Guide - Pacific Biosciences Template Preparation and Sequencing
Contents
1. Page2 Template Preparation Process In addition to generating circular templates the hairpin adapters pro vide two additional benefits First they provide a universal primer bind ing site and initiation sequence Second they protect the ends of the DNA fragments Exonucleases can therefore be used to degrade failed ligation products and templates containing internal nicks leaving behind only those templates that are suitable for single molecule sequencing The SMRTbell template preparation method creates a circularized template for use with multiple sequencing protocols A single stream lined protocol is used to create different insert size libraries by altering the fragmentation conditions Amplicons can also be used in the same size ranges as input DNA This template preparation protocol can be used for all modes of on instrument sequencing Template preparation can be complete in 3 6 hours with minimal hands on time Note that the time requirements scale with the number of samples The first step in the generation of a SMRTbell library is production of appropriately sized double stranded DNA fragments These fragments can be generated by random shearing of DNA or by amplification of target regions of interest The SMRTbell library itself is produced by ligating universal hairpin adapters onto double stranded DNA frag ments The hairpin dimers formed during this process are removed at the end of the protocol using a mag2. SE o 2 0 2 5 3 0 3 5 4 0 4 5 Insert Size kbp Relative loading as 9o of total sequencing ZMWs versus insert size from a SMRTbell size ladder A restriction digestion of an 18 5 kb plasmid generated an equimolar distribution of fragments from 160 bp to 4251 bp The resulting fragments were converted to SMRTbell templates via a modified blunt end ligation protocol which retains all fragment sizes 75 bp The SMRTbell size ladder was then bound loaded and sequenced using standard protocols Polymerase Template ratios The stoichiometric optimum for the polymerase template ratio is 2 polymerases bound to each template molecule one to each hairpin adapter At lower concentrations excess polymerase is used to increase the efficiency of binding It is highly recommended that all samples bound at a 10 1 polymerase to template ratio be loaded using MagBeads This excess is washed away during the MagBead protocol washing step See Table 2 for the recommended polymerase to tem plate ratios for different insert sizes Table 2 shows the recommended primer template ratios poly merase template ratios and the On Sample Plate concentrations per insert size These recommended values are the default values in the Calculator but can be adjusted by the user Use the Calculator to set up all your binding reactions Page 35 Table 2 Insert Size Primer to Template Ratio Polymerase to Template Ratio and Loading Recommendations Pri
3. 2000 rpm If the beads appear over dried or cracked let the Elution Buffer sit on the beads for 2 to 3 minutes then vortex again c Spin the tube down to pellet beads then place the tube back on the magnetic bead rack d Discard beads Optional Verify your DNA amount and concentration using Qubit Nanodrop or Qubit quantitation platform as appropriate Perform qualitative and quantitative analysis using a Bioanalyzer instrument Note that the Bioanalyzer instrument has different kits in its offering and the appropriate kit based on insert size should be used Dilute the samples appropriately before loading on the Bioanalyzer chip so that the DNA concentration loaded falls well within the detectable minimum and maximum range of the assay Refer to Agilent s users guides for specific information on the range of the specific kit you might be using Note that typical yield at this point of the process following End Repair and one AMPure PB bead purification step is approximately between 80 100 of the total starting material The end repaired DNA can be stored overnight at 4 C or at 20 C for longer duration Page 20 LIGATE ADAPTERS BIOSCIENCES Before You Begin Fragment DNA 10 kb Repair DNA Damage and DNA Ends Ligate Adapters Blunt Anneal Sequencing Primer to SMRTbell Templates Bind Polymerase to SMRTbell Templates Sequence Page 21 Blunt End Ligatio
4. DNA shearing methods and subsequent AMPure PB bead purification steps described below you should recover approximately 50 80 of your input DNA by mass Typical yields from pre purified DNA where smaller fragments are already eliminated are between 80 100 Page 12 Mix the bead DNA solution thoroughly Mix the beads with the DNA by pipetting up and down or inverting the tube until the solution is homogenous Quickly spin down the tube for 1 second to collect the beads Allow the DNA to bind to beads by shaking in a VWR vortex mixer at 2000 rpm for 10 minutes at room temperature Note that the bead DNA mixing is critical to yield After vortexing the bead DNA mixture should appear homogenous We recommend using a VWR vortex mixer with a foam microtube attachment see Overview section for part number If using other instrumentation ensure that the mixing is equally vigorous Failure to thoroughly mix the DNA with the bead reagent will result in inefficient DNA binding and reduced sample recoveries Spin down the tube for 1 second to collect beads Place the tube in a magnetic bead rack until the beads collect to the side of the tube and the solution appears clear The actual time required to collect the beads to the side depends on the volume of beads added With the tube still on the magnetic bead rack slowly pipette off cleared supernatant and save in another tube Avoid disturbing the bead pellet If
5. Elution Buffer needed The minimum DNA concentration required to proceed to the next step End Repair is 140 ng uL with preferred mass of at least 5 ug 14 Add Pacific Biosciences Elution Buffer volume calculated in step 13 above to your beads a Thoroughly resuspend beads by vortexing for 1 minute at 2000 rpm If the beads appear over dried or cracked let the Elution Buffer sit on the beads for 2 to 3 minutes then vortex again b Spin the tube down to pellet beads then place the tube back on the magnetic bead rack c Perform concentration measurements Verify your DNA concentration using a Nanodrop or Qubit quantitation platform If the DNA concentration is estimated to be equal to or below 12 ng uL a Qubit system reading is required When performing a Qubit system reading ensure that your sample is within the range of the Qubit kit you are using For proper concentration calculations incorporate the dilution factor used when diluting your sample to be within range of the Qubit kit and the dilution factor when diluting your sample with the working solution The latter part of this dilution factor can be calculated automatically by the Qubit system d Discard the beads Page 14 15 16 Perform qualitative and quantitative analysis using a Bioanalyzer instrument Note that the Bioanalyzer instrument has different kits in its offering and the appropriate kit based on insert size should be used Dilute the s
6. Template Prep Buffer ATP Lo Mix before proceeding Ligase 30 U uL 1 0 uL 0 75 UluL a The Ligase Buffer should remain closed and on ice when not frozen Page 22 If your insert size or input amount deviates from this table you can cal culate the amount of annealed blunt adapter to be added to the reac tion using the following equation Be sure to keep a 32 5 fold excess of hairpin adapters and adjust the final volume such that the hairpin adapter concentration does not exceed 1 uM Total ug of DNA insert X 106 1 650 X 1 Insert size in bp X pico moles of DNA available for ligation X picomoles of DNA available for ligation X 32 5 Total excess annealed adapters Y Y 20 20 uM annealed adaptor stock Z total uL of annealed adaptor to be added to the reaction If scaling of the reaction volume is necessary keep the buffer and enzyme concentrations proportional to the recommended amounts shown above 1 Mix the reaction well by pipetting or flicking the tube 2 Spin down the tube contents with a quick spin in a microfuge 3 Incubate at 25 C for 15 minutes At this point the ligation can be extended up to 24 hours or cooled to 4 C for storage of up to 24 hours 4 Incubate at 65 C for 10 minutes to inactivate the ligase then return the reaction to 4 C You must proceed with adding exonuclease after this step Add Exonuclease Add exonuclease to remove failed ligation products and Incubate Tube
7. accuracy An underloaded SMRT Cell will generate less data An overloaded SMRT cell may have slightly lower raw accu racy due to multiple polymerase template complexes in the same ZMW see accompanying graphs Page 50 TOOQ0 50000 9 50000 S 5 40000 e 30000 g 70000 60000 S 50000 S 5 40000 db 30000 Z e T0000 Qu 60000 50000 9 40000 30000 50 100 150 200 On SMRT cell concentration pM Figure 1 Yield Mapped Reads vs On SMRT Cell Loading Concentration Page 51 rm t 1 Q4 m Pg U MU d 440000 0 88 8 0 86 e 0 91 0 90 0 89 curacy 14000 0 86 0 87 C A 0 86 091 9 gs 0 89 dagoz 0 88 0 87 n Uu 50 100 150 200 On SMRT cell concentration pM Figure 2 Yield Mapped Reads vs On SMRT Cell Loading Concentration Figures 1 and 2 Yield and Accuracy vs on SMRT Cell Loading Con centration Sample1 200 bp PhiX174 amplicon small scale prep Sample2 E coli 2 kb library small scale prep Sample3 E coli 10 kb library large scale prep Figure 1 shows Yield in number of mapped reads vs on SMRT Cell loading concentration Figure 2 shows Raw accuracy vs on SMRT Cell loading concentration These results are for demonstration purposes only actual results may vary Page 52 PACI
