Pyrosequencing Protocol for the Detection of the Substitution at
Contents
1. 6 3 11 6 3 12 6 3 13 Centers for Disease Control and Prevention CDC Atlanta GA 30333 St DEPARTMENT OF HEALTH amp HUMAN SERVICES Public Health Service Load the PSQ96 Plate Low containing the annealed DNA template and sequencing primer onto the PyroMark Q96 ID instrument Load the cartridge containing enzyme substrate and nucleotides onto the PyroMark Q96 ID instrument with the cartridge label facing towards the user From the drop down menu in the Instrument option select PyroMark ID Note The specific name of the instrument may vary depending on the setup of the machine Ensure that the PSQ96 Plate Low and cartridge have been loaded into the instrument selected in the drop down menu Click Run to start the pyrosequencing reaction Ensure that the substrate peak appears after the substrate is added to confirm that the enzyme and substrate reagents are working 6 4 Cleaning the Instrument See part 6 4 of Pyrosequencing SQA Protocol Using the PyroMark 096 ID Platform section VI 6 5 Analysis of Pyrosequencing Data using SNP or Allele Quantification AQ Mode 6 5 1 6 5 2 6 5 3 6 5 4 6 5 5 6 5 6 6 5 7 6 5 8 When the SNP run is complete click Close Reopen the run from the import folder to reveal the SNP analysis window Figure 7 Pyrosequencing data may be analyzed in two modes SNP or AQ SNP mode will provide the nucleotide present at the site o2. Us oF HEALTH x oy DEPARTMENT OF HEALTH amp HUMAN SERVICES Public Health Service Centers for Disease Control and Prevention CDC Atlanta GA 30333 5 Detection of pre pandemic A H1N1 variant H275Y TT TAT TAT GA TT TAT T variant H275Y Notes 7 1 7 2 7 3 7 4 7 5 7 6 7 7 This pyrosequencing protocol is for the detection of substitutions found in influenza and is not to be used for typing subtyping rather it is to be used for viruses that have already been subtyped by another method e g real time RT PCR A positive control is optional for the pyrosequencing assay since the PyroMark Q96 ID provides a built in quality control for each assay Specifically if a pyrogram is generated for any of your samples this may serve as your positive control The naming of the sequences in the IdentiFire library can be changed to the users preference When the IdentiFire library is used any mutations within the target region that were not in the sequences of the reference library will be identified by the software as mismatched sequences and the closest matches will be shown Because the PyroMark Q96 ID platform has limitations it is suggested that each pyrogram be examined and verified visually One such limitation is that if the target sequence contains repeats of more than four or five identical nucleotides the pyrogram peak heights may no longer be directly proportional to the n
3. 5 a a Result Browser Run name Sy Mamie Creator Default user Volume information 3 06082011 SNP Date created 8 2 2011 2 26 47 PM E mix 192 pl 06152011 SNP S mix 192 pl d 06172011 SNP Run date 8 2 2011 2 26 47 PM Nucleotide A 8 07072011_ML Plate ID MA 06152011 SNP Nucleotide C 62 pl 07132011 SNP HE Reagent ID Nucleotide 62 pl 07222011 Surveill Cartridge ID Nucleotide 62 pl 07222011 Surveill Instrument PyroMark ID d MA 07272011 ML Serial 192 168 255 201 SOA 07282011 ML Instrument Instrument Parameters Code 0004 Samples w Vasiliy zPyroService s Recycle Bin lt E _ Help D Instrument PyroMark ID Close Default user PyroMark ID Figure 3 Example of PyroMark Q96 ID Software Showing SNP Run Setup L Gubareva Distribution Copy Effective 04 19 2012 Page 34 of 43 ERVIC NC Es of HEALTH x oy Public Health Service 2 DEPARTMENT HEALTH amp HUMAN SERVICES Atlanta GA 30333 Centers for Disease Control and Prevention CDC File Windows Help Define simplex SNP entry A H1N1 pdm09 NA275 ax PyroMark ID SNP
4. Benchtop PCR Marker Promega Nuclease free RT PCR grade water Ambion Distilled deionized water Mediatech Procedure 51 Isolation 5 2 RNA isolation procedures should be qualified and validated for recovery and purity before testing specimens Commercially available isolation procedures including QIAamp Viral RNA Mini Kit Qiagen RNeasy Mini Kit Qiagen MagNA Pure Compact RNA Isolation Kit Roche MagNA Pure LC RNA Isolation Kit Roche and MagNA Pure Total Nucleic Acid Kit Roche have been shown to generate highly purified RNA when following manufacturer s recommended procedures Performance of RT PCR based assays depend on the amount and quality of the RNA sample Programming the Thermal Cycler The following program incorporates cDNA synthesis immediately followed by PCR amplification Step 1 Incubate 50 C for 30 minutes Step 2 Denature 94 C for 2 minutes Step 3 Denature 94 C for 15 seconds Step 4 Anneal 55 C for 30 seconds Step 5 Extend 68 C for 1 minute Step 6 Repeat steps 3 5 for 45 cycles Step 7 Extend 68 C for 5 minutes Step 8 Hold 4 C forever L Gubareva Distribution Copy Effective 04 19 2012 Page 7 of 43 SERVICES of HEALTH x oy Centers for Disease Control and Prevention CDC Atlanta GA 30333 Sf DEPARTMENT OF HEALTH amp HUMAN SERVICES Public Health Service 5 3 Preparation of the RT PCR Reaction Mix and Thermal Cycling 5 3 1 5
5. 09282011 ML 10132011 ML 10192011 5N 10192011 SN Result Browser 10212011_SN Vasiliy Instrument aai in x Tools lt Save Close Default user PyroMark ID Figure 7 Example of a Completed SNP Run L Gubareva Distribution Copy Effective 04 19 2012 Page 37 of 43 DEPARTMENT HEALTH amp HUMAN SERVICES Public Health Service PyroMark ID 1 0 SNP Analysis MA 1021201 ff Fie Windows Help SNP gt og 04152010 SNPI223R MA 08192010 275 Simplex Entries 12172009 Diganos Centers for Disease Control and Prevention CDC Atlanta GA 30333 PyroMark ID Statistics Peak heights Histogram Plates Analysis criteria Plate overview Wellinfo File Layout Notes MA 12292003 AT Dia Entry ID H1N1pdm NA 275 F804 primer 588 C Bangladesh see ATC TACTATGAGGAATGCTCCT C Program Files Pyros Dispensation GATCGACTA Multiplex Entries Diagnostic specimen ru order Import Sample ID 2010807125 Instrument Test SNP Description H275Y Manie Quality Passed All s Notes MA 06082011 SNF Result His to Ty275 C C Analysis results 06152011 SNF SNP Analyzed 10 24 2011 10 39 12 8 06172011 SNF by user Default user SNP 07072011 ML W 07132011 SNF
6. CDC Atlanta GA 30333 Sf DEPARTMENT OF HEALTH amp HUMAN SERVICES Public Health Service Select a dispensation entry 6 3 5 1 Go to the Setup tab and under Entry click to select the dispensation order Figure 3 6 3 5 2 If the target specific entry is not in the Entry list then create a new SNP entry To create a new SNP entry click on the Simplex Entries icon and right click on the Simplex Entries folder and select New Entry Under Entry ID type in the name A HIN1 pdm09 NA275 Enter the sequence to be analyzed and click the Dispensation Order tab The sequence should be visible under the Dispensation order box Figure 4 Note Because of the natural genetic variability of the influenza virus genome SNP analysis can be affected if mutations occur in the region near the site of analysis Such mutations are rare but will cause the sample to fail for example a virus variant with the silent mutation at nucleotide position 822 T C of the NA gene If a sample with this mutation is determined by SQA the SNP analysis should be done with the following variant sequence ACC TACTAT Figure 5B The result will be inconclusive if such a variant is tested in SNP with the dispensation order generated for the major circulating virus variant ATC TACTAT Figure 5A 6 3 6 6 3 7 6 3 8 6 3 9 6 3 10 Click on the Pencil tool and highlight all the wel
