Home

xMAP® Cookbook

1. gDNA 3 Vo specific portion by an internal spacer A m When combined with a biotinylated a Biotinylated primer sequence specific reverse primer B a WA ee aa double stranded amplicon is created with a TAG overhang C The TAG overhang TAG primer allows hybridization capture to MagPlex TAG TAG microsphere without a competing B anti TAG complementary strand generated in the PCR reaction Chapter 51 3 Target Specific PCR Sequence Detection with MagPlex TAG Microspheres beads www luminexcorp com Page 93 BR_574 01_0613 Materials Needed Reagents and Consumables MagPlex TAG Microspheres Spacer modified TAG PCR primers 5 biotinylated reverse PCR primers Qiagen HotStar Taq 2X Master Mix dNTPs stocks 2X Tm Hybridization Buffer 1X Tm Hybridization Buffer streptavidin R phycoerythrin SAPE 96 well PCR Plate 96 well Bead Hybridization Plate optional MicroSeal A Magnetic separation plate special order Disposable pipette tips multi and single channel 2 1000 mL 25mL reservoirs divided well RNase DNase Free Microcentrifuge Tubes 1 5 ml Barrier Pipette Tips Vortex Mixer Microcentrifuge Bath Sonicator 40 55 kHz frequency waves Centrifuge with Microplate Swinging Bucket Rotor Brayer roller soft rubber or silicon Thermocycler with 96 well Head and Heated Lid Luminex Instrument with xPONENT 3 1 or higher software Chapter 5 1 3 Target Specific PCR Sequence
2. IC should be determined by 14 Mix the reactions gently by pipetting up and down several times with a multi titration in PBS 1 BSA or PBS channel pipettor BN 15 Cover the plate and incubate for 30 minutes at room temperature on a plate shaker at 800 rpm 16 OPTIONAL Include the following steps if high backgrounds occur Carefully remove the supernatant from each well by magnetic plate separator using either manual inversion manual pipetting or magnetic plate washer Take care not to disturb the microspheres Add 100 uL of Wash Buffer PBS TBN to each reaction well Take care not to disturb the microspheres 17 Repeat step 16 once more for a total of two washes 18 Bring final volume of each reaction to 100 uL with Assay Buffer 19 Analyze 50 75 uL on the Luminex analyzer according to the system manual Chapter 4 1 2 Competitive Immunoassay www luminexcorp com Page 49 BR_574 01_0613 Summary of Protocol Format 2 Add capture anti Add labeled antigen body coupled microspheres Wash microspheres w Read 50 uL on Luminex Assay Buffer analyzer Protocol 4 1 2 2 Competitive Immunoassay Format 2 POPP OHS EEO SE SESE E EEE HOLES ESET HOLE SE EOEE TE EEE EHO LEHH ET OEE EEE EEEEHOEESEEEEEEE SE EEEETETEEO EE OEEHEH OEE EEEEEH EL EEEEEEEEE HE LEEETE LENSE EESEEEELEEH EEL OEE DE LESE EEE E EEE 1 Select the appropriate antigen coupled microsphere sets 2 Resuspend the microspheres by vortex and sonication for
3. Luminex oy lst Edition xMAP Cookbook A collection of methods and protocols for developing multiplex assays with xMAP Technology a a T Authors Stephen Angeloni Ph D Robert Cordes B A Sherry Dunbar Ph D Carlos Garcia B A Grant Gibson Ph D Charles Martin Ph D Valerie Stone M S C T A S C P Effective Date 01 July 2013 Certain applications using Luminex Microspheres including those illustrated in this documentation may be covered by patents owned by parties other than Luminex Purchase and use of Luminex Microspheres does not convey a license to any third party patents unless explicitly stated in writing You are responsible for conducting the necessary due diligence and securing rights to any third party intellectual property required for your specific application s of any Luminex Microspheres Nothing herein is to be construed as recommending any practice or any product in violation of any patent or in violation of any law or regulation Introduction www luminexcorp com Page 2 BR_574 01_0613 1 Miroda CMON Me areas esac coe de actos esas eens oc ra a Geeerva ests fe vec cn hs sacle esd a cate E ha er ce torte a ta nist ele SA esd aaah gs anes eles enter anal nee A 4 L PAP We chine OSV rg caeena canes ioad Ae pa cetees wi enaa A cba t deena eau eae E AAE vytad depen aan eee een RA 5 3 Developmen Ora Ie ASSI enrere kerre EEEn ts nuan edad EEEO A nn ROS ee Goo nee en tee
4. Chapter 3 41 Optimization of Immunoassays Figure 11 Dynamic range and assay sensitivity may be affected by A reducing the amount of capture antibody on the bead to make lower concentration range more linear and B by using different amounts of capture antibody or antibodies with different affinities on multiple bead sets to form a multiplexed standard curve www luminexcorp com Page 35 BR_574 01_0613 Matrix effects POCO OHSS HOHE HOSE EE HEHHEE SHOE OOSOE EES OOH E SHOES SHES ESOS EE ESOS EO SOOO SEO HEES OSES OSEEE EE ESOEE TOTS E ESOS OHS OEE SHOE EOSEHS EE SSOSEEETEEEE SESE ESOOHEEHEEE EEE ESOS EEE Highly concentrated serum or plasma can lead to matrix effects presenting as poor bead recovery instrumentation clogging low signals and variable results Matrix effects can play a major role in assay performance and the type of sample tested may therefore have effects on assay performance Labs developing immunoassays should include replicates of samples as well as negative and positive low medium and high controls with known concentrations of the analytes of interest to aid in interpretation of results Dilutions of controls should be included that reflect the diluents used to reconstitute the standards and the sample matrix tested in order to account for possible matrix effects This will allow the assessment of linearity and recovery and aid in the choice of best standard curve regression and optimal calibr
5. POCO OCHS OHHH EEO OEEEEESOHEE SESE ESTO OEE SOOO EH OEEEEEESOE HS OHOEE ESOT OSH O SESH ES OSEOEESEEEEEEOOE ESOT EOEEESESH EE SOOEES OSE EESEHSEE ESOT EOTHEEE SESE ESOOEEEHSEEEEEESOEED ONES Any non specific protein can be used for blocking including many of the commercially available blocking buffers Do not use unpurified blockers such as non fat milk Chapter 4 3 Proteomics FAQ s www luminexcorp com Page 71 Can streptavidin R phycoerythrin SAPE be used in assays when the samples are in tissue culture media POO SOC ESE HHH EES OEEEEEHEHEE HEHEHE OSHS OEESOOHEEHOOEESESEOE ETOH EE ESOS EOS OOEE SESH ES OSHO EH SEEEE SESE TOTES E OT EOHE STOO E SHOE E OSES EESSOEEEETHEEE SESE ESOOHEEHTEEEEEESOEEDEDEE Tissue culture generally contains a large amount of biotin The SAPE will bind to the biotin in the media and not onto the detection antibody Here are some suggestions for a no wash format with tissue culture samples Use directly coupled detection antibody Pre combine the detection antibody and the SAPE 30 60 minutes before addition to the sample By doing this the detection antibody and SAPE can bind first before the free biotin can interfere How many PE molecules per MFI Based on experiments using PE standards the approximate molecules of PE per MFI is For Luminex 200 23 PE MFI at standard low PMT 5 PE MFI at high PMT For FLEXMAP 3D 15 PE MFI at standard low PMT 3 PE MFI at high PMT Fo
6. coupling o a Capture Sandwich Competitive Antibody Assay Assay Principle and Overview POPPE S CEST SEES EEEEEHESEEE EEO EE OEE EERE SE EOEH EE EEEE EE EEE OEE EEEE TEETH OEEOE EE SOEH TE HOEEHEEEES EET ET EEE SEEEE TOTES EEEEEE EEE OE EEEHE SEES ER TESEEEEESEH OEE EEE EDEES EEE ED Competitive Immunoassays can be multiplexed with Capture Sandwich Immunoassays adding versatility to your multiplex assays The general steps to performing a combined capture sandwich and competitive immunoassay with xMAP Technology are as follows Summary of Protocol Add antigen and Add capture antibody Add labeled detection antibody containing and or antigen coupled antibody sample and diluted microspheres competitor Wash microspheres w Read 50 uL on Assay Buffer Luminex analyzer Chapter 4 1 4 Combined Capture Sandwich and Competitive Immunoassay www luminexcorp com Page 55 BR_574 01_0613 Materials Needed Reagents and Consumables Vendor MagPlex Microspheres antibody or antigen coupled Assay Wash Buffer PBS 1 BSA Sigma P3688 PBS BN buffer Sigma P3688 PBS TBN buffer Sigma P3813 Sigma A7888 Sigma P9416 96 well plate See Appendix B PE or Biotin labeled Detection Antibody Any suitable source streptavidin R phycoerythrin SAPE Moss SAPE 001G75 Life Technologies S 866 or equivalent 1 5 mL microcentrifuge tubes USA Scientific 1415 2500 or Eppendorf Lo Bind 022431081 Disposa
7. Add biotinylated Incubate 30 minutes Wash and resuspend peptide microspheres w buffer Materials Needed Reagents and Consumables Vendor For complete equipment and materials list see Appendix B LumAvidin Microspheres Assay Wash Buffer PBS 1 BSA Biotin conjugated molecule PBS BN buffer PBS TBN buffer 1 5 mL microcentrifuge tubes Disposable pipettes tips Distilled deionized water ddH O 1 Also used as assay buffer 2 Also used as wash buffer Luminex Sigma P3688 Any suitable brand Sigma P3688 Sigma P3813 Sigma A7888 Sigma P9416 USA Scientific 1415 2500 Eppendorf Lo Bind 022431081 Any suitable brand Any suitable source Chapter 4 21 Coupling Biotinylated Peptides with LumAvidin Microspheres www luminexcorp com Page 59 BR_574 01_0613 Protocol 4 2 1 Coupling biotinylated peptides with LumAvidin Microspheres POCO S EHH SOEEEE ETOH SESE OSHS ESOOHSE HOES SO SSOE HOOT ESOS EO SOOO SESH ES OSEO SETHE E ESSE TOTS EE SEOE EE SOOEE SHOE E OOOH E ETOH EEHHEEO TESTES OOEEEHSEEEEEESOEED OEE Note Microspheres should be protected longed to light 1 Resuspend the stock LumAvidin microsphere suspension according to the N E instructions described in the Product Information Sheet provided with your microspheres 2 Transfer 1 0x10 of the stock microspheres to a recommended microcentrifuge tube 3 Pellet the stock microspheres by microcentrifugation at 28000 g for 1 2 miniutes or by usi
8. BR_574 01_0613 Protocol 3 3 3 nucleic acid coupling Note Microspheres should be 1 Bring a fresh aliquot of 20 C desiccated Pierce EDC powder to room POE an ALE temperature 2 Resuspend the amine substituted oligonucleotide probe or capture oligo to 1 mM 1 nanomole uL in dH O 3 Resuspend the stock uncoupled microspheres by vortexing and sonication according to the instructions described in the Product Information Sheet provided with your microspheres 4 Transfer 5 0 x 10 of the stock microspheres to a USA Scientific microcentrifuge tube 5 Pellet the stock microspheres with a tube magnet or by microcentrifugation at 8000 x g for 1 2 minutes 6 Remove the supernatant and resuspend the pelleted microspheres in 50 uL of 0 1 M MES pH 4 5 by vortexing and sonication for approximately 20 seconds 7 Prepare a 1 10 dilution of the 1 mM capture oligo in dH O 0 1 nanomole uL light throughout this procedure 8 Add 2 uL 0 2 nanomole of the 1 10 diluted capture oligo to the resuspended Note See Recommendations for microspheres and mix by vortex Scaling Oligonucleotide Microsphere 9 Prepare a fresh solution of 10 mg mL EDC in dH O Coupling in next section 10 One by one for each coupling reaction add 2 5 uL of fresh 10 mg mL EDC to the microspheres 25 ug or 0 5 ug uL and mix by vortex 11 Incubate for 30 minutes at room temperature in the dark 12 Prepare a second fresh solution of 1
9. Coupling Peptides with ADH www luminexcorp com Page 62 BR_574 01_0613 Chapter 4 2 3 Peptide Coupling to ADH Modified Microspheres Adipic acid dihydrazide ADH is a suitable chemical spacer for extending the peptide away from the surface of xMAP Microspheres beads for optimum reactivity with sample and reagents A sample protocol for coupling peptides to ADH modified microspheres is described below Summary of Protocol Add ADH coupled Wash microspheres w Add peptide microspheres buffer Add EDC Wash and resuspend microspheres w buffer Incubate 2 hours Materials Needed Vendor For complete equipment and Reagents and Consumables materials list see Appendix B MagPlex Microspheres ADH coupled Protein to couple Any suitable source Wash Buffer 0 1 M MES pH 6 0 Sigma M2933 1 Ethyl 3 3 dimethylaminopropyl carbodiimide hydrochloride Pierce 77149 EDC Wash Buffer PBS TBN Buffer Sigma P3813 Sigma A7888 Sigma P9416 PBS pH7 4 See Appendix A 1 5 mL microcentrifuge tubes Disposable pipettes tips Distilled deionized water ddH O USA Scientific 1415 2500 or Eppendorf Lo Bind 022431081 Any suitable brand Any suitable source Chapter 4 2 3 Peptide Coupling to ADH Modified Microspheres www luminexcorp com Page 63 BR_574 01_0613 Protocol 4 2 3 Coupling peptides to ADH Modified Microspheres oe pacts UAT ci ac chest oto pn EEA AEE OAA EAA O Note Mieras ENT Deproecied 1 R
10. MicroSeal A Magnetic separation plate special order Disposable pipette tips multi and single channel 2 1000 mL RNase DNase Free Microcentrifuge Tubes 1 5 ml Barrier Pipette Tips Vortex Mixer Microcentrifuge Bath Sonicator 40 55 kHz frequency waves Centrifuge with Microplate Swinging Bucket Rotor Brayer roller soft rubber or silicon Thermocycler with 96 well Head and Heated Lid Luminex Instrument with xPONENT 3 1 or higher software OLA Buffer and Reagent Recipes For complete equipment and Vendor l 4 l a l materials list see Appendix B Luminex IDT or other vendor IDT or other vendor Note Molecular grade ddH O should be used for all nucleic acid protocols Qiagen 203443 or equivalent New England Biolabs MO208S or equivalent Life Technologies 10297 018 or equivalent See Buffer and Reagent Recipes section See Buffer and Reagent Recipes section Moss SAPE 001G75 Life Technologies S 866 or equivalent BioRad MSP9601 BioRad MSA5001 V amp P Scientific VP771LD 4CS or equivalent Any suitable brand USA Scientific or Equivalent Any suitable brand Any suitable brand Any suitable brand Any suitable brand Eppendorf 5704 or equivalent USA Scientific 9127 2940 Any suitable brand Luminex Step Notes MagPlex TAG Microspheres from Required Microspheres regions should be purchased from Luminex They should be stored at 4 C in the dark For multiplex assays Luminex com
11. Ong K Chong C Lee F Chew and E Lee 2007 Multiplexed genotyping of ABC transporter polymorphisms with the Bioplex suspension array Biological Procedures Online 27 42 Li G X Luo J He Z Zhu G Yu H Qin T Zeng Z Liu S Wu J Xu and L Ren Heidenreich 2011 A novel liquid chip platform for simultaneous detection of 70 alleles of DNA somatic mutations on EGFR KRAS BRAF and PIK3CA from formalin fixed and paraffin embedded slides containing tumor tissue Clinical Chemistry And Laboratory Medicine 49 2 191 195 Li Y S Jortani B Ramey Hartung E Hudson B Lemieux and H Kong 2011 Genotyping three SNPs affecting warfarin drug response by isothermal real time HDA assays Clinica Chimica Acta 412 79 85 Marcil V D Sinnett E Seidman F Boudreau F P Gendron J F Beaulieu D Menard M Lambert A Bitton R Sanchez D Amre and E Levy 2012 Association between genetic variants in the HNF4A gene and childhood onset Crohn s disease Genes And Immunity 13 7 556 565 Chapter 5 1 2 Allele Specific Primer Extension ASPE SNP Typing www luminexcorp com Page 92 BR_574 01_0613 Chapter 5 1 3 There are a number of different PCR approaches to generate reporter molecules for detecting sequences in different types of samples These approaches have been used for a number of applications including the detection of various pathogens Babady Mead et al 2012 With standard P
12. Recovery of spiked e Use the neat sample value as the expected value if testing linearity of the neat samples should be in unspiked sample the range of 80 120 e Y Recovery 1 2 Observed value pg mL of 1 2 dilution x 100 e Expected value pg mL divided by 2 Y Recovery 1 4 Observed value pg mL of 1 4 dilution x 100 e Expected value pg mL divided by 4 e Y Recovery 1 8 Observed value pg mL of 1 8 dilution x 100 e Expected value pg mL divided by 8 e Diluting the control spike is a good control for serial dilutions Recovery for the control spike should be in the range of 80 120 If not this indicates there was a problem in preparing the control spike Chapter 3 51 Immunoassay Validation www luminexcorp com Page 39 BR_574 01_0613 Design of Assay Validation Typical performance parameters Precision Intra assay CV Inter assay CV Accuracy recovery 80 120 Working Assay Range Varies from target to target Matrices Plasma serum culture supernatant lysates other biological fluids AAAOCCOCOAAA AAAOOOOOOAAA AAABBBOHODAAA AAA Bong AAA AAABBBOODAAA AAABGB AAA AAABBBOODDAAA AAABGB AAA Above is a general plate layout for assay validation Columns 1 3 and 10 12 are standards ideally a 7 or 8 point standard curve in standard diluent The data from these six standard curves will be used to determine standard curve recovery intra assay CV L
13. swabs Need to convert RNA to pathogen detection etc etc DNA miRNA analysis DNA or RNA input material Starting with DNA preparation Is PCR amplification of target needed Type of chemistry PCR primer extension or ligation based application Need to couple capture molecules to beads Can MagPlex TAG beads be Use bioinformation tools to Is background low across all used design suitable probes for probes and samples What bead regions are application e Is specific signal for each compatible with your Test low plex mixes to analyte maintained and instrument optimize with assay are expected patterns chemistry observed Is signal range acceptable for accurate analysis Chapter 5 1 Introduction Development of Nucleic Acid Assays www luminexcorp com Page 77 BR_574 01_0613 Chapter 5 1 1 The oligonucleotide ligation assay OLA is flexible inexpensive and simple approach for detecting SNPs and other sequence variations The flexibility of the assay has allowed its use for genotyping a number of different genes and organisms Bruse Moreau et al 2008 Schwartz Pike Buchanan et al 2009 Henry Halldin Nadesakumaran et al 2012 In OLA chemistry one or more forward probes containing TAG sequences bind adjacent to a common biotinylated downstream probe Figure 14 The close proximity of a bound OLA TAG probe 3 end with the OLA reporter probe 5 end enables enzymatic ligation to join them in
14. 0 1 BSA in the reaction 2 Ifthe high background is due to contamination of the PCR reaction replace the PCR reagents 3 If high background is observed for the hybridization negative control replace the hybridization reagents 4 f high background is observed for the OLA negative control replace the OLA reagents References PCOS OPES EHH H EEO HEHE ESEHEE SESE OSTEO EES OOH EE HOES SEES OE HEHEHE ESOS TOSSES HOHE ES OSHS HSEEEE ESHEETS SHEET ETOH EOSOOHES OSE OE HOES E ETOH SOTHO SHOE ESOOHEEHSEEEEEESOEED ODES Bruse S et al 2008 Improvements to bead based oligonucleotide ligation SNP genotyping assays Biotechniques 45 5 559 571 Henry Halldin C N et al 2012 Multiplex Assay for Species Identification and Monitoring of Insecticide Resistance in Anopheles punctulatus Group Populations of Papua New Guinea American Journal Of Tropical Medicine And Hygiene 86 1 140 151 Schwartz K et al 2009 Identification of Cystic Fibrosis Variants by Polymerase Chain Reaction Oligonucleotide Ligation Assay Journal Of Molecular Diagnostics 11 3 211 215 Chapter 5 1 1 Oligo Ligation Assay OLA SNP Typing www luminexcorp com Page 84 BR_574 01_0613 Chapter 5 1 2 Allele Specific Primer Extension ASPE is a flexible inexpensive and simple chemistry for detecting SNPs and other sequence variations The flexibility of the assay has allowed its use for genotyping typing a number of dif
15. 1415 2500 or Eppendorf Lo Bind 022431081 Any suitable brand Any suitable source Protocol 4 1 1 Capture Sandwich Immunoassay POCO ESE H EOE EE OEEEEEHOHEEE EHO OOHOOEESOEHEE ESOS EESSOEE SOHO ET ESOS EES OOH EE HHO EHOESOEEEEEEEEESES 1 Select the appropriate antibody coupled microsphere sets 2 Resuspend the microspheres by vortex and sonication for approximately 20 seconds POCO HE SEES HOES EEE HH OHOEEEOOEEEESOOHTE SESE EES OOHEEHEEEEE ESSE DOES Note Microspheres should be protected from prolonged exposure to light throughout this procedure 3 Prepare a Working Microsphere Mixture by diluting the coupled microsphere stocks to a final concentration of 50 microspheres of each set uL in Assay Buffer NOTE 50 uL of Working Microsphere Mixture is required for each reaction Chapter 4 1 1 Capture Sandwich Immunoassay www luminexcorp com Page 44 BR_574 01_0613 4 Aliquot 50 uL of the Working Microsphere Mixture into the appropriate wells of a round bottom well plate 5 Add 50 uL of Assay Buffer to each background well 6 Add 50 uL of standard or sample to the appropriate wells 7 Mix the reactions gently by pipetting up and down several times with a multi channel pipettor 8 Cover the plate and incubate for 30 minutes at room temperature on a plate shaker set to approximately 800 rpm 9 Place the plate into the magnetic separator and allow separation to occur for 30 60 seconds 10 Use a multi channel pip