8. add equal volumes of AMPure PB beads to the saved supernatant and repeat the AMPure PB bead purification steps to recover the DNA Wash beads with freshly prepared 70 ethanol Note that 70 ethanol is hygroscopic and should be prepared FRESH to achieve optimal results Also 70 ethanol should be stored in a tightly capped polypropylene tube for no more than 3 days a Do not remove the tube from the magnetic bead rack b Use a sufficient volume of 70 ethanol to fill the tube 1 5 mL for 1 5 mL tube or 2 mL for 2 mL tube Slowly dispense the 70 ethanol against the side of the tube opposite the beads Let the tube sit for 30 seconds c Do not disturb the bead pellet d After 30 seconds pipette and discard the 70 ethanol 9 Repeat step 8 above 11 12 13 Remove residual 7096 ethanol and dry the bead pellet a Remove tube from magnetic bead rack and spin to pellet beads Both the beads and any residual 70 ethanol will be at the bottom of the tube b Place the tube back on magnetic bead rack c Pipette off any remaining 70 ethanol Check for any remaining droplets in the tube If droplets are present repeat step 10 Remove the tube from the magnetic bead rack and allow beads to air dry with the tube caps open for 30 to 60 seconds Elute the DNA off the beads a Elute the DNA in 30 uL Elution Buffer Page 19 14 15 16 b Thoroughly resuspend beads by vortexing for 1 minute
9. awareness or action Note Calls attention to an item that may be of interest but is not critical to the process Important Calls attention to an item that is necessary for proper operation of a step WARNING Indicates you should proceed with appropri ate caution This guide describes an optimized procedure for preparing your DNA template for sequencing on the PacBio System This Blunt End Liga tion protocol is suitable for all libraries greater than 250 bp amplicons and offers a total preparation time of approximately four hours An A T Ligation protocol can be used for preparing approximately 250 bp amplicon libraries See Pacific Biosciences Procedure amp Checklist 250 bp Amplicon Library Preparation and Sequencing available on our Customer Portal and our website at www smrtcommunity com Sample Net SMRTbell template is a double stranded DNA template capped by hairpin loops at both ends The SMRTbell template is structurally linear and topologically circular Some advantages of the SMRTbell structure include the generation of both sense and antisense sequence from a single molecule and the ability to achieve high single molecule accu racy through circular consensus sequencing approaches By avoiding the use of intramolecular ligation this method of forming circular templates is similarly efficient across a wide range of insert sizes This allows a single methodology to support all applications
10. device Verify that the input DNA used for shearing is high molecular weight DNA at the appropriate concentration for your shearing device If the input DNA is damaged this can lead to smaller insert sizes and difficulty in generating large insert size libraries which can be especially problematic for strobe sequencing projects Additionally the concentration of the input DNA can also alter the shear size When Library Yield is High but Sequencing Yield from the Library is Still Low Properly quantify SMRTbell libraries before annealing sequencing primer Run a Bioanalyzer gel from Agilent following manufacturer s loading recommendations Sheared libraries are comprised of a distribution of fragment sizes around a targeted size and molarities are best approximated using the Bioanalyzer software Check the level of adapter dimer contamination in the SMRT Portal secondary analysis report under Diagnostic Because of an intrinsic loading bias that favors the immobilization of smaller DNA template sizes in the SMRT Cells the amount of hairpin dimers in your sample should be kept as low as possible ideally 196 adapter dimer levels approaching 2 or higher will significantly decrease sequencing yields We strongly encourage performing at least a double AMPure PB bead purification step prior to performing the primer template annealing reactions when automating the library preparation procedure using a robotic platform a tr
11. for more reads per SMRT Cell due to e Reduced adapter dimers e Short insert contaminants Free polymerase The Calculator provides recommended sample concentrations for large scale and small scale binding reactions however it is recom mended that a loading titration be run to optimize the yield per SMRT Cell for a given sample described in the next section The MagBead Wash Buffer and MagBead Binding Buffer that are used for this step are included in the MagBead kit The bound samples are placed in the sample plate which is then placed on the instrument for sequencing Note that the samples are stable for one day but it is rec ommended that they be loaded as soon as possible after MagBead binding Page 37 Diffusion Loading Following the binding reaction the complex must be diluted to achieve the correct concentration for sequencing This dilution step allows the user to e Adjust for differences in yield among SMRTbell library preps Use either low or high concentration binding reactions or both e Run an optional loading titration to optimize the yield per SMRT Cell for a given sample described in the next section The Complex Dilution Buffer 2 0 and DTT that are used for this dilution step are included in the DNA Polymerase Binding kit The dilution cal culations are done by the Calculator The diluted samples are placed in the sample plate which is then placed on the instrument for sequencing Note that th
12. the barcode collar the Machine Vision System will read the barcode 5 Place the tube in the left slot encircled by your reagent plate location 6 Remove the blue cap from the SMRT Cell Oil tube 7 Replace the cap with a tube septa Place the SMRT Cell Oil tube in the right hand reagent slot Note that the SMRT Cell Oil tube is slightly larger and will fit only in that slot 99 OS Enzyme tube location j SMRT Cell Oil tube location 8 Gently close the metal door Page 43 Load your samples and mixing plate on to the Instrument 9 Lift up the metal door covering the Sample and Mixing slots Lift here T o o o eee 9 9 000 0 o o o o o o 0009909999 9 o o o o 9 9 9 9 eee 909 99979 090000900909 5 9 99 E o o o o o o o o 9 o 8 4 44 11 Place a 384 well mixing plate Eppendorf LoBind Deepwell plates in the slot labeled Mixing MIXING 1 12 Gently close the metal door 13 Press the Close button on the touchscreen User Interface optionally press the Clo
13. 12 Molecular BioProducts 0 2 mL PCR strip tube cat 3418 Eppendorf PN 80077 236 Eppendorf PN 80077 230 Sigma Aldrich VWR Catalog No 14005 824 Any Major Laboratory Supplier Any Major Laboratory Supplier Any Major Laboratory Supplier Molecular Biology Grade H20 x Any Major Laboratory Supplier Recommended DNA Isolation Kits Item Source Sample Isolation kits Qiagen Blood and Cell Culture DNA Maxi Kit 13362 Blood and Cell Culture DNA Midi Kit PN 13343 Qiagen Large Construct Kit 12462 QIAquick PCR Purification Kit PN 28104 Page9 FRAGMENT BIOSCIENCES Before You Begin Fragment DNA 10 kb Repair DNA Damage and DNA Ends Ligate Adapters Blunt Anneal Sequencing Primer to SMRTbell Templates Bind Polymerase to SMRTbell Templates Sequence Page 10 Shearing DNA Shearing DNA Using a Covaris g TUBE Shearing Device 5 kb Insert Sizes Optional Shearing DNA Using a Hydroshear Shearing Device 10 kb Insert Sizes Our large insert size protocols have been validated using DNA frag mented with the Covaris g TUBE with any system there will be some variation in the distribution of the sheared fragments In addition some DNA will be lost during the shearing process itself Depending on the quality of your starting material and the selected method of shearing you may expect to lose 20 of the starting mass
14. 30 seconds pipette and discard the 7096 ethanol 9 Repeat step 8 above 10 Remove residual 70 ethanol and dry the bead pellet a Remove tube from magnetic bead rack and spin to pellet beads Both the beads and any residual 70 ethanol will be at the bottom of the tube b Place the tube back on magnetic bead rack 11 Check for any remaining droplets in the tube If droplets are present repeat step 10 12 Remove the tube from the magnetic bead rack and allow beads to air dry with tube caps open for 30 to 60 seconds 13 Elute the DNA off the beads in 50 uL Elution Buffer Mix until homogenous then vortex for 1 minute at 2000 rpm a Thoroughly resuspend beads by vortexing for 1 minute at 2000 rpm If the beads appear over dried or cracked let the Elution Buffer sit on the beads for 2 to 3 minutes then vortex again b Spin the tube down to pellet beads then place the tube back on the magnetic bead rack c Discard beads 14 The eluted DNA in 50 uL of Elution Buffer should be taken into the second 0 45X AMPure PB bead purification step AMPure PB Size Selection and Purification Step 2 1 Add 22 5 uL 0 45X volume of AMPure PB beads to the 50 uL of eluted DNA from the first AMPure PB bead purification step above Before using mix the bead reagent well until the solution appears homogenous Then pipette the reagent slowly since the bead mixture is viscous and precise volumes are critical to the purification proc