7. I Klimov and L V Gubareva Detection of molecular markers of antiviral resistance in influenza A H5NI viruses using a pyrosequencing method Antimicrob Agents Chemother 2009 53 3 1039 1047 Deyde V M M Okomo Adhiambo G Sheu T R Wallis A Fry Dharan A I Klimov and L V Gubareva Pyrosequencing as a tool to detect molecular markers of resistance to neuraminidase inhibitors in seasonal influenza A viruses Antiviral Res 2009 81 1 16 24 Deyde V M T G Sheu A A Trujillo M Okomo Adhiambo R Garten A I Klimov and L V Gubareva Detection of molecular markers of drug resistance in 2009 pandemic influenza A H1N1 viruses by pyrosequencing Antimicrob Agents Chemother 2010 54 3 1102 1110 Sheu T G V M Deyde R J Garten A I Klimov L V Gubareva Detection of antiviral resistance and genetic lineage markers in influenza B virus neuraminidase using pyrosequencing Antiviral Research 2010 85 2 354 360 If you have a technical question about this SOP you may contact the CDC Molecular Epidemiology Team Influenza Division at fluantiviral 9 cdc gov L Gubareva Distribution Copy Effective 04 19 2012 Page 43 of 43
8. MA 07222011 Sun MA 07222011 Sun 07272011 q 07282011 ML 08082011 SNF 08172011 SNF 09062011 5 09082011 5 09132011 ML 10212011 5 Result Browser 105 LIL 09152011 SNF 09152011 SNF 09162011 09282011 ML 10132011 ML 10192011 SN 10192011 SN 10212011 SN 2 Vasiliy iC zPyroService mft Recycle Bin lt gt Instrument Help Report Save Close Default user PyroMark ID Figure 8 Example of Run Analysis in SNP Mode L Gubareva Distribution Copy Effective 04 19 2012 Page 38 of 43 ERVIC p SERVICES oF HEALTH 5 4 p DEPARTMENT OF HEALTH amp HUMAN SERVICES Public Health Service Centers for Disease Control and Prevention CDC Atlanta 30333 PyroMark ID 1 0 SNP Analysis M 10212011 SNP ML File Windows Help 08X SNP Analysis 10212011 _ SNP ML PyroMark ID SNP SNP Runs Well overview Frequencies Run info Statistics Peak heights Histogram E SNP Runs 12345 6 7 8 9 101112 C SNPmode Plates Analysis criteria Plate overview Well info 1 eC 259 W D4152010 SNPI223R oo 522 Notes 08192010 275 Simplex Entries M
9. Runs tab Expand the SQA Runs folder to select the run to be analyzed To analyze all samples in the run click Add all To analyze only selected samples highlight samples of interest and click Add 6 5 8 Under Analysis Setup select the corresponding library created in Step 6 5 6 in the Sequence Library drop down or select Browse to locate where the library is saved Click on Add to Select the play start button to begin analysis 6 5 9 After analysis generate reports and save When saving reports select the option Reports 6 6 Analysis of Pyrosequencing Data Below are examples showing the common target sequences 1 Detection of A H1N1 pdm09 wildtype H275 AT CAC CAC wildtype H275 L Gubareva Distribution Copy Effective 04 19 2012 Page 16 of 43 ERVICE p 9 Ry DEPARTMENT OF HEALTH amp HUMAN SERVICES Public Health Service r Centers for Disease Control HEALTH PS and Prevention CDC Atlanta GA 30333 2 Detection of A HIN1 pdm09 variant H275Y TAC TAT T TAC variant H275Y Note Arrow shows the presence of C incorporation for T CAC virus variant 4 5 are examples of pre pandemic A H1N1 pyrograms 4 Detection of pre pandemic A H1N1 wildtype H275 TAT GA CAT T wildtype L Gubareva Distribution Copy Effective 04 19 2012 17 43 SERVICES
10. 2012 Page 40 of 43 ERVICE p 9 Ry DEPARTMENT OF HEALTH amp HUMAN SERVICES Public Health Service A Centers for Disease Control of HEALTH x oy and Prevention CDC Atlanta GA 30333 2 Primers Table 1 RT PCR Primers Primer Sequence 5 3 Concentration Forward sw N1 F780 GGG GAA TGT YAA ATC AGT 20 uM Reverse sw N1 R1273 biot Biot CWA CCC AGA ARC GYC TTA 20uM TG Table 2 Sequencing Primer for amino acid at position 275 in the NA Primer Sequence 5 3 Concentration Sequence sw N1 275 F804 TGC MCC TAA TT 100 uM 3 RT PCR Product 20 ul of RT PCR product should be added to the respective wells of the plate containing the binding buffer solution 4 Target Entry Name A H1N1 pdm09 NA 275 5 Dispensation Order for SQA 5 CATG CATGCATGCATGCATGCATG should be visible under the expanded dispensation order window L Gubareva Distribution Copy Effective 04 19 2012 Page 41 of 43 6 SERVICES of HEALTH x oy Sy DEPARTMENT OF HEALTH amp HUMAN SERVICES Public Health Service A Centers for Disease Control and Prevention CDC Atlanta GA 30333 IdentiFire Library for Y275 Detection in Pandemic and Pre pandemic Influenza Viruses 6 1 In the library below a few examples of possible sequences are provided Examples A H1N1 pdm09 wildtype H275 means the virus 15 a 2009 pandemic A HINI carrying histidi
11. 3 2 5 3 3 5 3 4 Combine the components of the Superscript One Step RT PCR System to prepare a reaction mix Table 1 For multiple reactions prepare a master mix with some excess of reagent to allow for controls and pipetting error For example for 96 samples prepare a master mix for 100 samples 5 3 1 1 If using a 50 reaction volume aliquot 45 ul of the master mix into the wells of a 96 well PCR plate or into 0 2 ml PCR tubes on a cold block Add 5 ul of RNA from test and reference viruses in the corresponding well tube Close wells on the plate with stripped caps or foil and close tubes with caps 5 3 1 2 If using a 25 ul reaction volume Table 1 combine 22 5 ul of the master mix with 2 5 ul viral RNA Briefly centrifuge to ensure that all of the components are at the bottom of the amplification tube Place the plate tubes in the thermal cycler and run the RT PCR program see 5 2 Analysis of the RT PCR product should be made by gel electrophoresis to determine the production of an amplicon of the appropriate length L Gubareva Distribution Copy Effective 04 19 2012 Page 8 of 43 SERVICEs Us Public Health Service oF HEALTH x oy Table 1 RT PCR Reaction Components Component 2X Reaction Mix Forward Primer 20 uM Reverse Primer 20 uM SuperScript High Fidelity Enzyme Mix RNAse Inhibitor Nuclease Free Water Template RNA Total K DEPARTMENT OF HEALTH amp H
12. 4 World Health Organization Pyrosequencing Protocol for the Detection of the Substitution at Amino Acid Residue 275 in the Neuraminidase of 2009 Pandemic Viruses Using the PyroMark 096 ID Platform November 2012 The WHO Collaborating Centre for the Surveillance Epidemiology and Control of Influenza at the Centers for Disease Control and Prevention CDC Atlanta United States of America has made available this protocol for antiviral susceptibility testing of influenza A HINI pdm09 ERVIC prs Es Us of HEALTH g 9 Public Health Service Centers for Disease Control DEPARTMENT OF HEALTH amp HUMAN SERVICES and Prevention CDC Atlanta GA 30333 Sy Pyrosequencing Protocol for the Detection of the Substitution at Amino Acid Residue 275 the Neuraminidase of 2009 Pandemic H1N1 Viruses Using the PyroMark Q96 ID Platform Prepared by Molecular Epidemiology Team Virus Surveillance and Diagnosis Branch Influenza Division National Center for Immunization and Respiratory Diseases Centers for Disease Control and Prevention Effective 04 19 2012 Page 1 of 43 Distribution Copy L Gubareva of HEALTH x oy SERVICEs Us Sf DEPARTMENT OF HEALTH amp HUMAN SERVICES Public Health Service Centers for Disease Control K and Prevention CDC Atlanta 30333 Table of Contents II HI IV VI IX Introduction Pyroseq
13. PSQ96 Sample Prep Thermoplate Qiagen Vacuum Pump Laboport Orbital Plate Shaker Labnet Digital Heat Block VWR L Gubareva Distribution Copy Effective 04 19 2012 Page 25 of 43 4 SERVICEs Us oF HEALTH x oy and Prevention CDC Atlanta GA 30333 J DEPARTMENT OF HEALTH amp HUMAN SERVICES Public Health Service Centers for Disease Control Reagents and Supplies Sequencing primer Stocks of 100 uM in aliquots of 20 ul should be stored at 20 C The sequences of primers can be found in section VIII part 2 The primer sequence is provided for synthesis by the testing lab group Streptavidin Sepharose High Performance beads GE Healthcare PyroMark Binding Buffer Qiagen PyroMark Annealing Buffer Qiagen PyroMark Denaturation Solution Qiagen PyroMark 10X Wash Buffer Tris Acetate Qiagen Pyro Gold Reagents Qiagen Note Buffers Sepharose Beads and PyroGold Reagents should be stored at 4 C PSQ96 Plate Low 96 well clear plastic plates Qiagen 96 Ethanol Fisher 15 ml Falcon conical tubes Fisher Plastic Falcon pipettes and Pipette Aid Fisher Assorted pipettes and pipette tips Rainin 96 well plastic PCR reaction plates Fisher Distilled deionized water Mediatech Nuclease free water Ambion Plastic troughs trays for sample clean up Qiagen Filter probes for Vacuum prep tool Qiagen Plastic bottles for preparing buffers and reagents Nalgene Reference