16. 60 seconds 11 After the beads have pelleted remove the supernatant being careful not to disturb the bead pellets 12 Repeat steps 8 and 11 This is a total of two washes 13 Resuspend microspheres in 75 uL of 1X Tm Hybridization Buffer containing 2 8 ug mL SAPE 14 Incubate at 37 C for 15 minutes 15 Analyze 50 uL at 37 C on the Luminex analyzer according to the system manual light throughout this procedure Chapter 5 1 2 Allele Specific Primer Extension ASPE SNP Typing www luminexcorp com Page 90 BR_574 01_0613 Hybridization to MagPlex TAG Microspheres no wash protocol POCO OCHS E HHO E HOHE E ETOH ESTEE OO HOE EES OOH EEE OOEE EOS SOEH SOHO ESOS E OTHE OS EOHEE SOSH E HS EEEE ESSE TOTS ETOH EE SOOE ES OOEEE ESOS EE ESOS E OTHE TO SESE ESOOHEEHEEEEEEESOEED OEE 1 Select the appropriate MagPlex TAG microsphere sets and resuspend according to the instructions described in the Product Information Sheet provided with your microspheres beads 2 Combine 2500 microspheres of each set per reaction Note If needed an Excel based bead 3 Dilute concentrate the MagPlex TAG microsphere mixture to 111 of each calculator is available for determining microsphere set per uL in 1X Tm Hybridization Buffer and mix by vortex and the method and volumes needed for sonication for approximately 20 seconds making the bead mix Contact your 4 Aliquot 22 5 uL of the MagPlex TAG microsphere mixture to each well Luminex representative o
17. ASPE Master Mix as follows 10X PCR reaction buffer 2 0 uL 50 mM MgCl 0 5 uL TAG ASPE primer mix 500 nM each 1 0 uL Tsp DNA polymerase 5 U uL 0 15 uL 3 dNTP mix dCTP 100 uM each 1 0 uL 400 uM biotin dCTP 0 25 uL ddH O Molecular Grade 51 ul Total volume 10 uL 2 Assemble the ASPE reactions in 20 uL total volume for each sample as follows 2X ASPE Master Mix 10 uL Target EXO treated PCR Use up to Y uL ddH O as needed to 20 uL X uL Total volume 20 uL 3 Mix each ASPE reaction by pipetting up and down several times eoeeeeree eee eee eee eee eee eee eee ee ee ees eee eeseeeeeeeeeeeeeseeeeeeee eee eeeeeeeeeeseeeeeeeeeeeeeeeeeeeeeeseeeeeeeseeeeseeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeseeeeeeeeeeeeoeeeeeeeeeeeeeeoe Chapter 5 1 2 Allele Specific Primer Extension ASPE SNP Typing www luminexcorp com Page 89 BR_574 01_0613 4 Cover plate with a plate sealer and perform multiple rounds of primer extension in a thermal cycler with the following parameters Note The temperature of the 1 minute hybridization step can be adjusted to what is needed for different probe mixes Temperature 96 C 2 minutes glag 30 seconds 55 C 1 minute 30 cycles 3C 2 minutes 4 C Hold 5 Proceed to hybridization with MagPlex TAG Microspheres using a wash or no wash protocol Hybridization to MagPlex TAG Microspheres wash protocol Note Microspheres should be 1 Select the appropriate MagPlex TAG microsphere sets and resuspend pr
18. Allow the dry aliquot to warm to room temperature before opening Prepare a fresh 10 mg mL EDC solution immediately before each of the two additions and close the dry aliquot tightly and return to desiccant between preparations The dry aliquot should be discarded after the second addition Uncoupled microspheres tend to be somewhat sticky and will adhere to the walls of most microcentrifuge tubes resulting in poor post coupling microsphere recovery We have found that copolymer microcentrifuge tubes from USA Scientific 41415 2500 perform best for coupling and yield the highest microsphere recoveries post coupling 100 mM MES pH 4 5 should be filter sterilized and either prepared fresh or stored at 4 C between uses Do not store at room temperature The pH must be in the 4 5 4 7 range for optimal coupling efficiency The optimal amount of a particular oligonucleotide capture probe for coupling to carboxylated microspheres is determined by coupling various amounts in the range of 0 04 1 nmol per 5 x 10 microspheres Usually 0 2 to 1 nmol per 5 x 10 microspheres in a 50 uL reaction is optimal The coupling procedure can be scaled up or down Above 5 x 10 microspheres use the minimum volume required to resuspend the microspheres Below 5 x 10 microspheres maintain the microsphere concentration and scale down the volume accordingly We use 5 M TMAC Tetramethylammonium chloride solution from Sigma T 3411 for preparation of 1 5X and
19. Appendix A USA Scientific 1415 2500 or Eppendorf Lo Bind 022431081 Any suitable brand Any suitable source www luminexcorp com Page 67 BR_574 01_0613 Protocol 4 2 5 Coupling peptides to maleimide modified microspheres PN NAE A ESENE edie ANEA EE O OS SAAE AAA A NA a A E T from prolonged exposure to light Resuspend stock maleimide modified microsphere suspension by vortex and throughout this procedure sonication 15 30 seconds 2 Remove an aliquot of 1 x 10 maleimide microspheres and pellet by centrifugation at 2 8000 x g 1 2 minutes or by using a magnetic separator and remove supernatant 3 Resuspend maleimide microspheres at 1 x 10 mL in 0 1 M Sodium Phosphate 50 mM NaCl pH 7 0 by vortex 4 Aliquot 1 x 10 microspheres to each coupling reaction 100 uL 5 Add peptide 100 uL in 100 mM Tris pH 7 4 to each 1 x 10 microsphere reaction 6 Incubate 1 hour at room temperature with shaking protect from light 7 Pellet by centrifugation at 2 8000 x g 1 2 minutes or by using a magnetic separator and remove supernatant 8 Wash twice with PBS 1 BSA 200 500 uL 9 Resuspend coupled microspheres in PBS TBN Reaction Peptide titration 1 16 5 nmol 1 65 nmol 0 165 nmol 0 0165 nmol 0 00165 nmol 0 000165 nmol 0 0000165 nmol NO UW BR W N Chapter 4 2 5 Coupling Peptides with Maleimide www luminexcorp com Page 68 BR_574 01_0613 Chapter 4 3 For immunoassays should you couple a poly
20. EH SEEEE SESE ESOT SEE ESOS EO HSOTE SHOE EEOEHSEE SSO EETEOTE OEE ESOEHEEHOEEEEEESOEED ODES Run at least 2 background samples Run all samples at least in duplicate if possible whenever sample allows Minimize the presence of detergents in samples Some antibodies may be sensitive to detergents even at low concentrations e g 0 1 SDS Dilute concentrated biological samples 1 5 to overcome matrix serum effects that can interfere with analysis of the microspheres If samples cannot be diluted at least 1 5 try using a small initial reaction volume and diluting the final reaction prior to analysis For Capture Sandwich and Indirect Serological immunoassays 2 4 ug mL detection antibody is usually sufficient Up to five fold more detection antibody may be required for a no wash assay format The optimal detection antibody concentration will depend on specific reagents and level of multiplexing Concentrations often need to be increased when increasing the number of multiplexed assays and when converting to a no wash assay format For Competitive Immunoassay format we recommend testing a range of competing analyte 0 2 to 5 ug with increasing concentrations of antibody The antibody concentration that yields 70 80 of the maximum signal should provide the largest linear dynamic range for the assay The reporter concentration should be approximately one and one half times the concentration of the detection antibody Use SAPE as your re
21. ES SOOEE SOOT ETH OOS EE SOOO EEOETO SEO EESOOHSEHSEEEE SESE SOTHO E ESET EOSSOHES OOH E HOOT EESEOEEEEHOEEE SESE ES OOEEEESS High Background 1 Wash steps were not performed thoroughly Ensure that as much supernatant is removed as possible during each wash step while taking care to avoid disturbing the microsphere pellet Possible reagent contamination Replace all buffers first Use only nuclease free barrier pipette tips for all reagent additions and mixing Unexpected Results from Control Samples 1 Reagents were not stored at the recommended temperatures Make sure all reagents are stored at the recommended temperatures For reagents that are frozen avoid multiple freeze thaw cycles Place reagent master mixes that contain enzymes on ice during preparation If indicated pre warm other reagents to room temperature immediately before use Vortexing enzyme stocks You should never vortex enzyme stocks Instead flick tube to mix Gently vortex and quick spin the enzyme solution only after you have made the recommended dilution High signal on Negative Control sample due to contamination Make sure all consumables such as tubes and pipette tips are nuclease free as well as general reagents such as PBS 10 mM Tris pH 7 0 and nuclease free dH O If problem persists replace all buffer reagents Chapter 5 1 5 MicroRNA Analysis www luminexcorp com Page 109 BR_574 01_0613 4 Positive Control sample signal is too low Verify
22. ET ELELE HOSE ELOLEELEDEEEEECEOLELEOES xMAP Technology uses colored beads to carry biological assays similar to ELISA or nucleic acid hybridization assays By color coding microscopic beads into many spectrally distinct sets each bead set can be coated with a nucleic acid or protein capture molecule specific to a particular biological target allowing the simultaneous capture of multiple analytes from a single sample Because of the microscopic size and low density of these beads assay reactions exhibit virtually solution phase kinetics However once an assay is complete the solid phase characteristics allow each bead to be analyzed discretely By incorporating magnetic properties into xMAP Microspheres assay washing is simplified while maintaining desirable solution phase properties Figure 1 Figure 1 xMAP Microspheres include two dye products where A one 000000000 excitation wavelength allows observation A B 5080080808008 of two separate fluorescence emission 000000000 wavelengths yielding B 100 unique s s s s k s microsphere sets 10x10 dye matrix and three dye products where C s md s s one excitation wavelength allows eeeeeeeeee observation of three separate fluorescence Excite at One Excitation Observe Two Emission TORE EET SE YE wavelengths yielding D 500 unique aes oe ete 0000000000 microsphere sets 10x10x5 dye matrix SEA A amp gt gt O gt gt tototo 0 eee Exci
23. OOETEEEHO TE SEHO OE ESHSS SETHE SOOH EES OOHOT SOTHO E ESOS ESO OHESEESOST EE SOOEESHSEO TOTES OO ESOE TE ETOSEEEESOEESOOE TET ESESEEESEEEOEOES Multiplexed microspheres should be analyzed with individual analytes and multiplexed detection antibodies to determine sensitivity and detect interference between the various detection antibodies The optimal detection antibody concentration will vary with the specific reagent and should be determined by titration e g two fold serial dilution from 4 to 1 ug mL but generally 2 4 ug mL is adequate Detection antibody concentration may need to be increased in multiplex as compared to the concentration used in monoplex due to interactions between various detection antibodies In general as the level of multiplexing increases the amount needed for each detection antibody may also increase In unwashed assay formats detection antibody concentrations may need to be increased by up to as much as five fold to compensate for excess unbound analyte in the supernatant Typically reporter fluorophore SAPE concentration should be one and one half to two times the concentration of detection antibody Chapter 3 4 1 Optimization of Immunoassays www luminexcorp com Page 31 BR_574 01_0613 Cross reactivity POCO ESE HEHE HOSE EH HOHHEE EHO O SHOE E SOOO EE OOEE SEES ESOS OEE ESOS EOS OOO SESH E SOSH EHSEEEE SESE ES OTSEEESEOE TOSSES SHEET OOOH EE SSO E ETE O SESE EESOEHEEHOEE EEE ESOEE DOES If cross
24. The composition of this solution is 3 M TMAC Sigma T3411 0 15 solution Sarkosyl Sigma L7414 75mM Tris and 6mM EDTA The solution should be stored at room temperature The solution should be stored at room temperature TE pH 8 0 This is a 1X Tris EDTA Buffer pH 8 0 It can be purchased directly from any suitable vendor or made from more concentrated stocks It should be filter sterilized and stored at room temperature Streptavidin R phycoerythrin SAPE SAPE at 1 mg ml can be purchased from a number of suppliers such as Moss Incorporated SAPE 001G75 or Life Technologies S866 A working aliquot should be made fresh by diluting with 1X TMAC Hybridization buffer to the required volume and concentrations needed as indicated in the wash or no wash protocols Protocol 5 1 4 1 Direct DNA Hybridization no wash protocol POPPE S EEO SE EEEESEEOEEHELEEEE ESET HOLES EEO TE EEE EEE SEEO EE OEES ET EEEE HOLES EE EOEH EE EOEE HE TEEE EE SEEH EE OEEEHEEESEHEEEOEE ESTEE ELEEEDELENSETEEEOEHELEEEDELEEE EE LESE ELEN EE 1 Select the appropriate oligonucleotide coupled microsphere sets 2 Resuspend the microspheres beads by vortex and sonication for approximately 20 seconds 3 Prepare a Working Microsphere Mixture by diluting coupled microsphere stocks to 76 microspheres of each set uL in 1 5X TMAC Hybridization Solution Since 33 uL of Working Microsphere Mixture is required for each reaction this will provide about 2 500 beads of eac
25. and hybridization assay components by direct hybridization to labeled reverse complementary oligonucleotides O to 200 femtomoles Verify production of amplified target Verify labeling of amplified target Try increasing and decreasing the target input to determine optimal amount Decrease the hybridization temperature Check probe and target sequences for potential secondary structure Increase probe length Decrease size of target Redesign probes and target for the opposite DNA strand OMNAMKRWHN Poor Discrimination 1 If not using SAPE already containing BSA i e Moss SAPE 001G75 dilute SAPE in 1X Tm buffer containing BSA Final BSA concentration in the reaction should be 0 1 BSA in the reaction 2 Decrease the target input 3 Increase the hybridization temperature 4 Decrease probe length 5 Redesign probes and target for the opposite strand of DNA High Background 1 If not using SAPE already containing BSA i e Moss SAPE O01G75 dilute SAPE in 1X Tm buffer containing BSA Final BSA concentration in the reaction should be 0 1 BSA in the reaction 2 If high background is isolated to one or a few microsphere sets recouple the probes to different microsphere sets to determine if the high background is related to the probes or the microspheres 3 Resynthesize probes with high background 4 f high background occurs on all microsphere sets from the same coupling use uncoupled microspheres and coupled micro
26. approximately 20 seconds 3 Prepare a Working Microsphere Mixture by diluting the coupled microsphere stocks to a final concentration of 100 microspheres of each set uL in Assay Buffer 25 uL of Working Microsphere Mixture is required for each reaction 4 Dilute the biotinylated detection antibody to the IC_ or IC in Assay Buffer 25 uL of biotinylated detection antibody is required for each reaction Add 25 uL of Assay Buffer to each background well Add 25 uL of standard or sample to the appropriate wells Add 25 uL of the Working Microsphere Mixture to each well Mix the reactions gently by pipetting up and down several times with a multi channel pipettor 9 Add 25 uL of the diluted biotinylated detection antibody to each well 10 Mix the reactions gently by pipetting up and down several times with a multi channel pipettor 11 Cover the plate and incubate for 60 minutes at room temperature on a plate shaker 800 rpm for MagPlex Microspheres 12 Dilute the SAPE reporter to the appropriate concentration typically 24 ug mL in Assay Buffer 25 uL of diluted SAPE is required for each reaction 13 Add 25 uL of the diluted SAPE to each well 14 Mix the reactions gently by pipetting up and down several times with a multi channel pipettor 15 Cover the plate and incubate for 30 minutes at room temperature on a plate shaker 400 rpm for non magnetic microspheres or 800 rpm for MagPlex Microspheres 16 OPTIONAL Include
27. as E A a a ea aa 51 41 4 Combined Capture Sandwich and Competitive Immunoassay 0 ce tenn et ent teen nee n eens 55 4 2 Other Coupling Moieti S lt 60cacartucnnddded dime ddd eennehe Fenndagh wo rmddae ooo id assa sas bande mdewsamnedredoaas Hea wawd 58 4 2 1 Coupling Biotinylated Peptides with LumAvidin MicrosphereS 0 0 ccc ccc cece cnet nent tenet tenet enn ees 59 422 Coupling Feptides WINADH casi nn nature wee nieces ctensa take hide ie eh aap eee bind EAS EEEE AAN a eer kaia 61 4 2 3 Peptide Coupling to ADH Modified MicrosphereS 00 nnana reee 63 4 24 ROU WAS Peptides with MPBH area oer canes oy ences oa eee ea eul a See SE eae ae he Rae een bane eae ReMi bomen ee 65 4 2 5 Coupling Peptides to Maleimide Modified MicrospheresS 0 0 ccc cc eee ee nen teen ee ete e eben eee enna 67 AS Proteomics FAU Se os6csn65 bb wea mdnawaakdoeeoadiee Mhawecadeoh bansuadhowawsbeddd saab b Oh eees hoa e needeneousheoerosm be Roane 69 BD GN A O vend 4a eioa ated ee ow nee Re ee eee ee a eee e ee hoe ed Eo eri ape needa see TS 75 51 Introduction Development of Nucleic Acid Assays usuuununnaa rereua anaE EEEE 76 511 Oligo Ligation Assay OLA SNP Typing usuunaaunn anaua 78 51 2 Allele Specitie Primer Extension CASPE SNP Tynes rirsrrriicereeri tikiti ers REETA N ESETET TET AAE EEEE 85 51 3 Target Specific PCR Sequence Detection with MagPlex TAG Microspheres 0 0 0 ccc cece teen e tee teens 93 5 1 4 Dire
28. background occurs on all microsphere sets try decreasing the target input to determine optimal amount 5 Try decreasing amount of SAPE References Babady N E et al 2012 Comparison of the Luminex xTAG RVP Fast Assay and the Idaho Technology FilmArray RP Assay for Detection of Respiratory Viruses in Pediatric Patients at a Cancer Hospital Journal Of Clinical Microbiology 50 7 2282 2288 Chapter 51 3 Target Specific PCR Sequence Detection with MagPlex TAG Microspheres beads www luminexcorp com Page 97 BR_574 01_0613 Chapter 5 1 4 For some applications a Luminex based genomic assay may require coupling Luminex beads with specific capture sequences that are complementary to organism specific sequences in the labeled reporter molecules generated by an assay s chemistry These different approaches can be used for gene expression analysis genotyping specific sequence detection or other applications Yang Tran et al 2001 Itoh Mizuki et al 2005 Oehrmalm Eriksson et al 2012 In these situations specificity requires coupling capture probes of different lengths and or similar base compositions to different beads in the multiplex mix For these types of applications the hybridization of labeled target sequences to the beads requires stringent hybridization conditions to ensure a high degree of specificity with robust signal strength and low background To meet these needs the use of TMAC contain
29. by mixing equal amounts of 100 mM dATP dTTP dCTP and dGTP for the 4dNTP stock mix for gDNA amplification Individual stocks and concentrated mixes should be stored at 20 C The buffer s composition is 0 4 M NaCl 0 2 M Tris 0 16 Triton X 100 pH 8 0 It should be filter sterilized and stored at 4 C The buffer s composition is 0 2 M NaCl 0 1 M Tris 0 08 Triton X 100 pH 8 0 It should be filter sterilized and stored at 4 C SAPE at can be purchased from a number of suppliers such as Moss Incorporated SAPE 001G75 Life Technologies S866 or equivalent A working aliquot should be made fresh by diluting with 1X Tm Hybridization buffer to the required volume and concentrations needed as indicated in the wash or no wash protocols Chapter 5 1 1 Oligo Ligation Assay OLA SNP Typing www luminexcorp com Page 80 BR_574 01_0613 Protocol 5 1 1 OLA SNP Typing Genomic Target Sequence Amplification Multiplexed PCR amplification of genomic target regions containing SNPs of interest should be performed under optimized conditions The parameters listed below are for example purposes only and may not be optimum for your samples or any specific genomic amplification kit you may be using Each final reaction contains Reagent Amount gDNA template 50 ng Qiagen PCR reaction buffer 1X MgCl 1 5 mM dNTP 200 uM each primer 0 2 uM each Qiagen HotStar or other Taq polymerase 2 5 Units Amplification of target regio