15. 38 6 uL 22 42 6 uL Page 40 1 kb 2 kb 5 kb 10 kb Libraries No Complex Complex Reuse Reuse 41 uL 50 uL 53 uL 53 uL 62 uL 65 uL 74 uL 74 uL 74 uL Prepare Your Reagent Plates When using MagBead loading for a single SMRT Cell the instrument pipettes 9 uL of the MagBead bound sample Since 10 uL dead vol ume is necessary the total volume required is 19 uL Two SMRT Cells require 9 uL X 2 10 uL dead volume 28 uL Refer to Table 4 below for recommended complex volumes to load onto the sample plate Table 4 Recommended Complex Volumes for MagBead Loading on Sample Plates of SMRT Cells per Sample Well Greater than 1 kb Libraries 1 19 28 37 46 55 64 73 82 4 O oO OJN Thaw the following kit components accordingly 1 4 5 OS Enzyme Remove the OS Enzyme from the reagent package Keep at 20 C at all times When ready to use spin down the tube for 5 seconds replace cap with tube septa and place on the reagent drawer of the instrument Reagent plate The reagent plate can be thawed overnight at 4 C Thaw an additional 15 minutes at room temperature before using Note the following precautions which may impact reagent performance Do not thaw in hot water Do not remove plate seal until it is ready to be placed on Instrument Do not keep at room temperature after thawing e Do not keep the unsealed plate exposed to air Place the s
16. Cap Stock Reagent Color Cane Volume Ligated DNA 40 uL 100 U uL 1 0 uL ExoVII 10 1 0 uL Total Volume 42 uL 1 Spin down the tube contents with a quick spin in a microfuge 2 Incubate at 37 C for 1 hour then return the reaction to 49C You must proceed with purification after this step Page 23 Purify SMRTbell Templates In this purification process there are three 3 distinct and consecutive AMPure PB bead purification steps The first two 2 steps are per formed using 0 45X volumes of AMPure PB beads and the final step can be performed using either 0 40X or 0 45X volumes of AMPure PB beads Perform all purification steps at room temperature to ade quately remove enzymes exonucleases ligases etc and ligation products smaller than 0 4 kb e g adapter dimers AMPure PB Size Selection and Purification Step 1 1 Add 0 45X volumes of AMPure PB beads to the exonuclease treated ligation reaction Before using mix the bead reagent well until the solution appears homogenous Pipette the reagent slowly since the bead mixture is viscous and precise volumes are critical to the purification process Mix the bead DNA solution thoroughly Mix the beads with the ligation reaction by pipetting up and down or inverting the tube until the solution is homogenous Quickly spin down the tube for 1 second to collect the beads 4 Allow the DNA to bind to beads by shaking in a VWRS vortex m
17. FIC APPENDIX BIOSCIENCES TCCTCCTCCTCCGTTGITGTTIGITGAGAGAGAGAAGgctgggcaggctatgcaccctggtccaggtcaaaagctgcggaa cccgctagcggccatcttggccactaggggtcccgcagattcatattgtcgtctagcatgcacaatgctgcaaacccagcttgcaatgcccacagca agcggccaatctttacgccacgttgaattgtttattacctgtgactggctatggcttgcaacgccactcgtaaaactagtactttgcggttaggggaagta gacaaacccattactccacttcccggaagttcaactcattccaacacgaaataaaagtaaactcaacaccccaagcaggctatgtgggggggtga taggggtggattctatttcctatcccatcccctaggatctcaattaagttactagcgagttaaatgtctgtagcgatcccgtcagtcctatcgcgcgcatca agacctggttggttgagcgtgcagtagatcatcgataagctgcgagttaggtcatcccagaccgcatctggcgccaaacgttcagtggtagctaagg cgtcaccttcgactgtctaaaggcaatatgtcgtccttagctccaagtecctagcaagcgtgtC GGG TCTCTCTCTTTTCCTCCTCCT CCGTTGITGTIGI TGAGAGAGACCC Gacaocgcttgctagggacttggagctaaggacgacatattgcctttagacagtcgaaggt gacgccttagctaccactgaacgtttaggcgccagatgcggtctgggatgacctaactcgcagcttatcgatgatctactgcacgctcaaccaacca ggtcttgatgcgcgcgataggactgacgggatcgctacagacatttaactcgctagtaacttaattgagatcctaggggatgggataggaaatagaa tccacccctatcacccccccacatagcctgcttggggtgttgagtttacttttatttcgtgttggaatgagttgaacttccgggaagtggagtaatgggtttgt ctacttcccctaaccgcaaagtactagttttacgagtggcgttgcaagccatagccagtcacaggtaataaacaattcaacgtggcgtaaagattggc cgcttgctgtgggcattgcaagctgggtttgcagcattgtgcatgctagacgacaatatgaatctgcgggacccctagtggccaagatggccgctagc gggttccgcagcttttgacctggaccagggtgcatagcctgcccagcC TCTCTCTCTCTTT DNA Control Complex Sequence 250 bp to 3 kb Insert sequence lowercase no color Hairpin stem sequence Hairpi
18. PACIFIC BIOSCIENCES Template Preparation and Sequencing Guide For Research Use Only Not for use in diagnostic procedures P N 000 710 821 07 06122013 Copyright 2010 2013 Pacific Biosciences of California Inc All rights reserved Information in this document is subject to change without notice Pacific Biosciences assumes no responsibility for any errors or omissions in this document PACIFIC BIOSCIENCES DISCLAIMS ALL WARRANTIES WITH RESPECT TO THIS DOCUMENT EXPRESS STATUTORY IMPLIED OR OTHERWISE INCLUDING BUT NOT LIMITED TO ANY WARRANTIES OF MERCHANTABILIT Y SATISFACTORY QUALITY NONINFRINGEMENT OR FITNESS FOR A PARTICULAR PURPOSE IN NO EVENT SHALL PACIFIC BIOSCIENCES BE LIABLE WHETHER IN CONTRACT TORT WARRANTY PURSUANT TO ANY STATUTE OR ON ANY OTHER BASIS FOR SPECIAL CONSEQUENTIAL INCIDENTAL EXEMPLARY OR INDIRECT DAMAGES IN CONNECTION WITH OR ARISING FROM THIS DOCUMENT WHETHER OR NOT FORESEEABLE AND WHETHER OR NOT PACIFIC BIOSCIENCES IS ADVISED OF THE POSSIBILITY OF SUCH DAMAGES Certain notices terms conditions and or use restrictions may pertain to your use of Pacific Biosciences products and or third party products Please refer to the applicable Pacific Biosciences Terms and Conditions of Sale and to the applicable license terms at http www pacificbiosciences com licenses html Trademarks Pacific Biosciences the Pacific Biosciences logo PacB io SMRT and SMRTbell are trademarks of Pac
19. TP 0 5 uL 0 1 mM for 10 kb DNA Damage Repair 2 0 uL Mix Total Volume 1 50 0 uL If your input amount deviates from the inputs shown in this table adjust all reagent volumes proportionately Note that the DNA final concentra tion cannot exceed 100 ng uL 3 Mix the reaction well by pipetting or flicking the tube 4 Spin down tube contents with a quick spin in a microfuge 5 Incubate at 25 C for 15 minutes then return reaction to 4 C until ready for purification Page 17 Repair Ends The PacBio DNA Template Prep Kit is used to repair the ends of frag mented DNA or non phosphorylated 5 ends of PCR products in preparation for ligation with hairpin adapters Note that the tube caps are color coded for your convenience Use the following table to prepare your reaction then purify the DNA Tube Cap Stock DNA Damage Repaired M 50 uL End Repair Mix 25 uL 1X 1 Mix the reaction well by pipetting or flicking the tube 2 Spin down contents of tube with a quick spin in a microfuge 3 Incubate at 25 C for 5 minutes return the reaction to 4 C Purify the DNA Perform the following steps at room temperature Note that you must use low adhesion LoBind microcentrifuge tubes during the entire template preparation process 1 Add 0 45X volume of AMPure PB beads to the End Repair reaction Before using mix the bead reagent well until the solution appears homogenous Pipette the reagent slowly
20. Vendor and or Hydroshear Hydroshear Shearing Device Bioanalyzer Instrument Agilent Technologies PN 2100 Agilent 2100 Bioanalyzer DNA 1000 DNA Agilent Technologies 7500 DNA 12000 DNA Kits and or High Sensitivity DNA Kit Page 7 General Lab Supplies Item NanoDrop Series 2000 2000c 3300 8000 Or Qubit Quantitation Platform Fluorometer and Quant iT TM 96 well plates semi skirted Plate Septa Tube Septa AMPure PB Beads Item Sealing Film Roller or Septa Roller Speedball Roller Allegra 6KR Centrifuge Microcentrifuge 1000 16000 RCF Strip tube Centrifuge Magnetic Particle Concentrator 0 2 mL PCR tubes can be used for all reactions 0 5 mL VWR Eppendorf DNA LoBind tubes used for all reactions 1 5 mL VWR Eppendorf DNA LoBind tubes used for all reactions Ethanol absolute Vortex Genie attachment P with plate shaking Plate centrifuge Minifuge Aerosol resistant filter tips Page8 Vendor Thermo Scientific Invitrogen PN Q32857 Fisher Scientific E951020303 Pacific Biosciences Pacific Biosciences Pacific Biosciences Vendor Axygen PCR SP Roller Any Major Laboratory Supplier Allegra Eppendorf PN 5415D VWR PN 37000 700 Invitrogen 123 21D Bio Rad 0 2 mL flat cap PCR tube cat 0201 VWR tube strip with individually attached bubble caps 82006 634 Molecular BioProducts 0 2 mL PCR tube flat cap cat 34
21. aaa acttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtc agaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctacc agcggtggtttgtttgecggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtcctt ctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctg ccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggtt cgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcc cgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaa cgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgicgattttigtgatgctcgtcaggggggcggagcctatggaa aaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataa ccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaa Page 53 gagcgcctgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatatggtgcactctcagtacaatctgctctgatgccgca tagttaagccagtatacactccgctatcgctacgtgactgggtcatggctgcgccccgacacccgccaacacccgctgacgcgccctg acgggcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcacc gaaacgcgcgaggcagctgcggtaaagctcatcagcgtggtcgtgaagcgattcacagatgtctgcctgttcatccgcgtccagctcg ttgagtttctccagaagocgttaatgtctggcttctgataaagcgggccatgttaagggcggttttttcctgtttggtcactgatgcctccgtgta agggggatttctgttcatgggggtaatgataccgatgaaacgagagaggatgctcacgatacgggttactgatgatgaacatgcccgg ttactggaacgt
