aa a a AEREE eE TREES 30 Transduction of Mammalian Cells and Expression Analysis esses 36 Troubleshooting i oanien attained geri oci orto isi bie ieri agi d nete iota ied 40 Pie eum 44 Recipes inne evene ene nae enm nnn UR ee eR ee gu eed 44 Map of pLenti6 RAR2 V5 DEST teer ee etre e Rte eer e dete de taie seal 46 Features of pL nti6 RAR27 V5 DBST Potene esee beni epe iit eerte tente hin 47 Map oL pENTE S BC ia aetates adobe eme Rue DER te af uS gral ia eO tol Lco eR Ra 48 Map of pL nti6 UbG V5 GW lacZ te trn re tene er Ld ete ce i ERA 49 Map Of pLPT ie eoe ite I I ete Eget I EE ete eire Lee RIEN eee re ea EIER ee tas pes
2. Important To generate the pLenti6 R4R2 V5 DEST expression construct you will also need to generate an entry clone containing your gene of interest In this instance you may use any standard Gateway entry vector except pENTR 5 TOPO For more information see page 6 e The pLenti6 RAR2 V5 DEST expression vector into which the promoter and gene of interest will be simultaneously cloned using MultiSite Gateway Technology The vector also contains the elements required for packaging of the expression construct into virions e g 5 and 3 LTRs y packaging signal and the Blasticidin resistance marker to allow generation of stable cell lines For more information about the pLenti6 R4R2 V5 DEST vector see page 5 TM e The ViraPower Packaging Mix that contains an optimized mix of the three packaging plasmids pLP1 pLP2 and pLP VSVG These plasmids supply the helper functions as well as structural and replication proteins in trans required to produce the lentivirus For more information about the packaging plasmids see the Appendix pages 50 55 e An optimized 293FT producer cell line that stably expresses the SV40 large T antigen under the control of the human CMV promoter and facilitates optimal production of virus For more information about the 293FT Cell Line refer to the 293FT Cell Line manual After you have generated the pLenti6 RAR2 V5 DEST expression construct containing your promoter and gene of interest you will c
3. 4 Transduce your mammalian cell line with the pLenti6 RAR2 V5 DEST lentivirus Select for stably transduced cells using Blasticidin if desired Your Mammalian Cell Line of Interest 5 Assay for recombinant protein of interest Promoter gene V5 10 Methods Generating Entry Clones Introduction Important Generating an Entry Clone Containing a Promoter of Interest Before you can generate an expression construct in pLenti6 R4R2 V5 DEST you will first need to generate the following entry clones e An attL4 and atiR1 flanked entry clone containing your eukaryotic promoter of interest To generate this entry clone you must use the pENTR 5 TOPO entry vector and the pENTR 5 TOPO TA Cloning Kit supplied with the ViraPower Promoterless Lentiviral Gateway Kits See below for more information e An attL1 and attL2 flanked entry clone containing your gene of interest To generate this entry clone you may use any traditional Gateway entry vector or obtain an Ultimate ORF Clone available from Invitrogen See page 12 for more information General guidelines are provided in this section to help you generate the appropriate entry clones For detailed instructions refer to the manual for the entry vector you are using When generating your entry clones note that for efficient packaging to occur pLenti6 R4R2 V5 DEST has a limited cloning size of 4 5 to 5 kb That is the combined size of your prom
4. Limited Use Label License No 51 Blasticidin and the Blasticidin Selection Marker Limited Use Label License No 108 Lentiviral Technology Limited Use Label License No 109 Retroviral Helper Lines Use of this product in conjunction with methods for the introduction of RNA molecules into cells may require licenses to one or more patents or patent applications Users of these products should determine if any licenses are required Blasticidin and the blasticidin resistance gene bsd are the subject of U S Patent No 5 527 701 sold under patent license for research purposes only For information on purchasing a license to this product for purposes other than research contact Licensing Department Life Technologies Corporation 5791 Van Allen Way Carlsbad California 92008 Phone 760 603 7200 Fax 760 602 6500 The Lentiviral Technology based upon the lentikat system is licensed from Cell Genesys Inc under U S Patent Nos 5 834 256 5 858 740 5 994 136 6 013 516 6 051 427 6 165 782 and 6 218 187 and corresponding patents and applications in other countries for internal research purposes only Use of this technology for gene therapy applications or bioprocessing other than for non human research use requires a license from Cell Genesys Cell Genesys Inc 342 Lakeside Drive Foster City California 94404 The purchase of this product conveys to the buyer the non transferable right to use the purchased amount
5. Introduction The products listed in this section may be used with the ViraPower Promoterless Lentiviral Gateway Kits For more information refer to our website at www invitrogen com or contact Technical Support page 56 Accessory Many of the reagents supplied in the ViraPower Promoterless Lentiviral Products Gateway Kits as well as other products suitable for use with the kits are available separately from Invitrogen Ordering information is provided below Product Quantity Catalog no pENTR 5 TOPO TA Cloning Kit 20 reactions K591 20 One Shot Stb13 Chemically Competent E coli 20 x 50 ul C7373 03 PureLink HiPure Plasmid Midiprep Kit 25 preps K2100 04 S N A P Midiprep DNA Isolation Kit 20 reactions K1910 01 Low DNA Mass Ladder 50 applications 10068 013 High DNA Mass Ladder 50 applications 10496 016 Gateway LR Clonase II Plus Enzyme Mix 20 reactions 12538 020 100 reactions 12538 100 Ampicillin 5g Q100 16 ViraPower Bsd Lentiviral Support Kit 20 reactions K4970 00 ViraPower Lentiviral Packaging Mix 60 reactions K4975 00 293FT Cell Line 3 x 106 cells R700 07 Library Efficiency DB3 1 Competent Cells 1ml 5 x 0 2 ml 11782 018 Lipofectamine 2000 Reagent 0 75 ml 11668 027 1 5 ml 11668 019 Opti MEM I Reduced Serum Medium 100 ml 31985 062 500 ml 31985 070 Blasticidin 50 mg R210 01 B gal Antiserum 50 ul R901 25 Detecting You may detect e
6. coli K2500 20 e with One Shot Mach1 T1R Chemically Competent E coli K2520 20 When used in a MultiSite Gateway LR recombination reaction with a pENTR 5 TOPO entry clone and pLenti6 R4R2 V5 DEST entry clones generated in pCR 8 GW TOPO recombine less efficiently resulting in slightly fewer total colonies If you want to maximize the number of MultiSite Gateway LR recombinants obtained we suggest generating attL1 and attL2 containing entry clones in PENTR D TOPO If you wish to express a human gene of interest in pLenti6 R4R2 V5 DEST you may want to use an Ultimate Human ORF hORF Clone available from Invitrogen The Ultimate hORF Clones are fully sequenced clones provided in an attL1 and attL2 flanked Gateway entry vector that is ready to use ina recombin ation reaction with a pENTR 5 TOPO entry clone and the pLenti6 R4R2 V5 DEST vector For more information about the Ultimate hORF Clones available visit www invitrogen com clones or contact Technical Support see page 56 Continued on next page Generating Entry Clones Continued ORF Sequence Considerations pLenti6 R4R2 V5 DEST allows fusion of your gene of interest to a C terminal tag When generating your entry clone remember that your gene of interest must Contain a Kozak consensus sequence with an ATG initiation codon for proper initiation of translation Kozak 1987 Kozak 1990 Kozak 1991 An example of a Kozak consensus seque
7. 1 5 LTR bases 230 410 5 splice donor base 520 HIV 1 psi v packaging signal bases 521 565 HIV 1 Rev response element RRE bases 1075 1308 3 splice acceptor base 1656 3 splice acceptor base 1684 UbC promoter bases 1798 3016 attB1 site bases 3072 3096 lacZ ORF bases 3116 6172 attB2 site bases 6192 6216 V5 epitope bases 6269 6310 SV40 early promoter and origin bases 6365 6673 EM7 promoter bases 6728 6794 Blasticidin resistance gene bases 6795 7193 AU3 HIV 1 3 LTR bases 7279 7513 AUS bases 7279 7332 Truncated HIV 1 3 LTR bases 7333 7513 SV40 polyadenylation signal bases 7585 7716 bla promoter bases 8575 8673 Ampicillin b a resistance gene bases 8674 9534 pUC origin bases 9679 10352 49 Map of pLP1 pLP1 Map 50 The figure below shows the features of the pLP1 vector Note that the gag and pol genes are initially expressed as a gag pol fusion protein which is then self cleaved by the viral protease into individual Gag and Pol polyproteins The complete sequence of pLP1 is available for downloading from our website at www invitrogen com or by contacting Technical Support page 56 Comments for pLP1 8889 nucleotides CMV promoter bases 1 747 TATA box bases 648 651 Human f globin intron bases 880 1320 HIV 1 gag pol sequences bases 1355 5661 gag coding sequence bases 1355 2857 gag pol frameshift base 2650 pol coding sequence bases 2650 5661 HIV 1 Rev response element RRE base
8. Kit TM ViraPower Lentiviral Vectors One Shot Stb13 Chemically Competent E coli LR Clonase II Plus Enzyme Mix TM ViraPower Bsd Lentiviral Support Kit 293FT Cell Line Catalog no K591 10 K5910 00 J J y y y J J y Continued on next page Kit Contents and Storage Continued TM Shipping Storage The ViraPower Promoterless Lentiviral Gateway Kits are shipped as described below Upon receipt store each item as detailed below Note Catalog no K591 10 includes the pENTR 5 TOPO TA Cloning Kit ViraPower Lentiviral Vectors and One Shot Stbl3 Chemically Competent E coli only Component Shipping Storage ViraPower Lentiviral Vectors Wet ice 20 C One Shot Stbl3 Chemically Dry ice 80 C Competent E coli LR Clonase Plus II Enzyme Mix Dry ice 80 C ViraPower Bsd Lentiviral Support Wet ice Kit TM ViraPower Packaging Mix 20 C Lipofectamine 2000 4 C do not freeze Blasticidin 20 C 293FT Cell Line Dry ice Liquid nitrogen pENTR 5 TOPO TA Cloning Kit Dry ice pENTR 5 TOPO Reagents 20 C One Shot TOP10 Chemically Competent E coli 80 C TM ViraPower The following vectors are included with the ViraPower Promoterless Lentiviral Lentiviral Vectors Gateway Kits All vectors are supplied in suspension detailed below Store the vectors at 20 C Vec
9. MOI 43 Recipes LB Luria Bertani Medium LB Plates Containing Ampicillin and Blasticidin 44 Appendix 1 0 Tryptone 0 5 Yeast Extract 1 0 NaCl pH 7 0 1 For 1 liter dissolve 10 g tryptone 5 g yeast extract and 10 g NaCl in 950 ml deionized water 2 Adjust the pH of the solution to 7 0 with NaOH and bring the volume up to 1 liter 3 Autoclave on liquid cycle for 20 minutes Allow solution to cool to 55 C and add antibiotic if desired 4 Store at 4 C Follow the instructions below to prepare LB agar plates containing ampicillin and Blasticidin Important The stability of Blasticidin may be affected by high temperature therefore do not add Blasticidin to warm LB agar Let LB agar cool to room temperature before adding Blasticidin 1 2 9i Prepare LB medium as above but add 15 g L agar before autoclaving Autoclave on liquid cycle for 20 minutes After autoclaving cool to 55 C add ampicillin to a final concentration of 100 pg ml and pour into 10 cm plates Let harden then spread 50 ug ml Blasticidin on each plate Invert and store at 4 C in the dark Plates containing Blasticidin may be stored at 4 C for up to 2 weeks Blasticidin Blasticidin Molecular Weight Formula and Structure Handling Blasticidin Preparing and Storing Stock Solutions Blasticidin S HCl is a nucleoside antibiotic isolated from Streptomyces griseochromogenes which inhib
10. Mammalian cell line of choice e Complete culture medium for your cell line e 6mg ml Polybrene if desired e Appropriately sized tissue culture plates for your application e Blasticidin if selecting for stably transduced cells Continued on next page 37 Transduction of Mammalian Cells and Expression Analysis Continued Transduction Procedure Note Detecting Recombinant Protein 38 Follow the procedure below to transduce the mammalian cell line of choice with your lentiviral construct 1 Plate cells in complete media as appropriate for your application 2 On the day of transduction Day 1 thaw your lentiviral stock and dilute if necessary the appropriate amount of virus at a suitable MOI into fresh complete medium Keep the total volume of medium containing virus as low as possible to maximize transduction efficiency DO NOT vortex 3 Remove the culture medium from the cells Mix the medium containing virus gently by pipetting and add to the cells 4 Add Polybrene if desired to a final concentration of 6 pg ml Swirl the plate gently to mix Incubate at 37 C overnight Note If you are transducing cells with undiluted viral stock and are concerned about possible toxicity or growth effects caused by overnight incubation it is possible to incubate cells for as little as 6 hours prior to changing medium 5 The following day Day 2 remove the medium containing virus and replace with fresh com
11. R2 for recombinational cloning of the promoter and gene of interest from two separate entry clones e The ccdB gene located between the attR sites for negative selection e Chloramphenicol resistance gene Cm located between the two attR sites for counterselection e C terminal V5 epitope for detection of the recombinant protein of interest Southern et al 1991 e Blasticidin resistance gene for selection in E coli and mammalian cells Izumi et al 1991 Kimura et al 1994 Takeuchi et al 1958 Yamaguchi et al 1965 e Ampicillin resistance gene for selection in E coli e pUCorigin for high copy replication of the plasmid in E coli The MultiSite Gateway Technology The MultiSite Gateway Technology Gateway Technology is a universal cloning method that takes advantage of the site specific recombination properties of bacteriophage lambda Landy 1989 to provide a rapid and highly efficient way to transfer a single DNA sequence of interest into multiple vector systems The MultiSite Gateway Technology uses modifications of the Gateway Technology to allow simultaneous cloning of multiple DNA fragments in a defined order and orientation to create an expression construct In the ViraPower Promoterless Lentiviral Gateway Expression System the MultiSite Gateway Technology facilitates recombinational cloning of two DNA fragments encoding a promoter and gene of choice into the pLenti6 R4R2 V5 DEST lentiviral dest
12. Single Injection of Lentivirus into Human Skin Tissue Hum Gene Ther 12 1551 1558 Boshart M Weber F Jahn G Dorsch Hasler K Fleckenstein B and Schaffner W 1985 A Very Strong Enhancer is Located Upstream of an Immediate Early Gene of Human Cytomegalovirus Cell 41 521 530 Buchschacher G L Jr and Wong Staal F 2000 Development of Lentiviral Vectors for Gene Therapy for Human Diseases Blood 95 2499 2504 Burns J C Friedmann T Driever W Burrascano M and Yee J K 1993 Vesicular Stomatitis Virus G Glycoprotein Pseudotyped Retroviral Vectors Concentration to a Very High Titer and Efficient Gene Transfer into Mammalian and Nonmammalian Cells Proc Natl Acad Sci USA 90 8033 8037 Ciccarone V Chu Y Schifferli K Pichet J P Hawley Nelson P Evans K Roy L and Bennett S 1999 Lipofectamine 2000 Reagent for Rapid Efficient Transfection of Eukaryotic Cells Focus 21 54 55 Dull T Zufferey R Kelly M Mandel R J Nguyen M Trono D and Naldini L 1998 A Third Generation Lentivirus Vector with a Conditional Packaging System J Virol 72 8463 8471 Emi N Friedmann T and Yee J K 1991 Pseudotype Formation of Murine Leukemia Virus with the G Protein of Vesicular Stomatitis Virus J Virol 65 1202 1207 Gallichan W S Kafri T Krahl T Verma I M and Sarvetnick N 1998 Lentivirus mediated Transduction of Islet Grafts with Interleukin 4 Results
13. a 12 RECO END Nous l Consider the following when cloning your eukaryotic promoter sequence e Make sure that your DNA fragment contains all promoter and enhancer sequences e g TATA box transcription factor binding sites necessary to regulate expression of the downstream gene of interest following MultiSite Gateway LR recombination e Make sure that your promoter sequence contains a transcription initiation site e Make sure that your promoter sequence does not contain an ATG translation initiation codon To generate an attL1 and attL2 flanked entry clone containing the gene of interest you may use any Gateway entry vector available from Invitrogen except pENTR 5 TOPO For fast and easy generation of an entry clone using TOPO Cloning we recommend using the pENTR D TOPO entry vector Other TOPO adapted entry vectors are available see table below See the next page for recommendations to produce the entry clone Once you have selected an entry vector refer to the manual for the specific entry vector you are using for instructions to construct an entry clone All entry vector manuals are available for downloading from www invitrogen com or by contacting Technical Support see page 56 Entry Vector Kit Catalog No pENTR D TOPO Cloning Kit K2400 20 pENTR SD D TOPO Cloning Kit K2420 20 pCR 8 GW TOPO TA Cloning Kit e with One Shot TOP10 Chemically Competent E