30. by microcentrifugation at 28000 g for 1 2 minutes or by using a magnetic separator and remove supernatant 13 Repeat step 14 for a total of 2 washes with 1 mL of 0 1 M MES pH 4 5 14 Resuspend the MPBH modified microspheres in 1 mL of 0 1 M MES pH 4 5 and store refrigerated at 2 8 C in the dark Chapter 4 2 4 Coupling Peptides with MPBH www luminexcorp com Page 66 BR_574 01_0613 Chapter 4 2 5 Coupling Peptides with Maleimide Maleimide MPBH is a suitable chemical spacer for extending the free terminal cysteine containing peptide away from the surface of xMAP Microspheres beads for optimum reactivity with sample and reagents A sample protocol for coupling peptides to MPBH modified x MAP Microspheres is described below Summary of Protocol Add MPBH coupled microspheres Incubate 1 hour Materials Needed Reagents and Consumables MagPlex Microspheres MBPH modified Peptide to couple 100 mM Tris pH 7 4 Assay Wash Buffer PBS 1 BSA Storage Buffer PBS TBN 0 1M Sodium Phosphate 50mM NaCl pH 7 0 1 5 mL microcentrifuge tubes Disposable pipettes tips Distilled deionized water ddH O Chapter 4 2 5 Coupling Peptides with Maleimide Wash microspheres w Add peptide buffer Wash and resuspend microspheres w buffer For complete equipment and materials list see Appendix B Vendor Any suitable source See Appendix A See Appendix A Sigma P3813 Sigma A7888 Sigma P9416 See
31. enzymes and their buffers can be purchased from the buffers recommended manufacturers Use of each enzyme and its buffer in different master mixes are indicated in the protocol Chimeric probe design Proper design of the chimeric probes is critical for proper assay strategy performance An excel workbook for designing chimeric probes is available Contact your Luminex representative or visit www luminexcorp com To design probes with or without the workbook use the following procedure 1 Identify the miRNAs desired for the assay and obtain their sequences 2 Select MagPlex TAG bead regions desired for the plex required for cover all miRNAs of interest and internal controls 3 Design the chimeric capture probes so that each chimeric probe will capture the miRNA desired as well as the anti TAG sequence on the beads Note that the capture end for the probe should be RNA and the end for the xTAG sequence should be DNA This chimeric oligo should be biotinylated at the RNA 5 end see table below 4 Order the biotinylated chimeric DNA RNA probes from an oligo vendor See the Luminex chimeric probe design excel workbook for additional information for probe design characteristics Note The probes MUST be designed to be a perfect match to the miRNA under investigation since the high specificity of Reverse complement of miRNA 5 ACAAUCAGCUAAUUACACUGCCU 3 RNA the method allows single base resolution of mismatches between closely rel
32. is recommended that you check the efficiency of each coupling with a range of biotinylated complementary oligonucleotide concentrations For example if you coupled xMAP Microsphere 1 to 4 different amounts of oligo 1 ranging from 0 04 nmol to 5 0 nmol each of these couplings should be hybridized with several amounts of biotinylated complementary oligonucleotide target as shown below 5 fmols labeled 25 fmols labeled 50 fmols labeled 100 fmols labeled complementary target complementary target complementary target Bead 1 no oligo 1 Bead 1 no oligo 1 Bead 1 no oligo 1 Bead 1 0 04nmol oligo 1 Bead 1 0 04nmol oligo 1 Bead 1 0 04nmol oligo 1 Bead 1 0 20 nmol oligo 1 Bead 1 0 20 nmol oligo 1 Bead 1 0 20 nmol oligo 1 Bead 1 1 00 nmol oligo 1 Bead 1 1 00 nmol oligo 1 Bead 1 1 00 nmol oligo 1 Bead 1 5 00 nmol oligo 1 H O background no beads Bead 1 5 00 nmol oligo 1 H O background no beads Bead 1 5 00 nmol oligo 1 H O background no beads 10 fmol Oligo Target 2000 1500 O O O O OOOO TE 1000 oO zZ 500 O 0 01 0 1 1 10 nmol Probe PCR Target 2000 1500 m ee O O TE 1000 oO zZ 500 O 0 01 0 1 1 10 nmol Probe Chapter 3 3 4 Oligonucleotide Coupling Confirmation complementary target Bead 1 no oligo 1 Bead 1 0 04nmol oligo 1 Bead 1 0 20 nmol oligo 1 Bead 1 1 00 nmol oligo 1 Bead 1 5 00 nmol oligo 1 H O background no beads Figure 8 Plot of experimen
33. of a capture agent e g antibody or oligonucleotide or enzyme substrate e g peptide or protein in order to perform an assay There are approximately 100 million carboxyl groups on each xMAP microsphere The chemistry of the coupling process involves formation of a carbodiimide bond between primary amines on an antibody protein peptide or oligonucleotide and carboxyl groups on the surface of x MAP Microspheres Coupling Chemistry POCO S CEOS E SEES E ESE EEE EEO EE OEESE EE EEEH TE HOEE SE EEEOE EE OEEH EE HEE EES EEOE ETE ESET ESOEEHE HOOT TOTEEH ESET SE THESE TEESE TE HOESEEOEET EE EES EEL ETOEETESSELESEEE OEE SESE ELES OLESEN EE protein T O N H protein NH r O P A N Protein Coupled microsphere O Microsphere Noe A A NH x5 Semi stable m amine reactive N O NHS ester A a EDC Unstable reactive N F o acylisourea ester HO O Sulfo NHS One step for oligonucleotides ane NS Khe Ne Ne ons HN CH Amino Modified Oligonucleotide O O O GO O OH O C NSN N CH N CI Carboxylated microsphere ANN NS oni C A N N ED Nt o Acylisourea Active Oligonucleotide Coupled Intermediate Microsphere Antibody coupling for proteins is a simple two step carbodiimide procedure during which microsphere carboxyl groups are first activated with EDC 1 Ethyl 3 3 dimethylaminopropyl carbodiimide hydrochloride reagent in the presence of Sulfo NHS N hydroxysulfosuccinimide to form a sulfo NHS es
34. reaction 13 Add 10 uL of the diluted detection antibody to each well 14 Mix the reactions gently by pipetting up and down several times with a multi channel pipettor 15 Cover the plate and incubate for 60 minutes at room temperature on a plate shaker 800 rpm for MagPlex Microspheres Chapter 4 1 4 Combined Capture Sandwich and Competitive Immunoassay For complete equipment and materials list see Appendix B Note Microspheres should be protected from prolonged exposure to light throughout this procedure Technical Notes Ine IC and IC are the concentrations of detection antibody that yield 70 and 80 of the maximum obtainable signal respectively The IC_ or IC should be determined by titration in Assay Buffer e Concentrations of biotinylated competitors detection antibodies and SAPE should be optimized The optimal concentrations tend to be higher than in a washed assay e If high backgrounds are observed a final post labeling wash step may be performed just prior to analysis www luminexcorp com Page 56 BR_574 01_0613 16 Dilute the SAPE reporter to the appropriate concentration typically 210 12 ug mL in Assay Buffer 10 uL of diluted SAPE is required for each reaction 17 Add 10 uL of the diluted SAPE to each well 18 Mix the reactions gently by pipetting up and down several times with a multi channel pipettor 19 Cover the plate and incubate for 30 minutes at room temperature o
35. that the purified control RNA concentration is correct and the RNA is not degraded Low MFI Signal 1 RNA concentration or degradation Verify that the RNA concentration is correct and the RNA is not degraded 2 Thermal cycler not functioning properly or error in program Ensure all actual incubation temperatures are within 2 C of the recommended incubation temperature Make sure the step down protocol and other steps in the PCR program are entered correctly 3 Incorrect probe hybridization temperature and or annealing temperature Ensure probe hybridization and temperature annealing temperatures are optimum for the particular probe mix 4 Nuclease Enzyme too active Make sure the Enzyme is properly diluted and not at too high a concentration Decrease concentration if needed 5 Either SAPE not added or incorrect SAPE dilution used Make sure SAPE is stored at 4 C in the dark do not freeze SAPE solutions and ensure SAPE dilutions are prepared as described in the protocol and SAPE working stock is protected from light 6 Luminex instrument was not set for detection using high PMT Ensure Luminex analyzer is set to high reporter gain setting Chigh PMT 7 Severe agitation Avoid foam formation when pipetting reagents You should perform all reagent additions and mixing gently and to the bottom of the well 8 Sample evaporation Make sure all wells are sealed properly especially during incubations 9 Reagent additions not perfo
36. the following steps if high backgrounds occur Carefully remove the supernatant from each well using either manual inversion manual pipetting or magnetic plate washer Take care not to disturb the microspheres Add 100 uL of Wash Buffer PBS TBN to each reaction well method Take care not to disturb the microspheres 17 Repeat step 16 once more for a total of two washes 18 Bring final volume of each reaction to 100 uL with Assay Buffer 19 Analyze 50 75 uL on the Luminex analyzer according to the system manual ON AY Chapter 4 1 2 Competitive Immunoassay Add reporter antibody Note Microspheres should be protected from prolonged exposure to light throughout this procedure Technical Notes The IC_ and IC are the concentrations of detection antibody that yield 70 and 80 of the maximum obtainable signal respectively The IC_ or IC should be determined by titration in Assay Buffer Concentrations of the detection antibodies and SAPE should be optimized The optimal concentrations tend to be higher than in a washed assay www luminexcorp com Page 50 BR_574 01_0613 Chapter 4 1 3 Indirect Serological Immunoassay The following immunoassay protocol presumes that the user is familiar with general assay development and optimization including microsphere bead coupling Assay Principle and Overview An indirect immunoassay enables the detection of an antibody targe
37. the microspheres Add 100 uL of Wash Buffer PBS TBN to each reaction well 13 Repeat step 14 once more for a total of two washes 14 Remove the plate from the magnetic separator and add 100 uL of reporter conjugate e g SA PE to each well of the plate 15 Cover the plate to protect it from light and incubate for 30 minutes at room temperature on a plate shaker set to approximately 800 rpm 16 Place the plate into the magnetic separator and allow separation to occur for 60 seconds Carefully remove the supernatant from each well by magnetic plate separator using either manual inversion manual pipetting or magnetic plate washer Take care not to disturb the microspheres Add 100 uL of Wash Buffer PBS TBN to each reaction well 17 Repeat step 16 once more for a total of two washes 18 Remove the plate from the magnetic separator and add 100 uL of wash buffer to each well of the plate 19 Resuspend the microspheres by pipetting up and down several times with a multichannel pipettor or placing the plate onto a plate shaker for approximately 15 seconds 20 Analyze 75 uL on the Luminex analyzer according to the system manual light throughout this procedure Mixture is required for each reaction NOW Note Many standards are supplied prediluted at working concentration and do not require further dilution Chapter 4 1 3 Indirect Serological Immunoassay www luminexcorp com Page 53 BR_574 01_0613 Indirect Immu
38. uL dH O by vortex and sonication for approximately 20 seconds 6 Place the tube into a magnetic separator and allow separation to occur for 30 to 60 seconds 7 With the tube still positioned in the magnetic separator remove the supernatant Take care not to disturb the microspheres light throughout this procedure Chapter 3 3 1 Antibody and Protein Coupling www luminexcorp com Page 14 BR_574 01_0613 8 Remove the tube from the magnetic separator and resuspend the washed microspheres in 80 uL 100 mM Monobasic Sodium Phosphate pH 6 2 by vortex and sonication for approximately 20 seconds 9 Add 10 uL of 50 mg mL Sulfo NHS diluted in dH O to the microspheres and mix gently by vortex 10 Add 10 uL of 50 mg mL EDC diluted in dH 0 to the microspheres and mix gently by vortex 11 Incubate for 20 minutes at room temperature with gentle mixing by vortex at 10 minute intervals 12 Place the tube into a magnetic separator and allow separation to occur for 30 to 60 seconds 13 With the tube still positioned in the magnetic separator remove the supernatant Take care not to disturb the microspheres 14 Remove the tube from the magnetic separator and resuspend the xMAP Antibody Coupling microspheres in 250 uL of 50 mM MES pH 5 0 by vortex and sonication for AbC Kit approximately 20 seconds See Technical Note 2 15 Repeat steps 13 and 14 for a total of two washes with 50 mM MES pH 5 0 16 Remove the tube from the magneti
39. with your microspheres beads 2 Combine 2500 microspheres of each set per reaction 3 Dilute concentrate the MagPlex TAG microsphere mixture to 125 of each microsphere set per uL in 1x Tm Hybridization Buffer and mix by vortex and sonication for approximately 20 seconds 4 Aliquot 20 uL of the MagPlex TAG microsphere mixture to each well including those for bead background 5 Add1to 5 ul of each PCR reaction to appropriate wells and add 5 uL of dH O to each bead only background well 6 Adjust the total volume to 25 uL by adding the appropriate volume of dH O to each sample well that received less than 5 uL of PCR reaction 7 Prepare Reporter Mix by diluting SAPE to 8 10 ug mL in 1X Tm Hybridization Buffer 8 Add 70 75 uL SAPE to each well Mix gently 9 Cover the plate to prevent evaporation and hybridize in a thermal cycler or a temperature controlled bench top plate shaker with the following parameters 37 45 C for 25 to 45 minutes up to 45 C may be used to improve specificity of TAG anti TAG annealing 10 Analyze 70 uL at hybridization temperature on the Luminex analyzer according to the system manual light throughout this procedure Note If needed an Excel based bead calculator is available for determining the method and volumes needed for making the bead mix Contact your Luminex representative or visit www luminexcorp com Chapter 5 1 3 Target Specific PCR Sequence Detection with MagPlex TAG Microsphe
40. 0 mg mL EDC in dH O Note We recommend using a fresh 13 One by one for each coupling reaction add 2 5 uL of fresh 10 mg mL EDC to aliquot of EDC powder for each EDC the microspheres and mix by vortex addition 14 Incubate for 30 minutes at room temperature in the dark 15 Add 1 0 mL of 0 02 Tween 20 to the coupled microspheres 16 Pellet the coupled microspheres with a tube magnet or by microcentrifugation at gt 8000 x g for 1 2 minutes 17 Remove the supernatant and resuspend the coupled microspheres in 1 0 mL of 0 1 SDS by vortex 18 Pellet the coupled microspheres with a tube magnet or by microcentrifugation at gt 8000 x g for 1 2 minutes 19 Remove the supernatant and resuspend the coupled microspheres in 100 uL of TE pH 8 0 by vortex and sonication for approximately 20 seconds 20 Enumerate the coupled microspheres by hemacytometer or other particle cell counter Note If using a hemacytometer 21 Store coupled microspheres refrigerated at 2 8 C in the dark proceed as follows a Dilute the resuspended coupled microspheres 1 100 in dH 0 b Mix thoroughly by vortexing c Transfer 10 uL to the hemacytometer d Count the microspheres within the 4 large corners of the hemacytometer grid e Microspheres uL Sum of microspheres in 4 large corners x 2 5 x 100 dilution factor f Note maximum is 50 000 microspheres LL Chapter 3 3 3 Nucleic Acid Coupling www luminexcorp com Page 21 BR_574 01_0613 Cha
41. 1X TMAC hybridization solutions We find that this TMAC formulation does not have a strong ammonia odor TMAC hybridization solutions should be stored at room temperature to prevent precipitation of the Sarkosyl TMAC hybridization solutions can be warmed to hybridization temperature to re solubilize precipitated Sarkosyl Denaturation and hybridization can be performed in a thermal cycler Use a heated lid and a spacer Cif necessary to prevent evaporation Maintain hybridization temperature throughout the labeling and analysis steps The hybridization kinetics and thermodynamic affinities of matched and mismatched sequences can be driven in a concentration dependent manner At concentrations beyond the saturation level the hybridization efficiency can decrease presumably due to competition of the complementary strand and renaturation of the PCR product Therefore it is important to determine the range of target concentrations that yield efficient hybridization without sacrificing discrimination Whether it is necessary to remove the hybridization supernatant before the labeling step is depend on the amount of biotinylated PCR primers and unhybridized biotinylated PCR products that are present and available to compete with the hybridized biotinylated PCR product for binding to the SAPE reporter Chapter 3 3 4 Oligonucleotide Coupling Confirmation www luminexcorp com Page 25 BR_574 01_0613 Oligonucleotide coupling optimization It
42. 3789 or 3792 Ambion 96 well magnetic ring stand Assays Life Technologies AM10050 96 well round bottom polystyrene solid plates Costar 3789 or 3792 96 well plate magnet Assays PerkinElmer Customer Care 5083175 96 well round bottom polystyrene solid plates Costar 3789 or 3792 96 well Thermowell P polycarbonate PCR plates Costar 6509 96 well F bottom chimney well clear med Binding black Greiner bio one 655096 Aluminum Foil Lids Beckman 538619 or equivalent Note LumAvidin beads are not magnetic and require MultiScreen Filter Plates Millipore Cat No MABV N12 and vacuum pump system manifold for vacuum pump system such as the MultiScreen Resist Vacuum Manifold from Millipore MAVMO960R Appendix B Equipment needed for xMAP protocols www luminexcorp com Page 115 BR_574 01_0613 Compatible Plates and Consumables Source Notes Description 1 5 mL copolymer microcentrifuge tubes 1 5 mL Protein LoBind microcentrifuge tubes Extended Fine Tip Transfer Pipette 96 well flat bottom polystyrene solid plates 96 well round bottom polystyrene solid plates 96 well Thermowell polycarbonate PCR plates Model P 96 well Multiscreen BV 1 2 mm filter plates 96 well uClear flat bottom chimney well plates 384 well uClear flat bottom chimney well plates 384 well Thermowell GOLD polypropylene microplates 384 well Armadillo PCR Plates 384 well Hard Shell thin
43. CR based Indirect assay Primer extension Probe ligation Immunoassays Immunoassays are used for the detection of biological substances and have become established as one of the most popular analytical techniques applied in clinical and veterinary medicine drug discovery and rapidly emerging areas such as biothreat and food safety Due to the ease of use accuracy specificity and speed immunoassays are commonly used to measure a large number of hormones blood products enzymes drugs disease markers and other biological molecules Many immunoassays can be performed directly on untreated samples such as plasma serum urine saliva and cerebrospinal fluid Single analyte ELISA has been an industry standard for decades and has led to more novel techniques such as highly multiplexed immunoassays for measuring potentially hundreds of analytes simultaneously Such multiplex assays can be used to generate profiles of clinical samples that can facilitate accurate disease diagnoses or prediction of drug responses For multiplex immunoassays the effective biological range of each analyte must be considered to ensure that reporter fluorescence will fall into the dynamic range of your assay Monoplex assays address this by serial dilution of the sample but a multiplex assay must take a different approach Some analytes may exist in such a low range of concentrations that a more sensitive assay is needed for that analyte while another analyte in t