22. amples appropriately before loading on the Bioanalyzer chip so that the DNA concentration loaded falls well within the detectable minimum and maximum range of the assay Refer to Agilent Technologies guides for specific information on the range of the specific kit you might be using Note that typical yield at this point of the process i e post shearing and after one AMPure PB bead purification step is approximately 50 80 The sheared DNA can be stored for up to 24 hours at 4 C or at 209C for longer duration Page 15 REPAIR DNA DAMAGE BIOSCIENCES AND DNA ENDS 6 Before You Begin Fragment DNA 10 kb Repair DNA Damage and DNA Ends Ligate Adapters Blunt Anneal Sequencing Primer to SMRTbell Templates Bind Polymerase to SMRTbell Templates Sequence Page 16 Repair DNA For sheared DNA libraries and PCR products greater than 2 kb any Damage DNA damage generated during DNA extraction and PCR amplifica tions must be repaired using the DNA Damage Repair reagents pro vided by Pacific Biosciences Common types of damage may include abasic sites cytosine deamination and oxidation Note that DNA dam age repair is optional for insert sizes less than 2 kb 1 Thaw the kit components on ice 2 In a LoBind microcentrifuge tube add the following reagents Tube Reagent Cap ce Volume Final Conc onc Color DNA Damage Repair 10X 0 5 uL 1X Buffer NAD 100 X 0 5 uL 1X dN
23. e e g heme humic acid polyphenols Prior to fragmentation we recommend one or more of the following quality assessments to ensure that the DNA is pure and of high molec ular weight Quantitative Assessment e Spectrophotometry NanoDrop Spectrophotometer For samples of concentration gt 10 20ng uL We recommend 60 280 ratio of approximately 1 8 to 2 0 Fluorimetry PicoGreen or Qubit Fluorimeter Qualitative Assessment Gel electrophoresis and densitometry compared to the appropriate size standards Sample DNA should be of high molecular weight and comparable in intensity to a similar mass of control DNA 5 Gel Smear A Field Inversion Gel Electrophoresis system can be used to evaluate the quality of gDNA and determine the sizes of sheared DNA and SMRTbell templates see figure below On a field inversion gel high quality gDNA should migrate as a single band of approximately 50 kb Lane 1 30kb 20kb c c V DNA Input The 10 kb procedure described in this guide has been optimized to Requirements produce SMRTbell template sizes with an input amount of 5 ug For all other insert sizes download the Procedures from the Customer Portal or www smrtcommunity com SampleNet Note that depending upon the quality of your sample approximately 20 sample loss is to be expected as a result of the shearing and con centration process Therefore be
24. e diluted com plexes become slightly less stable at these lower concentrations and should be used as soon as possible Complex Dilution by the PacBio System The PacBio system takes the sample from the sample plate and fur ther dilutes it before placing it on the SMRT Cell for immobilization The dilution factor depends upon the insert size shorter inserts require lower concentrations on the SMRT Cell to achieve optimal loading while larger inserts require a higher concentration As a result shorter inserts have a larger dilution factor while longer inserts have a smaller dilution factor Immobilization During the immobilization step the bound polymerase template com plexes diffuse or are loaded by MagBeads into the Zero Mode Wave guides ZMW and become immobilized at the bottom of the ZMWs Immobilization of complexes into ZMWs occurs via diffusion or Mag Bead loading and behaves according to Poisson statistics meaning that multiple polymerase template complexes could become immobi lized in the same ZMW Megabases per SMRT Cell will increase with loading but accuracy and read length may decrease due to ZMWs with multiply loaded polymerase template complexes See Optional Loading Titration in the Troubleshooting section for more information For diffusion loading the complex immobilization time on the SMRT Cell is 30 minutes for all Standard sequencing samples up to 3 0 kb and 1 hour immobilization for fragments grea
25. ed Binding Concentration Small scale or Large scale The concentrations recommended in the Calculator are optimized to result in the highest possible fraction of active template polymerase complexes Large Scale Depending on template availability we recommend doing the binding reaction at Large scale high concentrations where the binding reaction is more efficient Moreover the bound complex can be diluted in a glycerol based storage buffer and stored for several months at 20 C with no significant loss of activity This Complex Stor age Buffer is included in the DNA Polymerase Binding Kit omall scale When limited sample is available the binding reaction can be done at the Small scale low concentration The Small scale con centration bound complex should be stored at 4 and used within three days Control Complex Identity and Amount The control complex is provided by Pacific Biosciences as a means for independent control of the binding and sequencing reactions If a prob lem arises with a run then the results from the control can assist in determining where the problem occurred These controls are SMRT bell templates already bound with the polymerase They are added to the sample during sample dilution for sequencing See Table 1 for the recommended control complex ratios for your insert size with the upper and lower bounds of actual insert sizes and corresponding Con trol Complex molarity ratios that can be accommoda
26. eing prepared For example 250 bp libraries should be purified with 1 8X volume of AMPure PB beads if less than this amount is used then library yield will suffer The ends of the DNA insert fragments should not be labeled in order to allow the hairpin adapter insert DNA ligation reactions to proceed For instance 5 FAM labeled PCR products can not be used as the input DNA for making SMRTbell templates A failure at the ligation step will lead to little or no library after the exonuclease treatment as partially ligated products are degraded The PacBio DNA Template Prep Kit should be properly handled with all reagents and enzymes stored at 20 The Template Prep Kit uses a number of different enzymes and improper storage of these enzymes can lead to reductions in their catalytic efficiency and drops in either library recovery or eventual sequencing yield For example using inactive ligase will compromise the ligation step and lead to little or no library recovery Page 48 Use the New England BioLabs PreCR Repair Mix prior to starting the End Repair reaction see UB Sequential Reaction DNA Damage Repair for the procedure and materials needed When the Sheared Library is the Wrong Size Make sure to optimize shearing conditions While this guide makes certain recommendations about shearing conditions it is also important to verify conditions effective for shearing your particular DNA sample on your shearing
27. epta mat on plate immediately Place the reagent plate on a VWR Microplate Shaker and shake for 1 minute at 1200 rpm If undissolved precipitates are present in any of the filled wells mix thoroughly by vigorously vortexing until the solution is clear opin the plate in a centrifuge briefly at 2000 rpm Page 41 6 Peel the foil seal off the plate as shown 7 Place the supplied Septa mat on the plate 8 Using a roller further press down the Septa mat onto the plate Prepare Your Dilute Your Bound Complex Sample Plate Load your samples on to a Sample plate Place the white Septa mat on the plate and press down with a roller to a ensure a tight fit Spin your sample plate down for 30 seconds at 2000rpm Place on the instrument Load Your X Atthe instrument open the Reagents Samples drawer You can either Reagent Mixing press the illuminated Open button on the instrument Reagents Sam and Sample Plates ples drawer or the Open button on the touchscreen User Interface Load your Reagents on to the Instrument 1 When the drawer opens lift up the metal door covering the Reagents slots Lift here 2 Place your reagent plate in the Reagent slot Note that there are 2 slots if you have only one plate you can place it in either slot The Barcode Scanner will locate the plate Page 42 3 Remove the OS Enzyme from the refrigerator or ice 4 Replace the cap with a tube septa Be careful not to remove
28. ess 2 Mix the bead DNA solution thoroughly Mix the beads with the ligation reaction by pipetting up and down or inverting the tube until the solution is homogenous 3 Quickly spin down the tube for 1 second to collect the beads Page 25 4 Allow the DNA to bind to beads by shaking in a VWR vortex mixer at 2000 rpm for 10 minutes at room temperature Note that the bead DNA mixing is critical to yield After vortexing the bead DNA mixture should appear homogenous We recommend using a VWR vortex mixer with a foam microtube attachment see Overview section with Catalog part number If using other instrumentation ensure that the mixing is equally vigorous Failure to thoroughly mix the DNA with the bead reagent will result in inefficient DNA binding and reduced sample recoveries 5 Spin down the tube for 1 second to collect beads 6 Place the tube in a magnetic bead rack until the beads collect to the side of the tube and the solution appears clear The actual time required to collect the beads to the side depends on the volume of beads added 7 Slowly pipette off cleared supernatant and save in another tube Avoid disturbing the bead pellet 8 Wash beads with freshly prepared 70 ethanol Note that 70 ethanol is hygroscopic and should be prepared FRESH to achieve optimal results Also 70 ethanol should be stored in a tightly capped polypropylene tube for no more than 3 days Do not remove the tube from t
29. gcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaa ggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgct ggtagcggtggtttttttgtttgcaagcagcagattacgcegcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctga cgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatga agttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtcta tttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgatac cgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaa ctttatccgcctccatccagtctattaattgttgeccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgc tgcaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgt tgtgcaaaaaagcggttagctccttcggtcctecgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcact gcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcg accgagttgctcttgcccggcgtcaacacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttctt cggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttac tttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaata ctcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaa ataggggttccgcgcacatttccccgaaaagtgccacctgacgtctaagaaaccattattatcatgacattaacctataaaaataggcg tatcacgaggccctttcgtcttcaagaattctcatgt
30. he magnetic bead rack Use a sufficient volume of 70 ethanol to fill the tube 1 5 mL for 1 5 mL tube or 2 mL for 2 mL tube Slowly dispense the 70 ethanol against the side of the tube opposite the beads Let the tube sit for 30 seconds Do not disturb the bead pellet After 30 seconds pipette and discard the 7096 ethanol 9 Repeat step 8 above 10 Remove residual 70 ethanol and dry the bead pellet a Remove tube from magnetic bead rack and spin to pellet beads Both the beads and any residual 70 ethanol will be at the bottom of the tube b Place the tube back on magnetic bead rack c Pipette off any remaining 70 ethanol 11 Check for any remaining droplets in the tube If droplets are present repeat step 10 12 Remove the tube from the magnetic bead rack and allow beads to air dry with tube caps open for 30 to 60 seconds Page 26 13 14 Elute the DNA off the beads in 100 uL of Elution Buffer Vortex for 1 minute at 2000 rpm Verify your DNA amount and concentration with either a Nanodrop or Qubit quantitation platform reading If recovery is sufficient to allow for an additional 2596 loss in the final AMPure PB purification step more if the library contains a high number of small fragments and it is desirable to increase the stringency of size selection consider using 0 40X volumes of AMPure PB beads This will remove most fragments 1 5 kb which will dominate loading if present Otherw
31. ic bead rack Pipette off any remaining 70 ethanol Page 27 SMRTbell Library Quality Assessment 11 12 13 14 15 Check for any remaining droplets in the tube If droplets are present repeat step 10 Remove the tube from the magnetic bead rack and allow beads to air dry with tube caps open for 30 to 60 seconds Elute the DNA off the beads in 10 uL of Elution Buffer Vortex for 1 minute at 2000 rpm Verify your DNA amount and concentration with either a Nanodrop or Qubit quantitation platform reading For general library yield expect 20 total yield from the Damage Repair input If your yield concentration is below 12ng uL use the Qubit system for quantitation To estimate your final concentration ng of DNA going into Damage Repair X 0 2 _ of Elution Buffer ng uL Perform qualitative and quantitative analysis using a Bioanalyzer instrument Note that typical DNA yield at this point of the process at the end of library preparation is between approximately 5 20 of the total starting DNA amount Successful sequencing of a SMRTbell library depends on an under standing of the molarity of templates This requires accurate quantita tion and sizing of the final library Size distribution can be measured using an Agilent 2100 Bioanalyzer High Sensitivity Kit Typical library yields will require at least a 1 10 dilution prior to analysis on the Bioanalyzer instrument to ensure reli able quantitati
32. ific Biosciences in the United States and or certain other countries All other trademarks are the sole property of their respective owners Pacific Biosciences of California Inc 1380 Willow Road Menlo Park CA 94025 www pacificbiosciences com Notice of Equipment Class Korea For Class A AS S Aa HAHA EN 7 BOAT FES ASHE 0 FH 23999 HAAA 552 AS SRLS For Class B 7 7 2 8 HAHAE EA FE 29041 AS SRLS pH BE MSAA Ap T eL BEFORE YOU BEGIN BIOSCIENCES Before You Begin Fragment DNA 10 kb Repair DNA Damage and DNA Ends Ligate Adapters Blunt Anneal Sequencing Primer to SMRTbell Templates Bind Polymerase to SMRTbell Templates Sequence Page 1 Overview Trained Personnel User Attention Words and Symbols Template Preparation Protocols SMRTbell Templates The PacBio System includes the Instrument the accompanying kits needed for DNA template preparation and sequencing on the instru ment and the software used to set up runs and analyze data Any personnel carrying out the procedures described herein must be trained in proper and safe laboratory practices Throughout Pacific Bio sciences documentation the words you or user refer to and assume properly trained individuals Throughout this guide user attention words and symbols appear that may require a particular level of
33. im ers and annealed templates are bound to DNA polymerase Lastly the sample plate is set up for sequencing Page4 DNA Quality Assaying the Quality of your Sample Pacific Biosciences template preparation process does not use ampli fication techniques As a result input DNA quality will be directly reflected in sequencing results Any DNA damage e g abasic sites nicks interstrand crosslinks or contaminants e g single stranded DNA RNA proteins dyes or salts present in the input material will impair performance of the system Therefore ensure that your DNA sample s double stranded Single stranded DNA will not be made into a SMRTbell template in this template preparation process and can interfere with quantitation and polymerase binding Has undergone a minimum of freeze thaw cycles Has not been exposed to high temperatures 65 C for 1 hour can cause a detectable decrease in sequence quality Has not been exposed to pH extremes 6 or 2 9 e Has 2 0 280 ratio of approximately 1 8 to 2 0 Does not contain insoluble material Does not contain RNA Has not been exposed to intercalating fluorescent dyes or ultraviolet radiation Does not contain chelating agents e g EDTA divalent metal cations e g 27 denaturants e g guanidinium salts phenol or detergents e g SDS Triton X100 CTAB Does not contain carryover contamination from the starting organism tissu
34. ingle SMRT Cell the instrument pipettes 4 uL of 250 or 500 bp complex or 9 uL of the 1000 2000 5000 or 10000 bp complex If Complex Reuse is selected and two or three SMRT Cells are requested the instrument pipettes 4 8 uL of 250 or 500 bp complex and 12 uL of 1000 2000 5000 or 10000 bp com plex Complex Reuse requires a slightly larger volume of liquid to com pensate for incomplete sample recovery by the instrument but this total volume is spread over two or three SMRT Cells For example to run four SMRT Cells of a 10 kb library without Com plex Reuse a minimum of 41 uL of complex 4 x 9 uL sample 5 uL dead volume should be placed in the sample well To run four SMRT Cells of 10 kb library with Complex Reuse a minimum of 26 uL of com plex 12 uL for the first three SMRT Cells 9 uL for fourth SMRT Cell 5 uL dead volume should be placed in the sample well Refer to Table 3 below for recommended complex volumes to load onto the sample plate Page 39 Table 3 Recommended Complex Volumes for Diffusion Loading on Sample Plates of SMRT Cells per 250 bp and 500 bp Sample Libraries Well No Complex Complex Reuse Reuse 2 13 uL 9 8 uL 3 17 uL 9 8 uL 4 21 uL 13 8 uL 5 25 uL 14 6 uL 6 29 uL 14 6 uL 7 33 uL 18 6 uL 8 37 uL 19 4 uL 9 41 uL 19 4 uL 10 45 uL 23 4 uL 11 49 uL 24 2 uL 12 53 uL 24 2 uL 13 28 2 uL 14 29 uL 15 29 uL 16 33 0 uL 7 33 8 uL 18 33 8 uL 19 37 8 uL 20 38 6 uL 21
35. iple purification process may be necessary Page 49 Optional Loading Titration Check activity of exonucleases if exonuclease digestion is incomplete library yields may be inflated due to the presence of partial ligation products and the persistence of damaged SMRTbell templates neither of which will sequence efficiently leading to decreases in sequencing metrics e g decreases in read length accuracy and yield Overview The optimal on SMRT Cell loading concentration may vary by sample Slight variations are cumulative in large projects spanning tens or hun dreds of SMRT Cells and a pilot experiment with a loading titration is recommended to maximize coverage and overall yields The data that is generated in the pilot run can be included in any downstream analy ses along with larger optimized data sets The Calculator facilitates setting up the complex dilutions on the sam ple plate to titrate on SMRT Cell template concentrations The calcula tor will generate four dilutions around the recommended concentration The user can make these dilutions from the same bound complex and run the four samples in a pilot loading titration run After the run has completed and the data processed the output of sec ondary analysis can be used to select the optimal on SMRT Cell con centration for running a larger batch of SMRT Cells We recommend using the on SMRT Cell concentration that yields the most data output at an acceptable