14. employment of this product or its components to a third party or otherwise use this product or its components or materials made by the employment of this product or its components for Commercial Purposes The buyer may transfer information or materials made through the employment of this product to a scientific collaborator provided that such transfer is not for any Commercial Purpose and that such collaborator agrees in writing a not to transfer such materials to any third party and b to use such transferred materials and or information solely for research and not for Commercial Purposes Notwithstanding the preceding any buyer who is employed in an academic or government institution may transfer materials made with this product to a third party who has a license from Life Technologies under the patents identified above to distribute such materials Transfer of such materials and or information to collaborators does not convey rights to practice any methods claimed in the foregoing patents or patent applications Commercial Purposes means any activity by a party for consideration and may include but is not limited to 1 use of the product or its components in manufacturing 2 use of the product or its components to provide a service information or data 3 use of the product or its components for therapeutic diagnostic or prophylactic purposes or 4 resale of the product or its components whether or not such product or its components are
15. for any Commercial Purpose and that such collaborator agrees in writing a not to transfer such materials to any third party and b to use such transferred materials and or information solely for research and not for Commercial Purposes Commercial Purposes means any activity by a party for consid eration and may include but is not limited to 1 use of the product or its components in manufacturing 2 use of the product or its components to provide a service information or data 3 use of the product or its components for therapeutic diagnostic or prophylactic purposes or 4 resale of the product or its components whether or not such product or its components are resold for use in research For products that are subject to multiple limited use label licenses the terms of the most restrictive limited use label license shall control Life Technologies Corporation will not assert a claim against the buyer of infringement of patents owned or controlled by Life Technologies Corporation which cover this product based upon the manufacture use or sale of a therapeutic clinical diagnostic vaccine or prophylactic product developed in research by the buyer in which this product or its components was employed provided that neither this product nor any of its components was used in the manufacture of such product If the purchaser is not willing to accept the limitations of this limited use statement Life Technologies is willing to accept return of
16. in the System is adapted with MultiSite Gateway Technology for easy simultaneous recombination based cloning of multiple DNA fragments in a defined order and orientation e Includes multiple features designed to enhance the biosafety of the system Continued on next page Overview Continued ViraPower Lentiviral Technology Purpose of this Manual TM The ViraPower Lentiviral Technology facilitates highly efficient in vitro or in vivo delivery of a target gene or RNA to dividing and non dividing mammalian cells using a replication incompetent lentivirus Based on the lentikat system developed by Cell Genesys Dull et al 1998 the ViraPower Lentiviral Technology possesses features which enhance its biosafety while allowing high level expression in a wider range of cell types than traditional retroviral systems TM The main components of the ViraPower Lentiviral Expression System include e ApLenti based expression vector into which the DNA sequence or sequences are cloned This vector contains elements required to allow packaging of the expression construct into virions and an antibiotic resistance marker to allow selection of stably transduced cell lines For more information see page 5 TM e The ViraPower Packaging Mix an optimized mixture of the three packaging plasmids required for production of the lentivirus e A 293FT producer cell line to facilitate optimal production of virus TM For
17. of the product and components of the product in research conducted by the buyer whether the buyer is an academic or for profit entity including non gene therapy research and target validation applications in laboratory animals Retroviral helper cell lines are licensed from Wisconsin Alumni Research Foundation under U S Patents and corresponding patents and applications in other countries for internal research purposes only Use of these cell lines for Commercial Purposes requires a license from Life Technologies 59 Gateway Clone Distribution Policy Introduction Gateway Entry Clones Gateway Expression Clones Additional Terms and Conditions 60 The information supplied in this section is intended to provide clarity concerning Invitrogen s policy for the use and distribution of cloned nucleic acid fragments including open reading frames created using Invitrogen s commercially available Gateway Technology Invitrogen understands that Gateway entry clones containing atfL1 and attL2 sites may be generated by academic and government researchers for the purpose of scientific research Invitrogen agrees that such clones may be distributed for scientific research by non profit organizations and by for profit organizations without royalty payment to Invitrogen Invitrogen also understands that Gateway expression clones containing attB1 and attB2 sites may be generated by academic and government researche
18. page 56 Comments for pENTR 5 UbCp 3861 nucleotides rrnB T2 transcription terminator bases 275 303 c rrnB T1 transcription terminator bases 437 480 c M13 forward 20 priming site bases 546 561 attL4 bases 601 697 GW1 priming site bases 639 663 Human UbC promoter bases 698 1906 attR1 bases 1907 2030 GW3 priming site bases 1937 1966 M13 reverse priming site bases 2126 2142 Kanamycin resistance gene 2255 3064 pUC origin bases 3185 3858 c complementary strand Map of pLenti6 UbC V5 GW lacZ Description Map of pLenti6 UbC V5 GW lacZ is a 10759 bp control vector expressing B galacto sidase under the control of the UbC promoter and is supplied with the kit for use as an expression control to help you optimize lentiviral production The vector was generated using the Gateway LR recombination reaction between an entry clone containing the lacZ gene and the pLenti6 UbC V5 DEST vector B galactosidase is expressed as a C terminal V5 fusion protein with a molecular weight of approximately 121 kDa The map below shows the elements of pLenti6 UbC V5 GW lacZ The pLenti6 UbC V5 complete sequence of the vector is available from our website at GW lacZ www invitrogen com or by contacting Technical Support page 56 attB1 lacZ attB2 V5epitope Lenti6 UbC 5 GWllacZ Comments for pLenti6 UbC V5 GW lacZ 10759 nucleotides 10759 bp RSV enhancer promoter bases 1 229 HIV
19. re titering your lentiviral stock prior to use e Number of freeze thaw cycles Viral titers can decrease as much as 10 with each freeze thaw cycle e Improper storage of your lentiviral stock Lentiviral stocks should be aliquotted and stored at 80 C see page 29 for recommended storage conditions Continued on next page Polybrene is a registered trademark of Abbott Laboratories Titering Your Lentiviral Stock Continued Selecting a Cell Line Note Antibiotic Selection Preparing Blasticidin You may titer your lentiviral stock using any mammalian cell line of choice Generally we recommend using the same mammalian cell line to titer your lentiviral stock as you will use to perform your expression studies However in some instances you may wish to use a different cell line to titer your lentivirus e g if you are performing expression studies in a non dividing cell line or a primary cell line In these cases we recommend that you choose a cell line with the following characteristics to titer your lentivirus e Grows as an adherent cell line e Easy to handle e Exhibits a doubling time in the range of 18 25 hours e Non migratory We generally use the HT1080 human fibrosarcoma cell line ATCC Catalog no CCL 121 for titering purposes Important You may use other cell lines including HeLa and NIH 3T3 to titer your lentivirus However note that the titer obtained when using HeLa cells or NIH 3T3 cells is a
20. resold for use in research Life Technologies Corporation will not assert a claim against the buyer of infringement of the above patents based upon the manufacture use or sale of a therapeutic clinical diagnostic vaccine or prophylactic product developed in research by the buyer in which this product or its components was employed provided that none of i this product ii any of its components or iii a method claim of the foregoing patents was used in the manufacture of such product Life Technologies Corporation will not assert a claim against the buyer of infringement of the above patents based upon the use of this product to manufacture a protein for sale provided that no method claim in the above patents was used in the manufacture of such protein If the purchaser is not willing to accept the limitations of this limited use statement Life Technologies is willing to accept return of the product with a full refund For information on purchasing a license to use this product for purposes other than those permitted above contact Licensing Department Life Technologies Corporation 5791 Van Allen Way Carlsbad California 92008 Phone 760 603 7200 For additional information about Invitrogen s policy for the use and distribution of Gateway clones see the section entitled Gateway Clone Distribution Policy page 61 Continued on next page Purchaser Notification Continued Limited Use Label License No 27 RNA Transfection
21. the product with a full refund For information about purchasing a license to use this product or the technology embedded in it for any use other than for research use please contact Out Licensing Life Technologies 5791 Van Allen Way Carlsbad California 92008 Phone 760 603 7200 or e mail outlicensing lifetech com Continued on next page 57 Purchaser Notification Continued Limited Use Label License No 19 Gateway Cloning Products Gateway Clone Distribution Policy 58 The purchase of this product conveys to the buyer the non transferable right to use the purchased amount of the product and components of the product in research conducted by the buyer whether the buyer is an academic or for profit entity The purchase of this product does not convey a license under any method claims in the foregoing patents or patent applications or to use this product with any recombination sites other than those purchased from Life Technologies Corporation or its authorized distributor The right to use methods claimed in the foregoing patents or patent applications with this product for research purposes only can only be acquired by the use of ClonaseTM purchased from Life Technologies Corporation or its authorized distributors The buyer cannot modify the recombination sequence s contained in this product for any purpose The buyer cannot sell or otherwise transfer a this product b its components or c materials made by the
22. transfect 293FT cells offers the following advantages e Provides the highest transfection efficiency in 293FT cells TM e DNA Lipofectamine 2000 complexes can be added directly to cells in culture medium in the presence of serum e Removal of complexes or medium change or addition following transfection is not required although complexes can be removed after 4 6 hours without loss of activity Note Lipofectamine 2000 is available separately from Invitrogen or as part of the ViraPower Lentiviral Support Kits see page viii for ordering information Opti MEM I To facilitate optimal formation of DNA Lipofectamine 2000 complexes we recommend using Opti MEM I Reduced Serum Medium available from Invitrogen see page viii for ordering information For more information about Opti MEM I visit our website at www invitrogen com or contact Technical Support page 56 Continued on next page 26 Producing Lentivirus in 293FT Cells Continued Recommended Transfection Conditions We produce lentiviral stocks in 293FT cells using the following optimized transfection conditions below The amount of lentivirus produced using these recommended conditions at a titer of 1 x 10 to 1 x 10 transducing units TU ml is generally sufficient to transduce 1 x 10 to 1 x 10 cells at a multiplicity of infection MOI 1 Condition Amount Tissue culture plate size 10 cm one per lentiviral construct Numb
23. 0 ul Did not perform the 1 hour grow out period before plating the transformation mixture After the heat shock step add S O C Medium and incubate the transformation mixture for 1 hour at 37 C with shaking before plating Continued on next page Troubleshooting Continued MultiSite Gateway LR Reaction continued Problem Cause Solution Different sized colonies i e large and small appear when using TOP10 or DH5a E coli for transformation Some transformants contain recombination has occurred between 5 and 3 LTRs plasmids in which unwanted e Select for transformants on LB plates containing both 100 pg ml ampicillin and 50 pg ml Blasticidin e Use the One Shot Stbl3 Chemi cally Competent E coli supplied with the kit for transformation Stbl3 E coli are recommended for cloning unstable DNA including lentiviral DNA containing direct repeats and generally give rise to fewer unwanted recombinants Few or no colonies obtained from the transformation control Competent cells stored incorrectly Store competent cells at 80 C After addition of DNA competent cells mixed by pipetting up and down After adding the DNA mix competent cells gently Do not mix by pipetting up and down Generating the Lentiviral Stock The table below lists some potential problems and possible solutions that may help you troubleshoot your cotransfectio
24. 00 pg ml ampicillin and 15 30 pg ml chloramphenicol e Due to the potential for rearrangement of lentiviral vectors caused by recombination between the 5 and 3 LTRs i e unwanted recombinants we recommend analyzing transformants to verify the integrity of the destination vector before proceeding e When propagating transformants culture bacteria in LB media Do not use richer bacterial medias as these media tend to give rise to a greater number of unwanted recombinants Continued on next page 15 Guidelines to Generate Expression Clones Continued Recombination Region of the Expression Clone 16 1701 1781 3570 3636 The recombination region of the expression clone resulting from attL4 promoter attR1 entry clone x attL1 gene attL2 entry clone x pLenti6 R4R2 V5 DEST is shown below Features of the Recombination Region e Shaded regions correspond to those DNA sequences transferred from the two entry clones into the pLenti6 R4R2 V5 DEST vector by recombination Note that the sequences comprising the aitB1 site are entirely supplied by the entry clones Non shaded regions are derived from the pLenti6 R4R2 V5 DEST vector e Bases 1829 and 3512 of the pLenti6 R4R2 V5 DEST sequence are marked CGAGGGGACC CGACAGGCCC GAAGGAATAG AAGAAGAAGG TGGAGAGAGA GACAGAGACA GATCCATTCG ATTAGTGAAC GGATCTCGAC GGTATCGATG TCGACGTTAA CGCTAGTGAT GEE CGG Pro CCA GGT Ala GCT CGA 3512 hel TTC AAG Leu T
25. 1987 An Analysis of 5 Noncoding Sequences from 699 Vertebrate Messenger RNAs Nucleic Acids Res 15 8125 8148 Continued on next page 61 References Continued Kozak M 1990 Downstream Secondary Structure Facilitates Recognition of Initiator Codons by Eukaryotic Ribosomes Proc Natl Acad Sci USA 87 8301 8305 Kozak M 1991 An Analysis of Vertebrate mRNA Sequences Intimations of Translational Control J Cell Biology 115 887 903 Landy A 1989 Dynamic Structural and Regulatory Aspects of Lambda Site specific Recombination Ann Rev Biochem 58 913 949 Lewis P F and Emerman M 1994 Passage Through Mitosis is Required for Oncoretroviruses but not for the Human Immunodeficiency Virus J Virol 68 510 516 Lois C Hong E J Pease S Brown E J and Baltimore D 2002 Germline Transmission and Tissue Specific Expression of Transgenes Delivered by Lentiviral Vectors Science 295 868 872 Luciw P A 1996 in Fields Virology Fields B N Knipe D M Howley P M Chanock R M Melnick J L Monath T P Roizman B and Straus S E eds 3 Ed pp 1881 1975 Lippincott Raven Publishers Philadelphia PA Malim M H Hauber J Le S Y Maizel J V and Cullen B R 1989 The HIV 1 Rev Trans activator Acts Through a Structured Target Sequence to Activate Nuclear Export of Unspliced Viral mRNA Nature 338 254 257 Miller J H 1972 Experiments in Molecular Genetics Cold