44. CR reaction chemistries double stranded PCR amplicons are generated along the whole length of the target sequence and primers These double stranded amplicons can generate low signals since the biotin labeled TAG strand will preferentially bind its complementary anti TAG strand rather than the complementary anti TAG sequence on the beads Elimination or reduction of the amount of unlabeled complementary strand can be achieved with more complex protocols involving enzyme treatments or asymmetric PCR chemistries A simpler and more straightforward approach is to prevent synthesis of the anti TAG complementary portion of the amplicon during the PCR reaction This can be achieved with the use of a TAG containing primer where the TAG sequence is separated from the sequence specific portion of the primer with an internal spacer Figure 17A When this TAG primer is combined with a sequence specific 5 biotinylated reverse primer an amplicon containing a single stranded TAG overhang and a sequence specific double stranded biotinylated region is generated Figure 17B The TAG portions of these amplicons do not have a competing anti TAG complementary strand to inhibit binding to the anti TAG sequences on the MagPlex TAG beads Figure 17C Figure 17 Outline of Target Specific PCR probe design and chemistry Figure 17 Target Specific PCR sequence detection involves A a TAG containing Sequence Specific Region primer separated from the sequence
45. Detection with MagPlex TAG Microspheres beads For complete equipment and Vendor aa materials list see Appendix B Luminex IDT or other vendor IDT or other vendor Qiagen 203443 or equivalent Note Molecular grade ddH O should Life Technologies 10297 be used for all nucleic acid protocols 018 or equivalent See Target Specific PCR Buffer and Reagent Recipes section See Target Specific PCR Buffer and Reagent Recipes section Moss Inc SAPE O01G75 Life Technologies S 866 or equivalent BioRad MSP9601 Corning Costar 6509 BioRad MSA5001 V amp P Scientific VP771LD 4CS or equivalent Any suitable brand Any suitable brand USA Scientific or Equivalent Any suitable brand Any suitable brand Any suitable brand Any suitable brand Eppendorf 5704 or equivalent USA Scientific 9127 2940 Any suitable brand Luminex www luminexcorp com Page 94 BR_574 01_0613 Target Specific PCR Buffer and Reagent Recipes POCO OSES HEHE HOSES HHEHEEEEHOEEOOHOE EES EOHEEEOOEE SESS OEE OOOH EEO SOSE TOTO OSEOHEE SOSH EH EEEEEESSOE EO OHSEEESOOE EE SOOHES HOSE E TOES EE SOOT OTHE TO THEE ESOEHESHOEEEEEESOEED ODES Step Notes MagPlex TAG Required Microspheres regions should be purchased from Luminex Microspheres from They should be stored at 4 C in the dark For multiplex assays Luminex combine different bead regions as directed in the protocol Enzymes and Enzyme All enzymes and their reaction buffers can
46. EOTEEHEEEEE THEE EEEEHHEEEEEE ESOL EEEELEEELEEEEHEEEEEEHELEEEELESEHELETEEELEELEEEELEEE EE EEEE EE EELELEEELES Coupling of oligonucleotides oligos to x MAP Microspheres beads is a straightforward process but does require a number of optimization steps to ensure best results in a multiplex assay Luminex supports custom oligo coupling but has also innovated a pre coupled pre optimized universal microsphere set that circumvents the need for assay developers to couple oligos to beads MagPlex TAG Microspheres are magnetic microspheres pre coupled with unique 24 base DNA sequences C anti TAGs to allow incorporation of complementary TAG sequences into custom oligonucleotide targets for hybridization capture Figure 6 Figure 7 MagPlex TAG Microspheres are pre coupled with anti TAG sequences allowing the user to incorporate TAG tails anti TAG 1 into assay reactions to facilitate bead a X Pa S capture without the need to chemically couple oligos anti TAG 2 e e 2 xe A anti TAG 3 gt 000 For users wishing to couple custom oligonucleotide sequences to xMAP Microspheres themselves below is a standard protocol It is recommended to use oligonucleotides synthesized with a 12 carbon amine containing group on the 5 end Having this spacer insures that the coupled oligo is raised off of the bead surface to facilitate interaction with the target and reporter molecules it needs
47. LOQ and ULOQ The wells marked with a B are blank wells i e assays run only with sample diluent The average of these ten should be used to determine background levels In columns 4 6 samples 1 6 are standard dilution series run in standard diluent to determine spike control recovery and linearity of dilution In columns 7 9 samples 1 6 are standard diluted in sample matrix to determine sample spike recovery and inter assay CV although a minimum of three plates needs to be run for inter assay CV Sample matrix should be depleted of target proteins e g use depleted serum or plasma Chapter 3 51 Immunoassay Validation R amp D Systems 2006 Spike and Recovery Immunoassay Sample Validation Protocol http www woongbee com ONewHome RnD ELISA RnD_ 20 SPIKEandREC2006 pdf www luminexcorp com Page 40 BR_574 01_0613 Proteomic Applications Chapter 4 Proteomic Applications www luminexcorp com Page 41 BR_574 01_0613 Chapter 4 1 The following immunoassay protocols presume that the user is familiar with general assay development and optimization including microsphere bead coupling This introduction is intended to review the immunoassay development process only at a high level First the assay format should be selected such as capture sandwich competitive or indirect assay Next is the acquisition of necessary reagents including antibodies analytes standards controls and buffers The capture reagen
48. M stock mix can be made by mixing equal amounts of 100 mM dATP dTTP dCTP and dGTP for the 4dNTP stock mix for gDNA amplification Individual stocks and concentrated mixes should be stored at 20 C Biotin 14 dCTP Biotin labeled dCTP can be purchased from several sources including Life Technologies Invitrogen 19518 018 It is supplied at 0 4 mM in 100 mM Tris HCl pH 7 5 0 1 mM EDTA Store at 20 C and use as indicated in the protocol Chapter 51 2 Allele Specific Primer Extension ASPE SNP Typing www luminexcorp com Page 87 BR_574 01_0613 2X Tm Hybridization Buffer The buffer s composition is 0 4 M NaCl 0 2 M Tris 0 16 Triton X 100 pH 8 0 It should be filter sterilized and stored at 4 C 1X Tm Hybridization Buffer The buffer s composition is 0 2 M NaCl 0 1 M Tris 0 08 Triton X 100 pH 8 0 It should be filter sterilized and stored at 4 C streptavidin R SAPE at 1 mg ml can be purchased from a number of suppliers such phycoerythrin SAPE as Moss Incorporated SAPE 001G75 Life Technologies S866 or equivalent A working aliquot should be made fresh by diluting with 1X Tm Hybridization buffer to the required volume and concentrations needed as indicated in the wash or no wash protocols Protocol 5 1 2 for ASPE SNP Typing POPSET ESO EE EE TEEEO HE EEETOSOTEEEEEEEEHOSEOH EHO OEE SOOO EO EEEE OT EOEEE HOSE OTE SETHE ESHEEEEOOEET OT OTOEEEEEEEE OOOOH ETOH OEESOOEEESEOOTEEEEETE SOHO EEESESLELEEEELEOEEDOLE
49. OS EE HOSE EESEOESEEEOETESEOEEETOOEEEESS Note Microspheres should be protected l l longed to light Resuspend the stock microsphere suspension according to the instructions Jrom prolonged exposure to lig throughout thi dure described in the Product Information Sheet provided with your microspheres E EA EELEE 2 Remove an aliquot of 25 x 10 of microspheres and pellet by centrifugation at 24000 g for 2 min or by using a magnetic separator and remove Supernatant 3 Resuspend the pelleted microspheres in 1 mL of 0 1 M MES pH 6 0 by vortex and sonication for approximately 20 seconds 4 Transfer the resuspended microspheres to a recommended microcentrifuge tube and pellet the microspheres by microcentrifugation at 28000 g for 1 2 minutes or by using a magnetic separator and remove supernatant 5 Dissolve MPBH at 80 mM 28 3 mg mL with DMSO 6 Dilute dissolved MPBH to 16 mM 5 7 mg mL with 0 1 M MES pH 6 0 7 Resuspend the microspheres in 250 uL of diluted MPBH by vortex 8 Add 100 uL of 20 mg mL EDC prepared immediately before use in 0 1 M MES pH 6 0 and mix by vortex 9 Incubate for 1 hour with mixing by rotation at room temperature 10 Add 1 mL of 0 1 M MES pH 4 5 and mix by vortex 11 Pellet the microspheres by microcentrifugation at 28000 g for 1 2 minutes or by using a magnetic separator and remove supernatant 12 Resuspend the pelleted microspheres in 1 mL of 0 1 M MES pH 4 5 by vortex and pellet
50. S pH 5 0 Sigma M2933 Assay Wash Buffer PBS 1 BSA Sigma P3688 Phosphate buffered saline PBS pH 7 4 Sigma P3813 Sigma P3563 PBS BN buffer Sigma P3688 PBS TBN buffer Sigma P3813 Sigma A7888 Sigma P9416 1 5 mL microcentrifuge tubes USA Scientific 1415 2500 or Eppendorf Lo Bind 022431081 Disposable pipettes tips Any suitable brand Distilled deionized water ddH O Any suitable source 1 Activation can be performed in 50 mM MES pH 6 0 6 2 with similar results 2 Coupling can be performed in 100 mM MES pH 6 0 with similar results For some proteins better solubility and better coupling may be achieved at a higher coupling pH 3 Alternative coupling buffer for proteins that do not couple well at pH 5 6 4 Also used as assay buffer 5 Also used as wash buffer Protocol 3 3 1 antibody coupling a eens cies denned E T te l l protected from prolonged exposure to 1 Resuspend the stock uncoupled microsphere suspension according to the instructions described in the Product Information Sheet provided with your microspheres 2 Transfer 5 0 x 10 of the stock microspheres to a recommended microcentrifuge tube 3 Place the tube into a magnetic separator and allow separation to occur for 30 to 60 seconds 4 With the tube still positioned in the magnetic separator remove the supernatant Take care not to disturb the microspheres 5 Remove the tube from the magnetic separator and resuspend the microspheres in 100
51. SOREEEOED Genomic Target Sequence Amplification Multiplexed PCR amplification of genomic target regions containing SNPs of interest should be performed under optimized conditions The parameters listed below are for example purposes only and may not be optimum for your samples or any specific genomic amplification kit you may be using Each final reaction contains Reagent Amount gDNA template 50 ng Qiagen PCR reaction buffer 1X MgCl 1 5 mM dNTP 200 uM each primer 0 2 UM each Qiagen HotStar or other Tag polymerase 2 5 Units Amplification of target regions can be done with the following PCR Cycling Parameters Temperature Time Cycle 95 C 15 minutes for enzyme activation ae 30 seconds 55 C 30 seconds 35 cycles 72 6 30 seconds 72 C 7 minutes A C Hold Chapter 5 1 2 Allele Specific Primer Extension ASPE SNP Typing www luminexcorp com Page 88 BR_574 01_0613 EXO SAP treatment for the removal of unused primers Treat 7 5 uL of each PCR reaction with ExoSAP IT according to the following procedure Reagent Amount PCR Reaction 7 5 uL ExoSAP IT 3 0 uL Total volume 10 5 uL Mix and incubate in a thermal cycler with the following protocol orale 30 minutes 80 C 15 minutes 4 C Hold or store at 20 C Detailed Multiplex ASPE Reaction Protocol Prior to making the 2X ASPE Master Mix dilute the ImM ASPE TAG primer mix 1 2000 500 nM each and the 100 mM 3 dNTP stock 1 1000 100 UM each 1 Make a 2x
52. TOEEEEEHEEOTEE HOLE EH EEEEEEEEEEH TEETER ESELEEEELEEE LESSEE EEEEEEHELEEO EE EEEHEDOLEEELELEEEELEEE EE EOEEE EEE EEE EE ELES Preparing sample control spike serial dilutions testing sample linearity To test samples for linearity make serial dilutions of the sample spike and control spike If the neat sample has a value greater than 60 of the high standard test the sample for natural linearity using the same dilution series described below Vortex briefly between each dilution 1 2 dilution Add 0 5 mL of sample spike control spike or neat sample to 0 5 mL standard curve diluent 1 4 dilution Add 0 5 mL of 1 2 dilution to 0 5 mL standard curve diluent 1 8 dilution Add 0 5 mL of 1 4 dilution to 0 5 mL standard curve diluent These dilutions will be read off the standard curve to determine if dilutions of unvalidated samples are parallel to the standard curve and if the values of the sample dilutions are accurate Calculations 1 Spike Recovery Recovery Observed Neat x 100 e Observed Spiked sample value e Neat Unspiked sample value Expected Amount spiked into sample e Note The neat sample may read O pg mL e Recovery should be in the range of 80 120 e Control spike should have a recovery value within 80 120 If not this indicates there was a problem in preparing the control spike 2 Linearity e Use the spiked sample value as the expected value if testing linearity of the spiked sample Note
53. When running biological fluids remember to sanitize with 10 20 bleach and wash and soak with distilled water at the end of the day to prevent clogging Chapter 4 3 Proteomics FAQ s www luminexcorp com Page 72 BR_574 01_0613 What signal is considered a positive signal PCOS SE EHH EES OEEEEESEHEE SESE EEO HOEEESOOH EEE OOEESESSOET ESOS OSES EOS OHEE SESH ES OSHS ESSE E SESE EO OESOEE ETOH EO HOOHESOOEEE HOHE EE ESOS EETHEEE SESS EESOOHEE ESOS ESESEOEED EEE e Base this on the positive control A general recommendation is that a positive signal should be at least 2 standard deviations above background or the negative control Which buffers solvents are compatible with the Luminex system During the coupling procedure avoid buffers that contain free amines that might interfere with the coupling to the COOH sites on the beads As the salt concentration of the buffer increases the classification of the beads in the flow analyzers may be effected causing the beads to spread out of the region i e SSC buffer e Avoid organic solvents as they will cause the internal classification dyes of the beads to leach out causing misclassification Can formaldehyde be used to stop reactions on the Luminex Microspheres POO SOC ESE HHH EHO EEEEESOHHEEEHOEE OSTEO EES OOH E SHOES ESSE OOOH ESOS E OTOH OSES ES OSEOE ESSE E SESE OSTEO SOOO OSOOHE SHOE E OTOH E ETOH EOTEEEO TESTES OOHEE ESOS SE ESOEED OEE Formaldehyde or Para forma
54. ad stock Since 0 4 ul of this stock is needed per reaction it can be diluted to the 4 0 ul volume required for each reaction as follows For 100 samples add 360 ul of TE pH 8 0 buffer to the 40 ul of bead mix Place the tube on a magnet or spin to pellet the beads Remove all of the supernatant Resuspend the beads in 400 ul of hybridization buffer This will achieve a mix where 4 ul will deliver 1 000 beads per region to each well for 100 wells reactions To compensate for slight fluid loss during pipetting a 20 overage can be calculated for these volumes Note For assays above 10 plex the use of multiple bead stocks of individual bead regions will require additional concentration steps to make a master mix that can deliver all the required bead regions at 1 000 beads per region in 4 ul If high plex bead mixes are required the purchase of bead stocks containing multiple bead regions is recommended to simplify or eliminate the concentration steps needed to make the bead mix that is added to the reaction Whatever the bead source the final bead dilution for use in the assay should be in hybridization buffer Also if needed an Excel based bead calculator is available for determining the method and volumes needed for making the bead mix Only purified total RNA should be used Purified miRNA or small RNA is not recommended Purification methods used to isolate miRNAs may introduce unwanted bias by selectively purifying some miRNA species
55. and should be from the same DNA strand per target sequence 5 For unrelated sequences probes may be lengthened Better sensitivity may be achieved with longer probes 50 or 70 nucleotides 6 Probes must have a primary amino group for coupling to the carboxyl group on the microsphere We suggest synthesizing the oligonucleotide with a 5 amine spacer See 7 7 Probes must have a spacer between the reacting amine and the hybridizing sequence We recommend synthesizing capture probes with 5 Amino Modifier C12 or 5 Uni Link Amino Modifier Chapter 3 3 4 Oligonucleotide Coupling Confirmation www luminexcorp com Page 24 BR_574 01_0613 Tips Important Points amp Critical Factors 1 Amine substituted oligonucleotide probes should be resuspended and diluted in dH 0 Tris azide or other amine containing buffers must not be present during the coupling procedure If oligonucleotides were previously solubilized in an amine containing buffer desalting by column or precipitation and resuspension into dH O is required We recommend using EDC from Pierce for best results EDC is labile in the presence of water The active species is hydrolyzed in aqueous solutions at a rate constant of just a few seconds so care should be taken to minimize exposure to air and moisture EDC should be stored desiccated at 20 C in dry single use aliquots with secure closures A fresh aliquot of EDC powder should be used for each coupling episode
56. ased Combine 2500 microspheres of each set per reaction bead calculator is available for Dilute concentrate the MagPlex TAG microsphere mixture to 111 of each determining the method and volumes microsphere set per uL in 1X Tm Hybridization Buffer and mix by vortex and needed for making the bead mix sonication for approximately 20 seconds Contact your Luminex representative Aliquot 22 5 uL of the MagPlex TAG microsphere mixture to each well or visit www luminexcorp com Add 2 5 uL of dH O to each background well Add 2 5 uL of each sample to the appropriate wells Cover the plate with MicroSeal A film to prevent evaporation and hybridize in a thermal cycler with the following parameters 96 C for 90 seconds 37 C for 30 minutes Prepare SAPE Mix by diluting SAPE to 10 ug mL in 1X Tm Hybridization Buffer Add 100 uL SAPE Mix to each well Mix gently Incubate at 37 C for 15 minutes Analyze 100 uL at 37 C on a Luminex analyzer according to the system manual Recommendations for Optimization and Troubleshooting PPO O OHO EES EE OEE SE EOEESEEOEEE SEES EE SEHE OEE OEEESEEHO EEE E TOTES OEE E ETOH EES EHO ET OO SHEET EHH TEHHEH TE OESOE ESOT EHESEETE THOT ECESESEEEEEOTEEHEOEELEDSETELEDELELEEESENES Low Reporter Intensity 1 Verify the production of the genomic target PCR products OLA templates on agarose gels 2 Verify the hybridization assay by direct hybridization to 5 and 50 femtomoles of labeled oligonucleotide targets Ci e biotinyl
57. ated TAGs 3 Titrate the gDNA input for target region generation to determine the optimal amount for OLA reaction 4 Titrate the gDNA amplified template input into OLA reaction to determine the optimal amount of template 5 Titrate the allele specific and reporter probe inputs to determine optimal Note An allele specific to reporter concentrations for OLA probe ratio of 1 50 improves the 6 Increase the number of cycles in the OLA reaction probability that an allele specific 7 Decrease and or increase the OLA annealing temperature probe will anneal adjacent to a 8 Check the primer and template sequences for potential secondary structure reporter probe 9 Redesign the PCR primers 10 Redesign the OLA probes for the opposite DNA strand 11 Lengthen the OLA probes Chapter 511 Oligo Ligation Assay OLA SNP Typing www luminexcorp com Page 83 BR_574 01_0613 Poor Discrimination 1 Increase the OLA annealing temperature 2 Redesign the OLA probes for the opposite DNA strand 3 Shorten the leaky OLA probe Poor Reporter Distribution Between Alleles 1 Redesign the OLA probes for the opposite DNA strand 2 Lengthen the OLA probes to increase signal on the low allele 3 Shorten the OLA probes to decrease signal on the high allele High Background 1 If not using SAPE already containing BSA Ci e Moss SAPE O01G75 dilute SAPE in 1X Tm buffer containing BSA Final BSA concentration in the reaction should be
58. ated in the wash or no wash protocols Protocol 5 1 3 Target Specific PCR Sequence Detection Target Sequence Amplification Multiplexed PCR amplification of target regions should be performed under optimized conditions The parameters listed below are for example purposes only and may not be optimum for your samples or any specific genomic amplification protocol you may be using Chapter 5 1 3 Target Specific PCR Sequence Detection with MagPlex TAG Microspheres beads www luminexcorp com Page 95 BR_574 01_0613 1 Assembly of PCR reactions Each final reaction contains Reagent Amount DNA template 50 ng Qiagen PCR reaction buffer 1X MgCl 1 5 mM dNTP 200 uM each xTAG and Biotinylated primer 0 2 uM each Qiagen HotStar or other Taq polymerase 2 5 Units 2 Cover plate with a plate sealer and place in a thermal cycler Perform PCR with the following program Note The temperature of the 55 C hybridization step can be adjusted as needed Temperature 95 C 15 minutes 94 C 30 seconds 55 C 30 seconds 35 cycles TIME 30 seconds 72 C 7 minutes A C Hold 3 Proceed to hybridization with MagPlex TAG Microspheres using the no wash protocol Hybridization to MagPlex TAG Microspheres no wash protocol Note Microspheres should be 1 Select the appropriate MagPlex TAG microsphere sets and resuspend PT OENE JEON a ae according to the instructions described in the Product Information Sheet provided
