Home

Contents - Thermo Fisher Scientific

image

Contents

1. TOP10F Chemically 20 x 50 pl C3030 03 Competent E coli One Shot Max Efficiency DH5a T1 20 x 50 pl 12297 016 Competent Cells Max Efficiency DH10B Competent Cells 5 x 0 2 ml 18297 010 Electrocomp Kit 2 x 20 reactions C66511 Ampicillin 200 mg 11593 027 Carbenicillin 58 10177 012 T7 promoter primer 2 ug N560 02 BGH Reverse primer 2ug N575 02 PureLink HiPure Plasmid Miniprep Kit 100 preps K2100 03 PureLink HiPure Plasmid Midiprep Kit 25 preps K2100 04 Lipofectamine 2000 Reagent 1 5 ml 11668 019 B Gal Assay Kit 1 kit K1455 01 B Gal Staining Kit 1 kit K1465 01 TM For stable transfection the pcDNA 3 1 V5 His vectors contain the resistance factor to Geneticin Geneticin is available from Invitrogen For more information visit www invitrogen com or contact Technical Support see page 14 Item Quantity Cat no Geneticin Selective Antibiotic 1g 11811 023 58g 11811 031 25g 11811 098 20 ml 50 mg ml 10131 035 100 ml 50 mg ml 10131 027 Continued on next page Accessory Products Continued Detecting Fusion A number of antibodies are available from Invitrogen that can be used to detect Proteins expression of your fusion protein from pcDNA 3 1 V5 His The table below describes the antibodies available and ordering information The amount of antibody supplied is sufficient for 25 western blots Antibody Pur
2. The buyer cannot sell or otherwise transfer a this product b its components or c materials made using this product or its components to a third party or otherwise use this product or its components or materials made using this product or its components for Commercial Purposes The buyer may transfer information or materials made through the use of this product to a scientific collaborator provided that such transfer is not for any Commercial Purpose and that such collaborator agrees in writing a not to transfer such materials to any third party and b to use such transferred materials and or information solely for research and not for Commercial Purposes Commercial Purposes means any activity by a party for consideration and may include but is not limited to 1 use of the product or its components in manufacturing 2 use of the product or its components to provide a service information or data 3 use of the product or its components for therapeutic diagnostic or prophylactic purposes or 4 resale of the product or its components whether or not such product or its components are resold for use in research For products that are subject to multiple limited use label licenses the terms of the most restrictive limited use label license shall control Life Technologies Corporation will not assert a claim against the buyer of infringement of patents owned or controlled by Life Technologies Corporation which cover this product based u
3. containing the P galactosidase gene was then ligated into peDNA 3 1 V5 His C in frame with the C terminal peptide Map of The figure below summarizes the features of the peDNA 3 1 V5 His lacZ vector pcDNA 3 1 The nucleotide sequence for pcDNA 3 1 V5 His lacZ is available for V5 His lacZ downloading from www invitrogen com or by contacting Technical Support see page 14 pcDNA3 1 V5 His lacZ Comments for pcDNA3 1 V5 His lacZ 8549 nucleotides CMV promoter bases 209 863 T7 promoter priming site bases 863 882 lacZ with C terminal tag 963 4115 lacZ ORF bases 963 4019 V5 epitope bases 4047 4088 Polyhistidine 6xHis tag bases 4098 4115 BGH reverse priming site bases 4138 4155 BGH polyadenylation signal bases 4137 4351 f1 origin of replication bases 4414 4827 SV40 promoter and origin bases 4892 5216 Neomycin resistance gene bases 5252 6046 SV40 polyadenylation signal bases 6065 6303 pUC origin bases 6735 7408 C Ampicillin resistance gene bases 7553 8413 C C complementary strand 11 Accessory Products Additional Products Geneticin Selective Antibiotic 12 The following additional products may be used with the pceDNA 3 1 V5 His vectors For more information visit www invitrogen com or contact Technical Support see page 14 Item Quantity Cat no One Shot TOP10 Chemically Competent 10 reactions C4040 10 E coli One Shot