26. 30 Continued on next page Producing Lentivirus in 293FT Cells Continued Alternative An alternative transfection procedure is provided below to cotransfect 293FT Transfection cells Note that use of this procedure generally results in production of lentiviral Procedure stocks with a slightly lower titer than those produced when using the Recommended Transfection Procedure previous page 1 The day before transfection plate the 293FT cells in a 10 cm tissue culture plate such that they will be 90 95 confluent on the day of transfection i e 6 x 10 cells in 10 ml of growth medium containing serum 2 Onthe day of transfection remove the culture medium from the 293FT cells and replace with 5 ml of growth medium or Opti MEM I Medium containing serum Do not include antibiotics in the medium 3 Prepare DNA Lipofectamine 2000 complexes as instructed in the Recommended Transfection Procedure Step 1 previous page 4 Add the DNA Lipofectamine 2000 complexes drop wise to each plate of cells Mix gently by rocking the plate back and forth Incubate the cells overnight at 37 C in a CO incubator 5 Follow Steps 5 8 as instructed in the Recommended Transfection Procedure previous page If you plan to use your lentiviral construct for in vivo applications we Note recommend filtering your viral supernatant through a sterile 0 45 um low protein binding filter after the low speed centrifugation step see Step 7 pre
27. 62 Features of pLenti6 R4R2 V5 DEST Features of the The pLenti6 R4R2 V5 DEST vector 8069 bp contains the following elements Vector Features have been functionally tested and the vector fully sequenced Feature Benefit Rous Sarcoma Virus RSV Allows Tat independent production of viral mRNA Dull et al enhancer promoter 1998 HIV 1 truncated 5 LTR Permits viral packaging and reverse transcription of the viral mRNA Luciw 1996 5 splice donor and 3 acceptors Enhances the biosafety of the vector by facilitating removal of the packaging sequence and RRE such that expression of the gene of interest in the transduced host cell is no longer Rev dependent Dull et al 1998 HIV 1 psi y packaging signal Allows viral packaging Luciw 1996 HIV 1 Rev response element RRE Permits Rev dependent nuclear export of unspliced viral mRNA Kjems et al 1991 Malim et al 1989 attR4 and attR2 sites Bacteriophage A derived DNA recombination sequences that have been optimized to permit recombinational cloning of DNA fragments from multiple entry clones Landy 1989 Chloramphenicol resistance gene Cm Allows counterselection of the plasmid ccdB gene Permits negative selection of the plasmid V5 epitope Allows detection of the recombinant fusion protein by the Anti V5 Antibodies Southern et al 1991 SV40 early promoter and origin Allows high level e
28. Invitrogen ViraPower Promoterless Lentiviral Gateway Kits Using MultiSite Gateway Technology to clone a promoter and gene of interest into a lentiviral vector for expression in dividing and non dividing mammalian cells Catalog nos K591 10 and K5910 00 IMPORTANT This kit will be discontinued at the end of 2009 Revision date 31 October 2010 Manual part no 25 0743 MANDO000465 invitrogen Corporate Headquarters Invitrogen Corporation 5791 Van Allen Way Carlsbad CA 92008 T 1 760 603 7200 F 1 760 602 6500 E tech_support invitrogen com For country specific contact information visit our web site at www invitrogen com ViraPower Promoterless Lentiviral Gateway Kits Using MultiSite Gateway Technology to clone a promoter and gene of interest into a lentiviral vector for expression in dividing and non dividing mammalian cells Catalog nos K591 10 and K5910 00 Revision date 31 October 2010 Manual part no 25 0743 MANDO000465 Table of Contents Kit Contents and Storage i secanigemmetiuies deii a nm degrade a dp fala iv Accessory Products e et E e UHR HUE m eei I Het I eer i bere eie they viii Introduction Put 1 Ovetvie Wess cmd mtus em cse ett hoa booa mtt 1 The ViraPower Promoterless Lentiviral Gateway Expression System sss 4 The Multisite Gateway Technology guna aee ri bae pt erred tabo eS M elem ae b opta iid 6 Biosafety Features of the System
29. Spring Harbor Laboratory Cold Spring Harbor New York Miyoshi H Takahashi M Gage F H and Verma I M 1997 Stable and Efficient Gene Transfer into the Retina Using an HIV based Lentiviral Vector Proc Natl Acad Sci USA 94 10319 10323 Naldini L 1998 Lentiviruses as Gene Transfer Agents for Delivery to Non dividing Cells Curr Opin Biotechnol 9 457 463 Naldini L 1999 in The Development of Human Gene Therapy Friedmann T ed pp 47 60 Cold Spring Harbor Laboratory Press Cold Spring Harbor NY Naldini L Blomer U Gage F H Trono D and Verma I M 1996 Efficient Transfer Integration and Sustained Long Term Expression of the Transgene in Adult Rat Brains Injected with a Lentiviral Vector Proc Natl Acad Sci USA 93 11382 11388 Nelson J A Reynolds Kohler C and Smith B A 1987 Negative and Positive Regulation by a Short Segment in the 5 Flanking Region of the Human Cytomegalovirus Major Immediate Early Gene Molec Cell Biol 7 4125 4129 Park F and Kay M A 2001 Modified HIV 1 Based Lentiviral Vectors Have an Effect on Viral Transduction Efficiency and Gene Expression In Vitro and In Vivo Mol Ther 4 164 173 Peng K W Pham L Ye H Zufferey R Trono D Cosset F L and Russell S J 2001 Organ Distribution of Gene Expression After Intravenous Infusion of Targeted and Untargeted Lentiviral Vectors Gene Ther 8 1456 1463 Pfeifer A Brandon E P Kootst
30. TR 5 TOPO TA Cloning Kit and 293FT Cell Line manuals are supplied with Catalog no K5910 00 All manuals are available for downloading from www invitrogen com or by contacting Technical Support see page 56 Continued on next page Overview Continued Important Note TM The ViraPower Promoterless Lentiviral Expression System is designed to help you create a lentivirus to deliver and express a gene of interest from a promoter of choice in mammalian cells Although the system has been designed to help you express your recombinant protein of interest in the simplest most direct fashion use of the system is geared towards those users who are familiar with the principles of retrovirus biology and retroviral vectors In addition we highly recommend that users possess a working knowledge of e Viral and tissue culture techniques e Gateway Technology and site specific recombination For more information about these topics refer to the following published reviews e Retrovirus biology and the retroviral replication cycle see Buchschacher and Wong Staal 2000 and Luciw 1996 e Retroviral and lentiviral vectors see Naldini 1999 Naldini 1998 and Yee 1999 e Gateway Technology and site specific recombination see Hartley et al 2000 and Landy 1989 The One Shot StbI3 Chemically Competent E coli LR Clonase II Plus Enzyme Mix and Lipofectamine 2000 Reagent included in the ViraPower Promoterl
31. afety features e The pLenti6 RAR2 V5 DEST vector contains a deletion in the 3 LTR AU3 that does not affect generation of the viral genome in the producer cell line but results in self inactivation of the lentivirus after transduction of the target cell Yee et al 1987 Yu et al 1986 Zufferey et al 1998 Once integrated into the transduced target cell the lentiviral genome is no longer capable of producing packageable viral genome e The number of genes from HIV 1 that are used in the system has been reduced to three i e gag pol and rev e The VSV G gene from Vesicular Stomatitis Virus is used in place of the HIV 1envelope Burns et al 1993 Emi et al 1991 Yee et al 1994 e Genes encoding the structural and other components required for packaging the viral genome are separated onto four plasmids i e three packaging plasmids and pLenti6 R4R2 V5 DEST All four plasmids have been engineered not to contain any regions of homology with each other to prevent undesirable recombination events that could lead to the generation of a replication competent virus Dull et al 1998 e Although the three packaging plasmids allow expression in trans of proteins required to produce viral progeny e g gal pol rev env in the 293FT producer cell line none of them contain LTRs or the packaging sequence This means that none of the HIV 1 structural genes are actually present in the packaged viral genome and thus are
32. are sufficient to kill most untransduced mammalian cell lines We recommend that you test a range of concentrations see protocol below to ensure that you determine the minimum concentration necessary for your cell line 1 Plate cells at approximately 25 confluence Prepare a set of 6 7 plates Allow cells to adhere overnight 2 The next day substitute culture medium with medium containing varying concentrations of Blasticidin 3 Replenish the selective media every 3 4 days and observe the percentage of surviving cells 4 Determine the appropriate concentration of Blasticidin that kills the cells within 10 14 days after addition of antibiotic Transduction of lentivirus into mammalian cells may be enhanced if cells are transduced in the presence of hexadimethrine bromide Polybrene For best results we recommend performing transduction in the presence of Polybrene Note however that some cells are sensitive to Polybrene e g primary neurons Before performing any transduction experiments you may want to test your cell line for sensitivity to Polybrene If your cells are sensitive to Polybrene e g exhibit toxicity or phenotypic changes do not add Polybrene during transduction In this case cells should still be successfully transduced Follow the instructions below to prepare Polybrene Sigma Catalog no H9268 1 Prepare a 6 mg ml stock solution in deionized sterile water 2 Filter sterilize and dispens
33. clone Clone Pasy 5 LTR 7 ori AU3 3 LTR Continued on next page The MultiSite Gateway Technology Continued att Sites Important LR Clonase II Plus Enzyme Mix Note In the Gateway Technology recombinational cloning is mediated via optimized att sites To accommodate simultaneous recombinational cloning of multiple DNA fragments in the MultiSite Gateway Technology these att sites have been further modified and optimized Modifications include alterations to both the sequence and length of the att sites resulting in the creation of new att sites exhibiting enhanced specificities and the improved efficiency required to permit cloning of multiple DNA fragments in a single reaction In the ViraPower Promoterless Lentiviral Gateway Expression System the entry and destination vectors contain the following att sites see the figure on the previous page e pENTR 5 TOPO containing your promoter of interest attL4 and attR1 e Entry vector containing your gene of interest attL1 and attL2 e pLenti6 R4R2 V5 DEST lentiviral destination vector attR4 and attR2 To facilitate proper generation of a lentiviral expression construct only this combination of entry clones and destination vector may be used in the MultiSite Gateway LR recombination reaction Note that the att sites used in MultiSite Gateway adapted vectors have been optimized to improve specificity and efficiency of
34. commend using the lentiviral stock to help you determine the optimal MOI for your particular cell line and application Once you have transduced the control lentivirus into your mammalian cell line of choice B galactosidase will be constitutively expressed and can be easily assayed see page 39 Remember that viral supernatants are generated by harvesting spent media containing virus from the 293FT producer cells Spent media lacks nutrients and may contain some toxic waste products If you are using a large volume of viral supernatant to transduce your mammalian cell line e g 1 ml of viral supernatant per well in a 6 well plate note that growth characteristics or morphology of the cells may be affected during transduction These effects are generally alleviated after transduction when the media is replaced with fresh complete media It is possible to concentrate VSV G pseudotyped lentiviruses using a variety of methods without significantly affecting their transducibility If the titer of your lentiviral stock is relatively low less than 5 x 10 TU ml and your experiment requires that you use a large volume of viral supernatant e g a relatively high MOI you may wish to concentrate your virus before proceeding to transduction For details and guidelines to concentrate your virus refer to published reference sources Yee 1999 You will need the following items e Your titered lentiviral stock store at 80 C until use e
35. d 48 72 hours posttransfection If many cells are still attached to the plate and look healthy at this point wait an additional 24 hours before harvesting the viral supernatant Viral supernatant too dilute Concentrate virus using any method of choice Yee 1999 Viral supernatant frozen and thawed multiple times Do not freeze thaw viral supernatant more than 3 times Poor choice of titering cell line Use HT1080 cells or another adherent cell line with the characteristics discussed on page 31 The size of the insert promoter gene is large Viral titers generally decrease as the size of the insert increases inserts larger than 4 5 5 kb are not recommended Gene of interest is toxic to cells Do not generate constructs containing activa ted oncogenes or potentially harmful genes Polybrene not included during transduction Transduce mammalian cells with the lentiviral construct in the presence of Polybrene Lipofectamine 2000 handled incorrectly e Store at 4 C Do not freeze e Mix gently by inversion before use Do not vortex No colonies obtained upon titering Too much Blasticidin used for selection Determine the Blasticidin sensitivity of your cell line by performing a kill curve experiment Use the minimum Blasticidin concentration required to kill your untransduced cell line Viral stocks stored incorrectly Aliquot and store stocks at 80 C Do not free
36. deed 50 Beatures ot pEPT Ter ea na muet Nei itetaefun tette peti enu 51 Map On E PM AT 52 Features OE pED2 seno e S eet ege n t ata reta i e ee e e rec ie e ode nt 53 Map okpLP VSVG e Gigs E o e d e M o I e ERR RN R ch dias T 54 Features Of PIP A VOV creer eic tee tert rreteseo tet btetet ss t Der teet etur e LIP Hte dre I rS 55 Technical Support sonet a adeo desea eta ER a im ee fu ei i ate e ie IR 56 Purchaser NotificatiOn s eere ete edere fee ettet deir tee feres ine rte f ees 57 Gateway Clone Distribution Policy sessie diee tea Nein os aide in aden ane cu As urea ec ae duod 61 Kefer rnces cete ese Sres enta ime m a e ERR RT IH d dae 62 iii Kit Contents and Storage Types of Kits Kit Components This manual is supplied with the following products Product Catalog no TM MultiSite Gateway Technology ViraPower Promoterless Lentiviral Gateway 9 Vector Kit with K591 10 with MultiSite Gateway Technology ViraPower Promoterless Lentiviral Gateway Expression Kit K5910 00 The ViraPower Promoterless Lentiviral Gateway Kits include the following components For a detailed description of the contents of each component see pages v vii For a detailed description of the contents of the pENTR 5 TOPO TA Cloning Kit and how to use the reagents supplied see the pENTR 5 TOPO TA Cloning Kit manual Component pENTR 5 TOPO TA Cloning
37. e 1 ml aliquots into sterile microcentrifuge tubes 3 Store at 20 C for long term storage Stock solutions may be stored at 20 C for up to 1 year Do not freeze thaw the stock solution more than 3 times as this may result in loss of activity Note The working stock may be stored at 4 C for up to 2 weeks Continued on next page Titering Your Lentiviral Stock Continued Materials Needed You will need the following items Your pLenti6 R4R2 V5 DEST lentiviral stock store at 80 C until use Your pLenti6 UbC V5 GW lacZ lentiviral stock store at 80 C until use Adherent mammalian cell line of choice Complete culture medium for your cell line 6 mg ml Polybrene if desired 6 well tissue culture plates Blasticidin 10 mg ml stock for selection Crystal violet Sigma Catalog no C3886 prepare a 1 crystal violet solution in 10 ethanol Phosphate Buffered Saline PBS Remember that you will be working with media containing infectious virus Follow the recommended Federal and institutional guidelines for working with BL 2 organisms Perform all manipulations within a certified biosafety cabinet Treat media containing virus with bleach Treat used pipets pipette tips and other tissue culture supplies with bleach and dispose of as biohazardous waste Wear gloves a laboratory coat and safety glasses or goggles when handling viral stocks and media containing virus Continued on next page 33 Tit