59. ated miRNAs Probe Portion Sequence miRNA sequence for mmu miR 34b 5p 5 AGGCAGUGUAAUUAGCUGAUUGU 3 Anti TAG sequence on MagPlex TAG MTAG A015 5 GTTGTAAAT TGTAGTAAAGAAGTA 3 Reverse complement of anti TAG Sequence 15 5 TACTTCTTTACTACAAT T TACAAC 3 DNA Oligo to order 5 Biotin ACAAUCAGCUAAUUACACUGCCUTACTTCTT TACTACAATTTACAAC 3 Chimeric probe mix Individual chimeric probe preparations from the manufacturer can be dissolved to 100 uM with TE buffer pH 8 0 If you need to make probe mixes higher than 100 plex the individual probe should be dissolved to higher concentrations 200 uM if possible The individual dissolved probes can be aliquoted and stored frozen at this point as individual concentrates To create an equimolar mix of chimeric probes a concentrated mixed probe stock at 1 uM for each probe is first made then further diluted to generate a working mix where 1 25 ul of probe mix for each reaction delivers 10nM for each probe Example A 5 plex miRNA profile is to be analyzed on 100 samples The total number of samples will require 100 1 25 ul 125 ul ofa 10nM probe mix with all 5 probes Each of the individual chimeric probes are at 100 uM and need to be diluted 1 100 to generate the 1 uM concentrated probe mix This 1 uM mix can be made by adding 1 25 ul of each probe into an empty tube with 118 75 ul of TE buffer 5 1 25 ul 6 25 ul 118 75 ul TE buffer creates 125 ul of 1 uM probe mix The working stock is made fr
60. ation Luminex recommends that plasma and serum be diluted at least 1 5 If samples cannot be diluted at least 1 5 try using a small initial reaction volume and diluting the final reaction prior to analysis on the Luminex instrument In addition if non specificity remains after diluting the serum samples try adding additional blockers to the assay buffers If BSA is not helping or might interfere with the assay you may opt for other species albumin porcine milk casein ChemiBLOCKER etc or switch to a washed assay format if using a no wash Washed versus unwashed assays POPP OCHS CEST EEEEESEEEEE HELE TOOTH OEEEH SE EOEE TE EEEE HE SEEH EE OEEO EE OEE ET EEESETEEEEESEEOEH HE LEEE EE OEEHEE EEE EEEOEHELETEEESEEESELEEEDELEHSELOEEEELELOEH OE EEEE EE DESEE ELE E EE Conversion of a washed assay to an unwashed assay format can reduce hands on time as well as decrease total assay time To convert to an unwashed format sample volume may be decreased and or detection antibody and SAPE concentrations are increased to compensate for higher concentrations of unbound analyte and detection antibody present in the reaction Increasing the volume of the detection antibody used as compared to the washed format assay introduces more detection antibody and dilutes the sample prior to analysis which may overcome matrix effects or issues caused by interfering substances In some cases a final post labeling wash step may be included to reduce background signal
61. ay even contain multiple SNPs For complete equipment and materials list see Appendix B Note Molecular grade ddH O should be used for all nucleic acid protocols www luminexcorp com Page 86 BR_574 01_0613 Vortex Mixer Any suitable brand Microcentrifuge Any suitable brand Bath Sonicator 40 55 kHz frequency waves Any suitable brand Centrifuge with Microplate Swinging Bucket Rotor Eppendorf 5704 or equivalent Brayer roller soft rubber or silicon USA Scientific 9127 2940 Thermocycler with 96 well Head and Heated Lid Any suitable brand Luminex Instrument with xPONENT 3 1 or higher software Luminex ASPE Buffer and Reagent Recipes POPP OH SCOOT EOE OSEESEHHEEEEOE ESOT TE EOOE TEESE SE OOOOH TEESE ETOH HES EEO ETE EHO ETE OEE SEH SEET OO EES EES OTHE THEE ET OE ESOT ESET EEOEESEEEEHEESETOO ETE ESO LESSEE EDEEETES ESOL ES ENES Step Notes MagPlex TAG Required Microspheres regions should be purchased from Luminex Microspheres from They should be stored at 4 C in the dark For multiplex assays Luminex combine different bead regions as directed in the protocol Enzymes and Enzyme All enzymes and their reaction buffers can be used as directed in the Reaction Buffers protocol PCR amplification primers Proper design of these primers for amplification of target regions for gDNA targets is required for optimum assay performance Recommendations for primer designs include 1 PCR primers should be designed to amplify gDNA target
62. be protected from prolonged exposure to 1 Select the appropriate antibody coupled microsphere sets 2 Resuspend the microspheres by vortex and sonication for approximately light throughout this procedure 20 seconds 3 Prepare a Working Microsphere Mixture by diluting the coupled microsphere stocks to a final concentration of 100 microspheres of each set uL in PBS 1 BSA Note 25 uL of Working Microsphere Mixture is required for each reaction 4 Dilute the biotinylated competitor to the IC or LIC in PBS 1 BSA Note 25 uL of diluted competitor is 5 Add 25 uL of PBS 1 BSA to each background well required for each reaction 6 Add 25 uL of standard or sample to the appropriate wells 7 Add 25 uL of the diluted biotinylated competitor to each well 8 Mix the reactions gently by pipetting up and down several times with a multi channel pipettor 9 Add 25 uL of the Working Microsphere Mixture to the appropriate wells 10 Mix the reactions gently by pipetting up and down several times with a multi Technical Note ANEPI EEL e The lIC__ and IC are the 11 Cover the plate and incubate for 60 minutes at room temperature on a plate a bi eted O coo wi concentrations of iotiny l competitor that yield 70 and 12 Dite tne SAPE reporter to 4 g mL in PBS 1 BSA Note 25 uL of diluted 2652 or ernai nunrobiand ie SAPE is required for each reaction l i l signal respectively The IC or 13 Add 25 uL of the diluted SAPE to each well
63. be used as directed in the Reaction Buffers protocol PCR Primer Design PCR primers should be designed to amplify a region containing any sequence of interest and the pairs should be matched for melting temperatures at 51 56 C Primers should amplify a region in the 100 150 bp range for best performance The TAG containing primer should have a 12 to 18 atom spacer separating the TAG sequence on its 5 end from its sequence specific 3 end The reverse primer should be biotinylated on its 5 end When designing these primers use oligo design software to select an appropriate TAG sequence to include on the TAG primers These primers can be purchased from multiple vendors such as IDT Upon receipt the primers should be dissolved or dilute with sterile molecular grade ddH O to a concentration of 1 mM 1 nanomole uL They can be stored as individual stocks at 20 C Pooled mixes can be made to deliver 0 2 uM of each primer PCR reaction or as your optimized PCR protocol requires 1X Tm Hybridization Buffer The buffer s composition is 0 2 M NaCl 0 1 M Tris 0 08 Triton X 100 pH 8 0 It should be filter sterilized and stored at 4 C streptavidin R SAPE can be purchased from a number of suppliers such as Moss phycoerythrin SAPE Incorporated SAPE 0O01G75 Life Technologies S866 or equivalent A working aliquot should be made fresh by diluting with 2X Tm Hybridization buffer to the required volume and concentrations needed as indic
64. beads followed by a short nuclease reaction that degrades mismatched and unbound probes Following a short SAPE labeling step and some washes the samples are ready for analysis Chapter 5 1 5 MicroRNA Analysis www luminexcorp com Page 104 BR_574 01_0613 Figure 18 miRNA assay work flow A B SC Step down Probe Hybridization RNase Digestions D SAPE Incubation Materials Needed Reagents and Consumables MagPlex TAG Microspheres Chimeric probes Stock RNAse One Wash and Hybridization buffer streptavidin R phycoerythrin SAPE 96 well PCR Plate 96 well Bead Hybridization Plate optional MicroSeal A Silicon Mat Magnetic separation plate special order Disposable pipette tips multi and single channel 2 1000 mL 25mL reservoirs divided well RNase DNase Free Microcentrifuge Tubes 1 5 ml Barrier Pipette Tips Vortex Mixer Microcentrifuge Bath Sonicator 40 55 kHz frequency waves Centrifuge with Microplate Swinging Bucket Rotor Brayer roller soft rubber or silicon Thermocycler with 96 well Head and Heated Lid Luminex Instrument with xPONENT 3 1 or higher software Chapter 5 1 5 MicroRNA Analysis A DNN Microsphere Hybridization Figure 18 A Step down Probe Hybridization DNA RNA chimeric probes hybridize to target miRNAs during 6 incremental reductions in annealing temperature 2 hours B Microsphere Hybridization
65. bine different bead regions as directed in the protocol To assist with making multiplex a Microsphere Stock Mix from individual bead stocks an Excel based bead calculator is available for determining the method and volumes needed for making the bead mix contact your Luminex representative or visit www luminexcorp com Enzymes and Enzyme All enzymes and their reaction buffers can be used as directed in the Reaction Buffers protocol Chapter 5 1 1 Oligo Ligation Assay OLA SNP Typing www luminexcorp com Page 79 BR_574 01_0613 PCR amplification primers for gDNA targets OLA TAG and biotinylated OLA reporter primers OLA primer design factors dNTPs 2X Tm Hybridization Buffer 1X Tm Hybridization Buffer streptavidin R phycoerythrin SAPE Proper design of these primers for amplification of target regions is required for optimum assay performance Recommendations for primer designs include 1 PCR primers should be designed to amplify gDNA target regions containing the SNP s of interest 2 PCR primers should not be labeled 3 Amplicon size is not restricted These primers can be purchased from multiple vendors Upon receipt the primers should be dissolved or diluted with molecular grade distilled deionized H O ddH O to a concentration of 1 mM 1 nanomole uL They can be stored as individual stocks at 20 C Pooled mixes can be made to deliver 0 2 uM of each primer PCR reaction or as your gDNA protocol requir
66. ble pipettes tips Any suitable brand Distilled deionized water ddH O Any suitable source 1 Also used as assay buffer 2 Also used as wash buffer Protocol 4 1 4 Combined Capture Sandwich and Competitive Immunoassay 1 Select the appropriate antibody and or antigen coupled microsphere sets 2 Resuspend the microspheres by vortex and sonication for approximately 20 seconds 3 Prepare a Working Microsphere Mixture by diluting the coupled microsphere stocks to a final concentration of 500 microspheres of each set uL in Assay Buffer 5 uL of Working Microsphere Mixture is required for each reaction 4 Dilute the biotinylated competitor to the IC_ or LIC in Assay Buffer 5 uL of diluted competitor is required for each reaction 5 Add 10 uL of Assay Buffer to each background 6 Add 10 uL of standard or sample to the appropriate wells 7 Add 5 uL of the diluted competitor to each well 8 Mix the reactions gently by pipetting up and down several times with a multi channel pipettor 9 Aliquot 5 uL of the Working Microsphere Mixture to each well 10 Mix the reactions gently by pipetting up and down several times with a multi channel pipettor 11 Cover the filter plate and incubate for 60 minutes at room temperature ona plate shaker 800 rpm for MagPlex Microspheres 12 Dilute the biotinylated detection antibody to the appropriate concentration in Assay Buffer 10 uL of diluted detection antibody is required for each
67. c separator and resuspend the activated and washed microspheres in 100 uL of 50 mM MES pH 5 0 by vortex and sonication for approximately 20 seconds 17 Add 125 25 5 or 1 ug protein to the resuspended microspheres Note We recommend titration in the 1 to 125 ug range to determine the optimal amount of protein per specific coupling reaction 18 Bring total volume to 500 uL with 50 mM MES pH 5 0 19 Mix coupling reaction by vortex Luminex Magnetic Tube 20 Incubate for 2 hours with mixing by rotation at room temperature Separator 21 Place the tube into a magnetic separator and allow separation to occur for 30 to 60 seconds 22 With the tube still positioned in the magnetic separator remove the supernatant Take care not to disturb the microspheres 23 Remove the tube from the magnetic separator and resuspend the coupled microspheres in 500 uL of PBS TBN by vortex and sonication for approximately 20 seconds 24 Optional Incubate for 30 minutes with mixing by rotation at room temperature Note Perform this step when using the microspheres the same day 25 Place the tube into a magnetic separator and allow separation to occur for 30 to 60 seconds 26 With the tube still positioned in the magnetic separator remove the supernatant Take care not to disturb the microspheres 27 Remove the tube from the magnetic separator and resuspend the microspheres in 1 mL of PBS TBN by vortex and sonication for approximately 20 seco
68. channel pipettor 29 Analyze 50 75 uL on the Luminex analyzer according to the system manual Capture Sandwich Immunoassay References POCO HSS O HHT LOEEEEESEOHE SETHE SOTHO EES OSHS HOHE SEES TE SEHO OSE OOSS SETHE EES OSHS OOOH SHEE ETOOEOO EEO OHES SETHE EO SOOTESESETE OOOH OE EESOET SETHE OOOH ESOOE TET EEE EO EESOEESEOES Bjerre M Hansen TK Flyvbjerg A T nnesen E Simultaneous detection of porcine cytokines by multiplex analysis development of magnetic bioplex assay Vet Immunol Immunopathol 2009 130 53 58 Chapter 4 1 1 Capture Sandwich Immunoassay www luminexcorp com Page 46 BR_574 01_0613 Chapter 4 1 2 The following immunoassay protocol presumes that the user is familiar with general assay development and optimization including microsphere bead coupling Competitive Assay Pa Format 1 Format 2 Assay Principle and Overview POPP OOo E SOOO ESO EEE TE CEEEHEOEE ESOL EEHETOOHETOOEEETOOEE EE SOOETE SOOO HETEEH EL EOEEESOEEOE TOTO TSOHOTE SOLE EOTEEEESOOHEEEOOTETESELETELELEEEESELESELEEEELOEEEDELEEEEEELEODEL OLED A competitive immunoassay enables detection of an antigen target with the use of a single capture antibody attached to the surface of a microsphere and a competitive labeled antigen reversibly bound to the antibody Format 1 Analyte in the sample is detected by competing away the bound labeled antigen and causing a decrease in signal The assay format may also b
69. cid assay analysis on Luminex beads Each Homozygous AA bead has a unique capture sequence specific for a marker sequence If reporter molecules are generated and captured bead A a fluorescence signal is detected fno reporter molecules are generated and captured bead a minimal or background signal is detected While there are a large number of scientific publications describing a variety of Luminex genomic assays www luminexcorp com bibliography the protocols outlined in this guide describe a number of applications developed and tested in the Luminex laboratory These protocols focus on several genomic chemistries captured to MagPlex TAG Microspheres but some may be applied with suitable modifications to beads coupled with other sequences by the user Development of an effective x MAP based nucleic acid assay is dependent ona number of factors One of the first things to consider is the purpose of the assay Depending on the application chosen different types of starting nucleic acid and other chemistry will be required to generate reporter molecules for data collection with the Luminex platform Chapter 5 1 Introduction Development of Nucleic Acid Assays www luminexcorp com Page 76 BR_574 01_0613 In general the steps involved in designing a x MAP based nucleic acid assay are described in the following workflow Gene expression e SNP typing Sequence detection CNV Tissue cell culture
70. clonal or monoclonal antibody to the microspheres beads cece POPP O HCE EE EE ELE SEE EH EEE EEE TEEEEEEEEE HE SOEEE ETOH EEE OEHOEEEEEH EEE SE SEEEEEOTEEHEEEOEHEEEEEEE ESET EEEELEHEDEEEEHEEEEE EL EEEEEE DELO EDEL EEELELEE LESSEE ELEOEE EE EEEE EEE EL Ee Monoclonal antibodies are recommended because of their specificity Polyclonal antibodies can be used after an affinity purification step If options are limited use what is available and check for possible cross reactivity with other analytes in the sample As always the success of the assay achieving the desired sensitivity and specificity will depend on the quality of the reagents Do protein protein interactions work on Luminex Microspheres PRPC OHH CE EEE TEETH ETE EEE TEESE EE EEE EE TETS EES OEOE SESE TEE TEE TE OESOEESEEEEEEEEEHTOEESEETEHEESEEEEHH OE EEEEETETSEHECEDESEEEET TEESE EE EESEEESESSE LESSEE OE EEEOS EEE ES OEE LENE Yes An example of protein protein interactions is a transcription complex where proteins interact to influence gene expression The difficulty with protein protein interactions is the low affinity that proteins have for each other Multiplex IP FCM Cimmunoprecipitation flow cytometry Principles and guidelines for assessing physiologic protein protein interactions in multiprotein complexes Bida AT Gil D Schrum AG Methods 2012 Feb 56 2 154 60 doi 10 1016 j ymeth 2011 09 005 Epub 2011 Sep 16 PMID 21945581 IP FCM measures physiologic pr
71. ct DNA Hybridization Sequence Detection 0 0 enn nnn enn eet eee e ene t eben 98 Sele AVICIORI IE Fila Slotaarraaea tangs oh eae ee aa rberecaredee rekon aig Leek ye eer nase bere foe erhaaes aonb E EERE 104 Appendix A Common Buffers Used in XxMAP Protocols cs ss aitb ect danas Shake bide sawed Rowe ewe hoe wa tee eee Ne ky ERE T ee ae ea Ree ER 112 Appendix B Equipment Needed for xMAP Protocols 0 0 00 nen nnn n nnn e een een n eben nee Ebb ee Eee 114 Index Table of Contents www luminexcorp com Page 3 BR_574 01_0613 Chapter I Biological assays have evolved from relatively large volume reactions to smaller volume faster highly automated tests Whether in a test tube rack a microwell plate or a micro volume chip these may all be considered arrays of assays where different samples are physically separated from one another Since biological assays are typically coupled to a colorimetric readout the notion of multiplexing or reading multiple test results in a single sample volume has been complicated primarily by spectral overlap Color from one assay detection channel interferes with color in other detection channels This limitation has made such multi color assays useful only to a few analytes per sample While microarrays 2 dimensional solid arrays allow small volume assaying of physically separated features limitations such as slow solid phase kinetics instability of immobilized protein or nucleic acid cap
72. ct Hybridization Buffer and Reagent Recipes section Moss Inc SAPE O01G75 Life Technologies S 866 or equivalent BioRad MSP9601 Corning Costar 6509 BioRad MSA5001 Phenix Research products SMX CM Any suitable magnet Any suitable brand Any suitable brand USA Scientific or Equivalent Any suitable brand Any suitable brand Any suitable brand Any suitable brand Eppendorf 5704 or equivalent USA Scientific 9127 2940 Any suitable brand Luminex www luminexcorp com Page 99 BR_574 01_0613 Direct Hybridization Buffer and Reagent Recipes POCO ESE HEHE HOSE EE SEHHEE EHO OS HOEEESOHH EEE OOEE SHEE OE HOHE ESTOS EOS OOEOSEOHEES OSES HSEEEE SESE OSHS ESOS E ESSE ES OOSEEESHESEE SOOT OTHEE ESHEETS OOHEEHEEEE EE ESOEEDODEE Step Notes MagPlex Microspheres Required Microspheres regions should be purchased from Luminex and coupled with desired capture probes as outlined in the Nucleic Acid Coupling protocol Chapter 3 3 4 The coupled beads should be resuspended as recommended in the coupling protocol and stored at coupled with desired capture sequences A C in the dark For multiplex assays combine different coupled bead regions as indicted in the following Direct Hybridization Protocols 1 5X TMAC Hybridization solution The composition of this solution is 4 5 M TMAC Sigma T3411 0 1 Sarkosyl Sigma L7414 50 mM Tris and 4 mM EDTA The solution should be stored at room temperature 1X TMAC Hybridization