4. mammalian cells of the bacterial aminoglycoside phosphotransferase gene APH derived from Tn5 results in detoxification of Geneticin Selective Antibiotic Southern and Berg 1982 Continued on next page Transformation and Transfection Continued Geneticin Selection Guidelines Preparing Cells for Lysis Lysing of Cells Geneticin is available from Invitrogen see page 12 for ordering information Use as follows 1 Prepare Geneticin in a buffered solution e g 100 mM HEPES pH 7 3 2 Use 100 to 1 000 ug ml of Geneticin in complete medium 3 Calculate concentration based on the amount of active drug check the lot label 4 Test varying concentrations of Geneticin on your cell line to determine the concentration that kills your cells kill curve Cells differ in their susceptibility to Geneticin Cells will divide once or twice in the presence of lethal doses of Geneticin Selective Antibiotic so the effects of the drug take several days to become apparent Complete selection can take from 2 to 4 weeks of growth in selective medium Use the procedure below to prepare cells for lysis prior to purification of your protein on ProBond see page 13 You will need 5 x 10 to 1 x 10 cells for purification of your protein on a 2 ml ProBond column see ProBond Protein Purification manual 1 Seed cells in five T 75 flasks or 2 to 3 T 150 flasks 2 Grow the cells in selective medium
5. site and the BstX I site The multiple cloning site has been confirmed by A sequencing and functional testing The sequence is available for downloading from www invitrogen com or by contacting Technical Support see page 14 l 861 ATTAATACGA CTCACTATAG GGAGACCCAA GCTGGCTAGT TAA GCT TGG TAC CGA GCT CGG Ala Trp Tyr Arg Ala Arg BstX I EcoRI EcoR V BsiX I NotI 922 ATC CAC TAG TCC AGT GTG GTG GAA TTC TGC AGA TAT CCA GCA CAG TGG CGG CCG Ile His Ser Ser Val Val Glu Phe Cys Arg Tyr Pro Ala Gln Trp Arg Pro Xho 1 Xba I Apa Sul V5 epitope 976 CTC GAG TCT AGA GGG CCC TTC GAA GGT AAG CCT ATC CCT AAC CCT CTC CTC GGT Leu Glu Ser Arg Gly Pro Phe Glu Gly Lys Pro Ile Pro Asn Pro Leu Leu Gly Age I Polyhistidine tag Pme 1 I 1030 CTC GAT TCT ACG CGT ACC GGT CAT CAT CAC CAT CAC CAT TGA GTTTAAACCC Leu Asp Ser Thr Arg Thr Gly His His His His His His T7 promoter priming site Hind Ill Kpn I Bank I BGH Reverse priming site I 1 1083 GCTGATCAGC CTCGACTGTG CCTTCTAGTT GCCAGCCAT Note that there are two BstX I sites in the polylinker Continued on next page Cloning into pcDNA 3 1 V5 His A B and C Continued Multiple Cloning Below is the multiple cloning site for peDNA 3 1 V5 His B Restriction sites are Site of labeled to indicate the cleavage site The boxed nucleotides indicate the variable pcDNA 3 1 V5 His region The multiple cloning site ha
6. the following precautions to prevent your clone from being overrun by background contaminants e Use carbenicillin instead of ampicillin Carbenicillin is more stable than ampicillin and allows for a longer period of selective pressure thus preserving your clones longer e Increase the antibiotic concentration More antibiotic means that your clones will not be overwhelmed by P lactamase buildup e Periodically refresh plate media If you suspect that tubes plates may be beginning to fail spin them down remove the old media and replenish the wells with fresh LB media plus glycerol and antibiotic Streak clones on selective preferably carbenicillin LB agar plates After about 12 hours isolate colonies for downstream usage This will isolate your desired clones from potential background contaminants We recommend that you sequence your construct with the T7 Promoter and BGH Reverse primers see page 12 for ordering information to confirm that your gene is fused in frame with the V5 epitope and the C terminal polyhistidine tag Refer to the diagrams on pages 3 5 for the sequence and location of the priming sites Primer Sequence T7 Promoter 5 TAATACGACTCACTATAGGG 3 BGH Reverse 5 TAGAAGGCACAGTCGAGG 3 For your convenience Invitrogen offers a custom primer service For more information visit www invitrogen com or call Technical Support see page 14 Plasmid DNA for transfection into euka