38. e MultiSite Gateway LR recombination reaction You may use any method of choice to isolate plasmid DNA We recommend using Invitrogen s PureLink HiPure Plasmid Midiprep Kit page viii DNA preparations are not recommended for MultiSite Gateway cloning reactions DNA cannot be quantitated by UV absorbance due to contaminating RNA and nucleotides estimate concentration by gel electrophoresis e g DNA Mass Ladder Cat no 10068 013 or 10496 016 Resuspend the purified plasmid DNA in sterile water or TE Buffer pH 8 0 to a final concentration of 150 ng ul The pLenti6 R4R2 V5 DEST destination vector is supplied as 6 ug of supercoiled plasmid in 40 ul of 150 ng ul vector in 10 mM Tris HCL 1mM EDTA pH 8 0 If you wish to propagate and maintain the pLenti6 RAR2 V5 DEST vector we recommend using 10 ng of the vector to transform One Shot ccdB Survival 2 T1 Chemically Competent Cells Catalog no A10460 from Invitrogen The ccdB Survival 2 T1 E coli strain is resistant to ccdB effects and can support the propagation of plasmids containing the ccdB gene TM TM Note Do not use general E coli cloning strains including Stbl3 TOP10 or DH5a for propagation and maintenance as these strains are sensitive to CcdB effects TM Follow the guidelines below when using DB3 1 E coli to propagate the pLenti6 RAR2 V5 DEST plasmid e To maintain integrity of the vector select for transformants in media containing 50 1
39. eb Resources Visit the Invitrogen website at www invitrogen com for e Technical resources including manuals vector maps and sequences application notes MSDSs FAQs formulations citations handbooks etc e Complete technical support contact information e Access to the Invitrogen Online Catalog e Additional product information and special offers Contact Us For more information or technical assistance call write fax or email Additional international offices are listed on our website www invitrogen com Corporate Headquarters Japanese Headquarters European Headquarters 5791 Van Allen Way ILOOP X Bldg 6F Inchinnan Business Park Carlsbad CA 92008 USA 3 9 15 Kaigan 3 Fountain Drive Tel 1 760 603 7200 Minato ku Tokyo 108 0022 Paisley PA4 9RF UK Tel Toll Free 1 800 955 6288 Tel 81 3 5730 6509 Tel 44 0 141 814 6100 Fax 1 760 602 6500 Fax 81 3 5730 6519 Tech Fax 44 0 141 814 6117 E mail tech_support invitrogen com E mail E mail eurotech invitrogen com MSDS Certificate of Analysis Limited Warranty 56 jpinfo invitrogen com Material Safety Data Sheets MSDSs are available at www invitrogen com msds The Certificate of Analysis CofA provides detailed quality control information for each product The CofA is available at www invitrogen com support and is searchable by product lot number which is printed on each box Invitrogen a part of Life Technologies Co
40. ecursor in Transfected CHO Cells FEBS Lett 261 101 105 Yamaguchi H Yamamoto C and Tanaka N 1965 Inhibition of Protein Synthesis by Blasticidin S I Studies with Cell free Systems from Bacterial and Mammalian Cells J Biochem Tokyo 57 667 677 Yee J K Miyanohara A LaPorte P Bouic K Burns J C and Friedmann T 1994 A General Method for the Generation of High Titer Pantropic Retroviral Vectors Highly Efficient Infection of Primary Hepatocytes Proc Natl Acad Sci USA 91 9564 9568 Yee J K 1999 in The Development of Human Gene Therapy Friedmann T ed pp 21 45 Cold Spring Harbor Laboratory Press Cold Spring Harbor NY Yee J K Moores J C Jolly D J Wolff J A Respess J G and Friedmann T 1987 Gene Expression from Transcriptionally Disabled Retroviral Vectors Proc Natl Acad Sci USA 84 5197 5201 Yu S F Ruden T v Kantoff P W Garber C Seiberg M Ruther U Anderson W F Wagner E F and Gilboa E 1986 Self Inactivating Retroviral Vectors Designed for Transfer of Whole Genes into Mammalian Cells Proc Natl Acad Sci USA 83 3194 3198 Zufferey R Dull T Mandel R J Bukovsky A Quiroz D Naldini L and Trono D 1998 Self inactivating lentivirus vector for safe and efficient in vivo gene delivery J Virol 72 9873 9880 2009 2010 Life Technologies Corporation All rights reserved For research use only Not intended for any animal
41. ed with kit e One Shot Stbl3 Chemically Competent E coli one vial per transformation thaw on ice immediately before use e OC Medium room temperature e pUC19 positive control if desired to verify the transformation efficiency Use this procedure to transform the MultiSite Gateway LR recombination reaction into One Shot Stbl3 Chemically Competent E coli TM 1 Thaw on ice one vial of One Shot Stbl3 chemically competent cells for each transformation 2 Add 2 pl of the MultiSite Gateway LR recombination reaction from Step 7 previous page into a vial of One Shot Stbl3 cells and mix gently Do not mix by pipetting up and down For the pUC19 control add 10 pg 1 ul of DNA into a separate vial of One Shot cells and mix gently Incubate the vial s on ice for 30 minutes Heat shock the cells for 45 seconds at 42 C without shaking Remove the vial s from the 42 C water bath and place on ice for 2 minutes Add 250 ul of pre warmed S O C Medium to each vial Cap the vial s tightly and shake horizontally at 37 C for 1 hour at 225 rpm in a shaking incubator Shy GT Rs v9 8 Spread 25 100 ul of the transformation mix on a pre warmed selective plate and incubate overnight at 37 C We recommend plating two different volumes to ensure that at least one plate will have well spaced colonies For the pUC19 control dilute the transformation mix 1 10 into LB Medium e g add 100 ul of the transformation
42. eneticin For more information about pCMVSPORT6TAg neo and how to culture and maintain 293FT cells refer to the 293FT Cell Line manual This manual is supplied with the ViraPower Promoterless Lentiviral Gateway Expression System and is also available for downloading from our website at www invitrogen com or by contacting Technical Support page 56 Note The 293FT Cell Line is available separately from Invitrogen see page ix The health of your 293FT cells at the time of transfection has a critical effect on Important the success of lentivirus production Use of unhealthy cells can negatively affect the transfection efficiency resulting in production of a low titer lentiviral stock For optimal lentivirus production i e producing lentiviral stocks with the expected titers follow the guidelines below to culture 293FT cells before use in transfection e Make sure that cells are healthy and greater than 90 viable e Subculture and maintain cells as recommended in the 293FT Cell Line manual Do not allow cells to overgrow before passaging e Use cells that have been subcultured for less than 20 passages TM Lipofectamine The Lipofectamine 2000 Reagent supplied with the ViraPower Promoterless 2000 Lentiviral Gateway Expression System Ciccarone eft al 1999 is a proprietary cationic lipid based formulation suitable for the transfection of nucleic acids into eukaryotic cells Using Lipofectamine 2000 to
43. er e Upon thawing use what you need and store the thawed stock solution at 4 C for up to 2 weeks e Medium containing Blasticidin may be stored at 4 C for up to 2 weeks 45 Map of pLenti6 R4R2 V5 DEST Map of pLenti6 R4R2 V5 DEST 46 The map below shows the elements of pLenti6 R4R2 V5 DEST DNA from the entry clones replaces the region between bases 1829 and 3512 The complete sequence for pLenti6 R4R2 V5 DEST is available from our website at www invitrogen com or by contacting Technical Support page 56 attR4 Cm ccdB attR2 V5 epitope 5 pLenti6 RAR2 V5 DEST Comments for pLenti6 R4R2 V5 DEST 8069 nucleotides RSV 5 LTR hybrid promoter bases 1 410 RSV promoter bases 1 229 HIV 1 5 LTR bases 230 410 5 splice donor base 520 HIV 1 psi y packaging signal bases 521 565 HIV 1 Rev response element RRE bases 1075 1308 3 splice acceptor base 1656 3 splice acceptor base 1684 attR4 site bases 1823 1947 Chloramphenicol resistance gene Cm bases 2055 2714 ccdB gene bases 3056 3361 attR2 site bases 3402 3526 V5 epitope bases 3579 3620 SV40 early promoter and origin bases 3675 3983 EM7 promoter bases 4038 4104 Blasticidin resistance gene bases 4105 4503 AU3 3 LTR bases 4589 4823 AUS bases 4589 4642 3 LTR bases 4643 4823 SV40 polyadenylation signal bases 4895 5029 bla promoter bases 5885 5983 Ampicillin bla resistance gene bases 5984 6844 pUC origin bases 6989 76
44. er of 293FT cells to transfect 6 x 10 cells see Important Note on page 26 to prepare cells for transfection TM Amount of ViraPower Packaging Mix 9 pg 9 ul of 1 ug ul stock to use Amount of pLenti based expression 3 ug plasmid to use Amount of Lipofectamine 2000 to use 36 ul Note You may produce lentiviral stocks using other tissue culture formats but optimization will be necessary to obtain the expected titers The recommended procedure to cotransfect 293FT cells differs from the traditional Lipofectamine 2000 transfection procedure in that you will 1 First prepare DNA Lipofectamine 2000 complexes and add them to plates containing growth media then 2 Add the 293FT cells to the media containing DNA Lipofectamine 2000 complexes and allow the cells to attach and transfect overnight see detailed procedure on the next page Using this procedure we consistently obtain lentiviral stocks with titers that are 3 to 4 fold higher than lentiviral stocks generated using the traditional Lipofectamine 2000 transfection procedure i e plating cells first followed by transfection with DNA Lipofectamine 2000 complexes You may use the traditional Lipofectamine 2000 transfection procedure if desired but keep in mind that lower viral titers may be obtained see Alternative Transfection Procedure page 29 Continued on next page 27 Producing Lentivirus in 293FT Cells Conti
45. erform the MultiSite Gateway LR recombination reaction using the appropriate entry clones and the pLenti6 RAR2 V5 DEST vector We recommend including a negative control no LR Clonase II Plus in your experiment to help you evaluate your results For optimal efficiency we recommend using the following amounts of plasmid DNA i e entry clones and destination vector in a 10 ul MultiSite Gateway LR recombination reaction e Anequimolar amount of each plasmid e 10 fmoles of each entry clone and 20 fmoles of pLenti6 R4R2 V5 DEST is recommended For a formula to convert fmoles of DNA to nanograms ng and an example see below Use the following formula to convert femtomoles fmoles of DNA to nanograms ng of DNA 660 fg X 1 ng fmoles 10 fg where x is the number of fmoles and N is the size of the DNA in bp For an example see below ng x fmoles N In this example you need to use 50 fmoles of an attB PCR product in the BP reaction The attB PCR product is 2 5 kb in size Calculate the amount of attB PCR product required for the reaction in ng by using the equation above 660 fg X Ing fmoles 10 fg 50 fmoles 2500 bp 82 5 ng of PCR product required 17 Performing the MultiSite Gateway LR Recombination Reaction Continued Recommended E coliHost Note Important Positive Control Entry Clone 18 For optimal results we recommend using Stb13 E coli for tran
46. ering Your Lentiviral Stock Continued Transduction and Titering Procedure 34 Follow the procedure below to determine the titer of your lentiviral stock using the mammalian cell line of choice You will use at least one 6 well plate for every lentiviral stock to be titered one mock well plus five dilutions 1 10 11 The day before transduction Day 1 trypsinize and count the cells plating them in a 6 well plate such that they will be 30 50 confluent at the time of transduction Incubate cells at 37 C overnight Example When using HT1080 cells we usually plate 2 x 10 cells per well in a 6 well plate On the day of transduction Day 2 thaw your lentiviral stock and prepare 10 fold serial dilutions ranging from 10 to 10 For each dilution dilute the lentiviral stock into complete culture medium to a final volume of 1 ml DO NOT vortex Note You may prepare a wider range of serial dilutions 10 to 10 if desired Remove the culture medium from the cells Mix each dilution gently by inversion and add to one well of cells total volume 1 ml Add Polybrene if desired to each well to a final concentration of 6 pg ml Swirl the plate gently to mix Incubate at 37 C overnight The following day Day 3 remove the medium containing virus and replace with 2 ml of complete culture medium The following day Day 4 remove the medium and replace with complete culture medium containing the appropriate amoun
47. ess Lentiviral Gateway Expression System are available separately from Invitrogen and are each supplied with individual documentation detailing general use of the product For instructions to use these products specifically with the ViraPower Promoterless Lentiviral Gateway Expression System follow the recommended protocols in this manual The ViraPower Promoterless Lentiviral Gateway Expression System Components of the ViraPower Promoterless Lentiviral Gateway Expression System How Lentivirus Works TM The ViraPower Promoterless Lentiviral Gateway Expression System facilitates highly efficient lentiviral based in vitro or in vivo expression of a gene of interest under the control of a promoter of choice in dividing and non dividing mammalian cells The kit includes the following major components e The pENTR 5 TOPO TA Cloning Kit containing the pENTR 5 TOPO vector for production of an entry clone containing the promoter of interest The vector is TOPO adapted and MultiSite Gateway adapted to allow TOPO Cloning of a Taq polymerase amplified PCR product encoding the promoter of interest and easy transfer of the promoter sequence into the pLenti6 R4R2 V5 DEST vector respectively For more information about the MultiSite Gateway Technology see page 6 For detailed information about the pENTR 5 TOPO vector and instructions to generate an entry clone refer to the pENTR 5 TOPO TA Cloning Kit manual
48. ge viii e Sterile 10 cm tissue culture plates one each for the lentiviral construct positive control and negative control e Sterile tissue culture supplies e 15 ml sterile capped conical tubes e Cryovials ViraPower The ViraPower Packaging Mix facilitates viral packaging of pLenti based Packaging Mix expression constructs following cotransfection into 293FT producer cells and contains an optimized mixture of the pLP1 pLP2 pLP VSVG plasmids The amount of the Packaging Mix 195 ug and Lipofectamine 2000 transfection reagent 0 75 ml supplied in the ViraPower Promoterless Lentiviral Gateway Expression System is sufficient to perform 20 cotransfections in 10 cm plates using the recommended protocol on page 28 For more information about the pLP1 pLP2 and pLP VSVG plasmids see the Appendix pages 50 55 Note ViraPower Packaging Mix is available separately from Invitrogen page viii or as part of the ViraPower Lentiviral Support Kits page viii Continued on next page 25 Producing Lentivirus in 293FT Cells Continued 293FT Cell Line The human 293FT Cell Line is supplied with the ViraPower Promoterless Lentiviral Gateway Expression System to facilitate optimal lentivirus production Naldini et al 1996 The 293FT Cell Line a derivative of the 293F Cell Line stably and constitutively expresses the SV40 large T antigen from pCMVSPORT6TAg neo and must be maintained in medium containing G
49. ice 2 seconds each time TM 4 Add2 lof LR Clonase II Plus enzyme mix to the sample and positive TM 20 control vials Do not add LR Clonase to the negative control vial Mix well by pipetting up and down Reminder Return LR Clonase II Plus enzyme mix to 80 C immediately after use Incubate the reaction at room temperature 20 25 C from 16 24 hours Add 1 pl of the Proteinase K solution to each reaction Incubate for 10 minutes at 37 C Proceed to Transforming One Shot Stb13 Competent E coli next page Note You may store the MultiSite Gateway LR reaction at 20 C for up to 1 week before transformation if desired Transforming One Shot StbI3 Competent E coli Introduction Materials Needed One Shot StbI3 Transformation Procedure Follow the instructions in this section to transform the MultiSite Gateway LR recombination reaction into One Shot Stbl3 Chemically Competent E coli included with the kit The transformation efficiency of One Shot StbI3 Chemically Competent E coli is 21 x 10 cfu ug plasmid DNA You will need the following items e MultiSite Gateway LR recombination reaction from Step 7 previous page e LB Medium if performing the pUC19 control transformation e LB plates containing 100 pg ml ampicillin two for each transformation warm at 37 C for 30 minutes before use e 42 C water bath e 37 C shaking and non shaking incubator Materials suppli