14. Simplex Entries Entry ID r Default histograms Simplex Entries A HTNT pdm0SNA275 in Development eee 2 MET Regular Dispensations Sequence name Simplex Entries Recycle Bin eue 22 Sequences 33g Recycle Bin Primer Sequence to analyze Multiplex Entries Position names Dispensation order Position 1 Sequences aq Dispensation order E BATCGAETA SNP Runs Warning 0 El Error 0 zl Reference peaks Result Browser 4 4 SQA Samples Instrument Tools Help Duplicate Save Close Default user Instrument 1 Figure 4 Example of Defining SNP Entry Distribution Copy Effective 04 19 2012 Page 35 of 43 L Gubareva J Public Health Service DEPARTMENT OF HEALTH amp HUMAN SERVICES Centers for Disease Control es and Prevention CDC SERVICES Us Atlanta GA 30333 oF HEALTH PS oy A Figure 5 SNP Results for H275 with a Silent Mutation at Nucleic Acid Position 822 T C A Analysis using the dispensation generated for the major circulating virus variant ATT CATTA B Analysis using the dispensation generated for the silent virus variant ACT CATTA Label Should Face User Figure 6 PyroMark 096 ID Cartridge Setup Page 36 of 43 L Gubareva Distribution Copy Effective 04 19 2012 of HEALTH x oy ERVIC p SERVICES j DEPARTMENT OF HEALTH amp HUMAN SERVICES Public Health S
15. When at room temperature prepare binding buffer solution 60 ul of binding buffer solution is needed per sample For 96 samples combine 4 ml Binding Buffer 2 ml distilled deionized water and 300 ul Streptavidin Sepharose beads resuspend beads by inverting in a 15 ml conical tube Briefly mix the binding buffer solution by inverting Aliquot 60 ul of the binding buffer solution into the wells of a 96 well PCR plate that will be used for pyrosequencing the RT PCR product Transfer 20 ul of RT PCR product into the respective wells of the 96 well plate containing binding buffer solution Cover the plate with a plastic adhesive cover place on an orbital plate shaker and agitate at 1400 rpm for at least 10 minutes Allow the plate to continue shaking until ready to begin the sample clean up steps with the PyroMark Vacuum Prep Workstation Step 6 2 11 Prepare annealing buffer solution 40 ul of annealing buffer solution is needed per sample For 96 samples combine 4 4 ml Annealing Buffer and 20 ul of the required 100 uM sequencing primer final concentration 0 45 uM in a 15 ml conical tube Briefly vortex to mix the annealing buffer solution Aliquot 40 ul of the annealing buffer solution into the respective wells of 96 well clear plastic plate PSQ96 Plate Low Place the plate onto its respective position on the Vacuum Prep Workstation Figure 2 Set plastic reagent trays in their designated positions on the Vacuum Prep Worksta
16. g quality of RT PCR product background cartridge issues etc Names of vendors or manufacturers are provided as examples of suitable product sources only Inclusion does not imply endorsement 1 Purpose This protocol is to be used in conjunction with the Reverse Transcription Polymerase Chain Reaction RT PCR Protocol for the Generation of an Amplicon from Influenza Virus RNA section V Pyrosequencing SQA Protocol Using the PyroMark 96 ID Platform section VI and Reference Material section This protocol describes the pyrosequencing assay that is used for partial sequencing of the biotinylated amplicon generated in RT PCR to detect and quantify the ratio of wild type and mutant variants in a viral population The single nucleotide polymorphism SNP and allele quantification AQ analyses are performed on nucleotide 823 the first nucleotide of codon 275 CAC in the NA gene of the pandemic H1NI virus Cytosine C at the first position is present in the wild type viruses carrying histidine at position 275 in the NA protein whereas thymine T at this position is present in mutant virus variants carrying tyrosine at position 275 in the NA protein 2 Scope This procedure is for use by the community of Public Health Laboratories with basic experience in RNA isolation RT PCR and pyrosequencing 3 Equipment PyroMark 096 ID Instrument Qiagen PyroMark Vacuum Prep Workstation and Tool Qiagen
17. in the release and detection of light The amount of light signal produced is proportional to the amount of pyrophosphate that is released upon nucleotide incorporation making it a quantitative analysis Accurate quantitative analysis together with other characteristics makes the pyrosequencing method a desirable for the detection of influenza molecular markers associated with resistance to antiviral drugs Pyrosequencing technology on the Biotage QIAGEN platform is better suited for the analysis of short sequences sequencing up to 100 nucleotides accurately The quantitative analysis of nucleotide incorporation allows for an accurate SNP analysis enabling the detection of minor variants present at 10 or lower In one pyrosequencing run it is possible to analyze up to 96 samples PyroMark Q96 which is valuable in the high throughput screening for molecular markers associated with drug resistance This method is also less laborious than the conventional Sanger sequencing and preparation of the pyrosequencing reactions with RT PCR template along with the pyrosequencing run may be completed within 1 5 2 hours The pyrosequencing reaction In the pyrosequencing reaction biotinylated single stranded DNA templates are bound to Streptavidin Sepharose beads in a solution containing enzymes and substrates DNA polymerase assists in the incorporation of a dispensed deoxyribonucleotide triphosphate dNTP into the DNA resulting in the release of pyrophos
18. of HEALTH x oy and Prevention CDC Atlanta GA 30333 VIII Reference Material NOTES This document may not be used as a standalone document This document is provided for Research Use Only These protocols are not intended to be used for commercial development or for profit testing Please do not distribute these procedures to other laboratories or commercial entities This document provides essential information for the detection of the H Y substitution at position 275 in the NA of A HIN1 pdm09 influenza viruses These RT PCR pyrosequencing primers will generate sequences for pre pandemic A H1NI viruses as well The specific single nucleotide changes that are associated with the amino acid substitution H275Y in the NA are H CAC Y TAC for the A HIN1 pdm09 or gt for the pre pandemic A H1N1 The pyrograms and the IdentiFire library provided in this section contains sequences for both A H1N1 pdm09 and A H1N1 viruses so their sequences may be distinguished 1 Reference Viruses Below are examples of reference viruses carrying histidine H or tyrosine Y at position 275 which may be used in the NA 275 pyrosequencing assay Reference Subtype Variant A California 07 2009 A HINI pdm09 H275 A Washington 29 2009 A H1N1 pdm09 H275Y A North Carolina 39 2009 A HINI pdm09 H275Y A Washington 10 2008 275 A Florida 21 2008 HINI H275Y L Gubareva Distribution Copy Effective 04 19
19. on the tips of the respective filter probes of the Prep Tool and will be visible Note The tips of the probes are white like the beads The captured beads will appear as a concave white substance on the tips of the probes With the vacuum still ON transfer the Prep Tool into the reagent tray containing 70 ethanol and flush until the tray is almost emptied 15 25 seconds then lift to drain the tool This step allows any unbound amplicon or unincorporated reagents from the RT PCR reaction to be washed off With the vacuum still ON transfer the Prep Tool into the reagent tray containing Denaturation Solution and flush until the tray is almost emptied 15 25 seconds then lift to drain the tool This step allows for the denaturation of the double stranded DNA amplicon containing a biotin tagged single stranded DNA template The complementary strand synthesized from the non biotinylated primer will be washed away With the vacuum still ON transfer the Prep Tool into the reagent tray with 1X Wash Buffer and flush until the tray is almost emptied 15 25 seconds then lift to drain the tool for 30 40 seconds Turn the vacuum OFF and disconnect the Prep Tool from the vacuum line Place the Prep Tool into the 96 well PSQ96 Plate Low containing annealing buffer solution including sequencing primer Move the Prep Tool in circular motions 15 25 seconds in the PSQ96 Plate Low to release beads bound to the single stranded template Note Th