7. until they are 80 90 confluent 3 Harvest the cells by treating with trypsin EDTA for 2 to 5 minutes or by scraping the cells in PBS 4 Inactivate the trypsin if necessary and transfer the cells to a sterile microcentrifuge tube 5 Centrifuge the cells at approximately 250 x g for 5 minutes You may lyse the cells immediately or freeze in liquid nitrogen and store at 80 C until needed TM TM If you are using ProBond resin refer to the ProBond Protein Purification manual for details about sample preparation for chromatography If you are using other metal chelating resin refer to the manufacturer s instruction Appendix pcDNA 3 1 V5 His A B and C Vectors TM Map of The figure below summarizes the features of the pcDNA 3 1 V5 His vectors The pcDNA 3 1 V5 His sequences for peDNA 3 1 V5 His A B and C are available for downloading from www invitrogen com or by contacting Technical Support see page 14 Details of the multiple cloning sites are shown on page 3 for pcDNA 3 1 V5 His A page 4 for pcDNA 3 1 V5 His B and page 5 for pcDNA 3 1 V5 His C y i WI oxtiis fen Comments for pcDNA3 1 V5 His A 5502 nucleotides CMV promoter bases 209 863 After the Xho site there is a unique T7 promoter priming site bases 863 882 BstE II site but no Xba or Apa Multiple cloning site bases 902 999 sites in version C V5 epitope bases 1000 1041 Polyhistidine 6xHis tag bases 1
8. warranty is granted for products beyond their listed expiration date No warranty is applicable unless all product components are stored in accordance with instructions The Company reserves the right to select the method s used to analyze a product unless the Company agrees to a specified method in writing prior to acceptance of the order Invitrogen makes every effort to ensure the accuracy of its publications but realizes that the occasional typographical or other error is inevitable Therefore the Company makes no warranty of any kind regarding the contents of any publications or documentation If you discover an error in any of our publications please report it to our Technical Support Representatives Life Technologies Corporation shall have no responsibility or liability for any special incidental indirect or consequential loss or damage whatsoever The above limited warranty is sole and exclusive No other warranty is made whether expressed or implied including any warranty of merchantability or fitness for a particular purpose Purchaser Notification Limited Use Label License No 5 Invitrogen Technology Limited Use Label License No 22 Vectors and Clones Encoding Histidine Hexamer The purchase of this product conveys to the buyer the non transferable right to use the purchased amount of the product and components of the product in research conducted by the buyer whether the buyer is an academic or for profit entity
9. 008 USA 3 9 15 Kaigan 3 Fountain Drive Tel 1 760 603 7200 Minato ku Tokyo 108 0022 Paisley PA4 9RF UK Tel Toll Free 1 800 955 6288 Tel 81 3 5730 6509 Tel 44 0 141 814 6100 Fax 1 760 602 6500 Fax 81 3 5730 6519 Tech Fax 44 0 141 814 6117 E mail tech_support invitrogen com E mail jpinfo invitrogen com E mail eurotech invitrogen com MSDS Certificate of Analysis Limited Warranty 14 Material Safety Data Sheets MSDSs are available on our website at www invitrogen com msds The Certificate of Analysis provides detailed quality control and product qualification information for each product Certificates of Analysis are available on our website Go to www invitrogen com support and search for the Certificate of Analysis by product lot number which is printed on the box Invitrogen a part of Life Technologies Corporation is committed to providing our customers with high quality goods and services Our goal is to ensure that every customer is 100 satisfied with our products and our service If you should have any questions or concerns about an Invitrogen product or service contact our Technical Support Representatives All Invitrogen products are warranted to perform according to specifications stated on the certificate of analysis The Company will replace free of charge any product that does not meet those specifications This warranty limits the Company s liability to only the price of the product No