50. in Sustained Gene Expression and Protection from Insulitis Human Gene Therapy 9 2717 2726 Gorman C M Merlino G T Willingham M C Pastan I and Howard B H 1982 The Rous Sarcoma Virus Long Terminal Repeat is a Strong Promoter When Introduced into a Variety of Eukaryotic Cells by DNA mediated Transfection Proc Natl Acad Sci USA 79 6777 6781 Hartley J L Temple G F and Brasch M A 2000 DNA Cloning Using in vitro Site Specific Recombination Genome Research 10 1788 1795 Hershko A and Ciechanover A 1982 Mechanisms of Intracellular Protein Breakdown Ann Rev Biochem 51 335 364 Izumi M Miyazawa H Kamakura T Yamaguchi L Endo T and Hanaoka F 1991 Blasticidin S Resistance Gene bsr A Novel Selectable Marker for Mammalian Cells Exp Cell Res 197 229 233 Kafri T Blomer U Peterson D A Gage F H and Verma I M 1997 Sustained Expression of Genes Delivered Directly into Liver and Muscle by Lentiviral Vectors Nature Genetics 17 314 317 Kimura M Takatsuki A and Yamaguchi I 1994 Blasticidin 5 Deaminase Gene from Aspergillus terreus BSD A New Drug Resistance Gene for Transfection of Mammalian Cells Biochim Biophys ACTA 1219 653 659 Kjems J Brown M Chang D D and Sharp P A 1991 Structural Analysis of the Interaction Between the Human Immunodeficiency Virus Rev Protein and the Rev Response Element Proc Natl Acad Sci USA 88 683 687 Kozak M
51. ination vector To generate your lentiviral expression clone you will 1 TOPO Clone the promoter of choice into the pPENTR 5 TOPO vector containing attL4 and attR1 recombination sites to create a PENTR 5 promoter entry clone The pENTR 5 TOPO vector and manual are included in this kit 2 Clone the gene of interest into any standard Gateway entry vector containing attL1 and attL2 recombination sites to create a pENTR gene entry clone For information about the Gateway entry vectors available see page 12 3 Usethe two entry clones in a single MultiSite Gateway LR recombination reaction with the pLenti6 R4R2 V5 DEST vector containing att R4 and attR2 recombination sites to create your expression clone of interest see the diagram below For more information about pLenti6 RAR2 V5 DEST see pages 5 and 46 47 For more information about the Gateway Technology refer to the Gateway Technology manual available from www invitrogen com or by contacting Technical Support see page 56 ori 4 kan ori m kan pENTR 5 promoter pENTR gene aftLA promoter atfR1 att gene a Entry Clones atfRA CB Cm aR Destination pLenti RAR2 V5 DEST Vector o amp AU3 3 LTR AUSS LTR haue LR Clonase II Plus promoter gene Expression Your expression
52. ing 30 ug ml chloramphenicol A true expression clone should not grow in the presence of chloramphenicol Sequencing the expression construct is not required as transfer of the promoter and gene of interest from the entry vectors into the pLenti6 R4R2 V5 DEST vector preserves the orientation and reading frame However if you wish to confirm that your gene of interest is in frame with the C terminal tag in pLenti6 RAR2 V5 DEST you may sequence your expression construct We recommend using the following primer for sequencing Refer to the diagram on page 16 for the location of the primer binding site in the vector Note For your convenience Invitrogen has a custom primer synthesis service For more information visit our website at www invitrogen com or contact Technical Support see page 56 Primer Sequence V5 C term reverse primer 5 ACCGAGGAGAGGGTTAGGGAT 3 Once you have generated your expression clone maintain and propagate the plasmid in LB medium containing 100 ug ml ampicillin Addition of Blasticidin is not required Continued on next page Transforming One Shot StbI3 Competent E coli Continued Verifying Expression of Recombinant Protein Optional Before proceeding to generate a lentiviral stock of your pLenti6 R4R2 V5 DEST expression construct you may verify that the construct expresses the gene of interest by transfecting the plasmid directly into mammalian cells and assaying for
53. ing from our website at www invitrogen com or by contacting Technical Support page 56 Comments for pLP VSVG 5821 nucleotides CMV promoter bases 1 747 TATA box bases 648 651 Human f globin intron bases 880 1320 VSV G glycoprotein VSV G bases 1346 2881 Human f globin polyadenylation signal bases 3004 3769 pUC origin bases 3927 4600 C Ampicillin b a resistance gene bases 4745 5605 C bla promoter bases 5606 5704 C C complementary strand Features of pLP VSVG Features of pLP VSVG pLP VSVG 5821 bp contains the following elements Features have been functionally tested Feature Benefit Human CMV promoter Permits high level expression of the VSV G gene in mammalian cells Andersson et al 1989 Boshart et al 1985 Nelson et al 1987 Human f globin intron Enhances expression of the VSV G gene in mammalian cells VSV G glycoprotein VSV G Encodes the envelope G glycoprotein from Vesicular Stomatitis Virus to allow production of a pseudotyped retrovirus with a broad host range Burns et al 1993 Emi et al 1991 Yee et al 1994 Human f globin polyadenylation signal Allows efficient transcription termination and polyadenylation of mRNA pUC origin of replication ori Permits high copy replication and maintenance in E coli Ampicillin bla resistance gene Allows selection of the plasmid in E coli 55 Technical Support W
54. ion supplied with the LR Clonase II Plus enzyme mix thaw and keep on ice until use Sterile 0 5 ml microcentrifuge tubes TM You must use LR Clonase II Plus enzyme mix for this application Do not use TM TM Important standard LR Clonase or LR Clonase IT enzyme mix LR Clonase II Plus enzyme mix is supplied with Catalog no K5910 00 but is also available separately from Invitrogen See page viii for ordering information Continued on next page 19 Performing the MultiSite Gateway LR Recombination Reaction Continued Setting Up the MultiSite Gateway LR Recombination omit the LR Clonase II Plus enzyme mix Reaction 1 temperature and mix Follow this procedure to perform the MultiSite Gateway LR recombination reaction between your entry clones and the pLenti6 R4R2 V5 DEST vector If you want to include a negative control set up a separate reaction in which you Add the following components to 0 5 ml microcentrifuge tubes at room Component Sample Negative Positive Control Control pENTR 5 promoter entry clone 10 fmol 1 7 ul 1 7 ul pENTR gene entry clone 10 fmol 1 6 ul pENTR 5 UbCp 10 fmol 1 yl pLenti6 R4R2 V5 DEST 20 fmol 1gl 1nl 1nl TE Buffer pH 8 0 to 8 ul to 8 ul to 8 ul 2 Remove the LR Clonase II Plus enzyme mix from 80 C and thaw on ice 2 minutes TM 3 Vortex the LR Clonase II Plus enzyme mix briefly tw
55. iral construct into cells in the presence of Polybrene e Transduce your lentiviral construct into cells using a higher MOI MOI too low Transduce your lentiviral construct into cells using a higher MOI Too much Blasticidin used for selection Determine the Blasticidin sensitivity of your cell line by performing a kill curve Use the minimum Blasticidin concentration required to kill your untransduced cell line Cells harvested too soon after transduction Do not harvest cells until at least 48 72 hours after transduction to allow expressed protein to accumulate in transduced cells Gene of interest is toxic to cells Generating constructs containing activated oncogenes or potentially harmful genes is not recommended Cytotoxic effects Observed after transduction Large volume of viral super natant used for transduction e Remove the spent medium containing virus and replace with fresh complete medium e Concentrate the virus Yee 1999 Polybrene used during transduction Verify the sensitivity of your cells to Polybrene If cells are sensitive omit the Polybrene during transduction Too much Blasticidin used for selection Determine the Blasticidin sensitivity of your cell line by performing a kill curve Use the minimum concentration of Blasticidin required to kill your untransduced cell line Gene of interest is toxic to cells Transduce cells at a lower
56. its protein synthesis in both prokaryotic and eukaryotic cells Takeuchi et al 1958 Yamaguchi et al 1965 Resistance is conferred by expression of either one of two Blasticidin S deaminase genes bsd from Aspergillus terreus Kimura et al 1994 or bsr from Bacillus cereus Izumi et al 1991 These deaminases convert Blasticidin S to a non toxic deaminohydroxy derivative Izumi et al 1991 The formula for Blasticidin S is Ci7H2sNgOs HCL and the molecular weight is 458 9 The diagram below shows the structure of Blasticidin NH2 Sn p HOOC o CH3 e Y rr NH O Always wear gloves mask goggles and protective clothing e g a laboratory coat when handling Blasticidin Weigh out Blasticidin and prepare solutions in a hood Blasticidin may be obtained separately from Invitrogen in 50 mg aliquots Blasticidin is soluble in water Sterile water is generally used to prepare stock solutions of 5 10 mg ml e Dissolve Blasticidin in sterile water and filter sterilize the solution e Aliquot in small volumes suitable for one time use see next to last point below and freeze at 20 C for long term storage or store at 4 C for short term storage e Aqueous stock solutions are stable for 1 2 weeks at 4 C and 6 8 weeks at 20 C e pHofthe aqueous solution should be 7 0 to prevent inactivation of Blasticidin e Do not subject stock solutions to freeze thaw cycles do not store in a frost free freez
57. lates containing 100 pg ml ampicillin Recombination reaction was not treated with proteinase K Treat reactions with proteinase K before transformation Used incorrect att sites for the reaction Use the appropriate entry clones i e attL4 and attR1 flanked entry clone and attL1 and attL2 flanked entry clone and pLenti6 R4R2 V5 DEST for the MultiSite Gateway LR reaction see page 11 for details about suitable entry vectors to use to generate entry clones TM LR Clonase II Plus enzyme mix is inactive or didn t use suggested amount of LR TM Clonase II Plus enzyme mix e Store the LR Clonase II Plus enzyme mix at 80 C for long term storage gt 6 months e Donot freeze thaw the LR Clonase II Plus enzyme mix more than 10 times e Use the recommended amount of LR Clonase II Plus enzyme mix see page 20 Used LR Clonase enzyme mix Use the LR Clonase II Plus enzyme mix for the MultiSite Gateway LR reaction Do not use other LR Clonase enzyme mixes Too much DNA was used ina MultiSite Gateway LR reaction Use an equimolar amount of each entry clone and destination vector Do not exceed 1 ug of total DNA in the reaction MultiSite Gateway LR reaction not incubated for sufficient time Incubate the MultiSite Gateway LR reaction at 25 C for 16 24 hours Insufficient amount of E coli transformed or plated Transform 2 ul of the reaction plate 50 ul or 10
58. lentiviral stock s While this procedure is not required for some applications it is necessary if e You wish to control the number of integrated copies of the lentivirus e You wish to generate reproducible expression results Guidelines and protocols are provided in this section to titer your lentiviral stocks To determine the titer of a lentiviral stock you will 1 Prepare 10 fold serial dilutions of your lentiviral stock 2 Transduce the different dilutions of lentivirus into the mammalian cell line of choice in the presence of Polybrene 3 Select for stably transduced cells using Blasticidin Stain and count the number of Blasticidin resistant colonies in each dilution A number of factors can influence viral titers including e The size of your insert promoter gene of interest Titers will generally decrease as the size of the insert increases The size of the wild type HIV 1 genome is approximately 10 kb Since the size of the elements required for expression from pLenti6 R4R2 V5 DEST total approximately 6 kb the size of your insert promoter gene should theoretically not exceed 4 5 5 kb for efficient packaging to occur e The characteristics of the cell line used for titering see the next page for more information e The age of your lentiviral stock Viral titers may decrease with long term storage at 80 C If your lentiviral stock has been stored for longer than 6 months we recommend titering or
59. mix to 900 ul of LB Medium and plate 25 100 ul 9 Store the remaining transformation mix at 4 C Plate out additional cells the next day if desired Continued on next page 21 Transforming One Shot StbI3 Competent E coli Continued What You Should See Analyzing Positive Clones Confirming the Expression Clone Sequencing Maintaining the Expression Clone 22 If you use E coli cells with a transformation efficiency of 1 x 10 cfu ug the MultiSite Gateway LR reaction should give approximately 1 000 to 5 000 colonies if the entire reaction is transformed and plated Note If you performed the MultiSite Gateway LR recombination reaction using a pCR 8 GW TOPO entry clone fewer total colonies may be obtained 1 Pick5 colonies and culture them overnight in LB medium containing 100 pg ml ampicillin Isolate plasmid DNA using your method of choice Analyze the plasmids by restriction analysis to confirm the presence and orientation of your inserts promoter gene as well as the integrity of the vector The ccdB gene mutates at a very low frequency resulting in a very low number of false positives True expression clones will be chloramphenicol sensitive and ampicillin and Blasticidin resistant Transformants containing a plasmid with a mutated ccdB gene will be chloramphenicol ampicillin and Blasticidin resistant To check your putative expression clone test for growth on LB plates contain
60. more information about the ViraPower lentiviral components in this kit see page 4 For more information about the biosafety features of the System see page 8 This manual provides an overview of the ViraPower Promoterless Lentiviral Gateway Expression System and provides instructions and guidelines to 1 Generate entry clones containing the promoter and gene of interest one in pENTR 5 TOPO and the second in any Gateway entry vector guidelines only provided 2 Use the pLenti6 R4R2 V5 DEST vector and two entry clones containing the promoter and gene of interest in a MultiSite Gateway LR recombination reaction to generate an expression clone 3 Cotransfect the pLenti6 R4R2 V5 DEST expression construct and the ViraPower Packaging Mix into the 293FT Cell Line to produce a lentiviral stock Titer the lentiviral stock 5 Transduce the mammalian cell line of choice with the Lenti6 R4R2 V5 DEST lentiviral construct 6 Assay for transient expression of your recombinant protein or generate a stably transduced cell line if desired For details and instructions to generate the entry clone containing the promoter of interest refer to the pENTR 5 TOPO TA Cloning Kit manual For instructions to generate the entry clone containing the gene of interest refer to the manual for the entry vector you select For instructions to culture and maintain the 293FT producer cell line refer to the 293FT Cell Line manual The pEN
61. n and titering experiments Problem Cause Solution Low viral titer Low transfection efficiency Used poor quality expression construct plasmid DNA i e plasmid DNA from a mini prep Unhealthy 293FT cells cells exhibit low viability Cells transfected in media containing antibiotics i e Geneticin Plasmid DNA transfection reagent ratio incorrect 293FT cells plated too sparsely Do not use mini prep plasmid DNA for transfection Use healthy 293FT cells under passage 20 do not overgrow Do not add antibiotics to media during transfection as this reduces transfection efficiency and causes cell death Use a DNA in ug Lipofectamine 2000 in pl ratio ranging from 1 2 to 1 3 Plate cells such that they are 90 95 confluent at the time of transfection OR use the recommended transfection protocol i e add cells to media containing DNA lipid complexes see page 28 Continued on next page 41 Troubleshooting Continued Generating the Lentiviral Stock continued 42 Problem Cause Solution Low viral titer continued Transfected cells not cultured in media containing sodium pyruvate One day after transfection remove media containing DNA lipid complexes and replace with media containing sodium pyruvate Sodium pyruvate provides an extra energy source for the cells Viral supernatant harvested too early Viral supernatants can generally be collecte