20. 247 SUA Hune C H5 HINT pdm NA 136 Import 1 1 199 1 1 223 H1N1pdm NA 275 H3N2 NA4 119 H3N2 NA 151 148 Target primers 3 2 151 423 primer Instrument Test SQA MET C3 SWL CLINICALS Vasiliy Recycle Bin Ej 90 08 8088 File View Figure 4 Example of PyroMark Q96 ID Software Showing SQA Run Setup Label Should Face User Figure 5 PyroMark Q96 ID Cartridge Setup L Gubareva Distribution Copy Effective 04 19 2012 Page 23 of 43 ERVIC NC Es 2 DEPARTMENT HEALTH amp HUMAN SERVICES Public Health Service Centers for Disease Control of HEALTH x oy K and Prevention CDC Atlanta 30333 PyroMark ID 1 0 SQA Analysis 10202011_ML m File Windows Help Peak heights Alignment 5 Plates Analysis criteria Plate overview Well info Statistics File Layout Notes 1 Entry ID H1N1pdm NA 275 Dispensstion order CATGCATGCATGCATGCATG Sample ID Description H275Y Notes Y MAO A 071 q 072 q 07 q MA 072 q MA 08 q Ma 081 MA 082 09 q Ma 09 031 Well B1 MA 092 1 maos q MA 106 ATCACTATGAGG q MA 101 af q MA 101 MA 101 q MA 10 MA 102 MA 102 matic 111 MATH
21. A 12172009 Diganos 1 12292009 Dia Entry ID H1N1pdm NA 275 F804 primer 1 33g a Bangladesh Suus to ATC TACTATGAGGAATGCTCCT 9 C Program Files Pyros in 3 Multiplex Entries order Sample 10 2010807125 GA Instrument Test SNP WellA10 Description 275 o Mamie Quality Passed 06082011 SNF IH 275 4 Analysis results Sequences 06152011 SNF His to zi T O0 C 100 0 AQ Analyzed 10 21 2011 10 29 01 MA 06172011 SNF by user Default user AQ MA 07072011 ML 07132011 5 4 10212011 5 ATO xj 07222011 Sur 07222011 Sur MA 07272011 07282011 ML 08082011 SNF 08172011 SNF 09062011 5 09082011 5 09132011 ML 09152011 SNF 03152011 SNF 09162011 Ban 09282011 ML M 10132011 ML MA 10192011 SN MA 10192011 SN 4 wo GA z m 7 5 5 Result Browser SQA MA 10212011 5N Samples 2 ca Vasiliy muet l m mem o E _ _ _ parcem Default user PyroMark ID Figure 9 Example of Run Analysis in AQ Mode L Gubareva Distribution Copy Effective 04 19 2012 Page 39 of 43 ERVICE p 9 Ry DEPARTMENT OF HEALTH amp HUMAN SERVICES Public Health Service r Centers for Disease Control
22. Build pattern assigned Plate ID MA 10202011 ML Run type SQA Run name MA 10202011 ML Run notes None well Sample ID Description Al 2011814359 H275Y Bl 2011814350 H275Y cl 2011814354 H275Y D1 2011814355 H275Y El 2011814361 H275Y Fl 2011814362 H275Y Gl 2011814364 H275Y Hl 2011814365 H275Y A2 2011814367 H275Y B2 2011814351 H275Y C2 2011814352 H275Y D2 2011814357 H275Y E2 2011814358 H275Y F2 2011814591 H275Y G2 2011814596 H275Y H2 2011814597 H275Y A3 2011814598 H275Y B3 2011814599 H275Y 2011814600 H275Y D3 2011814605 H275Y E3 2011814606 H275Y F3 2011814607 H275Y G3 2011814611 H275Y H3 2011814588 H275Y 2011814738 H275Y B4 2011814743 H275Y 2011814744 H275Y 48 Figure 1 Example of Run Sample Sheet for PyroMark Q96 ID Platform L Gubareva Distribution Copy Effective 04 19 2012 Page 20 of 43 DEPARTMENT OF HEALTH amp HUMAN SERVICES Public Health Service Centers for Disease Control and Prevention CDC Atlanta 30333 J Ethanol Denaturation Solution LE PCR plate Vacuum Prep Tool _ Biotage Figure 2 The PyroMark Q96 ID Vacuum Prep Workstation Effective 04 19 2012 Page 21 of 43 L Gubareva Distribution Copy Public Health Service p SERVICES DEPARTMENT OF HEALTH amp HUMAN SERVICES Centers for Disease Control and Prevention CDC b Atlanta 30333 of HEALTH x oy PyroMark ID 1 0 D
23. HEALTH amp HUMAN SERVICES Public Health Service Centers for Disease Control HEALTH x and Prevention CDC Atlanta GA 30333 IV Abbreviations A HIN1 pdm09 the 2009 A HINI pandemic influenza virus A HINI the pre pandemic A HINI influenza virus AQ allele quantification dNTP deoxyribonucleotide triphosphate H histidine neuraminidase pyrophosphate RT PCR reverse transcription polymerase chain reaction SNP single nucleotide polymorphism SQA sequence analysis Y tyrosine amino acid numbering by subtype L Gubareva Distribution Copy Effective 04 19 2012 Page 5 of 43 SERVICES _ DEPARTMENT OF HEALTH amp HUMAN SERVICES Public Health Service Centers for Disease Control and Prevention CDC Atlanta 30333 HEALTH x V Reverse Transcription Polymerase Reaction RT PCR Protocol for the Generation of an Amplicon from Influenza Virus RNA NOTES This procedure is provided for Research Use Only These protocols are not intended to be used for commercial development or for profit testing Please do not distribute these procedures to other laboratories or commercial entities Names of vendors or manufacturers are provided as examples of suitable product sources only Inclusion does not imply endorsement 1 Purpose This protocol describes the RT PCR procedures used for cDNA synthesis and
24. MATH Y 111 q q Test 2 Testi Y test 4 test 5 w MET H O SWL CLINIC Vasiliy Recycle Bin SDA Entries 50 Runs Analysis results SQA Analyzed 10 21 2011 9 19 27 AM by user Default user SQA Version 1 0 0 Result ATCACTATGAGG Quality Passed quality window 20 4 12 namai N char N foiled Samples Instrument Tools aam 2 Default user PyroMark ID Figure 6 Example of an SQA Run Analysis L Gubareva Distribution Copy Effective 04 19 2012 24 43 ERVICE p 9 Ry DEPARTMENT OF HEALTH amp HUMAN SERVICES Public Health Service Centers for Disease Control and Prevention CDC Atlanta GA 30333 oF HEALTH x oy VII Pyrosequencing Single Nucleotide Polymorphism SNP Analysis Protocol Using the PyroMark Q96 ID Platform NOTES This procedure is provided for Research Use Only These protocols are not intended to be used for commercial development or for profit testing Please do not distribute these procedures to other laboratories or commercial entities Analysis of samples using the SNP assay requires knowledge of the sequence To assure that there is no natural variation within the targeted sequence it is recommended that the SQA assay be run first Moreover compared to SQA SNP analysis is more susceptible to interference by various factors e
25. UMAN SERVICES 1 Reaction 1 Reaction 50 ul volume 25 ul volume 25 ul 12 5 ul 1 ul 0 5 pl 1 ul 0 5 pl 1 ul 0 5 ul 0 5 ul 0 25 ul 16 5 ul 8 25 ul Sul 2 5 ul 50 ul 25 ul Centers for Disease Control and Prevention CDC Atlanta GA 30333 Note One of the RT PCR primers used is biotinylated refer to section VIII part 2 6 Other SOP s and Documents User s Guide for Superscript One Step RT PCR System with Platinum Taq High Fidelity L Gubareva Distribution Copy Effective 04 19 2012 Page 9 of 43 SERVICES Us Sf DEPARTMENT OF HEALTH amp HUMAN SERVICES Public Health Service Centers for Disease Control K and Prevention CDC Atlanta 30333 of HEALTH x oy VI Pyrosequencing Sequence Analysis SQA Protocol Using the PyroMark Q96 ID Platform NOTES This procedure is provided for Research Use Only These protocols are not intended to be used for commercial development or for profit testing Please do not distribute these procedures to other laboratories or commercial entities When the presence of the H275Y variant is detected it is suggested that the SNP analysis be run which allows for allele quantification proportion of H275 and H275Y variants C or T at nt823 respectively Names of vendors or manufacturers are provided as examples of suitable product sources only Inclusion does not imply endorsement 1 Purpose This protocol describes the pyroseque