10. 051 1068 BGH reverse priming site bases 1091 1108 BGH polyadenylation signal bases 1090 1304 f1 origin of replication bases 1357 1780 SV40 promoter and origin bases 1845 2169 Neomycin resistance gene bases 2205 2999 SV40 polyadenylation signal bases 3018 3256 pUC origin bases 3688 4361 C Ampicillin resistance gene bases 4506 5366 C C complementary strand There is a unique Sac II site between the Apa site and the Sfu site in version B only Continued on next page pcDNA_ 3 1 V5 His A B and C Vectors Continued Features of pcDNA 3 1 V5 His 10 pcDNATM3 1 V5 His A 5 502 bp pcDNAT Y3 1 V5 His B 5 506 bp and pcDNA 3 1 V5 His C 5 498 bp contain the following elements All features have been functionally tested Feature Benefit Human cytomegalovirus CMV immediate early promoter enhancer Permits efficient high level expression of your recombinant protein Andersson et al 1989 Boshart et al 1985 Nelson et al 1987 T7 promoter priming site Allows for in vitro transcription in the sense orientation and sequencing through the insert Multiple cloning site in three reading frames Allows insertion of your gene and facilitates cloning in frame with the V5 epitope and polyhistidine C terminal tag V5 epitope Gly Lys Pro Ile Pro Asn Pro Leu Leu Gly Leu Asp Ser Thr Allows detection of your recombinant protein with the Anti V5 Antibody Catalog
11. Nelson J A Reynolds Kohler C and Smith B A 1987 Negative and Positive Regulation by a Short Segment in the 5 Flanking Region of the Human Cytomegalovirus Major Immediate Early Gene Mol Cell Biol 7 4125 4129 Sambrook J Fritsch E F and Maniatis T 1989 Molecular Cloning A Laboratory Manual Second Edition Plainview New York Cold Spring Harbor Laboratory Press Shigekawa K and Dower W J 1988 Electroporation of Eukaryotes and Prokaryotes A General Approach to the Introduction of Macromolecules into Cells BioTechniques 6 742 751 Southern J A Young D F Heaney F Baumgartner W and Randall R E 1991 Identification of an Epitope on the P and V Proteins of Simian Virus 5 That Distinguishes Between Two Isolates with Different Biological Characteristics J Gen Virol 72 1551 1557 Southern P J and Berg P 1982 Transformation of Mammalian Cells to Antibiotic Resistance with a Bacterial Gene Under Control of the SV40 Early Region Promoter J Molec Appl Gen 1 327 339 Wigler M Silverstein S Lee L S Pellicer A Cheng Y C and Axel R 1977 Transfer of Purified Herpes Virus Thymidine Kinase Gene to Cultured Mouse Cells Cell 11 223 232 2009 2010 Life Technologies Corporation All rights reserved For research use only Not intended for any animal or human therapeutic or diagnostic use 16 Notes 17 invitrogen Corporate Headquarters Invitroge
12. h the correct restriction pattern and use sequencing to confirm that your gene is in frame with the C terminal peptide e Transfect your construct into the cell line of choice using your own method of transfection e Test for expression of your recombinant gene by western blot analysis or functional assay If you do not have an antibody to your protein Invitrogen offers Anti V5 antibodies or Anti His C term antibodies to detect your recombinant protein See page 13 for ordering information e To purify your recombinant protein you may use metal chelating resin such as ProBond ProBond resin is available separately see page 13 for ordering information Continued on next page Cloning into pcDNA 3 1 V5 His A B and C Continued Before Starting General Molecular Biology Techniques Maintaining pcDNA 3 1 V5 His Kozak Sequence for Mammalian Expression Diagrams are provided on pages 3 5 to help you ligate your gene of interest in frame with the C terminal peptide General considerations are listed below for additional information For information on transformation and transfection see page 6 For help with DNA ligations E coli transformations restriction enzyme analysis purification of single stranded DNA DNA sequencing and DNA biochemistry please refer to Molecular Cloning A Laboratory Manual Sambrook et al 1989 or Current Protocols in Molecular Biology Ausubel et al 1994 Many E coli stra