62. nce is provided below Other sequences are possible but the G or A at position 3 and the G at position 4 shown in bold illustrates the most commonly occurring sequence with strong consensus Replacing one of the two bases at these positions provides moderate consensus while having neither results in weak consensus The ATG initiation codon is shown underlined G ANNATGG Be in frame with the C terminal tag after recombination with pLenti6 RAR2 V5 DEST NOT contain a stop codon 13 Guidelines to Generate Expression Clones Introduction Experimental Outline Substrates for the MultiSite Gateway LR Recombination Reaction Important 14 After you have generated separate entry clones containing your promoter and gene of interest you will perform the MultiSite Gateway LR recombination reaction to simultaneously transfer the two DNA fragments into the pLenti6 R4R2 V5 DEST vector to create an expression clone with the following Structure attB4 promoter attB1 gene of interest attB2 To ensure that you obtain the best possible results we recommend that you read this section and the sections entitled Performing the MultiSite Gateway LR Recombination Reaction pages 17 22 and Transforming One Shot Stb13 Competent E coli pages 21 23 before beginning To generate an expression clone you will 1 Perform a MultiSite Gateway LR recombination reaction using the appropriate entry clone
63. never expressed in the transduced target cell No new replication competent virus can be produced e The lentiviral particles produced in this system are replication incompetent and only carry the gene of interest No other viral species are produced e Expression of the gag and pol genes from pLP1 has been rendered Rev dependent by virtue of the HIV 1 RRE in the gag pol mRNA transcript Addition of the RRE prevents gag and pol expression in the absence of Rev Dull et al 1998 e A constitutive promoter RSV promoter has been placed upstream of the 5 LTR in the pLenti6 RAR2 V5 DEST vector to offset the requirement for Tat in the efficient production of viral RNA Dull et al 1998 Continued on next page Biosafety Features of the System Continued Biosafety Level 2 Important Despite the inclusion of the safety features discussed on the previous page the lentivirus produced with this System can still pose some biohazardous risk since it can transduce primary human cells For this reason we highly recommend that you treat lentiviral stocks generated using this System as Biosafety Level 2 BL 2 organisms and strictly follow all published BL 2 guidelines with proper waste decontamination Furthermore exercise extra caution when creating lentivirus carrying potential harmful or toxic genes e g activated oncogenes For more information about the BL 2 guidelines and lentivirus handling refer to the document Biosafet
64. nies for analysis as transformants containing a plasmid that has recombined between the 5 and 3 LTRs i e unwanted recombinants generally give rise to larger colonies than those containing an intact plasmid Do not transform the MultiSite Gateway LR recombination reaction into E coli strains that contain the F episome e g TOP10F These strains contain the ccdA gene and will prevent negative selection with the ccdB gene The pENTR 5 UbCp plasmid is included with the kit for use as a positive control for the MultiSite Gateway LR recombination reaction and is a pENTR 5 entry clone containing the human UbC promoter You may use this entry clone together with any attL1 and attL2 flanked entry clone in your MultiSite Gateway LR recombination reaction to verify the efficiency of the TM reaction For a map of pENTR 5 UbCp see the Appendix page 48 Performing the MultiSite Gateway LR Recombination Reaction Continued Materials Needed You will need the following items 10 fmoles purified plasmid DNA of your attL4 and attR1 flanked entry clone 10 fmoles purified plasmid DNA of your attL1 and attL2 flanked entry clone 10 fmoles control plasmid pENTR 5 UbCp if desired 20 fmoles pLenti6 R4R2 V5 DEST vector LR Clonase II Plus enzyme mix supplied with Catalog no K5910 00 keep at 80 C until immediately before use TE Buffer pH 8 0 10 mM Tris HCl pH 8 0 1 mM EDTA 2 ug yl Proteinase K solut
65. nsfection efficiency We recommend isolating plasmid DNA using the PureLink HiPure Plasmid Midiprep Kit or the S N A P Midiprep Kit page viii Resuspend the purified pLenti6 R4R2 V5 DEST expression plasmid containing your promoter gene of interest in sterile water or TE Buffer pH 8 0 to a final concentration ranging from 0 1 3 0 pg pl You will need 3 ug of the expression plasmid for each transfection Important Do not use mini prep plasmid DNA for transfection The pLenti6 UbC V5 GW lacZ plasmid is included with the ViraPower Promoterless Lentiviral Gateway kits for use as a positive control for lentivirus production and expression and facilitates constitutive expression of B galactosidase under the control of the human UbC promoter We recommend including the positive control vector in your cotransfection experiment to generate a control lentiviral stock Once generated use the control lentivirus to help you optimize expression conditions in your mammalian cell line of interest The pLenti6 UbC V5 GW lacZ control vector is supplied in suspension in TE Buffer pH 8 0 You will need 3 ug of the plasmid for transfection For a map of pLenti6 UbC V5 GW lacZ see the Appendix page 49 Note If you wish to propagate the pLenti6 R4R2 V5 DEST plasmid use 10 ng of vector to transform a recA endA E coli strain e g Stb13 Select for transformants on LB agar plates containing 100 ng ml ampicillin If you use an E coli
66. nued Transfection Procedure 28 Follow the procedure below to cotransfect 293FT cells We recommend including a negative control no DNA no Lipofectamine 2000 in your experiment to help evaluate your results You will need 6 x 10 293FT cells for each sample 1 TM For each transfection sample prepare DNA Lipofectamine 2000 complexes as follows a Ina sterile 5 ml tube dilute 9 ug of the ViraPower Packaging Mix and 3 ug of pLenti based plasmid DNA 12 ug total in 1 5 ml of Opti MEM I Medium without serum Mix gently b Ina separate sterile 5 ml tube mix Lipofectamine 2000 gently before use then dilute 36 ul in 1 5 ml of Opti MEM I Medium without serum Mix gently and incubate for 5 minutes at room temperature c After the 5 minute incubation combine the diluted DNA with the diluted Lipofectamine 2000 Mix gently d Incubate for 20 minutes at room temperature to allow the DNA TM Lipofectamine 2000 complexes to form The solution may appear cloudy but this will not impede the transfection While DNA lipid complexes are forming trypsinize and count the 293FT cells Resuspend the cells at a density of 1 2 x 10 cells ml in growth medium or Opti MEM I Medium containing serum Do not include antibiotics in the medium Add the DNA Lipofectamine 2000 complexes to a 10 cm tissue culture plate containing 5 ml of growth medium or Opti MEM I Medium containing serum Do not include antibio
67. oever The above limited warranty is sole and exclusive No other warranty is made whether expressed or implied including any warranty of merchantability or fitness for a particular purpose Purchaser Notification Introduction Information for European Customers Limited Use Label License No 5 Invitrogen Technology Use of the ViraPower Promoterless Lentiviral Gateway Kits is covered under a number of different licenses including those detailed below The 293FT Cell Line is genetically modified and carries the pUC derived plasmid pCMVSPORT6Tag neo As a condition of sale use of this product must be in accordance with all applicable local legislation and guidelines including EC Directive 90 219 EEC on the contained use of genetically modified organisms The purchase of this product conveys to the buyer the non transferable right to use the purchased amount of the product and components of the product in research conducted by the buyer whether the buyer is an academic or for profit entity The buyer cannot sell or otherwise transfer a this product b its components or c materials made using this product or its components to a third party or otherwise use this product or its components or materials made using this product or its components for Commercial Purposes The buyer may transfer information or materials made through the use of this product to a scientific collaborator provided that such transfer is not
68. or human therapeutic or diagnostic use 63 Notes Notes
69. oter gene of interest must not exceed 4 5 to 5 kb Inserts larger than 5 kb can reduce packaging efficiency resulting in lower lentiviral titers The pENTR 5 TOPO TA Cloning Kit containing the pENTR 5 TOPO vector is supplied with the ViraPower Promoterless Lentiviral Gateway Kits to facilitate generation of an attL4 and attR1 flanked entry clone containing your eukaryotic promoter of interest Note that you must use the pENTR 5 TOPO vector in this application other Gateway entry vectors are not suitable To generate an entry clone using pENTR 5 TOPO you will 1 Use Taq polymerase to produce a PCR product encoding your eukaryotic promoter of interest 2 TOPO Clone the PCR product into pENTR 5 TOPO using a 5 minute bench top ligation 3 Transform the TOPO Cloning reaction into chemically competent E coli supplied with the kit and select for entry clones For instructions and protocols refer to the pENTR 5 TOPO TA Cloning Kit manual This manual is supplied with the ViraPower Promoterless Lentiviral Gateway Kits but is also available for downloading from www invitrogen com or by contacting Technical Support see page 56 Note The pENTR 5 TOPO TA Cloning kit is also available separately from Invitrogen page viii Continued on next page 11 Generating Entry Clones Continued Promoter Sequence Considerations Generating an Entry Clone Containing a Gene of Interest
70. otransfect the plasmid and the ViraPower Packaging Mix into 293FT cells to produce a replication incompetent lentiviral stock This lentiviral stock may then be transduced into the mammalian cell line of interest to express your recombinant protein Once the lentivirus enters the target cell the viral RNA is reverse transcribed actively imported into the nucleus Lewis amp Emerman 1994 Naldini 1999 and stably integrated into the host genome Buchschacher amp Wong Staal 2000 Luciw 1996 After the lentiviral construct has integrated into the genome you may assay for transient expression of your recombinant protein or use antibiotic selection to generate a stable cell line for long term expression studies Continued on next page The ViraPower Promoterless Lentiviral Gateway Expression System Continued VSV Envelope Glycoprotein In vivo Gene Delivery Features of the pLenti6 R4R2 V5 DEST Vector Most retroviral vectors are limited in their usefulness as gene delivery vehicles by their restricted tropism and generally low titers In the ViraPower Promoterless Lentiviral Gateway Expression System this limitation has been overcome by use of the G glycoprotein gene from Vesicular Stomatitis Virus VSV G as a pseudotyping envelope thus allowing production of a high titer lentivirus with a significantly broadened host cell range Burns et al 1993 Emi et al 1991 Yee et al 1994 TM The ViraPowe
71. owing ways e Pool a heterogeneous population of cells and test for expression directly after transduction i e transient expression Note that you must wait for a minimum of 48 72 hours after transduction before harvesting your cells to allow expressed protein to accumulate in transduced cells e Select for stably transduced cells using Blasticidin This requires a minimum of 10 12 days after transduction but allows generation of clonal cell lines that stably express the gene of interest Note We have observed stable expression of a target gene for at least 6 weeks following transduction and selection If you wish to select for stably transduced cells you must first determine the minimum concentration of Blasticidin required to kill your untransduced mammalian cell line i e perform a kill curve experiment For guidelines to perform a kill curve experiment see page 32 If you titered your lentiviral construct in the same mammalian cell line that you are using to perform your stable expression experiment then you may use the same concentration of Blasticidin for selection that you used for titering To obtain optimal expression of your gene of interest you will need to transduce the lentiviral construct into your mammalian cell line of choice using a suitable MOI MOL is defined as the number of virus particles per cell and generally correlates with the number of integration events and as a result expression Typically expres
72. plete culture medium 6 The following day Day 3 perform one of the following e Harvest the cells and assay for expression of your recombinant protein if you are performing transient expression experiments e Remove the medium and replace with fresh complete medium containing the appropriate amount of Blasticidin to select for stably transduced cells Proceed to Step 7 7 Replace medium with fresh medium containing Blasticidin every 3 4 days until antibiotic resistant colonies can be identified generally 10 12 days after selection 8 Pick at least 5 Blasticidin resistant colonies see Note below and expand each clone to assay for expression of the recombinant protein Integration of the lentivirus into the genome is random Depending upon the influence of the surrounding genomic sequences at the integration site you may see varying levels of recombinant protein expression from different Blasticidin resistant clones We recommend testing at least 5 Blasticidin resistant clones and selecting the clone that provides the optimal expression of your recombinant protein for further studies You may use any method of choice to detect your recombinant protein of interest including functional analysis immunofluorescence or Western blot If you have cloned your gene of interest in frame with the C terminal V5 epitope tag you may detect your recombinant protein in a Western blot using one of the Anti V5 Antibodies available from In
73. pproximately 10 fold lower than the titer obtained when using HT1080 cells The titer of a lentiviral construct may vary depending on which cell line is chosen see Important note above If you have more than one lentiviral construct we recommend that you titer all of the lentiviral constructs using the same mammalian cell line The pLenti6 R4R2 V5 DEST expression construct contains the Blasticidin resistance gene bsd Kimura et al 1994 to allow for Blasticidin selection Takeuchi et al 1958 Yamaguchi et al 1965 of mammalian cells that have stably transduced the lentiviral construct Note Blasticidin is supplied with the ViraPower Promoterless Lentiviral Gateway Expression System but is also available separately from Invitrogen or as part of the ViraPower Lentiviral Support Kits see page viii for ordering information For more information about how to prepare and handle Blasticidin refer to the Appendix page 45 Continued on next page 31 Titering Your Lentiviral Stock Continued Determining Antibiotic Sensitivity Using Polybrene During Transduction Preparing and Storing Polybrene 32 Since you will be selecting for stably transduced cells using Blasticidin you must first determine the minimum concentration of Blasticidin required to kill your untransduced mammalian cell line i e perform a kill curve experiment Typically concentrations ranging from 2 10 ug ml Blasticidin
74. r Promoterless Lentiviral Expression System is suitable for in vivo gene delivery applications Many groups have successfully used lentiviral vectors to express a target gene in tissues including brain retina pancreas muscle liver and skin Gallichan et al 1998 Kafri et al 1997 Miyoshi et al 1997 Naldini 1998 Pfeifer et al 2001 Pfeifer et al 2001 Takahashi et al 1999 For more information about target genes that have been successfully expressed in vivo using lentiviral based vectors refer to the references above as well as the following additional references Baek et al 2001 Dull et al 1998 Lois et al 2002 Park amp Kay 2001 Peng et al 2001 The pLenti6 RAR2 V5 DEST vector contain the following elements e Rous Sarcoma Virus RSV enhancer promoter for Tat independent production of viral mRNA in the producer cell line Dull et al 1998 e Modified HIV 1 5 and 3 Long Terminal Repeats LTR for viral packaging and reverse transcription of the viral mRNA Dull et al 1998 Luciw 1996 Note The U3 region of the 3 LTR is deleted AU3 and facilitates self inactivation of the 5 LTR after transduction to enhance the biosafety of the vector Dull et al 1998 e HIV 1 psi Y packaging sequence for viral packaging Luciw 1996 e HIV Rev response element RRE for Rev dependent nuclear export of unspliced viral mRNA Kjems et al 1991 Malim et al 1989 e Two recombination sites att R4 and att