36. ise proceed to the third 0 45X volumes of AMPure PB bead purification step Note that yield from 0 40X is typically 10 lower than 0 45X volumes of AMPure PB bead purification AMPure PB Size Selection and Purification Step 3 1 Add 45 uL 0 45X volume or 40 uL 0 40X volume of AMPure beads to the 100 uL of eluted DNA Note that for 0 40X volume it is critical to accurately pipet the desired volume of AMPure PB bead solution there is a steep drop off in recovery for concentrations 0 40X 2 Mix the bead DNA solution thoroughly 3 Quickly spin down the tube for 1 second to collect the beads Do not pellet beads Allow the DNA to bind to beads by shaking in a VWR vortex mixer at 2000 rpm for 10 minutes at room temperature Spin down the tube for 1 second to collect beads Place the tube in a magnetic bead rack to collect the beads to the side of the tube Slowly pipette off cleared supernatant and save in another tube Avoid disturbing the bead pellet Note It is especially important to save the supernatant for 0 40X volumes of AMPure PB purification steps in case of low recovery Wash beads with freshly prepared 70 ethanol Repeat step 8 above 10 Remove tube from magnetic bead rack and spin to pellet beads Remove residual 70 ethanol and dry the bead pellet Both the beads and any residual 70 ethanol will be at the bottom of the tube Place the tube back on magnet
37. ity s N2 tank supply gauge and verify that the supply is gt 80 psi preferably gt 100 120 psi Note that you must have designed your run prior to running the instru ment Refer to the RS Remote online help systems for more informa tion Page 47 TROUBLESHOOTING BIOSCIENCES Troubleshooting When Adapter Dimers May Be Cause of Low Yield Low Library Yields If you suspect that the low yield is due to adapter dimers then you try re purifying the library Increase the current annealed template volume to 50 uL using 1X Primer Buffer dilute the Primer Buffer 1 10 in water Then perform an additional AMPure PB bead purification step using e g for a 10 kb library use 0 45X AMPure PB beads However do not shake in a VWR vortex mixer at 2000 rpm room temperature for more than 10 minutes as adapter dimers may bind to the beads After the ethanol wash resuspend the beads in 1X Primer Buffer Calculate the appropriate volume of Elution Buffer and elute the DNA off the beads Perform an calculation to recalculate molarity before setting up the Annealing and Binding reaction Then repeat the Primer Annealing steps using the Sample Preparation Calculator see the Anneal and Binding sections of this Guide When DNA Quality is Suspected to be Sub Optimal Ensure that the concentration of AMPure PB beads is appropriate for the size of the library b
38. ixer at 2000 rpm for 10 minutes at room temperature Note that the bead DNA mixing is critical to yield After vortexing the bead DNA mixture should appear homogenous We recommend using a VWR vortex mixer with a foam microtube attachment see Overview section with Catalog part number If using other instrumentation ensure that the mixing is equally vigorous Failure to thoroughly mix the DNA with the bead reagent will result in inefficient DNA binding and reduced sample recoveries 5 Spin down the tube for 1 second to collect beads 6 Place the tube in a magnetic bead rack until the beads collect to 7 8 side of the tube and the solution appears clear The actual time required to collect the beads to the side depends on the volume of beads added Slowly pipette off cleared supernatant and save in another tube Avoid disturbing the bead pellet Wash beads with freshly prepared 70 ethanol Note that 70 ethanol is hygroscopic and should be prepared FRESH to achieve optimal results Also 70 ethanol should be stored in a tightly capped polypropylene tube for no more than 3 days a Do not remove the tube from the magnetic bead rack Page 24 b Use a sufficient volume of 70 ethanol to fill the tube 1 5 mL for 1 5 mL tube or 2 mL for 2 mL tube Slowly dispense the 70 ethanol against the side of the tube opposite the beads Let the tube sit for 30 seconds c Do not disturb the bead pellet d After
39. les However because Hydrodynamic shearing perfor mance can vary with each shearing assembly we recommend optimiz ing the shearing whenever a new shearing assembly is used The sheared DNA can be stored for up to 24 hours at 4 C or 2 months at 20 C Page 11 Sheared 10 kb DNA Distribution on a Bioanalyzer Instrument AMPure PB Purification Steps Throughout this Guide Concentrate DNA The FU 45 Figu For graph below shows an example of fragment size distribution Y 5 300 500 700 1000 2000 5000 17000 re1 Fragment Size Distribution for 10 kb all 10 kb purification and concentration steps you must use 0 45X AMPure PB beads For your convenience the guide details these requirements in each section Perform the following steps at room temperature to concentrate your DNA sample Note that you must use low adhesion LoBind microcentrifuge tubes during the entire template preparation process 1 Add 0 45X volume of AMPure PB magnetic beads to the sheared DNA Before using mix the bead reagent well until the solution appears homogenous Pipette the reagent slowly since the bead mixture is viscous and precise volumes are critical to the purification process Consistent and efficient recovery of your sample is critical to successful SMRTbell library preparation If using this protocol for the first time we strongly recommend that you process a control sample first Using the
40. mer Polymerase PUDE Diffusion L Concentra vs EE tion pM MagBead Large Large Large Scale Scale Scale 36 SEQUENCING BIOSCIENCES Before You Begin Fragment DNA 10 Ligate Adapters Blunt Anneal Sequencing Primer to SMRTbell Templates Bind Polymerase to SMRTbell Templates Sequence Page 36 Sequencing Overview Prior to sequencing the bound template polymerase complex must be transferred into the 96 well sample plate at the correct concentration and volume to support the desired number of SMRT Cells This section provides background information necessary for preparing the bound complex for sequencing Diffusion vs MagBead Loading Note that there are two loading options for bound complexes For load ing using the MagBead Station you must bind the complex to Mag Beads using the PacBio MagBead Kit For more specific information on preparing your library using the Mag Bead station see Pacific Biosciences Procedure amp Checklist Low Input 10 kb Library Preparation and Sequencing MagBead Station The Procedure can be found on our Customer Portal or our website at www smrtcommunity com SampleNet MagBead Loading Following the polymerase binding reaction the MagBead Kit is used to bind the library complex with MagBeads before sequencing MagBead bound complexes provide
41. n of SMRTbell Templates Blunt End Ligation Reaction During this step blunt hairpins are ligated to repaired fragment ends Figure 1 Repaired Fragment Ends sn FA y UM YU Dp CU Jp rn m TN 4 ES E ITI Figure 2 Blunt Hairpin Adapters and Insert DNA Ready for Ligation To ligate the hairpins SMRTbell templates to the DNA fragments you will need BLUNT hairpin adapters These are shipped as 20 uM oligonucleotide stock and are pre annealed This reaction can be scaled for the number of library samples being prepared In a LoBind microcentrifuge tube on ice add the following reagents in the order shown note that you can add water to achieve the desired DNA volume If preparing a Master Mix ensure that the adapter is NOT mixed with the ligase prior to introduction of the inserts Add the adapter to the well with the DNA All other components including the ligase should be added to the Master Mix Tube Cap Stock Final DNA End Repaired BEEN 29uL to 30 uL Blunt Adapter 20uM 20 uM 1 0 uL 0 5 uM Mix before proceeding
42. n loop sequence primer binding site in bold underline Site of first incorporation DNA Control Complex Sequence 3 kb to 10 kb TCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGATatcccegcaagaggccceggcagtaccggcataaccaagcc tatgcctacagcatccagggtgacggtgccgaggatgacgatgagcgcattgttagatttcatacacggtgcctgactgcgttagcaatt taactgtgataaactaccgcattaaagcttatcgatgataagctgtcaaacatgagaattcttgaagacgaaagggcctcgtgatacgc ctatttttataggttaatgtcatgataataatggtttcttagacgtcaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttattttt ctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatgagtattca acatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaag atcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaa tgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtgttgacgccgggcaagagcaactcggtcgccgcatacactattc tcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccata accatgagtgataacactgcggccaacttacttctgacaacgatceggaggaccgaaggagctaaccgcttttttgcacaacatgggg gatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgcagc aatggcaacaacgtigcgcaaactattaactggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggat aaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggt atcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacga aatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatactttagattgattt
43. netic bead purification step with size selec tive conditions The final step of the protocol is to remove failed ligation products through the use of exonucleases Short insert libraries are created with a combination of an A tailing step and ligation to an adapter with a single T nucleotide overhang See Pacific Biosciences Procedure amp Checklist 250 bp Amplicon Library Preparation and Sequencing available on our Customer Portal and our website at www smrtcommunity com SampleNet Figure 1 Double stranded DNA Page3 ZEEL Epp pp tm a tma m m AERRERRRRE REN RAERRRRARREE TIETTTTTL EIN h hik ih k dn Ee t th h E TE S 8 8 Ll tB Herd Figure 2 Fragmented DNA Figure 3 Repaired Ends of Fragmented DNA TITS Va P nd Figure 4 SMRTbell Adapters o pICTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT 3 Figure 5 Overhang Adapter o pATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT 3 Figure 6 Blunt Adapter 5 AAAAAAAAAAAAAAAAAATTAACGGAGGAGGAGGA 3 Figure 7 C2 Primer underlined sequence hybridizes to the hairpin loop and red portion contains 2 methoxy modifications to increase stability After the exonuclease step SMRTbell templates are annealed to pr