26. Viruses and Biotinylated Amplicon Template 5 1 These reference viruses are to be used directly for viral RNA isolation and pyrosequencing This is because virus passage in cell culture can alter the genetic make up of the virus which may affect the pyrosequencing results For example an H275Y variant could revert to a wild type sequence H275 Examples of reference viruses for a particular target may be found in part of section VIII 5 2 A biotinylated amplicon is generated using isolated viral RNA in an RT PCR reaction as described in section V L Gubareva Distribution Copy Effective 04 19 2012 Page 26 of 43 SERVICEs Us of HEALTH x oy 6 Procedure Centers for Disease Control Sf DEPARTMENT OF HEALTH amp HUMAN SERVICES Public Health Service and Prevention CDC Atlanta GA 30333 6 1 X Preparation of Run Sample Sheet and Import into PyroMark ID Platform 6 1 1 6 1 2 Prepare an MS Excel spreadsheet of samples to be tested Figure 1 and save as a text tab delimited file Create a folder with the current date the date the run is to be performed and name the run sample sheet as the current date If necessary include additional information on the file name Note The Type should read SNP Import the saved text file into the PyroMark ID platform as follows 10 Open the Pyrosequencing Data Exchange Tool 11 Click on File Click on Login 12 Select login to im
27. age Reconstitute both the enzyme E and the substrate S in 620 ul nuclease free water Swirl to mix DO NOT vortex The reconstituted enzyme E and the substrate S are stable for at least 5 days at 4 or for one freeze 20 C thaw cycle Ensure that the dispensation pins needles on the cartridge are clean and not bent before use To do so fill each channel in the cartridge with distilled deionized water seal the channel and apply pressure Water should stream straight down out of the pin Remove the excess water and add the corresponding amount of enzyme substrate and nucleotides see 6 3 8 into each channel of the cartridge with the label facing the user as shown in Figure 5 Load the volumes carefully to ensure that air bubbles are not created L Gubareva Distribution Copy Effective 04 19 2012 Page 14 of 43 of HEALTH x oy ERVICE p 9 Ry 6 3 12 6 3 13 6 3 14 6 3 15 Centers for Disease Control and Prevention CDC Atlanta GA 30333 St DEPARTMENT OF HEALTH amp HUMAN SERVICES Public Health Service Note If the water does not stream through the pins of the cartridge the pins may be clogged Soaking the pins in warm water may help unclog the pins A cartridge with clogged pins should not be used and a new cartridge may be needed Load the PSQ96 Plate Low containing the annealed DNA template and sequencing primer onto the PyroMark Q96 ID instrument Load the cartrid
28. amplification of influenza viral RNA isolated from clinical specimens or grown viral isolates The RT PCR primers are found in Reference Material section VIII The RT PCR amplicon generated is used in the pyrosequencing protocol s section VI and or VII 2 Scope This procedure is for use by the community of Public Health Laboratories with basic experience in RNA isolation RT PCR and pyrosequencing 3 Equipment Thermal Cycler DNA Engine Tetrad 2 Bio Rad 4 Reagents and Supplies RT PCR primer Stocks of 20 uM in aliquots of 20 ul should be stored at 20 C The sequences of primers can be found in section VIII part 2 The primers are provided for synthesis by the testing lab group Superscript III One Step RT PCR System with Platinum Taq High Fidelity Invitrogen Protector RNase Inhibitor Roche 1 5 ml sterile Eppendorf tubes Fisher Flat Top 96 well PCR reaction plates ISC BioExpress Strip Caps for Flat Top PCR reaction plates ISC BioExpress 0 2 ml PCR tubes ISC BioExpress Assorted pipettes and pipette tips Rainin L Gubareva Distribution Copy Effective 04 19 2012 Page 6 of 43 SERVICES SV 2 HEALTH PS 4 DEPARTMENT HEALTH amp HUMAN SERVICES Public Health Service Centers for Disease Control and Prevention CDC Atlanta GA 30333 Cold block for 96 well plate ISC BioExpress 2 Agarose E Gels 96 Invitrogen E Base electrophoresis system Invitrogen
29. are currently two classes of drugs that are available M2 blockers adamantanes and neuraminidase inhibitors NAIs The emergence of influenza viruses resistant to these antiviral drugs have yielded a need for the extensive surveillance of molecular markers associated with antiviral resistance A variety of methods are available for the monitoring of molecular markers associated with drug resistance Sanger sequencing high resolution melting curve and real time reverse transcriptase PCR have been employed for the analysis of these molecular markers within the influenza virus genome Although these methods are used for the analysis of influenza virus genomic variation they have limitations For example real time reverse transcriptase PCR is dependent on the detection of specific mutations and is unable to detect additional mutations The Sanger sequencing method has the ability to identify mutations but it is not suitable for quantitative single nucleotide polymorphism SNP analysis Sanger sequencing is also laborious time consuming and it can be difficult to interpret the sequence chromatograms from samples containing multiple virus variants quasispecies Pyrosequencing technology differs from other sequencing technologies during DNA synthesis it generates a sequence in real time Nucleotide sequences are determined by the sequential addition and subsequent incorporation of nucleotides which trigger a cascade of enzymatic reactions resulting
30. e SQA Runs icon Figure 4 and expand the Import folder to see the imported run double click to open the file Under the General tab in the drop down Instrument Parameters menu select Instrument Parameters Code 000 The number for X should match what is on the reagent cartridge to be used Instructions for the setup of a new Instrument Parameter are provided with the reagent cartridge Select a dispensation entry 6 3 6 1 Go to the Setup tab and under Entry click to select the dispensation order Figure 4 6 3 6 2 the target specific entry is not in the Entry list then create a new SQA entry To create a new SQA entry click on the SQA Entries icon and right click on the SQA folder and select New Entry Under Entry ID type in the name found in part 4 of section Under the Dispensation order tab enter the sequence found in part 5 of section VIII in the dispensation order box The sequence should be visible under the Expanded dispensation order box Figure 3 Click on the Pencil tool and highlight all the wells that are to be used The name of the entry should now appear in these wells Click the View tab to reveal a drop down menu Select to see the volumes of the enzyme E substrate S and nucleotides A C G and T that need to be added to the cartridge Remove the PyroMark Gold reagent kit from 4 C stor
31. e mixture on the plate should now appear cloudy and the white concave substance should no longer be present on the tips of the probes Denaturation of template primer mixture Place the PSQ96 Plate Low onto the PSQ96 Sample Prep Thermoplate holder on the 89 heat block for 4 minutes Do not leave the PSQ96 Plate Low on the heat block for more than 4 minutes Annealing template and primer Remove the PSQ96 Sample Prep Thermoplate holder with the PSQ Plate Low from the 89 heat block and allow it to cool on a bench for 10 minutes Remove the PSQ Plate Low from the PSQ96 Sample Prep Thermoplate holder and allow it to rest directly on the bench for an additional 4 minutes to end the annealing step Note During the 10 minutes when the plate on the holder is cooling Step 6 2 17 Steps 6 3 1 through 6 3 11 can be completed L Gubareva Distribution Copy Effective 04 19 2012 Page 13 of 43 of HEALTH x oy ERVICE p 9 Ry Centers for Disease Control and Prevention CDC Atlanta GA 30333 St DEPARTMENT OF HEALTH amp HUMAN SERVICES Public Health Service 6 3 Pyrosequencing Using the PyroMark Q96 ID Equipment and Software 6 3 1 6 3 2 6 3 3 6 3 4 6 3 5 6 3 6 6 3 7 6 3 8 6 3 9 6 3 10 6 3 11 Open PyroMark Q96 ID software Enter Login name Enter password click OK Select SQA on the left side of the program window Figure 3 To start a new run click on th