13. ins are suitable for the growth of this vector To propagate and maintain pcDNA 3 1 V5 His A B and C use 10 ng of the vector to transform a recA recombination deficient endA endonuclease A deficient E coli strain like TOP10 TOP10F DH5a T1 DH10B or equivalent see page 12 for ordering information Select the transformants on LB plates containing 50 to 100 pg ml ampicillin For long term storage prepare a glycerol stock of your plasmid containing E coli strain If you are recombining your entry clone with a destination vector for mammalian expression your insert should contain a Kozak consensus sequence with an ATG initiation codon for proper initiation of translation Kozak 1987 Kozak 1991 Kozak 1990 An example of a Kozak consensus sequence is provided below Other sequences are possible but the G or A at position 3 and the G at position 4 shown in bold illustrates the most commonly occurring sequence with strong consensus Replacing one of the two bases at these positions provides moderate consensus while having neither results in weak consensus The ATG initiation codon is shown underlined G AJNNATGG Continued on next page Cloning into pcDNA 3 1 V5 His A B and C Continued Multiple Cloning Below is the multiple cloning site for peDNA 3 1 V5 His A Restriction sites are Site of labeled to indicate the cleavage site Note that there is a stop codon between the pcDN A 3 1 V5 His BamH I
14. invitrogen pcDNA 7 3 1 V5 His A B and C Catalog no V810 20 Rev date 09 November 2010 Manual part no 28 0141 MAN0000645 ii Contents Contents and Soria il pad iv Methods asar cacenhcceacacacesscacacens aeacacasauascnasaceesstacecetececncceecanusatecenacateuenueuttace 1 Cloning into poDNA 3 17 Vo His AB NIE as 1 Transformation and Transfection ccccesscssssesscsseseeecscessecssesesecssaesecsssaeeecnssassecassacsecassassecaesaseesaeaseesaseaserents 6 A tieiseh es nee esa nee eee estan ee TTT 9 peON A 3 1 V5 His A Band Vectors ini di ia E DES 9 PIN SIIVS OS SAA AAA EIER 11 Accessory PLOGDUCHS os eer IL ADA dali ADE ias 12 Technical Support 2222 eins A hin ee NB A sian AA A 14 Purchaser Notifie tion nn een es Be en en bb dae Aaa ER 15 References ars AA IAI ION NN 17 iii Contents and Storage Contents Shipping and Storage 20 ug each of peDNA 3 1 V5 His A B and C are supplied at 0 5 pg pl in 10 mM Tris HCI 1 mM EDTA pH 8 0 in a total volume of 40 pl 20 ug of peDNA 3 1 V5 His lacZ is supplied at 0 5 ug pl in 10 mM Tris HCI 1 mM EDTA pH 8 0 in a total volume of 40 ul pcDNA 3 1 V5 His vectors are shipped on wet ice Upon receipt store vectors at 20 C Methods Cloning into pcDNA 3 1 V5 His A B and C Introduction Experimental Outline pcDNA 3 1 V5 His A B and C are 5 5 kb vectors derived from pcDNA 3 1 and designed for high level ex
15. n Corporation 5791 Van Allen Way Carlsbad CA 92008 T 1 760 603 7200 F 1 760 602 6500 E tech_support invitrogen com For country specific contact information visit our web site at www invitrogen com