73. d in multiplex with the individual candidate detection antibodies and analytes This allows rapid identification of the best performing capture and detection antibody pair for a particular analyte J Figure 9 Lt T Both polyclonal and monoclonal antibodies can be used for detection but monoclonal antibodies should be specific for a different epitope than the capture antibody or can be used if they are directed to a repeating epitope on the analyte Detection antibodies are typically biotinylated to use with streptavidin R phycoerythrin SAPE as the reporter but detection antibodies may also be directly conjugated to PE which eliminates the need for a separate reporter labeling step in the assay protocol Chapter 3 4 1 Optimization of Immunoassays Ce ooo ooooooo ooololo l o Figure 9 Determining the best capture antibody and detection antibody by pairwise analysis Using a small test quantity of antibody and microspheres each candidate capture antibody is coupled to a separate microsphere and tested with target antigen and multiple candidate detection antibodies Because of xMAP multiplexing capabilities the above 16 reactions can be performed in 4 wells The best matched pair can easily be determined allowing the greatest assay sensitivity www luminexcorp com Page 29 BR_574 01_0613 General Immunoassay Tips POCO ESE HHH SESE EEE EEHEHEEE ESO ESHEETS OOH EEOOEE EO ESOEESOHHEE OSES EOS OOEOSEOHEE SOSH
74. decreasing the amount of capture reagent coupled to the microspheres While this may result in saturation at lower analyte concentrations and lower the maximum achievable signal it may improve linearity at low concentrations thus improving the limit of detection Fig 11A Figure 11 A Higher amount of capture antibody Lower amount of capture antibody 14000 z 140004 1 1o e 0 I e o o 0 e O gt D I I I I 2 l l lt Linear curve at lower 0 analyte concentation I o l 1 1 D e 5 1 L oO J 1 O 1 2 3 4 5 O 1 2 3 4 5 conc conc B Extended dynamic range with a muliplexed standard curve 14000 oO l l l l l I l 10 Bead o a 1 ge PP CC oo o e Bead 2 S o 0 o0 e Bead1 l e l p I 1 1 io I oO O 9 O 1 2 3 4 5 conc Antibodies with higher affinity can also improve sensitivity both as capture and detection reagents Higher signals and extended dynamic range at high analyte concentrations can be achieved by increasing the amount of capture reagent coupled to the microspheres Both high sensitivity and broad dynamic range can sometimes be achieved through coupling capture antibodies of different affinities to different microsphere color sets and combining them to create a multiplexed standard curve Fig 11B The same effect can be accomplished by coupling different concentrations of the same capture reagent to different microsphere color sets
75. dization to capture each assay product to a unique MagPlex bead For a complete list of the TAG and anti TAG sequences for each of the 150 available microspheres visit www uminexcorp com MagPlex and MagPlex TAG Microspheres are compatible with all Luminex instruments including MAGPIX up to 50 plex Luminex 100 200 up to 80 plex and FLEXMAP 3D up to 500 plex for MagPlex up to 150 plex for MagPlex TAG Basic Luminex equipment reagents include Calibration and Verification kits and Sheath or Drive Fluid They are also offered in a variety of custom volumes For additional information on all xMAP reagents contact your sales manager or visit http www l uminexcorp com Products ReagentsMicrospheres Depending on the type of multiplex assay you are developing certain additional reagents and equipment must be provided by you For a list of materials needed for typical assays see each specific protocol For a list of common buffers and equipment used in xMAP assays please see Appendices A and B Assays and protocols are described for MagPlex or MagPlex TAG Microspheres unless otherwise noted Chapter 3 2 Reagents and Equipment Note Bead colors are referred to as regions because beads are plotted in different regions of the bead map in the instrument software based on their dye ratios www luminexcorp com Page 10 BR_574 01_0613 Chapter 3 3 xMAP Microspheres beads require chemical coupling
76. e 30 cycles A C Hold 5 Proceed to hybridization with MagPlex TAG Microspheres using a wash or no wash protocol Hybridization to MagPlex TAG Microspheres wash protocol POCO HSS OHH EES OEE EE EEEHOE ESOT EO OHOO ESOS ESO OOE ES OEEOE OOOH OS ESESE SESE ESOS E SES OOSOT SEES ETOOEHOESOOEESEESOES EE SOOTESESES ES SOHT OO SSOS TEESE E OSES EESOOE TEESE EEE ESSE ESEOES Note Microspheres should be 1 Select the appropriate MagPlex TAG microsphere sets and resuspend protected from prolonged exposure to according to the instructions described in the Product Information Sheet light throughout this procedure provided with your microspheres beads 2 Combine 2500 microspheres of each set per reaction Note If needed an Excel based bead calculator is available for determining the method and volumes needed for making the bead mix Contact your Luminex representative or visit www luminexcorp com 3 Dilute concentrate the MagPlex TAG microsphere mixture to 100 of each microsphere set per uL in 2X Tm Hybridization Buffer and mix by vortex and sonication for approximately 20 seconds 4 Aliquot 25 uL of the MagPlex TAG microsphere mixture to each well 5 Add 5 to 25 uL of each OLA reaction to appropriate wells Note 1 5 uL is usually sufficient and add 25 uL of dH O to each background well 6 Adjust the total volume to 50 uL by adding the appropriate volume of dH O to each sample well that received less than 25 uL of OLA reaction 7 Cover th
77. e Eee HOE HOHE OOOO HOH OOOH OBE O HEHEHE OEE BO Chapter 3 3 4 Oligonucleotide Coupling Confirmation www luminexcorp com Page 27 BR_574 01_0613 Chapter 3 4 Once the best antibody pairs or nucleic acid reagent ratios are determined for each analyte assays should be combined into a multiplex and checked for cross reactivity at each step The multiplexed coupled microsphere bead set should be tested with each individual analyte and detection antibody or oligonucleotide target to evaluate performance and determine specificity Factors such as specific cross reactivity among individual assays non specific binding of other reagent components or interference of sensitivity due to excess non bound reagents may affect your multiplex assay Chapter 3 4 Optimization of Multiplex www luminexcorp com Page 28 BR_574 01_0613 Chapter 3 4 1 The first steps in optimizing an assay are to ensure that the optimum amount of capture molecule is bound to the microsphere bead and that capture reagent pairs allow maximum binding and detection capacity For capture sandwich immunoassays it is important to confirm that the pair of antibodies used bind to different epitopes One advantage of multiplexing is that it can facilitate the screening of candidate capture and detection reagents For example several different potential capture antibodies for a particular analyte can each be coupled to a different microsphere set and then teste
78. e hybridization buffer as the diluent At the 30 C HOLD pause the thermal cycler remove MicroSeal A and add 2 5 ul of diluted nuclease enzyme to each reaction while the plate remains in the cycler It is important that the enzyme is pipetted into the bottom of the tube not onto the walls After addition seal with new MicroSeal A film 8 Remove the plate briefly from the thermal cycler and mix well by gentle vortexing followed by a brief spin 1 to 2 seconds to bring the all contents down into the bottom of the wells 9 Return plate to the thermal cycler for the final step of 30 C for 30 minutes 10 Five minutes prior to the end of the 30 C step prepare a 1 500 dilution master mix of SAPE Calculate the volume by using 75 ul per well with an overage of 20 Example If 10 samples are tested make 10x75 ul of reporter solution plus 20 overage 900 ul Chapter 5 1 5 MicroRNA Analysis www luminexcorp com Page 108 BR_574 01_0613 11 12 13 14 15 16 17 18 12 20 21 22 23 24 Remove the reaction supernatant prior to the addition of SAPE as follows Place the plate on a magnetic separator Let the magnetic beads migrate for 2 minutes Remove MicroSeal A film With a multi channel pipette remove the fluid gently from the wells without disturbing the bead pellet Add 200 ul of wash buffer to each well and resuspend the beads by pipetting up and down 3 or 4 times Return the plate to th
79. e magnetic separator and again allow the microspheres beads to migrate and form a pellet for 2 minutes Again remove MicroSeal A film and remove the supernatant gently and carefully Add 75 ul of the diluted SAPE solution and mix by pipetting up and down several times Seal the plate with MicroSeal A film Shake the sealed plate on a plate shaker for 30 minutes at room temperature Shake at a speed that insures a mixing vortex is formed in each well Remove plate from plate shaker and place it on the magnetic separator allowing the microspheres to migrate for 2 minutes Remove all of the solution from the wells by pipetting without disturbing the pellet Add 200 ul of wash buffer to each well and resuspend the beads by pipetting up and down 3 to 4 times Return the plate to the magnetic separator and allow beads to migrate for 2 minutes and remove all the supernatant without disturbing the bead pellets Repeat steps 20 to 22 for another wash Remove plate form magnet and add 100 ul wash buffer and resuspend beads by pipetting up and down 3 to 4 times Caution Avoid making foam or bubbles Read the plate in a suitable Luminex instrument which has been adjusted for the type of plate used If you prefer you may transfer the 100 ul of bead suspension to a standard bead hybridization plate Corning Costar 6509 for analysis Recommendations for Optimization and Troubleshooting eecccce COPS EHHE EO OHHEEEEOEHEEHSEHEEOESOE ES OSEE EO OEEE
80. e microsphere surface lannone et al 2001 Drummond et al 2008 Gu et al 2008 Luminex recommends in the following order POCO E SHOOT EOE SOEESOHEEEEHOE SOE HOO TES OSH OES OEEE TOSSES OSES ESOOSTEETOOHTESEHOEESOHEOEHSOE EEO ESOES OSHS TES OSH OES OOHEE OSHS E HOES E ETHOS EE ETHOS ETESOSESOOH EE HSOEESESSOEESENES 1 Coupling the peptide to a carrier protein Conjugating your small molecule to a carrier protein such as bovine serum albumn BSA keyhole limpet hemocyanin KLH or thyroglobulin TG may be done using commercially available crosslinking reagents followed by coupling the modified capture moiety to the beads using our standard protein coupling protocol 2 Biotinylate the peptide and bind it to LumAvidin beads non magnetic Your capture peptide may be available in biotinylated form or may be easily modified using commercially available reagents In this case the detection reagent must be directly conjugated with PE 3 Modify the microsphere surface with adipic acid dihydrazide ADH or 4 4 N Maleimidophenyl butyric acid hydrazide hydrochloride MPBH and couple the peptide via carboxyl or sulfhydryl groups using EDC Other Coupling Moiety References POPP OHS EEE ELSE EEE EEE TEETH ESET EO EEEE EE EOE ETE EEEEHETEEEELEEEEE TOTO HOOT EH SOEEEEEEEEHEDETEDELELEEEELEEESEEEEEELEEEELELEEEELESEH EDEL EE ELE ELEE EO EOEEEESEEE EEE ESEEEEEEEE lannone M A Consler T G Pearce K H Stimmel J B Parks D J and G
81. e plate with MicroSeal A film to prevent evaporation and hybridize in a thermal cycler with the following parameters 96 C for 90 seconds 37 C for 30 minutes 8 Pellet the MagPlex TAG Microspheres by placing the plate on a magnetic separator for 30 to 60 seconds 9 After the beads have pelleted remove the supernatant being careful not to disturb the bead pellets 10 Resuspend the pelleted MagPlex TAG Microspheres in 75 uL of 1X Tm Hybridization Buffer on a magnetic separator for 30 to 60 seconds 11 After the beads have pelleted remove the supernatant being careful not to disturb the bead pellets Chapter 5 1 1 Oligo Ligation Assay OLA SNP Typing www luminexcorp com Page 82 BR_574 01_0613 12 13 14 15 Repeat steps 8 to 11 for a total of two washes Resuspend microspheres in 75 uL of 1X Tm Hybridization Buffer containing 2 8 ug mL SAPE Incubate at 37 C for 15 minutes Analyze 50 uL at 37 C on the Luminex analyzer according to the system manual Hybridization to MagPlex TAG Microspheres no wash protocol eecccce w NOMS 10 11 COCO EEE EHH EEE TEHE EES OEHEEHSEEEOTEOOE ES OHHEEOSOEH EOE OOE ETHOS HOSE E ESOS EHO E SEO E SHEETS HEHE E SESH SOHHEE ETOH EO SEOEESOSEEE HOOT ESEOEEEEHOETESEOE EES OOEEEESS Select the appropriate MagPlex TAG microsphere sets and resuspend according to the instructions described in the Product Information Sheet provided with your microspheres Note If needed an Excel b
82. e reaction plate at hybridization temperature for 5 minutes Analyze 50 uL at hybridization temperature on the Luminex analyzer according to the system manual Protocol 5 1 4 2 Direct DNA Hybridization Washed Protocol 10 11 12 13 14 15 16 Select the appropriate oligonucleotide coupled microsphere sets Resuspend the microspheres by vortex and sonication for approximately 20 seconds Prepare a Working Microsphere Mixture by diluting coupled microsphere stocks to 76 microspheres of each set uL in 1 5X TMAC Hybridization Solution Since 33 uL of Working Microsphere Mixture is required for each reaction this will provide about 2 500 beads of each region reaction Mix the Working Microsphere Mixture by vortex and sonication for approximately 20 seconds To each sample or background well add 33 uL of Working Microsphere Mixture To each background well add 17 uL TE pH 8 To each sample well add volumes of labeled target reaction and TE pH 8 0 to a total volume of 17 uL Note for most assay chemistries 2 5 uL of a robust PCR or labeled target reaction will be sufficient for detection Mix reaction wells gently by pipetting up and down several times Cover the plate to prevent evaporation and hybridize in a thermal cycler with the following parameters 95 C for 5 minutes denaturation step 45 to 60 C for 15 to 20 minutes hybridization step During the hybridization incubation prepare fresh Reporter Mix by dil
83. e reversed with the antigen attached to the microsphere and the antibody labeled Format 2 In this case the analyte in the sample competes away the labeled antibody in solution rather than on the surface of the microsphere This assay is useful for smaller protein analytes lt 3 4 kD with only a single or very few epitopes or when only a single antibody is available The general steps to performing this type of assay on xMAP Technology are as follows Summary of Protocol Format 1 Add capture anti Add antigen containing Add labeld antigen body coupled sample microspheres Wash microspheres w Read 50 uL on Assay Buffer Luminex analyzer Chapter 4 1 2 Competitive Immunoassay www luminexcorp com Page 47 BR_574 01_0613 For competitive immunoassays the higher the sample target concentration the weaker the eventual signal The major advantage of a competitive immunoassay is the ability to use crude or impure samples and still selectively bind any target that may be present Technical Notes POPPE HELO E EEE SEEEE HOLE ESOT E EEE EEE HO SEOHELEOEE ES EOEO EE EOOE OE EOOE TEESE ELOTOEESOEEEHOOEETOLOTO EE SOEHHEEEEETELEHOHE LETHE EEEEEEEOEEETHSEHEETEEESOLELEEEELESEEDELESEOREEEOES For Competitive Immunoassay format we recommend testing a range of competing analyte 0 2 to 5 ug with increasing concentrations of antibody The antibody concentration that yields 70 80 of the maximum signal should provide the largest linea
84. eference on page 19 Summary of Protocol Add microspheres to Add detection antibody Incubate for reaction tube 30 minutes Read 50 75 uL on Luminex analyzer Wash and resuspend microspheres with Assay Buffer 2x Materials Needed Reagents and Consumables MagPlex Microspheres antibody coupled Assay Wash Buffer PBS 1 BSA PBS BN buffer PBS TBN buffer 96 well plate PE or Biotin labeled anti species detection Antibody streptavidin R phycoerythrin SAPE 1 5 mL microcentrifuge tubes Disposable pipettes tips Distilled deionized water ddH O 1 Also used as assay buffer 2 Also used as wash buffer Vendor For CoR equipment ana materials list see Appendix B Sigma P3688 Sigma P3813 Sigma A7888 Sigma P9416 Sigma P3813 See Appendix B Any suitable source Moss SAPE 001G75 Life Technologies S 866 or equivalent USA Scientific 1415 2500 or Eppendorf Lo Bind 022431081 Any suitable brand Any suitable source esccoecocsocsocsocsoooococooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooo ooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooloo o Chapter 3 3 2 Antibody Coupling Confirmation www luminexcorp com Page 16 BR_574 01_0613 A protocol for verifying antibody coupling is provided below A dose response increase in MFI should be observed as concentration of labeled detection antibody increases In general an antibody coupling sho
85. ent to the LoD or it could be at a much higher concentration Chapter 3 4 1 Optimization of Immunoassays www luminexcorp com Page 33 BR_574 01_0613 Targets LLoQ ULoQ Ko D Intra assay inter assay CV CV a OOO OOO O O OOOO O a Ja p e o ae faa pess os de oo Oo The assay results above are sensitive accurate and precise The LLoQ and ULoQ values define the working assay range accuracy 80 120 recovery and precision lt 10 intra assay CV The LoD is defined here as the lowest measurable concentration obtained at the MFI of 3 replicate wells for 8 standard points The inter assay CV is measured from the CV of observed concentrations of 8 standard points for 3 independent assays Precision Intra assay and inter assay reproducibility should be determined in sample diluent NOTE Intra Inter assay CV may vary between site user and assay The following can be used as guidelines Within assay working range Intra assay CV lt 10 is usually acceptable A minimum of 3 separate runs should be performed to determine the intra assay precision The intra assay precision should be calculated from a minimum of 2 replicates at each of 2 spiked concentrations Inter assay CV lt 20 is usually acceptable A minimum of 5 separate runs should be performed to determine inter assay precision NOTE LLoQ may vary between site user and target analyte For additional examples calculations and information refer to the f
86. equisites for cytokine measurements in clinical trials with multiplex immunoassays BMC Immunology 2009 10 U1 U11 Dernfalk J Waller K P and Johannisson A Commercially available antibodies to human tumour necrosis factor tested for cross reactivity with ovine and bovine tumour necrosis factor using flow cytometric assays Acta Vet Scand 2004 45 99 107 Dernfalk J Waller K P and Johannisson A The xMAP technique can be used for detection of the inflammatory cytokines IL 1 IL 6 and TNF bovine samples Vet Inmunol Immunopathol 2007 118 40 9 Faucher S Crawley A M Decker W Sherring A Bogdanovic D Ding T Bergeron M Angel J B and Sandstrom P Development of a quantitative microsphere capture assay for soluble IL 7 receptor alpha in human plasma PLoS One 2009 4 U66 U71 Lawson S Lunney J Zuckermann F Osorio F Nelson E Welbon C Clement T Fang Y Wong S Kulas K and Christopher Hennings J Development of an 8 plex Luminex assay to detect swine cytokines for vaccine development Assessment of immunity after porcine reproductive and respiratory syndrome virus PRRSV vaccination Vaccine 2010 28 5356 64 Ray C A Bowsher R R Smith W C Devanarayan V Willey M B Brandt J T and Dean R A Development validation and implementation of a multiplex immunoassay for the simultaneous determination of five cytokines inh
87. er Oligo coupling wash buffer Oligo coupling wash buffer Microsphere coupling activation General purpose nucleic acid buffer xTAG DNA hybridization reactions xTAG labeling and wash buffer Direct DNA hybridization microsphere diluent Source Sigma S3139 Sigma M2933 Sigma P3813 Sigma P3563 Sigma P3688 Sigma S8032 Sigma P3813 Sigma A7888 Sigma P9416 Sigma 58032 Sigma P3688 Sigma M2933 Sigma P9416 Sigma L4522 Pierce 7 149 Sigma T9285 Sigma T3411 Sigma L7414 Sigma T3038 Invitrogen 15575 020 Adjust to pH 6 2 with 5 N NaOH Filter sterilize Store at 4 C Adjust to pH 5 0 with 5 N NaOH Filter sterilize Store at 4 C Filter sterilize Store at 4 C Filter sterilize Store at 4 C Filter sterilize Store at 4 C Filter sterilize Store at 4 C Filter sterilize Store at 4 C Adjust pH w 5N NaOH Filter sterilize Store at 4 C Filter sterilize Store at room temperature Filter sterilize Store at room temperature Store desiccated at 20 C Filter sterilize Store at room temperature Filter sterilize Store at 4 C Filter sterilize Store at 4 C Filter sterilize Store at room temperature www luminexcorp com Page 112 BR_574 01_0613 1 Activation can be performed in 50 mM MES pH 6 0 6 2 with similar results 2 Coupling can be performed in 100 mM MES pH 6 0 with similar results For some proteins better solubility and better c