75. ra N Gage F H and Verma I M 2001 Delivery of the Cre Recombinase by a Self deleting Lentiviral Vector Efficient Gene Targeting In Vivo Proc Natl Acad Sci USA 98 11450 11455 Pfeifer A Kessler T Yang M Baranov E Kootstra N Cheresh D A Hoffman R M and Verma I M 2001 Transduction of Liver Cells by Lentiviral Vectors Analysis in Living Animals by Fluorescence Imaging Mol Ther 3 319 322 Schorpp M Jager R Schellander K Schenkel J Wagner E F Weiher H and Angel P 1996 The Human Ubiquitin C Promoter Directs High Ubiquitous Expression of Transgenes in Mice Nuc Acids Res 24 1787 1788 Continued on next page 62 References Continued Southern J A Young D F Heaney F Baumgartner W and Randall R E 1991 Identification of an Epitope on the P and V Proteins of Simian Virus 5 That Distinguishes Between Two Isolates with Different Biological Characteristics J Gen Virol 72 1551 1557 Takahashi M Miyoshi H Verma I M and Gage F H 1999 Rescue from Photoreceptor Degeneration in the rd Mouse by Human Immunodeficiency Virus Vector Mediated Gene Transfer J Virol 73 7812 7816 Takeuchi S Hirayama K Ueda K Sakai H and Yonehara H 1958 Blasticidin S A New Antibiotic The Journal of Antibiotics Series A 11 1 5 Wulff B S O Hare M M Boel E Theill L E and Schwartz T W 1990 Partial Processing of the Neuropeptide Y Pr
76. rporation is committed to providing our customers with high quality goods and services Our goal is to ensure that every customer is 100 satisfied with our products and our service If you should have any questions or concerns about an Invitrogen product or service contact our Technical Support Representatives All Invitrogen products are warranted to perform according to specifications stated on the certificate of analysis The Company will replace free of charge any product that does not meet those specifications This warranty limits the Company s liability to only the price of the product No warranty is granted for products beyond their listed expiration date No warranty is applicable unless all product components are stored in accordance with instructions The Company reserves the right to select the method s used to analyze a product unless the Company agrees to a specified method in writing prior to acceptance of the order Invitrogen makes every effort to ensure the accuracy of its publications but realizes that the occasional typographical or other error is inevitable Therefore the Company makes no warranty of any kind regarding the contents of any publications or documentation If you discover an error in any of our publications please report it to our Technical Support Representatives Life Technologies Corporation shall have no responsibility or liability for any special incidental indirect or consequential loss or damage whats
77. rs for the purpose of scientific research Invitrogen agrees that such clones may be distributed for scientific research by academic and government organizations without royalty payment to Invitrogen Organizations other than academia and government may also distribute such Gateway expression clones for a nominal fee 10 per clone payable to Invitrogen We would ask that such distributors of Gateway entry and expression clones indicate that such clones may be used only for research purposes that such clones incorporate the Gateway Technology and that the purchase of Gateway Clonase from Invitrogen is required for carrying out the Gateway recombinational cloning reaction This should allow researchers to readily identify Gateway containing clones and facilitate their use of this powerful technology in their research Use of Invitrogen s Gateway Technology including Gateway clones for purposes other than scientific research may require a license and questions concerning such commercial use should be directed to Invitrogen s licensing department at 760 603 7200 References Andersson S Davis D L Dahlback H J rnvall H and Russell D W 1989 Cloning Structure and Expression of the Mitochondrial Cytochrome P 450 Sterol 26 Hydroxylase a Bile Acid Biosynthetic Enzyme J Biol Chem 264 8222 8229 Baek S C Lin Q Robbins P B Fan H and Khavari P A 2001 Sustainable Systemic Delivery via a
78. s 5686 5919 Human f globin polyadenylation signal bases 6072 6837 pUC origin bases 6995 7668 C Ampicillin bla resistance gene bases 7813 8673 C bla promoter bases 8674 8772 C C complementary strand Features of pLP1 Features of pLP1 8889 bp contains the following elements Features have been functionally pLP1 tested Feature Benefit Human cytomegalovirus CMV promoter Permits high level expression of the HIV 1 gag and pol genes in mammalian cells Andersson et al 1989 Boshart et al 1985 Nelson et al 1987 Human f globin intron Enhances expression of the gag and pol genes in mammalian cells HIV 1 gag coding sequence Encodes the viral core proteins required for forming the structure of the lentivirus Luciw 1996 HIV 1 pol coding sequence Encodes the viral replication enzymes required for replication and integration of the lentivirus Luciw 1996 HIV 1 Rev response element RRE Permits Rev dependent expression of the gag and pol genes Human f globin polyadenylation signal Allows efficient transcription termination and polyadenylation of mRNA pUC origin of replication ori Permits high copy replication and maintenance in E coli Ampicillin bla resistance gene Allows selection of the plasmid in E coli 51 Map of pLP2 pLP2 Map 52 The figure below shows the features of the pLP2 vector The complete seq
79. s and pLenti6 R4R2 V5 DEST see below Transform the reaction mixture into a suitable F coli host Select for expression clones see page 16 for an illustration of the recombination region of expression clones in pLenti6 R4R2 V5 DEST To perform the two fragment MultiSite Gateway LR recombination reaction you must have the substrates listed below e attL4 and attR1 flanked entry clone containing the promoter of interest e ttL1 and attL2 flanked entry clone containing the gene of interest e attR4 and attR2 flanked pLenti6 R4R2 V5 DEST vector Keep in mind the following e You cannot successfully create a two fragment expression clone using the MultiSite Gateway LR recombination reaction if you have any combination of att flanked entry clones other than the ones listed above e You must use the pLenti6 R4R2 V5 DEST destination vector for this reaction Other pLenti based destination vectors or Gateway destination vectors cannot be used For optimal results we recommend performing the MultiSite Gateway LR recombination reaction using e Supercoiled entry clones e Supercoiled pLenti6 R4R2 V5 DEST Continued on next page Guidelines to Generate Expression Clones Continued Plasmid Preparation Vector Information Propagating the Destination Vector Guidelines to Propagate the Destination Vector Once you have generated your entry clones prepare purified plasmid DNA from each entry clone to use in th
80. sformation as this strain is particularly well suited for use in cloning unstable DNA such as lentiviral DNA containing direct repeats One Shot Stbl3 Chemically Competent E coli are included in the kit for transformation For instructions see Transforming One Shot Stbl3 Competent E coli page 21 Note that transformants containing unwanted recombinants see Note below are obtained TM less frequently when Stbl3 E coli are used for transformation You may transform the LR recombination reaction into other recA endA E coli strains including TOP10 and DH5a if desired Note however that these strains are not as well suited for cloning unstable DNA and may give rise to a low percentage lt 5 of transformants containing unwanted recombinants i e plasmids where recombination has occurred between the 5 and 3 LTRs when selected on plates containing only ampicillin If you wish to use TOP10 or DH5a cells for transformation follow the guidelines below to reduce the frequency of obtaining unwanted recombinants e Select for transformants using 100 pg ml ampicillin and 50 pg ml Blasticidin Note that transformed E coli grow more slowly in LB media containing two selection agents and may require slightly longer incubation times to obtain visible colonies For a recipe to prepare LB agar plates containing ampicillin and Blasticidin see page 44 For more information about Blasticidin see page 45 e Select small colo
81. sion levels increase linearly as the MOI increases A number of factors can influence determination of an optimal MOI including the nature of your mammalian cell line e g non dividing vs dividing cell type see Note on the next page its transduction efficiency your application of interest and the nature of your gene of interest If you are transducing your lentiviral construct into the mammalian cell line of choice for the first time we recommend using a range of MOIs e g 0 0 05 0 1 0 5 1 2 5 to determine the MOI required to obtain optimal expression of your recombinant protein for your particular application Continued on next page Transduction of Mammalian Cells and Expression Analysis Continued Note Positive Control Important Concentrating Virus Materials Needed In general we have found that 80 90 of the cells in an actively dividing cell line e g HT1080 express a target gene when transduced at an MOI of 1 Some non dividing cell types transduce lentiviral constructs less efficiently For example only about 50 of the cells in a culture of primary human fibroblasts express a target gene when transduced at an MOI of 1 If you are transducing your lentiviral construct into a non dividing cell type you may need to increase the MOI to achieve optimal expression levels for your recombinant protein If you have generated the pLenti6 UbC V5 GW lacZ positive control lentiviral construct we re
82. strain other than Stb13 for transformation e g TOP10 or DH5a select for transformants on LB agar plates containing 100 ug ml ampicillin and 50 ug ml Blasticidin Continued on next page Producing Lentivirus in 293FT Cells Continued Materials Needed You will need the following items e pLenti6 R4R2 V5 DEST expression construct 0 1 3 0 pg pl in sterile water or TE Buffer pH 8 0 e pLenti6 UbC V5 GW lacZ control vector supplied with the kit TM e ViraPower Packaging Mix supplied with Catalog no K5910 00 resuspend in 195 ul of sterile water to a concentration of 1 pg pl see below for more information e 293FT cells cultured in the appropriate medium i e D MEM containing 10 FBS 2 mM L glutamine 0 1 mM MEM Non Essential Amino Acids and 176 penicillin streptomycin see the next page for more information TM e Lipofectamine 2000 transfection reagent supplied with Catalog no K5910 00 store at 4 C and mix gently before use see page 26 for more information e Opti MEM I Reduced Serum Medium pre warmed see page 26 for more information e Fetal bovine serum FBS e Complete growth medium containing sodium pyruvate i e DLMEM containing 10 FBS 2 mM L glutamine 0 1 mM MEM Non Essential Amino Acids 1 penicillin streptomycin and 1 mM MEM Sodium Pyruvate Note MEM Sodium Pyruvate provides an extra energy source for the cells and is available from Invitrogen as a 100 mM stock solution pa
83. t of Blasticidin to select for stably transduced cells Replace medium with fresh medium containing Blasticidin every 3 4 days After 10 12 days of selection day 14 16 you should see no live cells in the mock well and discrete Blasticidin resistant colonies in one or more of the dilution wells Remove the medium and wash the cells twice with PBS Add crystal violet solution 1 ml for 6 well dish 5 ml for 10 cm plate and incubate for 10 minutes at room temperature Remove the crystal violet stain and wash the cells with PBS Repeat wash Count the blue stained colonies and determine the titer of your lentiviral stock Continued on next page Titering Your Lentiviral Stock Continued What You Should See Example of Expected Results When titering pLenti lentiviral stocks using HT1080 cells we generally obtain titers ranging from 5 x 10 to 2 x 10 transducing units TU ml see below for an example Note If the titer of your lentiviral stock is less than 1 x 10 TU ml we recommend producing a new lentiviral stock See page 30 and the Troubleshooting section page 40 for more tips and guidelines to optimize your viral yield In this experiment a pLenti6 lentiviral stock was generated using the protocol on page 28 HT1080 cells were transduced with 10 fold serial dilutions of the lentiviral supernatant 10 to 10 dilutions or untransduced mock following the protocol on page 34 Forty eight hours post transd
84. t page Kit Contents and Storage Continued ViraPower Bsd Lentiviral Support Kit Contents 293FT Cell Line pENTR 5 TOPO TA Cloning Kit TM The ViraPower Bsd Lentiviral Support Kit includes the following reagents Store the Lipofectamine 2000 at 4 C and the ViraPower Packaging Mix and Blasticidin at 20 C Important Store Lipofectamine 2000 at 4 C Do not freeze Product Composition Quantity ViraPower Packaging Mix Contains a mixture of the pLP1 195 ug pLP2 and pLP VSVG plasmids at 1 pg ul in TE Buffer pH 8 0 Lipofectamine 2000 Proprietary 0 75 ml Blasticidin Powder 50 mg The 293FT Cell Line is supplied as one vial containing 3 x 10 frozen cells in 1 ml of Freezing Medium Upon receipt store in liquid nitrogen For instructions to thaw culture and maintain the 293FT Cell Line see the 293FT Cell Line manual The ViraPower Promoterless Lentiviral Gateway Kits include the pENTR 5 TOPO TA Cloning Kit to facilitate production of an attL4 and attR1 flanked entry clone containing your eukaryotic promoter of interest The pENTR 5 TOPO TA Cloning Kit contains e pENTR 5 TOPO Reagents e One Shot TOP10 Chemically Competent E coli Refer to the pENTR 5 TOPO TA Cloning Kit manual for a detailed description of the reagents provided with the kit and instructions to produce the entry construct vii Accessory Products
85. the MultiSite Gateway LR recombination reaction and may vary in size and sequence from those used in the Gateway Technology The MultiSite Gateway LR recombination reaction is catalyzed by LR Clonase II Plus enzyme mix LR Clonase II Plus enzyme mix facilitates efficient recombinational cloning of multiple DNA fragments but is also suitable for use in standard Gateway LR reactions Note however that standard LR Clonase enzyme mix is not suitable for use in the MultiSite Gateway LR recombination reaction Recombination between attR and attL sites generates attB sites see figure on the previous page in the lentiviral expression vector We have shown that the presence of attB sites within the expression cassette does not affect gene expression Biosafety Features of the System Introduction Biosafety Features of the ViraPower Promoterless Lentiviral System TM The lentiviral and packaging vectors supplied in the ViraPower Promoterless Lentiviral Gateway Expression System are third generation vectors based on lentiviral vectors developed by Dull et al 1998 This third generation HIV 1 based lentiviral system includes a significant number of safety features designed to enhance its biosafety and to minimize its relation to the wild type human HIV 1 virus These safety features are described below TM The ViraPower Promoterless Lentiviral Gateway Expression System includes the following key s
86. tics in the medium Add 5 ml of the 293FT cell suspension 6 x 10 total cells to the plate contain ing media and DNA Lipofectamine 2000 complexes Mix gently by rocking the plate back and forth Incubate cells overnight at 37 C in a CO incubator The next day remove the medium containing the DNA Lipofectamine 2000 complexes and replace with complete culture medium containing sodium pyruvate i e D MEM containing 10 FBS 2 mM L glutamine 0 1 mM MEM Non Essential Amino Acids 176 penicillin streptomycin and 1 mM MEM Sodium Pyruvate Note Expression of the VSV G glycoprotein causes 293FT cells to fuse resulting in the appearance of multinucleated syncytia This morphological change is normal and does not affect production of the lentivirus Harvest virus containing supernatants 48 72 hours post transfection by removing medium to a 15 ml sterile capped conical tube Note Minimal differences in viral yield are observed whether supernatants are collected 48 or 72 hours post transfection Caution Remember that you are working with infectious virus at this stage Follow the recommended guidelines for working with BL 2 organisms see page 9 for more information Centrifuge at 3000 rpm for 15 minutes at 4 C to pellet cell debris Perform filtration step if desired see Note on the next page Pipet viral supernatants into cryovials in 1 ml aliquots Store viral stocks at 80 C Proceed to Titering Your Lentiviral Stock page