32. efine SQA entry HIN1pdm NA 275 ff File Windows Help Define SQA entry HiNipdm NA 275 Entry ID SOA H1N1pdm NA 275 C Dispensations in Development MET Regular Dispensations Dispensation order Primers gt 59 5096 SOA Test 3 Recycle Bin Entered dispensation order CATGCATGCATGCATGCATG 50 Entries 5 Expanded dispensation order SQA Runs CATGCATGCATGCATGCATG Samples Instrument Tools Help Duplicate Save Close Default user Instrument 1 Figure 3 Example of Defining SQA Entry Effective 04 19 2012 22 of 43 L Gubareva Distribution Copy ERVIC E DEPARTMENT OF HEALTH amp HUMAN SERVICES Public Health Service Centers for Disease Control E and Prevention CDC e Atlanta 30333 PyroMark ID 1 0 SQA Run Setup 10202011_ML File Windows Help SQA Run Setup 10202011 ML PyroMark ID SNP General Setup EE 21 25 SQA Runs Enty Sample D Notes cameratest 11 23 2010 2 22 10_HN Entry Entry ID H1N1pdm NA 275 04072010 275 223 239 W test M2 H1N1pdm NA 275 Notes SQA Entries 2007 R B NA 198 F553 primer Dispensation order CATGCATGCATGCATGCATG ao CLIA Competencies 222 C Diagnostic specimen runs 274 H1N1pdm H4 222 F715 primer H1N1pdm NA
33. ervice Centers for Disease Control K and Prevention CDC Atlanta 30333 oMark ID 1 0 SNP Analysis 12011_SNP_ML f File Windows Help ex Analysis 10212011 5 PyroMark ID Statistics Peak heights Histogram Well overview Genotype Run info 20 SNP Runs 345678 9 101112 SNPmode eG 04152010 SNPI223R 08192010 275 12172009 Diganos 5 Plates Analysis criteria Plate overview Well info File Layout Notes 1 Well A10 Simplex Entries 12292009 Dia 10 HIN1pdm NA 275 F804 primer 33g 1 Bangladesh Sequence to ATC TACTATGAGGAATGCTCCT 1 C Program Files Pyros ae CS Multiplex Entries 9 1 Diagnostic specimen ru EET a Import Sample ID 2010807125 H Instrument Test SNP Mamie Quality All Prsi 06082011 SNF Result Sequences MA 06152011 SNF 06172011 SNF 07072011 4 07132011 SNF 4 10212011 SNPOME xj q 07222011 q 07222011 Sur q 07272011 07282011 ML MA 08082011 SNF 08172011 SNF 09062011 5 09082011 5NF 09132011 ML 09152011 SNF 09152011 SNF 09162011 Ban
34. f analysis for example T T T C or C C Figure 8 AQ mode will provide the percentage of each nucleotide present Figure 9 Under the Well overview tab select the SNP or AQ mode and click to analyze all the samples in the run To analyze only wells of interest first highlight the wells you wish to analyze and then click Selected When analysis is complete click Save Click on the Report tab in either mode select Custom delimited short and save the run as txt file In Microsoft Excel go to import external date browse to locate the run file and open it choose Delimited click on Next and select Semi colon and other Click on Finish This generates an excel sheet with summarized results of the SNP or AQ The table can be edited as needed Pyrograms may also be generated While in either mode select the Report tab Here you may choose all or select specific wells as well as edit the number of rows to allow for multiple pyrograms to be shown per page L Gubareva Distribution Copy Effective 04 19 2012 Page 29 of 43 SERVICEs J DEPARTMENT OF HEALTH amp HUMAN SERVICES Public Health Service Centers for Disease Control and Prevention CDC Atlanta GA 30333 oF HEALTH x oy Note If only specific pyrograms are needed you must select these wells before selecting the Report tab and then click save This will generate a wo
35. ge containing enzyme substrate and nucleotides onto the PyroMark Q96 ID instrument with the cartridge label facing towards the user From the drop down menu in the Instrument option select PyroMark ID Note The specific name of the instrument may vary depending on the setup of the machine Ensure that the PSQ96 Plate Low and cartridge have been loaded into the instrument selected in the drop down menu Click to start the pyrosequencing reaction Ensure that the substrate peak appears after the substrate is added to confirm that the enzyme and substrate reagents are working 6 4 Cleaning the Instrument 6 4 1 6 4 2 6 4 3 6 4 4 To clean the Prep Tool place the hand tool in the reagent tray containing distilled deionized water reconnect the vacuum line to the hand tool and turn ON the vacuum Flush until the tray is almost emptied 1 2 minutes Turn the vacuum OFF Remove the reagent trays from the Vacuum Prep Workstation discard excess solutions and rinse the reagent trays with distilled deionized water Set the reagent trays upon paper towels on the bench to dry When the Pyrosequencing run is finished remove and discard the PSQ96 Plate Low from the PyroMark Q96 ID instrument Remove the cartridge from the PyroMark Q96 ID instrument and discard unused enzyme substrate and nucleotides Wash the cartridge at least 3 times with distilled deionized water and check to make sure that all di
36. kID Figure 2 Example of a SNP Run for PyroMark Q96 ID Platform L Gubareva Distribution Copy Effective 04 19 2012 Page 33 of 43 ERVIC p SERVICES DEPARTMENT OF HEALTH amp HUMAN SERVICES Public Health Service Centers for Disease Control E and Prevention CDC e Atlanta 30333 Fie Windows Help Sx SNP Run Setup PyroMark ID SNP SNP Runs General Setup 08182010 3 2 Enty Sample ID Notes 08182010 N 275 08202010 275 08232011 Traininc 08312010 NA275_ 08312010 275 09022010 275 09032010 275_ 0907010 275 t 0907010 NA275 lt 10082010 275 10182010 79 11052010 79 11182010 1223 _1 12072009 HA222 W 12162009 Diag_P 12212009 New Il 7 6 2010 1142010 275 X MA2 12 2010_NA222 q 2 12 2010 NA27E SNP B152 22210 New Folder Instrument Test SNP Entry Simplex Multiplex 1 1 275 804 primer Entry ID Notes Sequence to analyze ATC TACTATGAGGAATGCTCCT Dispensation order GATCGACTA H1N1pdm NA 275 F804 primer Simplex Entries Reuse entries 71 Zh 1 2 Multiplex Entries enm mi Ee en z 2 7 5 m
37. ls that are to be used The name of the entry should now appear in these wells Click the View tab to reveal a drop down menu Select to see the volumes of the enzyme E substrate S and nucleotides A C G and T that need to be added to the cartridge Remove the PyroGold reagent kit from 4 storage Reconstitute both the enzyme E and the substrate S in 620 ul nuclease free water Swirl to mix DO NOT vortex The reconstituted enzyme E and the substrate S are stable forat least 5 days at 4 C for one freeze 20 C thaw cycle Ensure that the dispensation pins needles on the cartridge are clean and not bent before use To do so fill each channel in the cartridge with distilled deionized water seal the channel and apply pressure Water should stream straight down out of the pin Remove the excess water and add the corresponding amount of enzyme substrate and nucleotides see 6 3 8 into each channel of the cartridge with the label facing the user as shown in Figure 6 Load the volumes carefully to ensure that air bubbles are not created Note If the water does not stream through the pins of the cartridge the pins may be clogged Soaking the pins in warm water may help unclog the pins A cartridge with clogged pins should not be used and a new cartridge may be needed L Gubareva Distribution Copy Effective 04 19 2012 Page 28 of 43 of HEALTH x oy ERVICE p 9 Ry
38. lysis in AQ Mode L Gubareva Distribution Copy Effective 04 19 2012 Page 31 of 43 ERVIC oF HEALTH PS Centers for Disease Control 2 DEPARTMENT HEALTH amp HUMAN SERVICES Public Health Service and Prevention CDC Mee Atlanta 30333 Booki Microsoft Excel Home Insert PageLayout Formulas Data Review View e B a cmn AP aT m ceneras E A A eee zl ix elete B EE son Clipboard amp Font g Alignment Number 2 Styles Cells Editing 05 m m m mm mmm m mm ma 1 Importtype fetch _2 System type MA 3 jPlatetype PSQ96Plate 4 Build patterr assigned _5 pPlate ID MA 10192011 SNP ML _6 Runtype SNP 7 10192011 SNP ML _8 Runnotes None _9 Well Sample ID Description 10 1 2010807125 275 11 1 2010807318 H275Y 212 1 2010808552 H275Y 13 01 2010808560 H275Y 14 E1 2010808601 H275Y 15 1 2010808846 275 16 G1 2010809743 H275Y 17 2010807154 275 18 2 2010807160 275 19 B2 2010807169 275 _20 2 2010808530 275 _21 02 2010808562 275 22 2 2010808567 275 _23 2 2010808606 275 24 62 2010808673 275 25 2 2010808708 275 HC W Sheet Sheet Sheets 262 Ready _ e y Figure 1 Example