16. no R960 25 and the Anti V5 HRP Antibody Catalog no R961 25 Southern et al 1991 C terminal polyhistidine tag Permits purification of your recombinant protein on metal chelating resin such as ProBond In addition the C terminal polyhistidine tag is the epitope for the Anti His C term Antibody Catalog no R930 25 and the Anti His C term HRP Antibody Catalog no R931 25 BGH reverse priming site Permits sequencing through the insert Bovine growth hormone BGH polyadenylation signal Efficient transcription termination and polyadenylation of mRNA Goodwin and Rottman 1992 fl origin Allows rescue of single stranded DNA SV40 early promoter and Allows efficient high level expression of the origin neomycin resistance gene and episomal replication in cells expressing the SV40 large T antigen Neomycin resistance gene Selection of stable transfectants in mammalian cells Southern and Berg 1982 SV40 polyadenylation signal Efficient transcription termination and polyadenylation of mRNA pUC origin High copy number replication and growth in E coli Ampicillin resistance gene B lactamase Selection of vector in E coli pcDNA 3 1 V5 His lacZ TM Description pcDNA 3 1 V5 His lacZ is a 8 549 bp control vector containing the gene for P galactosidase p DNA 3 1 V5 His C was digested with EcoR V and Not I A 3 2 kb blunt Not I fragment
17. pon the manufacture use or sale of a therapeutic clinical diagnostic vaccine or prophylactic product developed in research by the buyer in which this product or its components was employed provided that neither this product nor any of its components was used in the manufacture of such product If the purchaser is not willing to accept the limitations of this limited use statement Life Technologies is willing to accept return of the product with a full refund For information about purchasing a license to use this product or the technology embedded in it for any use other than for research use please contact Out Licensing Life Technologies 5791 Van Allen Way Carlsbad California 92008 Phone 760 603 7200 or e mail outlicensing lifetech com This product is licensed under U S Patent Nos 5 284 933 and 5 310 663 and foreign equivalents from Hoffmann LaRoche Inc Nutley NJ and or Hoffmann LaRoche Ltd Basel Switzerland and is provided only for use in research Information about licenses for commercial use is available from QIAGEN GmbH Max Volmer Str 4 D 40724 Hilden Germany 15 References Andersson S Davis D L Dahlback H J rnvall H and Russell D W 1989 Cloning Structure and Expression of the Mitochondrial Cytochrome P 450 Sterol 26 Hydroxylase a Bile Acid Biosynthetic Enzyme J Biol Chem 264 8222 8229 Ausubel F M Brent R Kingston R E Moore D D Seidman J G Smith J A and St
18. pose Cat no Anti V5 Detects 14 amino acid epitope R960 25 Anti V5 HRP derived from the P and V proteins R961 25 of the paramyxovirus SV5 Anti V5 AP Southern et al 1991 R962 25 Anti His C term Detects the C terminal R930 25 Anti His C term HRP polyhistidine tag requires the free 934 95 carboxyl group for detection Anti His C term AP R932 25 TM Purifying Fusion The following products can be used in conjunction with pcDNA 3 1 V5 His Proteins vectors to purify recombinant protein Item Quantity Cat no ProBond Purification System 6 purifications K850 01 ProBond Nickel Binding Resin 50 ml R801 01 Precharged resin provided as a 50 150 ml R801 15 slurry in 20 ethanol 13 Technical Support Web Resources Visit the Invitrogen website at www invitrogen com for e Technical resources including manuals vector maps and sequences application notes MSDSs FAQs formulations citations handbooks etc e Complete technical support contact information e Access to the Invitrogen Online Catalog e Additional product information and special offers Contact Us For more information or technical assistance call write fax or email Additional international offices are listed on our website www invitrogen com Corporate Headquarters Japanese Headquarters European Headquarters 5791 Van Allen Way LOOP X Bldg 6F Inchinnan Business Park Carlsbad CA 92