88. erated and captured bead a minimal or background signal is detected Chapter 3 1 Assay Design www luminexcorp com Page 9 BR_574 01_0613 Chapter 3 2 The newest generation of xMAP beads are MagPlex Microspheres beads which are superparamagnetic microspheres 6 5 microns in diameter These beads are impregnated with different ratios of two or three dyes allowing the generation of 500 different bead regions for the development of assays up to 500 plex The surface of these beads are also impregnated with iron containing magnetite particles This feature allows the use of magnets to rapidly remove the beads from reaction suspensions to speed up processing during different protocols and minimize bead loss resulting in more reproducible data generation MagPlex Microspheres should be purchased from Luminex They should be stored at 4 C and be kept in the dark They can be used directly from their vials as described in the coupling protocol MagPlex Microspheres are available at concentrations of 2 5 million and 12 5 million beads mL and can be ordered in ImL and 4mL vial sizes MagPlex TAG Microspheres are MagPlex beads covalently coupled with unique 24 base oligonucleotide anti TAG sequences These beads enable the user to quickly and easily design custom bead arrays simply by adding a complementary TAG sequence to primers or probes used in assay reactions and then using the TAG anti TAG hybri
89. es OLA primers can be ordered from several oligo manufacturers Upon receipt they should be resuspended in molecular grade ddH O to 1mM 1 nanomole uL Make a 100 nM OLA TAG probe mix by combining and diluting each 1 mM stock 1 10 000 into one tube with molecular grade ddH O Make a 5 uM OLA reporter probe mix by combining and diluting each 1 mM stock 1 200 into one tube with molecular grade ddH O Individual stocks and probe mixes should be stored at 20 C 1 OLA probes should be synthesized for all sequence variants and all OLA TAG and OLA reporter pairs for each target should be from the same DNA strand 2 OLA probes should be matched for melting temperature at 51 56 C 3 OLA TAG probes should extend out to and include the SNP as the 3 nucleotide 4 Use oligo design software to select an appropriate TAG sequence 5 The OLA TAG probe is synthesized with the TAG sequence incorporated at the 5 end 6 The OLA reporter probe should have a melting temperature of 51 DOC 7 The OLA reporter probe s 5 base should be the nucleotide immediately downstream from the SNP variant nucleotide 8 The OLA reporter probe must be modified with phosphate at the 5 end and with biotin at the 3 end 9 If two SNPs are close enough so that OLA TAG and reporter probes overlap target the second SNP on the opposite strand These can be purchased from several vendors such as Life Technologies 10297 018 A 25 mM stock mix can be made
90. es with MPBH 4 4 N Maleimidophenyl butyric acid hydrazide hydrochloride MPBH is a suitable chemical spacer for extending the peptide away from the surface of xMAP Microspheres beads for optimum reactivity with sample and reagents MPBH provides an 8 atom spacer with a reactive maleimide group for coupling to cysteine sulfhydryls A sample protocol for modifiying xMAP Microspheres with MPBH is described below Summary of Protocol Add uncoupled Wash microspheres w Add MPBH microspheres buffer Add EDC Incubate 1 hour Wash and resuspend gt microspheres w buffer Materials Needed Reagents and Consumables Vendor For complete equipment and materials list see Appendix B MagPlex Microspheres Luminex 4 4 N Maleimidophenyl butyric acid hydrazide hydrochloride Pierce 22305 MPBH 0 1M MES pH 6 0 Sigma M2933 DMSO Any suitable source 1 Ethyl 3 3 dimethylaminopropyl carboiimide hydrochloride EDC Pierce 77149 0 1 M MES pH 4 5 Sigma M2933 1 5 mL microcentrifuge tubes USA Scientific 1415 2500 or Eppendorf Lo Bind 022431081 Disposable pipettes tips Any suitable brand Distilled deionized water ddH O Any suitable source Chapter 4 2 4 Coupling Peptides with MPBH www luminexcorp com Page 65 BR_574 01_0613 Protocol 4 2 4 Modification of microspheres with MPBH maleimide COCO ESE HEHE TOO HOE EES OEHE SESE EE SESE TOES H EE ESEOE EOS OOHE SHOE HOES EEESOEEEETOOEESEOE EES OHHESHSEOEE SESE ETOH HETOSOOTE STOO ETH
91. esh by making a 1 100 dilution of this 1 uM probe mix with hybridization buffer to bring the probe mix to the 10 nM concentration This working dilution is the Chimeric Probe mix that is used at 1 25 ul reaction as described in the protocol Chapter 5 1 5 MicroRNA Analysis www luminexcorp com Page 106 BR_574 01_0613 Hybridization and wash buffer MagPlex TAG Magnetic bead mixes Samples Requirements for the assay Chapter 5 1 5 The same buffer is used for hybridization to Luminex beads and washes It is a pH 7 7 buffer consisting of 10 mM Tris 200 mM sodium acetate 5mM EDTA and 0 05 Tween 20 This buffer can be made from 3M sodium acetate stock solution a 0 5 M EDTA solution pH 8 0 a 1M Tris pH 7 5 and a 10 Tween 20 solution with a final adjustment to the proper pH as needed Filters sterilize and store at Ae Pre defined MagPlex TAG bead mixes come in a concentration of 2 5 x10 beads per region per mL Since each region should contribute 1 000 beads per reaction 0 4 ul of the bead stock would be needed for each reaction and can be diluted into a maximum volume of 4 0 ul see protocol Creation of a master mixture that is added as 4 0 ul reaction to deliver 1 000 beads rxn for each region can be made as follows assuming the bead stock purchased has all the bead regions required for the assay Multiply the number of samples by 0 4 ul For example if 100 samples are to be tested this would be 40 0 ul of be
92. esuspend stock ADH modified microsphere suspension by vortex and i ia eee ae throughout this procedure sonication 15 30 seconds 2 Remove an aliquot of 25 x 10 ADH microspheres and pellet by centrifugation at gt 8000 x g 1 2 minutes or by using a magnetic separator and remove Supernatant 3 Wash once with 1mL 0 1 M MES pH 6 0 and pellet by centrifugation at gt 8000 x g 1 2 minutes or by using a magnetic separator and remove supernatant and resuspend ADH microspheres in 100 uL 0 1 M MES pH 6 0 vortex 4 Add 250 ug protein to ADH microspheres and adjust volume to 500 uL with 0 1 M MES pH 6 0 5 Add 50 uL 200 mg mL EDC prepared immediately before use in 0 1 M MES pH 6 0 vortex 6 Incubate 2 hours at room temperature with rotation protect from light 7 Pellet by centrifugation at 2 8000 x g 1 2 minutes or by using a magnetic separator and remove supernatant Resuspend coupled microspheres in 1 mL PBS pH and vortex 8 Pellet by centrifugation at 2 8000 x g 1 2 minutes or by using a magnetic separator and remove supernatant wash twice with 1 mL PBS TBN 9 Resuspend coupled microspheres in 1 mL PBS TBN 10 Count microsphere suspension by hemacytometer Calculation Total microspheres count 1 corner 4x4 section x 1 x 10 x dilution factor x resuspension volume in mL Chapter 4 2 3 Peptide Coupling to ADH Modified Microspheres www luminexcorp com Page 64 BR_574 01_0613 Chapter 4 2 4 Coupling Peptid
93. ette to carefully aspirate the supernatant from each well Take care not to disturb the microspheres 11 Leave the plate in the magnetic separator for the following wash steps a Add 100 uL Assay Buffer to each well b Use a multi channel pipette to carefully aspirate the supernatant from each well or use the manual inversion wash method Take care not to disturb the microspheres c Repeat steps a and b above 12 Remove the plate from the magnetic separator and resuspend the microspheres in 50 uL of Assay Buffer by gently pipetting up and down several times using a multi channel pipettor 13 Dilute the biotinylated detection antibody to 4 ug mL in Assay Buffer Note 50 ul of diluted detection 14 Add 50 uL of the diluted detection antibody to each well i l oe l l l antibody is required for each reaction 15 Mix the reactions gently by pipetting up and down several times with a multi channel pipettor 16 Cover the plate and incubate for 30 minutes at room temperature on a plate shaker set to approximately 800 rpm 17 Place the plate into the magnetic separator and allow separation to occur for 30 60 seconds 18 Use a multi channel pipette to carefully aspirate the supernatant from each well Take care not to disturb the microspheres 19 Leave the plate in the magnetic separator for the following wash steps a Add 100 uL Assay Buffer to each well b Use a multi channel pipette to carefully aspirate the supernatant from each well or u
94. f Working Microsphere final concentration of 50 microspheres of each set uL in PBS 1 BSA 3 Resuspend the microspheres by vortex and sonication for approximately 20 seconds Aliquot 50 uL of the working microsphere mixture into the appropriate wells Add 50 uL of diluted controls and diluted samples to the appropriate wells If available add 50 uL of standard to the appropriate wells Cover the plate to protect it from light and incubate for 60 minutes at room temperature on a plate shaker set to approximately 800 rpm 8 Place the plate into the magnetic separator and allow separation to occur for 30 60 seconds Carefully remove the supernatant from each well by magnetic plate separator using either manual inversion manual pippetting or magnetic plate washer Take care not to disturb the microspheres Add 100 uL of Wash Buffer PBS TBN to each reaction well 9 Repeat step 8 once more for a total of two washes 10 Remove the plate from the magnetic separator and add 100 uL of detection antibody to each well of the plate 11 Cover the plate to protect it from light and incubate for 30 minutes at room temperature on a plate shaker set to approximately 800 rpm 12 Place the plate into the magnetic separator and allow separation to occur for 30 60 seconds Carefully remove the supernatant from each well by magnetic plate separator using either manual inversion manual pipetting or magnetic plate washer Take care not to disturb
95. ferent genes and organisms Francis DM 2012 Koo Ong et al 2007 Li Luo et al 2011 Li Jortani et al 2011 Marcil Sinnett et al 2012 Figure 15 ASPE mechanism A A a 3 OD dATP dTTP dGTP 5 3 dcTP OY Na 5 B EE a N N D G 5 3 dATP dTTP dGTP a acTP xv 5 The chemistry takes advantage of a primer s ability to act as a suitable primer for a DNA polymerase when the probe 3 base is complementary to the target SNP s base Figure 15A When a probe 3 base is complementary the polymerase can use it to synthesize new DNA containing biotin labeled nucleotides but a primer cannot promote this extension if its 3 base is mismatched Figure 15B With several rounds of primer extension significant quantities of labeled molecules are produced to generate the signals required for analysis of multiple genotypes in one reaction To take advantage of this chemistry with the xMAP platform each ASPE primer that identifies a SNP variation needs a unique TAG sequence on its 5 end Figure 15 In addition for each SNP gDNA targets containing SNPs of interest must be amplified before testing with ASPE probe mixes This is achieved using standard multiplex PCR amplification methods Figure 16 Target genomic amplicons can be of various sizes containing multiple SNP targets This combination of gDNA target amplification primer function for variant detection and m
96. h region reaction 4 Mix the Working Microsphere Mixture by vortex and sonication for approximately 20 seconds 5 To each sample or background well add 33 uL of Working Microsphere Mixture 6 To each background well add 17 uL TE pH 8 7 To each sample well add volumes of labeled target reaction and TE pH 8 0 to a total volume of 17 UL 8 Mix reaction wells gently by pipetting up and down several times 9 Cover the plate to prevent evaporation and hybridize in a thermal cycler with the following parameters 95 C for 5 minutes denaturation step 45 to 60 C for 15 to 20 minutes hybridization step 10 During the hybridization incubation prepare fresh Reporter Mix by diluting SAPE to 6 24 ug mL in 1X TMAC Hybridization Solution to provide a final SAPE concentration of 2 8 ug mL 11 Add 25 uL of Reporter Mix to each well and mix gently by pipetting up and down several times Chapter 5 1 4 Direct DNA Hybridization Sequence Detection Note If needed an Excel based bead calculator is available for determining the method and volumes needed for making the Working Microsphere Mixture Note for most assay chemistries 2 5 uL of a robust PCR or labeled target reaction will be sufficient for detection Note Use the optimum hybridization temperature for the target sequences in the mix Note 25 uL of Reporter Mix is required for each reaction www luminexcorp com Page 100 BR_574 01_0613 12 13 Incubate th
97. he same multiplex assay may be abundant and therefore require a lower sensitivity assay Sensitivity of each antibody assay may be affected by the affinity of the capture antibody the abundance of the capture antibody and the amount of capture beads used for that analyte Chapter 3 1 Assay Design www luminexcorp com Page 8 BR_574 01_0613 Figure 3 Figure 3 Common assay formats for immunoassays include A capture sandwich assay requiring capture and detection antibodies to your analyte target polyclonal capture antibodies should be purified and mono specific B competitive antibody assay requiring a single antibody and a labeled positive target and C indirect assay or serology assay requiring both a target protein and an anti antibody A Capture Sandwich Competitive Assay Indirect Serological Assay A second consideration for polystyrene microsphere based immunoassays is the biological matrix and non specific binding Serum samples typically have extraneous proteins that may non specifically bind to polystyrene and other materials x MAP Microspheres beads are polystyrene beads that appear relatively smooth under a microscope but on a molecular level have irregular porous surfaces Microsphere pores range in size from 100 to 2000 angstroms allowing them to trap proteins which typically range from 50 to 100 angstroms in diameter Microsphere assays can employ blocking agents optimized for each bio
98. hen using peptides to measure enzymatic reactions a buffer optimal for that assay would be required Do you have any recommendations for labeling proteins Reagents may be ordered with reporter fluorophores directly labeled e We have had success labeling proteins with phycoerythrin using PhycoLink kits from Prozyme http www prozyme com Coupling Polysaccharides POPPE EEE EEE EE EEE HEE EEEE TOOT SEH O EEE EEEOEH TE EEE EH ESEEOEEOEE OEE EEEETOEESE EE EOEE SE EOEE HOLES EESEEOEEEEEH ES EEEEH EE EOEEETEEESEREEETE LETS ELOEEEEEELOEH ODE LOEE DED ESE EEO E EEE For information regarding the coupling of polysaccharides to microspheres please refer to the following publication Pickering J W T B Martins R W Greer M C Schroder M E Astill C M Litwin S W Hildreth and H R Hill 2002 A multiplexed fluorescent microsphere immunoassay for antibodies to Pneumococcal capsular polysaccharides American Journal of Clinical Pathology 117 589 596 Biagini RE Schlottmann SA Sammons DL Smith JP Snawder JC Striley CA MacKenzie BA Weissman DN Method for simultaneous measurement of antibodies to 23 pneumococcal capsular polysaccharides Clin Diagn Lab Immunol 2003 10 744 750 Schlottmann S Jain N Chirmule N Esser M 2006 A Novel Chemistry for Conjugating Pneumococcal Polysaccharides to Luminex Microspheres Journal Of Inmunological Methods 309 75 85 Alternatives to BSA for blocking
99. imately one and one half times the concentration of the detection antibody When using streptavidin R phycoerythrin SAPE at concentrations gt 8 ug mL final concentration in a no wash format a dilution or wash step may be required to minimize background fluorescence prior to analysis on the Luminex instrument Materials Needed For complete equipment and Reagents and Consumables Vendor materials list see Appendix B MagPlex Microspheres antigen coupled Assay Wash Buffer PBS 1 BSA Sigma P3688 PBS BN buffer Sigma P3688 PBS TBN buffer Sigma P3813 Sigma A7888 Sigma P9416 96 well plate See Appendix B PE or Biotin labeled Detection Antibody Any suitable source streptavidin R phycoerythrin SAPE Moss SAPE 001G75 Life Technologies S 866 or equivalent 1 5 mL microcentrifuge tubes USA Scientific 1415 2500 or Eppendorf Lo Bind 022431081 Disposable pipettes tips Any suitable brand Distilled deionized water ddH O Any suitable source 1 Also used as assay buffer 2 Also used as wash buffer Chapter 4 1 3 Indirect Serological Immunoassay www luminexcorp com Page 52 BR_574 01_0613 Protocol 4 1 3 Indirect Serological Immunoassay Note Microspheres should be 1 Dilute samples and controls using diluent for example dilute 1 to 500 ea 2 Select the appropriate antigen coupled microsphere mixture Prepare a Working Microsphere Mixture by diluting the coupled microsphere stocks to a Note 50 uL o
100. ing typically used for direct hybridization assays Note Microspheres should be protected from prolonged exposure to light throughout this procedure Note Coupling confirmation should be performed at the anticipated assay hybridization temperature www luminexcorp com Page 23 BR_574 01_0613 Figure 7 Typical results of an oligonucleotide coupling reaction Oligonucleotide Hybridization 20000 15000 we a 12500 10000 5000 Net Median Fluorescence 7500 y f 2000 J O 25 50 Us 100 125 150 175 200 225 fmol Complementary Oligo Recommendations for Optimization and Troubleshooting Probe Design Strategy 1 All probes should be exactly the same length per target sequence using TMAC hybridization buffer 2 For detection of point mutations use probes between 18 and 24 nucleotides in length 20 nucleotides is a good starting point 3 If point mutations or SNPs are expected in a sequence they should be positioned at the center of the probe sequence i e position 10 or 11 for a 20 nucleotide probe Multiple polymorphisms should be equally spaced throughout the probe sequence Point mutations may be positioned off center if necessary to prevent secondary structure in probe sequence Usually adequate specificity can be achieved if a point mutation is at nucleotide position 8 14 in a 19 or 20 nucleotide probe 4 Probes should be synthesized for all sequence variants Call mutant and wild type sequences
101. ing buffers has proven to be a good alternative to other buffer systems Dunbar and Jacobson 2007 Oehrmalm Jobs et al 2010 Oehrmalm Eriksson et al 2012 This protocol outlines a TMAC based hybridization procedure that can be used for these types of direct hybridization assays as well as other applications Chapter 5 1 4 Direct DNA Hybridization Sequence Detection www luminexcorp com Page 98 BR_574 01_0613 Materials Needed Reagents and Consumables MagPlex Microspheres oligo coupled 1 5X TMAC Hybridization solution 1X TMAC Hybridization solution TE pH 8 0 streptavidin R phycoerythrin SAPE 96 well PCR Plate 96 well Bead Hybridization Plate optional MicroSeal A Silicon Mat Magnetic separation plate Disposable pipette tips multi and single channel 2 1000 mL 25mL reservoirs divided well RNase DNase Free Microcentrifuge Tubes 1 5 ml Barrier Pipette Tips Vortex Mixer Microcentrifuge Bath Sonicator 40 55 kHz frequency waves Centrifuge with Microplate Swinging Bucket Rotor Brayer roller soft rubber or silicon Thermocycler with 96 well Head and Heated Lid Luminex Instrument with xPONENT 3 1 or higher software Chapter 5 1 4 Direct DNA Hybridization Sequence Detection For complete equipment and Vendor aa materials list see Appendix B See Direct Hybridization Buffer and Reagent Recipes section See Direct Hybridization Buffer and Reagent Recipes section See Dire