87. tor Quantity Contents pLenti6 R4R2 V5 DEST 6 ug 40 ul of 150 ng pl vector in 10 mM Tris HCl 1mM EDTA pH 8 0 pLenti6 UbC V5 GW lacZ 10 ug 20 ul of 0 5 pg pl control vector in 10 mM Tris HCl 1mM EDTA pH 8 0 pENTR 5 UbCp 10 ug 20 pl of 0 5 pg pl vector in 10 mM Tris HCl 1mM EDTA pH 8 0 Continued on next page Kit Contents and Storage Continued One Shot StbI3 Chemically Competent E coli Genotype of Stbl3 E coli LR Clonase II Plus Enzyme Mix vi The following reagents are included with the One Shot Stb13 Chemically Competent E coli kit Transformation efficiency is 21 x 10 cfu ug plasmid DNA Store at 80 C Product Composition Quantity Stbl3 Cells 21x50 pl S O C Medium 2 Tryptone 0 5 Yeast Extract 10 mM NaCl 2 5 mM KCl 10 mM MgCl 10 mM MgSO 20 mM glucose 6 ml pUC19 Control DNA 0 5 mM EDTA pH 8 10 pg ul in 5 mM Tris HCl 50 ul F mcrB mrr hsdS20 rg ms recA13 supE44 ara 14 galK2 lacY1 proA2 rpsL20 Str xyl 5 X leu mtl 1 The following reagents are supplied with the LR Clonase II Plus enzyme mix Box 3 Store at 20 C for up to 6 months For long term storage store at 80 C Product Composition Quantity LR Clonase II Plus Proprietary 40 pl Enzyme Mix Proteinase K solution 2 pg tl in 40 pl 10 mM Tris HCl pH 7 5 20 mM CaCh 50 glycerol Continued on nex
88. transferred This expression plasmid contains elements that allow packaging of the construct into virions and the Blasticidin resistance marker for selection of stably transduced cell lines e Components of the ViraPower Lentiviral System Catalog no K5910 00 only for production of a replication incompetent lentivirus that transiently or stably expresses the gene of interest in both dividing and non dividing mammalian cells TM For more information about the ViraPower Lentiviral Technology and the MultiSite Gateway Technology see pages 6 7 TM Use of the ViraPower Promoterless Lentiviral Gateway Expression System to facilitate lentiviral based expression of the gene of interest provides the following advantages e Allows production of a lentiviral construct that facilitates expression of a gene of interest under the control of a promoter of choice e Generates replication incompetent lentivirus that effectively transduces both dividing and non dividing mammalian cells thus broadening the potential applications beyond those of traditional retroviral systems Naldini 1998 e Efficiently delivers the gene of interest to mammalian cells in culture or in vivo Dull et al 1998 e Provides stable long term expression of a target gene beyond that offered by adenoviral based systems Dull et al 1998 Naldini et al 1996 e Produces a pseudotyped virus with a broad host range Yee et al 1994 e The expression vector
89. uction the cells were placed under Blasticidin selection 10 ng ml After 10 days of selection the cells were stained with crystal violet see plate below and colonies were counted 10 102 mock 105 10 10 In the plate above the colony counts were e Mock no colonies e 10 dilution confluent undeterminable e 10 dilution confluent undeterminable e 10 dilution confluent undeterminable e 10 dilution 46 e 10 dilution 5 Thus the titer of this lentiviral stock is 4 8 x 10 TU ml i e average of 46 x 10 and 5 x 10 35 Transduction of Mammalian Cells and Expression Analysis Introduction Transient vs Stable Expression Determining Antibiotic Sensitivity for Your Cell Line Multiplicity of Infection MOI Determining the Optimal MOI 36 Once you have generated a lentiviral stock with a suitable titer you are ready to transduce the lentiviral construct into the mammalian cell line of choice and assay for expression of your recombinant protein Guidelines are provided below Reminder Remember that your lentiviral construct contains a deletion in the 3 LTR that leads to self inactivation of the lentivirus after transduction into mammalian cells Once integrated into the genome the lentivirus can no longer produce packageable virus After transducing your lentiviral construct into the mammalian cell line of choice you may assay for expression of your gene of interest in the foll
90. uence of pLP2 is available for downloading from our website at www invitrogen com or by contacting Technical Support page 56 Comments for pLP2 4180 nucleotides RSV enhancer promoter bases 1 271 TATA box bases 200 207 Transcription initiation site base 229 RSV UTR bases 230 271 HIV 1 Rev ORF bases 391 741 HIV 1 LTR polyadenylation signal bases 850 971 bla promoter bases 1916 2014 Ampicillin bla resistance gene bases 2015 2875 pUC origin bases 3020 3693 Features of pLP2 Features of pLP2 4180 bp contains the following elements Features have been functionally pLP2 tested Feature Benefit RSV enhancer promoter Permits high level expression of the rev gene Gorman et al 1982 HIV 1 Rev ORF Encodes the Rev protein which interacts with the RRE on pLP1 to induce Gag and Pol expression and on the pLenti6 V5 expression vector to promote the nuclear export of the unspliced viral RNA for packaging into viral particles HIV 1 LTR polyadenylation signal Allows efficient transcription termination and polyadenylation of mRNA Ampicillin bla resistance gene Allows selection of the plasmid in E coli pUC origin of replication ori Permits high copy replication and maintenance in E coli 53 Map of pLP VSVG pLP VSVG Map 54 The figure below shows the features of the pLP VSVG vector The complete sequence of pLP VSVG is available for download
91. vious page to remove any remaining cellular debris We recommend using Millex HV 0 45 um PVDF filters Millipore Catalog no SLHVR25LS for filtration If you wish to concentrate your viral stock to obtain a higher titer perform the filtration step first before concentrating your viral stock Long Term Place lentiviral stocks at 80 C for long term storage Repeated freezing and Storage thawing is not recommended as it may result in loss of viral titer When stored properly viral stocks of an appropriate titer should be suitable for use for up to one year After long term storage we recommend re titering your viral stocks before transducing your mammalian cell line of interest Scaling Up Virus It is possible to scale up the cotransfection experiment to produce a larger Production volume of lentivirus if desired For example we have scaled up the cotransfection experiment from a 10 cm plate to a T 175 cm flask and harvested up to 30 ml of viral supernatant If you wish to scale up your cotransfection remember that you will need to increase the number of cells plated and the amounts of DNA Lipofectamine 2000 and medium used in proportion to the difference in surface area of the culture vessel 29 Titering Your Lentiviral Stock Introduction Experimental Outline Factors Affecting Viral Titer 30 Before proceeding to transduction and expression experiments we highly recommend determining the titer of your
92. vitrogen see page viii for ordering information For more information visit our website at www invitrogen com or contact Technical Support page 56 Continued on next page Transduction of Mammalian Cells and Expression Analysis Continued Assaying for p galactosidase If you transduce mammalian cells with the pLenti6 UbC V5 GW lacZ positive control lentivirus you may assay for p galactosidase expression by Western blot analysis or activity assay using cell free lysates Miller 1972 Invitrogen offers the B gal Antiserum and the B Gal Assay Kit for fast and easy detection of B galactosidase expression See page ix for ordering information Note The f galactosidase protein expressed from the pLenti6 UbC V5 GW lacZ control lentiviral construct is fused to the V5 epitope and is approximately 121 kDa in size If you are performing Western blot analysis you may also use the Anti V5 Antibodies available from Invitrogen see page viii for ordering information for detection 39 Troubleshooting MultiSite Gateway The table below lists some potential problems and possible solutions that may LR Reaction 40 help you troubleshoot the MultiSite Gateway LR recombination reaction Problem Cause Solution Few or no colonies obtained from sample reaction and the transformation control gave colonies Incorrect antibiotic used to select for transformants Select for transformants on LB agar p
93. xpression of the selection marker and episomal replication in cells expressing the SV40 large T antigen EM7 promoter Synthetic prokaryotic promoter for expression of the selection marker in E coli Blasticidin bsd resistance gene Permits selection of stably transduced mammalian cell lines Kimura et al 1994 AU3 HIV 1 truncated 3 LTR Allows viral packaging but self inactivates the 5 LTR for biosafety purposes Dull et al 1998 The element also contains a polyadenylation signal for transcription termination and polyadenylation of mRNA in transduced cells SV40 polyadenylation signal Allows transcription termination and polyadenylation of mRNA bla promoter Allows expression of the ampicillin resistance gene Ampicillin resistance gene B lactamase Allows selection of the plasmid in E coli pUC origin Permits high copy replication and maintenance in E coli 47 Map Map of of pENTR 5 UbCp pENTR 5 UbCp is a 3861 bp entry construct containing the human UbC pENTR 5 UbCp promoter Hershko amp Ciechanover 1982 Schorpp et al 1996 Wulff et al 1990 48 and is included with the kit for use as a positive control in the MultiSite Gateway LR recombination reaction Note that attL4 and attR1 sites flank the UbC promoter The complete sequence of pENTR 5 UbC is available from our website at www invitrogen com or by contacting Technical Support
94. xpression of your recombinant protein using an antibody to the Recombinant V5 epitope Horseradish peroxidase HRD or alkaline phosphatase AP Protein conjugated antibodies allow one step chemiluminescent or colorimetric detection A fluorescein isothiocyanate FITC conjugated antibody allows one step detection in immunofluorescence experiments The amount of antibody supplied is sufficient for 25 western blots Product Quantity Catalog No Anti V5 Antibody 50 pl R960 25 Anti V5 HRP Antibody 50 pl R961 25 Anti V5 AP Antibody 125 pl R962 25 Anti V5 FITC Antibody 50 pl R963 25 viii Overview Introduction Advantages of the ViraPower Promoterless Lentiviral Gateway Expression System Introduction The ViraPower Promoterless Lentiviral Gateway Expression System combines Invitrogen s ViraPower Lentiviral and MultiSite Gateway technologies to facilitate lentiviral based expression of a gene of interest from any promoter of choice in dividing or non dividing mammalian cells The System includes e The pENTR 5 TOPO TA Cloning Kit for production of an entry clone containing your eukaryotic promoter of interest The pPENTR 5 TOPO entry vector is adapted with MultiSite Gateway Technology to facilitate transfer of the promoter sequence into the lentiviral expression plasmid e Apromoterless pLenti6 RAR2 V5 DEST destination vector into which the promoter and gene of interest are
95. y in Microbiological and Biomedical Laboratories 4 Edition published by the Centers for Disease Control CDC This document may be downloaded at the following address http www cdc gov od ohs biosfty bmbl4 bmbl4toc htm Handle all lentiviruses in compliance with established institutional guidelines Since safety requirements for use and handling of lentiviruses may vary at individual institutions we recommend consulting the health and safety guidelines and or safety officer s at your institution prior to use of the ViraPower Promoterless Lentiviral Gateway Expression System Experimental Outline Flow Chart The diagram below describes the general steps required to express a gene of interest under the control of your own promoter using the ViraPower Promoterless Lentiviral Gateway Expression System atfR4 Cm JE pENTR 5 TOPO pLenti6 R4R2 V5 DEST entry clone i LR Clonase II Plus Enzyme Mix 1 Perform a MultiSite Gateway uncos ee o RA LR recombination reaction between the appropriate entry clones and pLenti6 R4R2 V5 DEST to generate the pLenti6 R4R2 pLenti6 7 g R4R2 V5 DEST V5 DEST expression construct expression construct ViraPower Packaging Mix 2 Cotransfect the 293FT producer ate cell line with your pLenti6 R4R2 V5 DEST expression construct and the optimized Packaging Mix 293FT Producer Cell Line 3 Harvest viral supernatant and determine the titer
96. your recombinant protein if desired Follow the guidelines below Use an easy to transfect dividing mammalian cell line e g HEK 293 or COS 7 Use a transfection reagent that allows high efficiency transfection we recommend using Lipofectamine 2000 Reagent see page 26 Note Lipofectamine 2000 is supplied with the ViraPower Promoterless Lentiviral Gateway Expression System but is also available separately from Invitrogen see page viii for ordering information Follow the manufacturer s instructions for the transfection reagent you are using to perform plasmid transfection If you are using Lipofectamine 2000 follow the instructions included with the product 23 Producing Lentivirus in 293FT Cells Introduction Plasmid Preparation Positive Control 24 Once you have generated your pLenti6 R4R2 V5 DEST expression construct containing your promoter and gene of interest you will cotransfect the expression construct and the optimized ViraPower Packaging Mix into 293FT cells to produce a lentiviral stock This section provides protocols and instructions to generate a lentiviral stock Once you have generated your expression construct you must isolate plasmid DNA for transfection Plasmid DNA for transfection into eukaryotic cells must be clean and free from contamination with phenol and sodium chloride Contami nants may kill the cells and salt will interfere with lipid complexing decreasing tra
97. yr TTG TAC AAC ATG Lys AAA TTT GGC CCG Val GTG CAC 1829 TAGTTGAAAC ATA TCT TTT CAA l GAA TIG GAC CCA AGT CTT AAG CTG CGI TCA ENG AAC TAC ATG attB4 AAA TEE AAA TET GCA Cam GGC CCG Val Asp Ile Gln His GTT GAT ATC CAG CAC CAA CTA TAG GTC GTG Arg CGG GCC TGA ACT Phe TTC AAG Glu GAA CTT attB2 Gly Lys GGT AAG CCA TTC l Pro COT GGA Ile ATC TAG Pro Asn Pro Leu Leu CCT AAC CCT CTC CTC GGA TTG GGA GAG GAG Ser AGT TCA Gly GGT CCA Gly GGC CCG Leu Cre GAG attB1 Gly GGC ccG Asp GAT CTA Arg CGC GCG Ser TCT AGA Ser TCG AGC Thr ACG TGC V5 epitope GTTTGGAATT V5 C term reverse priming site ser AGT TCA Arg CGT GCA Leu CTA GAT Thr ACC TGG Gly GGT CCA Gly GGC CCG KK TAG ATC ATCAACTTTG TAT AGA AAA GTT GGC TCC GAA TTC CCG AGG CTT AAG Pro CCG GGC aea ok kok TAA ATT Performing the MultiSite Gateway LR Recombination Reaction Important Introduction Determining How Much DNA to Use in the Reaction Converting Femto moles fmoles to Nanograms ng Example of fmoles to ng Conversion A new enzyme LR Clonase II Plus is supplied in this kit and the MultiSite Gateway LR recombination reaction protocol has been changed Follow the protocol below carefully Follow the guidelines and instructions in this section to p
98. ze thaw more than 3 times Polybrene not included during transduction Transduce mammalian cells with the lentiviral construct in the presence of Polybrene Titer indeterminable cells confluent Too little Blasticidin used for selection Increase amount of Blasticidin used for selection Viral supernatant not diluted sufficiently Titer lentivirus using a wider range of 10 fold serial dilutions e g 10 to 10 Continued on next page Troubleshooting Continued Transducing Mammalian Cells The table below lists some potential problems and possible solutions that may help you troubleshoot your transduction and expression experiment Problem Cause Solution No expression of the gene of interest Promoter silencing e If youare using a viral promoter to express the gene of interest note that lentiviral constructs can integrate into a chromosomal region that down regulates or silences the promoter Screen multiple antibiotic resistant clones and select the one with the highest expression levels e Use a promoter that is not subject to silencing to express the gene of interest Viral stocks stored incorrectly Aliquot and store stocks at 80 C Do not freeze thaw more than 3 times Poor expression of the gene of interest Low transduction efficiency e Polybrene not included during transduction e Non dividing cell type used e Transduce the lentiv

ViraPower™ Promoterless Lentiviral Gateway® Kits

Contents

Download Pdf Manuals

Related Search

Related Contents

ViraPower&trade; Promoterless Lentiviral Gateway&reg; Kits

Contents

Download Pdf Manuals

Related Search

Related Contents

ViraPower™ Promoterless Lentiviral Gateway® Kits