39. n CDC Atlanta GA 30333 Note Buffers Sepharose Beads and PyroGold Reagents should be stored at 4 C PSQ96 Plate Low 96 well clear plastic plates 96 Ethanol 15 ml Falcon conical tubes Plastic Falcon pipettes and Pipette Aid Assorted pipettes and pipette tips 96 well plastic PCR reaction plates Distilled deionized water Nuclease free water Plastic troughs trays for sample clean up Filter probes for Vacuum prep tool Plastic bottles for preparing buffers and reagents Qiagen Fisher Fisher Fisher Rainin Fisher Mediatech Ambion Qiagen Qiagen Nalgene Reference Viruses and Biotinylated Amplicon Template 5 1 These reference viruses are to be used directly for viral RNA isolation and pyrosequencing This is because virus passage in cell culture can alter the genetic make up of the virus which may affect the pyrosequencing results For example an H275Y variant could revert to a wild type sequence H275 Examples of reference viruses may be found in part 1 of section 5 2 A biotinylated amplicon is generated using isolated viral RNA in an RT PCR reaction as described in section V Procedure 6 1 Preparation of Run Sample Sheet and Import into PyroMark ID Platform 6 1 1 Prepare an MS Excel spreadsheet of samples to be tested Figure 1 and save as a text tab delimited file txt 6 1 2 Import the saved text file into the PyroMark ID platform as follows 1 Open the Pyro
40. ncing assay that is used for partial sequencing of the biotinylated amplicon generated in RT PCR This protocol is to be used in conjunction with the Reverse Transcription Polymerase Chain Reaction RT PCR Protocol for the Generation of an Amplicon from Influenza Virus RNA section V and Reference Material section VIII 2 Scope This procedure is for use by the community of Public Health Laboratories with basic experience in RNA isolation RT PCR and pyrosequencing 3 Equipment PyroMark Q96 ID Instrument Qiagen PyroMark Vacuum Prep Workstation and Tool Qiagen PSQ96 Sample Prep Thermoplate Qiagen Vacuum Pump Laboport Orbital Plate Shaker Labnet Digital Heat Block VWR 4 Reagents and Supplies Sequencing primer Stocks of 100 uM in aliquots of 20 ul should be stored at 20 The sequence of the primer can be found in section VIII part 2 The primer sequence is provided for synthesis by the testing lab group Streptavidin Sepharose High Performance beads GE Healthcare PyroMark Binding Buffer Qiagen PyroMark Annealing Buffer Qiagen PyroMark Denaturation Solution Qiagen PyroMark 10X Wash Buffer Tris Acetate Qiagen PyroMark Gold Reagents Qiagen L Gubareva Distribution Copy Effective 04 19 2012 Page 10 of 43 SERVICEs Us oF HEALTH x oy DEPARTMENT OF HEALTH amp HUMAN SERVICES Public Health Service Centers for Disease Control and Preventio
41. ne at position 275 A HIN1 pdm09 variant Y275 means the virus is a 2009 pandemic A H1N1 carrying the Y275 substitution etc 6 2 The below library also includes additional sequences containing silent mutations For example A HINI pdm09 wildtype H275 T822C with a silent mutation at nucleotide 822 and pre pandemic H1N1 wildtype H275 with silent mutations for amino acids 279 and 280 gt A H1N1 pdm09 wildtype H275 ATCACTATGAGGAATGCTCC gt A H1N1 pdm09 variant H275Y ATTACTATGAGGAATGCTCC gt A H1N1 pdm09 wildtype H275 T822C ACCACTATGAGGAATGCTCC gt A H1N1 pdm09 variant H275Y T822C ACTACTATGAGGAATGCTCC gt Pre pandemic H1N1 wildtype H275 TTCATTATGAGGAATGCTCT gt Pre pandemic H1NI wildtype H275 TTCATTATGAGGAATGTTCC gt Pre pandemic H1N1 variant H275Y TTTATTATGAGGAATGCTCT gt Pre pandemic H1N1 variant H275Y TTTATTATGAGGAATGTTCT gt Pre pandemic H1N1 variant H275Y TTTATTATGAGGAATGTTCC L Gubareva Distribution Copy Effective 04 19 2012 Page 42 of 43 SERVICES J DEPARTMENT OF HEALTH amp HUMAN SERVICES Public Health Service Centers for Disease Control and Prevention CDC Atlanta GA 30333 of HEALTH x oy IX References Deyde V M and L V Gubareva Influenza genome analysis using pyrosequencing method current applications for a moving target Expert Review of Molecular Diagnostics 2009 9 5 493 509 Deyde V M T Nguyen R A Bright A Balish B Shu S Lindstrom A
42. of a Run Sample Sheet for PyroMark Q96 ID Platform L Gubareva Distribution Copy Effective 04 19 2012 Page 32 of 43 am SERVICES 2 DEPARTMENT HEALTH amp HUMAN SERVICES Public Health Service Centers for Disease Control and Prevention CDC D Atlanta GA 30333 oF HEALTH PS f Fie Windows SNP Run Setup Training SNP PyroMark ID SNP SNP Runs General Setup SNP Runs 01242011 H3N2 seq primer test SNP TS Geras 29 01242011 H3N2 VM primer test SNP TS Training SNP 01252011 IRR stocks SNP TS Instrument parameters Simplex Entries 012720111AR stocks SNP TS Instruments Parameters Code 0004 gt 01282011 3 2 seq primer test SNP TS Plate ID 04152010 SNP275 HN ee 329 40152010 5 2238 HN Training SNP Multiplex Entries MA 01282011 Proficiency Panel AT SNP Reagent ID Bangladesh 2 CLIA Proficiency Cartridge ID m Diagnostic specimen runs DEEP HN Sequences Import Run notes o ERN m C Instrument Test SNP Mamie q 07142011 SNP ML SNP Runs MA 07112011 SNP Kat ML2011703368 07132011 SNP H5 07152011 SNP ML 08012011 SNP 08052011 SNP Result Browser 1 Training SNP C 0A Recycle Bin 1 4 SOA Samples Instrument Tools Help Duplicate Instrument QiagenPyroMarkID X Run Save Close Default user GiagenPyroMar
43. phate PPi The PPi is then converted into ATP via ATP sulfurylase in the presence of adenosine 5 phosphosulfate APS The ATP is used by luciferase to aid in the production of a light signal by converting luciferin to oxyluciferin The height of each peak produced by this light signal as can be seen in a pyrogram is proportional to the amount of ATP processed To avoid the recognition of deoxyadenosine triphosphate dATP by luciferase an analog of ATP deoxyadenosine alfa thio triphosphate dATPaS is used by the DNA polymerase for incorporation Apyrase is also present in the solution and is used to degrade any unincorporated nucleotides L Gubareva Distribution Copy Effective 04 19 2012 Page 3 of 43 J Public Health Service DEPARTMENT OF HEALTH amp HUMAN SERVICES Centers for Disease Control He and Prevention CDC SERVICES Us Atlanta GA 30333 oF HEALTH PS oy Pyrosequencing Assay Flow Chart Influenza subtype determination and RNA isolation are not included in this protocol III Safety Information These protocols can be performed under biosafety level 1 or 2 BSL 1 BSL 2 conditions should be in compliance with institutional regulatory requirements by trained personnel with appropriate personal protective equipment PPE using the standard aseptic technique Page 4 of 43 L Gubareva Distribution Copy Effective 04 19 2012 ERVICE p 9 Ry DEPARTMENT OF
44. port database 13 Enter Username 14 Enter Password 15 Click 16 Click Import 17 Browse to find run sample sheet saved in step 6 1 1 18 Click Import Prompt appears saying Import done Click OK and close the Pyrosequencing Data Exchange Tool Note This is the default setup for the platform and may be different if the user has altered the original setup profile 6 2 Setup of Pyrosequencing Reaction See part 6 2 in Pyrosequencing SQA Protocol Using the PyroMark Q96 ID Platform section VI 6 3 Using the PyroMark Q96 ID Equipment and Software 6 3 1 Open PyroMark Q96 ID software 6 3 2 Enter Login name Enter password click 6 3 3 Select SNP on the left side of the program window Figure 8 To start a new run click on the SNP Runs icon Figure 8 and expand the Import folder to see the imported run double click to open the file imported in step 6 1 2 6 3 4 Under the General tab in the drop down Instrument Parameters menu select Instrument Parameters Code 000X The specific number for X should match what is on the reagent cartridge to be used Instructions for the setup of a new instrument parameter are provided with the reagent cartridge L Gubareva Distribution Copy Effective 04 19 2012 Page 27 of 43 SERVICEs Us of HEALTH x oy 6 3 5 Centers for Disease Control and Prevention