19. pression purification and detection of recombinant proteins in mammalian hosts High level stable and non replicative transient expression can be carried out in most mammalian cells The vectors contain the following elements e Three reading frames to facilitate in frame cloning with a C terminal tag encoding the V5 epitope and a polyhistidine metal binding peptide e Human cytomegalovirus CMV immediate early promoter for high level expression in a wide range of mammalian cells e Episomal replication in cell lines that are latently infected with SV40 or that express the SV40 large T antigen e g COS7 The control plasmid pcDNA 3 1 V5 His lacZ contains a 3 2 kb fragment containing the B galactosidase gene cloned in frame with the C terminal peptide see page 11 pcCDNA 3 1 V5 His lacZ is included for use as a positive control for transfection expression purification and detection in the cell line of choice Use the following outline to clone and express your gene of interest in pcDNA 3 1 V5 His e Consult the multiple cloning sites described on pages 3 5 to determine which vector A B or C should be used to clone your gene in frame with the C terminal V5 epitope and polyhistidine tag e Ligate your insert into the appropriate vector and transform into E coli Select transformants with 50 to 100 pg ml ampicillin e Analyze your transformants for the presence of insert by restriction digestion e Select a transformant wit
20. ruhl K 1994 Current Protocols in Molecular Biology New York Greene Publishing Associates and Wiley Interscience Boshart M Weber F Jahn G Dorsch H sler K Fleckenstein B and Schaffner W 1985 A Very Strong Enhancer is Located Upstream of an Immediate Early Gene of Human Cytomegalovirus Cell 41 521 530 Chen C and Okayama H 1987 High Efficiency Transformation of Mammalian Cells by Plasmid DNA Mol Cell Biol 7 2745 2752 Chu G Hayakawa H and Berg P 1987 Electroporation for the Efficient Transfection of Mammalian Cells with DNA Nuc Acids Res 15 1311 1326 Felgner P L Holm M and Chan H 1989 Cationic Liposome Mediated Transfection Proc West Pharmacol Soc 32 115 121 Felgner P L and Ringold G M 1989 Cationic Liposome Mediated Transfection Nature 337 387 388 Goodwin E C and Rottman F M 1992 The 3 Flanking Sequence of the Bovine Growth Hormone Gene Contains Novel Elements Required for Efficient and Accurate Polyadenylation J Biol Chem 267 16330 16334 Kozak M 1987 An Analysis of 5 Noncoding Sequences from 699 Vertebrate Messenger RNAs Nuc Acids Res 15 8125 8148 Kozak M 1990 Downstream Secondary Structure Facilitates Recognition of Initiator Codons by Eukaryotic Ribosomes Proc Natl Acad Sci USA 87 8301 8305 Miller J H 1972 Experiments in Molecular Genetics Cold Spring Harbor New York Cold Spring Harbor Laboratory
21. ryotic cells must be very clean and free from phenol and sodium chloride Contaminants will kill the cells and salt will interfere with lipid complexing decreasing transfection efficiency We recommend isolating DNA using the PureLink HiPure Miniprep Kit or the PureLink HiPure Midiprep Kit see page 12 for ordering information or CsCl gradient centrifugation Continued on next page Transformation and Transfection Continued Methods of Transfection Positive Control Assay for B galactosidase Activity Detection of Fusion Proteins Note Geneticin Selective Antibiotic For established cell lines e g HeLa consult original references or the supplier of your cell line for the optimal method of transfection Precisely follow the protocol for your cell line paying particular attention to medium requirements when to pass the cells and at what dilution to split the cells Further information is provided in Current Protocols in Molecular Biology Ausubel et al 1994 Methods for transfection include calcium phosphate Chen and Okayama 1987 Wigler et al 1977 lipid mediated Felgner et al 1989 Felgner and Ringold 1989 and electroporation Chu et al 1987 Shigekawa and Dower 1988 For high efficiency transfection in a broad range of mammalian cells use Lipofectamine 2000 Reagent available from Invitrogen see page 12 For more information on Lipofectamine 2000 and other transfection reagents vi