44. of your DNA sample The most up to date guidance on how to use the g TUBE along with recommended centrifuges and centrifugation speeds can be found in the g TUBE user manual available for download from the Covaris web site e After the first centrifuge spin check the upper chamber for residual liquid Re spin if necessary f there is still liquid in the chamber after 2 spins use a 20 uL pipettor and pipette up and down several times Then spin the tube down again After shearing determine the approximate size range by loading 30 ng of DNA on to the Bioanalyzer 12000 chip or by running a low percent agarose gel Check quantitation on a Nanodrop system Note that fragments sheared using the g TUBE are greatly dependent on gDNA quality and size and may range from 6 kb to 20 kb Use a Covaris g TUBE to shear your DNA sample The most up to date guidance on how to use the g TUBE along with recommended centrifuges and centrifugation speeds can be found in the g TUBE user manual available for download from the Covaris website Depending upon the quality of your sample approximately 20 to 50 sample loss is to be expected as a result of the shearing and con centration process Therefore be sure to have sufficient amounts of starting DNA in order to have at least 5 ug of sheared and concen trated DNA 140 ng uL for the Damage Repair reaction Note that a Hydroshear Shearing Device can also be used to shear DNA samp
45. on The SMRTbell library should be quantitated via fluorescence either in single sample Qubit system or plate based Quant iT system for mats Follow manufacturers instructions and ensure that a double stranded DNA standard is used for the quantitation Page 28 PACIFIC ANNEAL SMRTBELL TEMPLATES BIOSCIENCES AND PRIMERS Before You Begin Fragment DNA 10 kb Repair DNA Damage and DNA Ends Ligate Adapters Blunt Anneal Sequencing Primer to SMRTbell Templates Bind Polymerase to SMRTbell Templates Sequence Page 29 Primer Annealing and Polymerase Binding Template Preparation Calculator To Access the Calculator Primer Annealing Prior to sequencing you must anneal primers to the SMRTbell tem plate bind annealed templates to DNA polymerase and set up the sample plate for sequencing A discussion of the optional loading titra tion to optimize yield per SMRT Cell is also included A Template Preparation Calculator Calculator is provided to assist you through setting up the annealing and binding reactions and setting up the sample plate for sequencing The Calculator can be used in three different modes Volume to use In this mode the Calculator uses the entire sample specified to run the maximum number of SMRT Cells possible of SMRT Cells In this mode the user specifies how many SMRT Cells to prepare and the Calculator determines the amount of sam
46. ore You Begin section The stock concentration provided in the Template Prep Kit is 5 uM SMRTbell molarity calculation In calculating SMRTbell molarity we use the following formula Insert concentration ng ul 1 000 000 Insert concentration in Mean insert size bp 650 nM or fmol uL The detailed calculation is Insert Concentration ng uL 1 mol basepairs 1g 101 fmol nM Mean insert size bp 650 g 10 ng 1 mol uL base pairs See Table 3 in the Sequencing section for a summary of the recom mended concentrations and reuse options for each insert size Page 31 PACIFIC BINDING POLYMERASE TO BIOSCIENCES TEM PLATES 6 Before You Begin Fragment DNA 10 kb Repair DNA Damage and DNA Ends Ligate Adapters Blunt Anneal Sequencing Primer to SMRTbell Templates Bind Polymerase to SMRTbell Templates Sequence Page 32 Binding Reaction Overview In the binding reaction step the primer annealed SMRTbell templates are bound to DNA polymerases Reaction Conditions The reaction takes place in the presence of a buffer DTT nucleotides and a divalent metal cation which stabilizes the complex For all sam ples loading by diffusion the recommended reaction time is 4 hours at 30 C followed by 4 C indefinitely For all samples bound at a 10 1 polymerase to template ratio and using MagBead loading a heat inac tivation step at 37 for 30 minutes is requir
47. ple necessary Loading Titration This mode allows the user to set up a loading titration of the bound complex to optimize the yield of data per SMRT Cell The Calculator suggests four concentrations around the recommended complex concentration on the sample plate however the user can customize the titration range as desired for their sample You can access the Calculator in two ways Bytyping in the Instrument IP address provided by your IT department into a web browser The Calculator will be residing on your local network and can be launched using the link at the top of the RS Dashboard e By downloading from the web at http calc pacb com or http calc PacificBiosciences com Be sure to always check for updates The Calculator is best viewed using Firefox or Chrome browsers Insert Sizes For annealing binding and instrument setup purposes insert sizes are separated into distinct groups See the tables in the Binding section for recommended primer template polymerase template and Control Complex ratios and On Sample Plate concentrations for each insert size Page 30 Reaction Conditions The primer annealing reaction takes place in 1X Primer Buffer stock is 10X The concentrations of the primer and SMRTbell template are dependent on insert size See Table 2 in the Binding section for the primer template ratios as used by the Calculator Primer Sequence The primer sequence currently in use is shown in The Bef
48. se button on the instrument LoadtheSMRT Open the SMRT Cells Tips drawer You can either press the illumi Cells and Tips nated Open button on the instrument SMRT Cells Tips drawer or the Open button on the touchscreen User Interface Load your SMRT Cells Tips on to the Instrument 1 When the drawer opens place the appropriate number of SMRT Cell 8Pacs determined previously during project planning into the SMRT Cells tray Place this end in first Jn p 1 1 ie Ex f Page 45 2 Place tip boxes in the slots Note that at a minimum there should be a tip box in slot 1 and slot 6 Be sure to remove the lid and tape from the tip boxes 3 Gently close the drawer door 4 Press the Close button on the touchscreen User Interface optionally press the Close button on the instrument WARNING Pinch Point Do not place fingers inside drawers as they are closing PINCH POINT Keep hands and fingers clear Front View Start Your Run Before starting your run press Scan on the RS touch screen in order for the instrument to scan the contents of the drawers Once the con tents have been scanned the Start button will be activated After Page 46 pressing Start the UI will prompt you to verify that certain steps have been performed prior to sequencing Waste has been emptied Verify that the Waste bin is less than half full Nitrogen supply is within range Locate your facil
49. since the bead mixture is viscous and precise volumes are critical to the purification process 2 Mix the bead DNA solution thoroughly Mix the beads with the End Repair reaction by pipetting up and down or inverting the tube until the solution is homogenous 3 Quickly spin down the tube for 1 second to collect the beads 4 Allow the DNA to bind to beads by shaking in a VWR vortex mixer at 2000 rpm for 10 minutes at room temperature Note that the bead DNA mixing is critical to yield After vortexing the bead DNA mixture should appear homogenous We recommend using a VWR vortex mixer with a foam microtube attachment see Overview section with part number If using other instrumentation ensure that the mixing is equally vigorous Failure to thoroughly mix the DNA with the bead reagent will result in inefficient DNA binding and reduced sample recoveries Page 18 5 Spin down the tube 1 second to collect beads 6 Place the tube in a magnetic bead rack until the beads collect to the side of the tube and the solution appears clear The actual time required to collect the beads to the side depends on the volume of beads added Slowly pipette off cleared supernatant and discard Avoid disturbing the bead pellet With the tube still on the magnetic bead rack slowly pipette off cleared supernatant and save in another tube Avoid disturbing the bead pellet If the DNA is not recovered at the end of this Procedure you can
50. sure to have sufficient amounts of starting DNA in order to have the required amount of starting material for the End Repair reaction Page6 Scaling Up Reactions Please note that all reaction volumes are concentration dependent and each can be scaled with the input amount of sheared DNA If pre paring larger amounts of DNA scale all the reaction volumes propor tionally For example if the input amount is double the amount of DNA we recommend carrying out the reaction with double of every compo nent and double the total volume PacBio Kits and PacBio Kits and SMRT Cell 8Pacs For Sequencing Experiments SMRT Cells the PacBio System Required Item Source DNA Template Prep Kit 2 0 Pacific Biosciences DNA Polymerase Binding Kit P4 Pacific Biosciences DNA Sequencing Kit 2 0 Pacific Biosciences DNA Sequencing Kit XL 1 0 Pacific Biosciences Plasmidbell Complex P4 Pacific Biosciences DNA Control Complex P4 Pacific Biosciences MagBead Kit Pacific Biosciences MagBead Buffer Kit Pacific Biosciences AMPure PB Kit Pacific Biosciences SMRT Cell 8Pac Pacific Biosciences SMRT Cell Oil Pacific Biosciences Specific Lab Required Equipment for Successful Template Preparation Equipment and Related Consumables Required Shearing Device g TUBE microcentrifuge tubes Covaris Covaris S2 System 1 sample or Covaris E Series 96 samples For Covaris devices miniTube holders and clear mini Tubes will also be needed Item