45. rd document with the pyrograms of the run and the results of the analysis 6 6 Analysis of Pyrosequencing Data Below are examples showing the common target sequences 1 Detection of A H1N1 pdm09 wildtype H275 AT CAC TAT CAC wildtype H275 2 Detection of A HIN1 pdm09 variant H275Y TAC TAT L Gubareva Distribution Copy Effective 04 19 2012 Page 30 of 43 ERVICE p 9 KS DEPARTMENT OF HEALTH amp HUMAN SERVICES Public Health Service A Centers for Disease Control oF HEALTH x oy and Prevention CDC Atlanta GA 30333 3 Detection of A HIN1 pdm09 mixture H275H Y AT C T AC 428 275 57 2 d v es 7 Notes See notes in part 7 of Pyrosequencing SQA Protocol Using the PyroMark 096 ID Platform section VI 8 Other SOPs and Documents PyroMark 096 ID User s Manual Index of Figures Figure 1 Example of a Run Sample Sheet for PyroMark Q96 ID Platform Figure 2 Example of a SNP Run for PyroMark 096 ID Platform Figure 3 Example of PyroMark Q96 ID Software Showing SNP Run Setup Figure 4 Example of Defining SNP Entry Figure 5 SNP Results for NA H275 with a Silent Mutation at Nucleic Acid Position 822 Figure 6 PyroMark Q96 ID Cartridge Setup Figure 7 Example of a Completed SNP Run Figure 8 Example of Run Analysis in SNP Mode Figure 9 Example of Run Ana
46. sequencing Data Exchange Tool 2 Click on File Click on Login 3 Select login to import database 4 Enter Username 5 Enter Password 6 Click OK 7 Click Import 8 Browse to find run sample sheet saved in Step 6 1 1 9 Click Import Prompt appears saying Import done Click OK and close the Pyrosequencing Data Exchange Tool Note This is the default setup for the platform and may be different if the user has altered the original setup profile L Gubareva Distribution Copy Effective 04 19 2012 Page 11 of 43 of HEALTH x oy SERVICEs Centers for Disease Control and Prevention CDC Atlanta GA 30333 St DEPARTMENT OF HEALTH amp HUMAN SERVICES Public Health Service 6 2 Setup of Pyrosequencing Reaction 6 2 1 6 2 2 6 2 3 6 2 4 6 2 5 6 2 6 6 2 7 6 2 8 6 2 9 6 2 10 Set the digital heat block to 89 C place the PSQ96 Sample Prep Thermoplate holder upon the heat block and allow the plate to heat to 89 Remove the Streptavidin Sepharose beads PyroMark Binding Buffer Annealing Buffer Denaturation Solution 1X Wash Buffer and 7096 Ethanol from 4 C storage and place at room temperature Note Dilute PyroMark 10X Wash Buffer in distilled deionized water 1 10 to make the 1X working solution of wash buffer listed above Dilute 96 ethanol to 70 ethanol by combining 700 ml of 9696 ethanol and 280 ml of distilled deionized water
47. spensation pins are clean by applying pressure to the top of each of the channels in the cartridge see Note for 6 3 11 6 5 Analysis of Pyrosequencing Data Using IdentiFire Software 6 5 1 When the SQA run is complete click Close 6 5 2 Reopen the run from the import folder to reveal the SQA analysis window Figure 6 6 5 3 Under the Analyze option select All to analyze all the samples in the run To analyze only selected wells first highlight the wells you wish to analyze then click Selected 6 5 4 When analysis is complete click Save L Gubareva Distribution Copy Effective 04 19 2012 Page 15 of 43 SERVICEs Us J DEPARTMENT OF HEALTH amp HUMAN SERVICES Public Health Service Centers for Disease Control and Prevention CDC Atlanta GA 30333 of HEALTH x oy Note The icon for a completed run file is a blue check and will replace the green icon which denotes a run setup that has not yet been run Note It is CRITICAL that each pyrogram be examined and verified visually even when using IdentiFire 6 5 5 Close the PyroMark ID software 6 5 6 Prior to IdentiFire analysis copy the IdentiFire Library found in part 7 of section VIII containing the pyrosequencing target region of interest wildtype and variant genotypes and paste into a new MS Word file save as a text txt 6 5 7 Open IdentiFire software Under the Sequence Input select the SQA
48. tion Figure 2 and fill with 7096 Ethanol Denaturation Solution 1X Wash Buffer and distilled deionized water respectively When Step 6 2 5 is close to completion 3 5 minutes left prime the filters in the PyroMark M Prep Tool by adding distilled deionized water into a plastic reagent tray and place beneath the tool Figure 2 Turn ON the vacuum switch for both the Vacuum Prep Workstation and the vacuum pump This will allow water to flush through and prime the filter probes on the Prep Tool Let the tool sit in the plastic reagent tray until it is ready to use When Step 6 2 5 is complete remove the plastic PCR plate containing the PCR product bound to Streptavidin Sepharose M beads from the shaker Place L Gubareva Distribution Copy Effective 04 19 2012 Page 12 of 43 of HEALTH x oy ERVICE p 9 Ry 6 2 11 6 2 12 6 2 13 6 2 14 6 2 15 6 2 16 6 2 17 6 2 18 Centers for Disease Control and Prevention CDC Atlanta GA 30333 St DEPARTMENT OF HEALTH amp HUMAN SERVICES Public Health Service the plate onto its respective position on the Vacuum Prep Workstation Gently remove plastic adhesive cover from plate to avoid splashing With the vacuum ON as described in Step 6 2 9 place the Prep Tool into the respective wells of the 96 well PCR plate until the entire volume has been collected 5 10 seconds The Streptavidin Sepharose beads with immobilized amplicons will be captured
49. uencing Assay Flow Chart Safety Information Abbreviations Reverse Transcription Polymerase Reaction RT PCR Protocol for the Generation of an Amplicon from Influenza Virus RNA This protocol describes the RT PCR procedures used for the synthesis and amplification of influenza viral RNA isolated from clinical specimens or grown viral isolates Pyrosequencing Sequence Analysis SQA Protocol Using the PyroMark 096 ID Platform This protocol describes the pyrosequencing assay that is used for partial sequencing of the biotinylated amplicon generated in RT PCR Pyrosequencing Single Nucleotide Polymorphism SNP Analysis Protocol Using the PyroMark Q96 ID Platform This protocol describes the pyrosequencing SNP assay that is used for partial sequencing of the biotinylated amplicon generated in RT PCR Reference Material This document contains the reference viruses RT PCR and sequencing primers amount of RT PCR product needed for pyrosequencing name of the target dispensation order pyrogram examples and a sequence library References Page 10 24 39 42 L Gubareva Distribution Copy Effective 04 19 2012 Page 2 of 43 SERVICEs Us 2 DEPARTMENT HEALTH amp HUMAN SERVICES Public Health Service Centers for Disease Control and Prevention CDC of HEALTH x oy Atlanta GA 30333 I Introduction For the prophylaxis and treatment of influenza A virus infections there
50. umber of nucleotides In such cases the software may overcall or miscall the nucleotide in the final sequence results Both the PyroMark Q96 ID and the IdentiFire software will not be able to detect mixtures e g H Y at 275 Mixtures must be verified visually As the virus evolves the IdentiFire library sequences and primers may need to be updated Other SOPs and Documents PyroMark Q96 ID User s Manual L Gubareva Distribution Copy Effective 04 19 2012 18 43 SERVICES o DEPARTMENT OF HEALTH amp HUMAN SERVICES Public Health Service Centers for Disease Control N and Prevention CDC Atlanta 30333 HEALTH x Index of Figures Figure 1 Example of a Run Sample Sheet for PyroMark Q96 ID Platform Figure 2 The PyroMark Q96 ID Vacuum Prep Workstation Figure 3 Example of Defining SQA Entry Figure 4 Example of PyroMark Q96 ID Software Showing SQA Run Setup Figure 5 PyroMark Q96 ID Cartridge Setup Figure 6 Example of an SQA Run Analysis L Gubareva Distribution Copy Effective 04 19 2012 Page 19 of 43 oF HEALTH x oy ERVIC Es 2 DEPARTMENT HEALTH amp HUMAN SERVICES Public Health Service Centers for Disease Control K and Prevention CDC agg Atlanta 30333 10202011 ML txt Notepad File Edit Format View Help Import type fetch System type MA 3 Plate type 5096 1
Download Pdf Manuals
Related Search