22. s been confirmed by sequencing and B functional testing The sequence is available for downloading from www invitrogen com or by contacting Technical Support see page 14 T7 promoter priming site Hind Ill KpnI BamHI l 861 ATTAATACGA CTCACTATAG GGAGACCCAA GCTGGCTAGT TAAG CTT GGT ACC GAG CTC GGA Leu Gly Thr Glu Leu Gly BstX I EcoRI EcoR V BstX I NotI l 923 TCC ACT AGT CCA GTG TGG TGG AAT TCT GCA GAT ATC CAG CAC AGT GGC GGC CGC Ser Thr Ser Pro Val Trp Trp Asn Ser Ala Asp Ile Gln His Ser Gly Gly Arg Xho 1 Xba I Apa I Sac I Sfu I V5 epitope l 977 TCG AGT CTA GAG GGC COG CGG TTC GAA GGT AAG CCT ATC CCT AAC CCT CTC CTC Ser Ser Leu Glu Gly Pro Arg Phe Glu Gly Lys Pro Ile Pro Asn Pro Leu Leu A ge I Polyhistidine tag Pme I l l 1031 GGT CTC GAT TCT ACG CGT ACC GGT CAT CAT CAC CAT CAC CAT TGA GTTTA Gly Leu Asp Ser Thr Arg Thr Gly His His His His His His BGH Reverse priming site T 1 1081 AACCCGCTGA TCAGCCTCGA CTGTGCCTTC TAGTTGCCAG Note that there are two BstX I sites in the polylinker Continued on next page Cloning into pcDNA 3 1 V5 His A B and C Continued Multiple Cloning Site of pcDNA 3 1 V5 His C Below is the multiple cloning site for ppDpDNA 3 1 V5 His C Restriction sites are labeled to indicate the cleavage site The boxed nucleotides indicate the variable region The multiple cloning site has been confirmed by sequencing and functional te
23. sit our web site at www invitrogen com or contact Technical Support see page 14 pcDNA 3 1 V5 His lacZ is provided as a positive control vector for mammalian transfection and expression see page 11 pcCDNA 3 1 V5 His lacZ may be used to optimize transfection conditions for your cell line The gene encoding B galactosidase is expressed in mammalian cells as a fusion protein MW 121 kDa A successful transfection results in B galactosidase expression that can be easily assayed You may assay for B galactosidase expression by activity assay using cell free lysates Miller 1972 or by staining the cells for activity Invitrogen offers the B Gal Assay Kit and the B Gal Staining Kit see page 12 for ordering information for fast easy detection of P galactosidase expression A number of antibodies are available from Invitrogen that can be used to detect expression of your fusion protein from pcDNA 3 1 V5 His see page 13 for ordering information The C terminal tag adds about 3 kDa to the size of your protein Additional amino acids may be added to your protein depending on the sites used to clone the gene of interest TM For stable transfection pcDNA 3 1 V5 His A B and C contain the resistance factor to Geneticin Geneticin blocks protein synthesis in mammalian cells by interfering with ribosomal function It is an aminoglycoside similar in structure to neomycin gentamycin and kanamycin Expression in
24. sting The sequence is available for downloading from www invitrogen com or by contacting Technical Support see page 14 T7 promoter priming site Hind DI KpnI ind pn 1 861 ATTAATACGA CTCACTATAG GGAGACCCAA GCTGGCTAGT TA AGC TTG GTA CCG AGC BamH I 918 TCG GAT Ser Asp NotI 969 GCG GCC Ala Ala BstX I EcoR I CCA CTA GTC CAG TGT GGT GGA ATT Pro Leu Val Gln Cys Gly Gly Ile Ser Leu Val Pro Ser EcoR V BstX I CTG CAG ATA TCC AGC ACA GTG eu Gln Ile Ser Ser Thr Val Xhol BsiE II a V5 epitope GCT CGA GET CAC CCA TTC GAA GGT Ala Arg Gly His Pro Phe Glu Gly Age AAG CCT ATC CCT AAC CCT CTC Lys Pro Ile Pro Asn Pro Leu Polyhistidine tag 1020 CTC GGT Leu Gly Pme I i CTC GAT TCT ACG CGT ACC GGT CAT Leu Asp Ser Thr Arg Thr Gly His 1 CAT CAC CAT CAC CAT TGA GTT His His His His His BGH Reverse priming site l l 1071 TAAACCCGCT GATCAGCCTC GACTGTGCCT TCTAGTTGCC AGCCATCTGT Note that there are two BstX I sites in the polylinker Transformation and Transfection E coli Transformation Applying Selective Pressure Plasmid Preparation Transform your ligation mixtures into a competent recA endA E coli strain e g TOP10 TOP10F DH5a T1 DH10B page 12 and select on LB plates containing 50 100 pg ml ampicillin Select 10 20 clones and analyze for the presence and orientation of your insert We recommend taking some if not all of

Download Pdf Manuals

image

Related Search

Related Contents

ウインカーステーキット 取扱説明書  MANUAL DE USUARIO - POOL TECHNOLOGIE  2706-6.4, Dataliner DL5 Slave Displays User Manual    NewAir APH-4000PV User's Manual    Manuale Sharebot NG (Italiano)  たけのこと春野菜の 青椒肉絲  

Copyright © All rights reserved.
Failed to retrieve file