51. ted by each of the insert size groups Page 33 Table 1 Insert Size and Control Complex Molarity Ratios Insert Control Complex to target lt 10 Size Bound Bound of total number of reads per movie 500 bp 1 3 For Standard sequencing there are two controls DNA Control Com plex P4 for 250 bp to 3 kb and DNA Control Complex P4 for 3 0 kb to 10 kb The DNA Control Complex P4 for 250 bp to 3 kb has a 600 bp insert size while the DNA Control Complex P4 for 3 0 kb to 10 kb has a 4 3 kb insert size During sequencing the control complexes can be used to troubleshoot underperforming samples The exact sequences are provided at the end of this document The amount of Control Complex to add to experimental templates is governed by two considerations First the required amount of the Con trol Complex depends on the desired fraction of Control reads Cur rently the recommended yield of Control reads is lt 10 of the total number of reads per movie Secondly the size of the Control relative to the size of the experimental templates matters Loading of templates into zero mode waveguides ZMWs is size dependent small inserts load better than large see the figure below Because of this size dependence different ratios of control sample templates are needed for small versus large libraries Page 34 ZMW Loading Bias for Various Insert Sizes o N o c 5 c o w
52. ter than 3 0 kb 5000 bp and 10000 bp Page 38 For MagBead loading the complex immobilization time on the SMRT Cell is one hour for all samples greater than 1 kb Bound Complex Reuse The bound complex used for immobilization on one SMRT Cell may be reused on several subsequent SMRT Cells allowing for greater data output for a given amount of input DNA When Complex Reuse is selected on the RS Remote up to two additional SMRT Cells can be immobilized using the diluted complex from the first SMRT Cell this is limited by both evaporation and the volume recovery capabilities of the instrument Complex reuse is available for all Standard sequencing insert sizes It is not available for MagBead loading Loading Concentration Recommendations The recommended concentration on the SMRT Cell depends on the binding concentrations insert sizes and immobilization time Table 2 in the Binding section provides recommendations for loading concen trations on the plate for different insert sizes at both Small scale and Large scale binding conditions Complex Volumes for Loading The liquid volume to load into the 96 well sample plate depends on the desired number of SMRT Cells the insert size and whether or not Complex Reuse will be used Note that the sample plate has a maxi mum fill volume of 80 uL and an instrument pipetting dead volume of 5 uL for diffusion loading and 10 uL for MagBead loading When using diffusion loading for a s
53. tgcgcatgatcgtgctcct gtcgttgaggacccggctaggctggcggggttgccttactggttagcagaatgaatcaccgatacgcgagcgaacgtgaagcgactg ctgctgcaaaacgtctgcgacctgagcaacaacatgaatggtcttcggtttccgtgtttcgtaaagtctggaaacgcggaagtcagcgc cctgcaccattatgttccggatctgcatcgcaggatgctgctggctaccctgtggaacacctacatctgtattaacgaagcgctggcattg accctgagtgatttttctctggtcccgecgcatccataccgccagttgtttaccctcacaacgttccagtaaccgggcatgttcatcatcagt aacccgtatcgtgagcatcctctctcgtttcatcggtatcattacccccatgaacagaaatcccccttacacggaggcatcagtgaccaa acaggaaaaaaccgcccttaacatggcccgctttatcagaagccagacattaacgcttctggagaaactcaacgagctggacgcgg atgaacaggcagacatctgtgaatcgcttcacgaccacgctgatgagctttaccgcagctgcctcgcgcgtttcggtgatgacggtgaa aacctctgacacatgcagctcccggagacggtcacagcttgtctgtaagcggatgccgggagcagacaagccoegtcagggcgcgt cagcgggtgttggcgggtgtcggggcgcagccatgacccagtcacgtagcgatagcggagtgtatactggcttaactatgcggcatc agagcagattgtactgagagtgcaccatatgcggtgtgaaataccgcacagatgcgtaaggagaaaataccgcatcaggcgctcttc Page 54 cgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccac agaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgogttgctg gcgtttttccataggctccgccccecctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactata aagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttc gggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccc cccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcag ccactggtaacaggatta
54. tggctccaagtagcgaagcgagcaggactgggcggcggccaaagcggtcggacagtgctccgagaacgggtgcgcatag aaattgcatcaacgcatatagcgctagcagcacgccatagtgactggcgatgctgtcggaatggacgatAl CI CTCTCTTTT CCTCCTCCTCCGTTGT IGT TGTTGAGAGAGATatcgtccattccgacagcatcgccagtcactatggcgtgctgct agcgctatatgcgttgatgcaatttctatgcgcacccgttctcggagcactgtccgaccgctttggccgccgcccagtcctgctcgcttcg ctacttggagccactatcgactacgcgatcatggcgaccacacccgtcctgtggatcctctacgccggacgcatcgtggccggcatca ccggcgccacaggtgcggttgctggcgcctatatcgccgacatcaccgatggggaagatcgggctcgccacttcgggctcatgagc gcttgtttcggcgtgggtatggtggcaggccccegtggccgggggactgttgggcgccatctccttgcatgcaccattccttgcggcggcg gtgctcaacggcctcaacctactactgggctgcttcctaatgcaggagtcgcataagggagagocgtcgaccgatgcccttgagagcct tcaacccagtcagctccttccggtgggcgcggggcatgactatcgtcgccgcacttatgactgtcttctttatcatgcaactcgtaggaca ggtgccggcagocgctctgggtcattttcggcgaggacoegctttcgctggagcgcgacgatgatcggcctgtcgcttgcggtattcggaat cttgcacgccctcgctcaagccticgtcactggtcccgccaccaaacgtttcggcgagaagcaggccattatcgccggcatggcggcc gacgcgctgggctacgtcttgctggcgttcgcgacgcgaggctggatggccttccccattatgattcttctcgcttccggcggcatcggg atgcccgogttgcaggccatgctgtccaggcaggtagatgacgaccatcagggacagcttcaaggatcgctcgcggctcttaccagc ctaacttcgatcactggaccgctgatcgtcacggcgatttatgccgcctcggcgagcacatggaacgggttggcatggattgtaggcgc cgccctataccttgtctgcctecccgcgttgcgtcgcggtgcatggagccgggccacctcgacctgaatggaagccggocggcacctcg ctaacggattcaccactccaagaattggagccaatcaattcttgcggagaactgtgaatgcgcaaaccaacccttggcagaacatatc catcgcgtccgccatctccagcagccgcacgcggcgcatctcgggcagcgttgggtcctggccacggg
55. tgtgagggtaaacaactggcggtatggatgcggcgggaccagagaaaaatcactcagggtcaatgccagcgctt cgttaatacagatgtaggtgttccacagggtagccagcagcatcctgcgatgcagatccggaacataatggtgcagggcgctgacttc cgcgtttccagactttacgaaacacggaaaccgaagaccattcatgttgttgctcaggtcgcagacgttttgcagcagcagtcgcttcac gttcgctcgcgtatcggtgattcattctgctaaccagtaaggcaaccccgccagcctagccgggtcctcaacgacaggagcacgatca tgcgcacccgtggccaggacccaacgctgcccgagatgcgccgcgtgcggctgctggagatggcggacgcgatggatatgttctgc caagggttggtttgcgcattcacagttctccgcaagaattgattggctccaattcttggagtggtgaatccgttagcgaggtgccgccggc ttccattcaggtcgaggtggcccggctccatgcaccgcgacgcaacgcggggaggcagacaaggtatagggcggcgcctacaatc catgccaacccgttccatgtgctcgccgaggcggcataaatcgccgtgacgatcagcggtccagtgatcgaagttaggctggtaaga gccgcgagcgatccttgaagctgtccctgatggtcgtcatctacctgcctggacagcatggcctgcaacgcgggcatcccgatgccgc cggaagcgagaagaatcataatggggaaggccatccagcctcgcgtcgcgaacgccagcaagacgtagcccagcgcgtcggcc gccatgccggcgataatggcctgcttctcgccgaaaocgtttggtggcgggaccagtgacgaaggcttgagcgagggogtgcaagatt ccgaataccgcaagcgacaggcogatcatcgtcgcgctccagcgaaagcggtcctcgccgaaaatgacccagagcgctgccggc acctgtcctacgagttgcatgataaagaagacagtcataagtgcggcgacgatagtcatgccccgcgceccaccggaaggagctgac tgggttgaaggctctcaagggcatcggtcgacgctctcccttatgcgactcctgcattaggaagcagcccagtagtaggttgaggccgt tgagcaccgccgccgcaaggaatggtgcatgcaaggagatggcgcccaacagtcccccggccacggggcctgccaccataccc acgccgaaacaagcgctcatgagcccgaagtggcgagcccgatcttccccatcggtgatgtcggcgatataggcgccagcaaccg cacctgtggcgccggtgatgccggccacgatgcgtccggcgtagaggatccacaggacgggtgtggtcgccatgatcgcgtagtcg atag
56. the DNA is not recovered at the end of this procedure you can add equal volumes of AMPure PB beads to the saved supernatant and repeat the AMPure PB bead purification steps to recover the DNA Wash beads with freshly prepared 70 ethanol Note that 70 ethanol is hygroscopic and should be prepared FRESH to achieve optimal results Also 70 ethanol should be stored in a tightly capped polypropylene tube for no more than 3 days a Do not remove the tube from the magnetic bead rack b Use a sufficient volume of 70 ethanol to fill the tube 1 5 mL for 1 5 mL tube or 2 mL for 2 mL tube Slowly dispense the 70 ethanol against the side of the tube opposite the beads Let the tube sit for 30 seconds c Do not disturb the bead pellet d After 30 seconds pipette and discard the 70 ethanol Page 13 9 Repeat step 8 above 10 Remove residual 70 ethanol and dry the bead pellet a Remove tube from magnetic bead rack and spin to pellet beads Both the beads and any residual 7096 ethanol will be at the bottom of the tube b Place the tube back on magnetic bead rack c Pipette off any remaining 70 ethanol 11 Check for any remaining droplets in the tube If droplets are present repeat step 10 12 Remove the tube from the magnetic bead rack and allow beads to air dry with the tube caps open for 30 to 60 seconds 13 Calculate appropriate volume of Elution Buffer a For 10 kb libraries ng X0 5 pL of
57. ttgacagcttatcatcgataagctttaatgcggtagtttatcacagttaaattgctaa cgcagtcaggcacogtgtatgaaatctaacaatgcgctcatcgtcatcctcggcaccgtcaccctggatgctgtaggcataggcttggtt atgccggtactgccgggcctcttgcgggat CTCTCTCTTT Insert sequence lowercase no color Hairpin stem sequence Hairpin loop sequence primer binding site in bold underline Site of first incorporation 06122013 Page 55
Download Pdf Manuals
Related Search