102. ion 1 Increase the ASPE annealing temperature 2 Redesign the ASPE primers for the opposite DNA strand 3 Shorten the leaky ASPE primer Chapter 5 1 2 Allele Specific Primer Extension ASPE SNP Typing www luminexcorp com Page 91 BR_574 01_0613 Poor Reporter Distribution Between Alleles Redesign the ASPE primers for the opposite DNA strand 2 Lengthen the ASPE primer to increase signal on the low allele 3 Shorten the ASPE primer to decrease signal on the high allele High Background 1 1 If not using SAPE already containing BSA i e Moss SAPE 001G75 dilute SAPE in 1X Tm buffer containing BSA Final BSA concentration in the reaction should be 0 1 BSA in the reaction 2 If high background is observed for the PCR negative control verify performance of the Exo SAP step 3 Ifthe high background is due to contamination of the PCR reaction replace the PCR reagents 4 f high background is observed for the hybridization negative control replace the hybridization reagents 5 If high background is observed for the ASPE negative control replace the ASPE reagents References Francis DM 2012 DNA Sequence Variation SNP Genotyping Using Allele Specific Primer Extension ASPE with the Luminex platform The Ohio State University web site at http www extension org pages 32476 dna sequence variation snp genotyping using allele specific primer extension aspe with the luminex pl Koo S T
103. ion of three essential assay characteristics 1 Use of MagPlex TAG microsphere beads mixes Users can create their own mixes as needed These magnetic beads are available from Luminex with unique TAG sequences already coupled to them These sequences are universal array sequences that do not cross hybridizing with each other or with any known sequence in the biome 2 Biotin labeled chimeric probes These are composed of RNA sequences that are 100 complementary to their mature miRNA targets anda DNA sequence which is 100 complementary to specific anti TAG sequences on the MagPlex TAG Microspheres beads The probes can be easily designed by the user making the assay more cost effective and flexible to meet the user s needs 3 Nuclease protection chemistry This chemistry when combined with the assay s step down hybridization protocol results in single base resolution of nucleotide differences even with miRNA species that cannot be distinguished with other chemistries This combination of characteristics also contributes to the assay having a short 1day protocol without sacrificing single nucleotide specificity even without PCR amplification Sorensen 2011 This is achieved by the ability of the biotinylated chimeric probes to specifically bind their miRNA targets in a short period of time with the protocol s step down hybridization approach The chimeric probe miRNA complexes are then rapidly captured on MagPlex TAG
104. ions are selected based on your particular bead mix 5 Beads shifting out of region in the bead map on the Luminex instrument Ensure hybridization buffer wash made properly and washes if any are performed thoroughly Make sure the bead solution is stored in the dark at 4 C to prevent photo bleaching References POPC SEES E SEES ETOEE HEE EEEE ESET HO EEEH OE HOEHTEEEEEHELETOEEOEE EEE EEEETOEESE TESOL SE EEEE HO SEEH EE OEEOEH EEE OE EEE EL ETEEEEEEESEEEEEEE LENSE OEEEELELOEH OE LEEE EE LES EEE OEE EE Dunbar S and J Jacobson 2007 Quantitative Multiplexed Detection of Salmonella and Other Pathogens by Luminex xMAP Suspension Array Methods Molecular Biology 394 1 19 Itoh Y N Mizuki T Shimada F Azuma M Itakura K Kashiwase E Kikkawa J K Kulski M Satake and H Inoko 2005 High throughput DNA typing of HLA A B C and DRB1 loci by a PCR SSOP Luminex method in the Japanese population Immunogenetics 57 10 717 729 Oehrmalm C R Eriksson M Jobs M Simonson M Stromme K Bondeson B Herrmann A Melhus and J Blomberg 2012 Variation Tolerant Capture and Multiplex Detection of Nucleic Acids Application to Detection of Microbes Journal Of Clinical Microbiology 50 10 3208 3215 Oehrmalm C M Jobs R Eriksson S Golbob A Elfaitouri F Benachenhou M Stromme and J Blomberg 2010 Hybridization properties of long nucleic acid probes for detection of variable ta
105. iplex titration of IL 4 IL 6 and IL 8 Multiplexed Analytes with multiplex reporter antibodies i e Detection Detection Detection Multiplexed Detection Multiplexed Detection the full multiplex reaction IL 4 IL 6 IL 8 IL 4 IL 6 IL 8 IL 4 IL 6 IL 8 ae Test 1 is for individual analytes and corresponding reporter antibodies to determine if analytes cross react with non target beads Test 2 is for individual analytes and multiplexed detection antibodies to determine if reporter antibodies cross react with non target analytes Test 3 is for multiplexed analytes and multiplex detection antibodies to determine sensitivity and to confirm there is no cross reactivity in the complete assay Each test should be run as a standard curve with a blank and 7 concentrations of analyte as shown in the dilution table below Chapter 3 4 1 Optimization of Immunoassays www luminexcorp com Page 32 BR_574 01_0613 Three Fold Serial Dilution of Individual and Multiplexed Cytokines Tube IL 4 pg ml IL 6 pg ml IL 8 pg ml IL 4 IL 6 IL 8 pg ml 3333 3 3333 3 3333 3 3333 3 e fe qe qe w Replace any reagents that show interference cross reactivity or poor performance and determine the optimal sample and reaction volumes microspheres per reaction within the range of 2000 5000 microspheres per region incubation times detection antibody and reporter concentrations coupling amount for capture reagents and assay format wa
106. king agents sample volume and dilution total reaction volume number of microspheres per reaction 2000 5000 per region per well concentration of capture reagent for coupling detection antibody and reporter concentration assay format washed vs unwashed and incubation times are optimized to provide best results according to the specific assay requirements and the performance is evaluated and validated with known samples Concentrated biological samples and samples of a highly complex nature such as serum plasma or tissue lysates should be diluted at least 1 5 to prevent interference or microsphere agglutination from matrix effects Any reagents that show interference cross reactivity or poor performance should be replaced Chapter 3 4 1 Optimization of Immunoassays www luminexcorp com Page 37 BR_574 01_0613 Chapter 3 5 After confirmation of successful coupling and sufficient signal from a multiplex assay microspheres beads should be further tested with standard or control materials These are often recombinant proteins as known positive and negative samples Protein samples should be prepared in the appropriate sample matrix to match the composition of the test samples as closely as possible Chapter 3 5 Assay Validation www luminexcorp com Page 38 BR_574 01_0613 Chapter 3 5 1 Spike and recovery immunoassay sample validation protocol POPP oH P ESE EEL SE EEE ELLE TEETH SETH OEEEHEETEEESEEEEEHEEE
107. ldehyde can usually be used to stop reactions in microsphere assays The final concentration should be less than 1 We recommend testing it with a small sample of beads coupled to reagents before incorporating it fully into the procedure How much should you increase the amount of PE when converting from monoplex to multiplex PCOS OHS EEE H OEE EEEEHEEE SHOE EOS HOE EES OOHEE ESOS SEES ESOS ESOS TOTO SESH EE SOSH EH EEEE ES ESOEE TOTES E SOOO ESOT SHOE OSH HSEE ESOS EOTEEEE TESTES OOHEEEEEE EEE ESOEED ODES Use cumulative concentration of simplex assay e There is no prescribed ratio of biotin to SA RPE concentration because the extent of biotinylation of detection antibodies is usually not known Titration is recommended More PE must be added for no wash than wash What does it mean when there is a high RP1 peak in the zero bin of the histogram POCO ESE HHH EEE OEEHEEHEHEE SOHO OSTEO OSEOHEE HOES SEES HOHE EE SEOS TOTO OS HOHEE SOTHO E OOOH E SESE EO OHEOSE ETOH EO SOOHESOOEEE HOES EE SOOT E OTHE TO SEH ESOEHEE TEESE EESOEES ODES e This may occur in no wash assays where the RP1 signal on the bead is less than the background signal The Background Subtract algorithm of the software takes a background reading before and after each bead f the amount of fluorescence present in solution is greater than the fluorescence on the beads themselves zero values will be reported This can be corrected by reducing the a
108. leaching Chapter 5 1 5 MicroRNA Analysis www luminexcorp com Page 110 BR_574 01_0613 Low Specificity 1 Wrong concentration of Probe Mix in the reactions Make sure the Probe Mix dilution is prepared correctly 2 Pipetting errors Verify that pipettes are calibrated and volumes measured are accurate Low Sensitivity 1 RNA concentration not correct or RNA degraded Verify that the RNA concentration not too high or too low and that the RNA is not degraded Carryover contamination Make sure you carefully perform the manual washes to avoid sample transfer mistakes or carryover contamination While removing plate sealers make sure well contents do not splash over adjacent wells Chimeric probe hybridization to RNA needs to be optimized Probe concentration or hybridization temperatures need to be adjusted A chimeric probe titration series and different probe hybridization step down temperature range may need to be tested Chimeric probe sequences not accurate Make sure the chimeric probe sequences are the correct reverse compliment to the target RNA sequence Use the Excel based FlexmiR 200 Chimeric probe design tool for proper probe design Contact your Luminex representative or visit www luminexcorp com Bead hybridization temperature too high or low A temperature gradient may be needed to determine the optimum bead hybridization temperature References Cascione L P Gasparini F Lovat S Carasi A Pulviren
109. logical matrix to reduce non specific binding of non target molecules Nucleic acid assays POPP S EEE TESORO TEE EE EEEEEEOEEEEHOEEEH SESE EE EEEE HE EEEHETOEE HE EOTEEHOEEEE EO SEEE SEH OEE HE TETEEETEHEEEOEEOE LESSEE EE HEEEEELEEHELEOEHELEES ERE EEEE HE LEEE EOE LEEELEDESEE EEE EEE Multiplex nucleic acid assays require mostly different optimization steps from immunoassays although some similarities exist Similar to immunoassays sensitivity of nucleic acid assays may be affected by the amount of capture oligonucleotide and the amount of beads used In order to distinguish similar nucleic acid sequences standards and controls must be run to confirm that there is minimal cross hybridization and non specific hybridization between sequences Depending on whether the purpose of your assay is gene expression genotyping or simply sequence detection there are different requirements for the type of starting nucleic acid used in the assay and the chemistry required to generate reporter molecules No matter which chemistry is used to generate the reporter molecules the capture and detection of the reporter molecules is performed as diagrammed in Figure 4 Figure 4 Figure 4 Schematic of nucleic acid assay analysis on Luminex beads Each Homozygous AA bead has a unique capture sequence specific for a marker sequence If reporter molecules are generated and captured bead A a fluorescence signal is detected Ifno reporter molecules are gen
110. miRNA chimeric probe complexes are hybridized to microspheres 30 minutes C RNase Digestion Excess probes single stranded RNAs and mismatched probes are digested Only perfectly matched probes are protected 30 minutes D SAPE Incubation A brief incubation with steptavidin conjugated R Phycoerythrin SAPE incorporates reporter molecules 30 minutes Detection Targets of interest are quantified on an xMAP instrument lt 5 hours total to results Vendor For complete equipment and Luminex materials list see Appendix B IDT or other vendor Promega M4265 See miRNA Buffer and Reagent Recipes section Note Molecular grade ddH O should be used for all nucleic acid protocols Moss SAPE 001G75 Life Technologies S 866 or equivalent BioRad MSP9601 Corning Costar 6509 BioRad MSA5001 Phenix Research products SMX CM V amp P Scientific VP771LD 4CS or equivalent Any suitable brand Any suitable brand USA Scientific or Equivalent Any suitable brand Any suitable brand Any suitable brand Any suitable brand Eppendorf 5704 or equivalent USA Scientific 9127 2940 Any suitable brand Luminex www luminexcorp com Page 105 BR_574 01_0613 miRNA Buffer and Reagent Recipes PCOS OPE SE HOHE HOSE EHHEHEOEESOEEOOHOE EES HOHE HOES EEO ESOT SOHO TOTO TOTO O SHOES OHH E ESHEETS SHOES OTST ESOS EOS OOH ESO OEEE OOOH EESSOSEE ETE OSES EESOEHEEHEEEE EE ESOEED OEE Title Title Enzymes and enzyme All
111. mount of reporter fluorescence or washing samples before running them Chapter 4 3 Proteomics FAQ s www luminexcorp com Page 73 Can the Luminex platform analyze whole cell assays PCOS OPES EHH H OSES ETOH EEHOEE OO EOOTESOOHE EE OOEE SHES ESOS TOTES TOTO ESEOHEE SOSH EO SEEEE SESE OSHS EE TOOH EE SOOTESOSEEE OOOH EE SOOT ESTEE O SESE ESOOHEEHOEEEEEESOEED ODES The Luminex platform is not designed to analyze whole cells Cell lysates can be analyzed as long as the viscosity of the sample is sufficiently reduced before aspirating into the analyzer This will have to be an empirical determination on the part of the user The user needs to be aware of potential shifting of the beads due to composition differences between sample core and sheath fluid How many events should be collected per analyte POPP SLES E SEES E EEE HE EEE TEETH OEEEH SE EOEE EEE EEE HE EEEHEEOEEOEEEEOE HOLES TESOL TOE HETESE EH OEEHEH OEE EE EOEHEEETEEEEEEESELEEED HELENS EEE EEEEEELEEH OE LOEE HE LESEE ELE EE 50 100 events is sufficient to obtain accurate results Refer to Carson and Vignali Carson R T and D A A Vignali 1999 Simultaneous quantitation of 15 cytokines using a multiplexed flow cytometric assay Journal of Immunological Methods From the comparison they concluded The data derived from as few as 100 beads per cytokine assay was sufficient to obtain accurate results While all subsequent data presented here represent the collection of ap
112. n Al and A2 containing the microsphere solution 7 Add 50 uL of each of the diluted detection antibody solutions prepared in Step 4 into the appropriate wells as shown in the plate layout below 4 5 6 8 9 10 T1 Example of plate layout using columns 1 amp 2 8 Mix the reactions gently by pipetting up and down several times with a pipettor 9 Cover the plate and incubate for 30 minutes at room temperature on a plate shaker Chapter 3 3 2 Antibody Coupling Confirmation Note Microspheres should be protected from prolonged exposure to light throughout this procedure Note 50 uL per well of the microsphere solution is required for each reaction 16 wells 800 uL www luminexcorp com Page 17 BR_574 01_0613 10 Clip the plate in place on the Luminex Magnetic Plate Separator and rapidly and forcefully invert over a biohazard receptacle to evacuate the liquid from the wells NOTE For information on the MagPlex Manual Wash Method please visit http www luminexcorp com Products ReagentsMicrospheres MagneticSeparators 11 Wash each well with 100 uL of Assay Buffer by gently pipetting up and down several times with a pipettor and remove the liquid by using the procedure described in the previous step 12 Repeat step 11 for a total of 2 washes 13 Resuspend the microspheres in 100 uL of Assay Buffer by gently pipetting up and down several times with a pipettor 14 Analyze 50 75 uL on the Luminex analyzer acc
113. n a plate shaker 800 rpm for MagPlex Microspheres 20 Bring final volume of each reaction to 100 uL with assay buffer 21 OPTIONAL Include the following steps if high backgrounds occur Carefully remove the supernatant from each well using either manual inversion manual pipetting or magnetic plate washer Take care not to disturb the microspheres Add 100 uL of Wash Buffer PBS TBN to each reaction well Take care not to disturb the microspheres 22 Repeat step 21 once more for a total of two washes 23 Bring final volume of each reaction to 100 uL with Assay Buffer 24 Analyze 50 75 uL on the Luminex analyzer according to the system manual Chapter 4 1 4 Combined Capture Sandwich and Competitive Immunoassay www luminexcorp com Page 57 BR_574 01_0613 Chapter 4 2 Peptides phospholipids and other small molecules can be directly coupled to the microsphere bead surface Komatsu et al 2004 Shichijo et al 2004 but may be more efficiently accomplished through modification of the small molecule or the microsphere to provide adequate spacing from the microsphere surface This can be accomplished through the use of a linker or carrier protein attached to the small molecule which can then be coupled to the microsphere surface using the standard one step carbodiimide chemistry If the small molecule is available in a biotinylated form it can be bound to LumAvidin Microspheres where the avidin provides spacing from th
114. nd protocols for developing multiplex biological assays with xMAP Technology Chapter2 xMAP Technology www luminexcorp com Page 6 BR_574 01_0613 o SOSA Chapter 3 Development of an xMAP Assay The development process for xMAP multiplex assays is relatively simple but does require a few unique considerations compared to monoplex assays The following describes the general workflow of xMAP assay development Identify Appropriate Assay Identify Necessary Couple Beads Design Reagents and Equipment Validate eoeeeeree eee eee eee eee eee eee eee eee ee esses eeeeeeeeseeeeeeeeeeeeeeeeeeeeeeeeeeeeeseeeeeeeeeeeeoeeeeeeeeeeseeeeeeeseeeeseeeeeeeeeeeeoee ee eee ee eH oH HEHEHE OE HOEHO HEED HOO HEHEHE OHH OREO HEHEHE OEE Chapter 3 Development of an xMAP Assay www luminexcorp com Page 7 BR_574 01_0613 Chapter 3 1 xMAP Technology is adaptable to a number of biological assays including immunoassays nucleic acid assays and enzyme activity assays Common immunoassay formats are capture sandwich competitive and indirect antibody assays Nucleic acid assays are hybridization based where a probe sequence captures a labeled complementary target from your sample reaction Enzyme activity assays typically involve labeling or cleaving a peptide substrate to introduce or release a fluorescent molecule Immunoassay Nucleic acid Enzyme activity Capture sandwich TAG incorporation Kinase Phosphatase selectivity Competitive P
115. nds 28 Repeat steps 25 and 26 This is a total of two washes with 1 mL PBS TBN 29 Remove the tube from the magnetic separator and resuspend the coupled and washed microspheres in 250 1000 uL of PBS TBN 30 Count the number of microspheres recovered after the coupling reaction using Note When counting on a a cell counter or hemacytometer hemacytometer use the following 31 Store coupled microspheres refrigerated at 2 8 C in the dark calculation Total microspheres count 1 corner of 4 x 4 section x 1 x Follow this coupling procedure with Coupling Confirmation section 3 3 2 10 x dilution factor x resuspension volume in mL Chapter 3 31 Antibody and Protein Coupling www luminexcorp com Page 15 BR_574 01_0613 Chapter 3 3 2 Antibody Coupling Confirmation Once antibodies have been coupled to xMAP Microspheres beads it is strongly recommended to assess coupling efficiency before proceeding to assay development The coupled microspheres can be reacted with phycoerythrin PE labeled anti species antibody and analyzed on a Luminex instrument Alternatively target antigen may be biotinylated and subsequently labeled with streptavidin R phycoerythrin SAPE Proteins are typically coupled in random orientation as they have many lysine groups available for coupling Functional testing is also critical during assay development Examples of coupling confirmation can be found in de Jager et al 2003 see r
116. ng a magnetic separator and remove supernatant 4 Remove the supernatant and resuspend the pelleted microspheres in 250 uL of PBS BSA by vortex and sonication for approximately 20 seconds 5 Dilute the biotin conjugated molecule in PBS BSA The optimal concentration should be determined by titration in the 4 4000 nM range 6 Add 250 uL of the biotin conjugated molecule solution to the microsphere suspension and mix immediately by vortex 7 Incubate for 30 minutes with mixing by rotation at room temperature 8 Pellet the bound microspheres by microcentrifugation at 28000 g for 1 2 minutes or by using a magnetic separator and remove supernatant 9 Resuspend the pelleted microspheres in 500 uL of Blocking Storage Buffer PBS BN or PBS TBN by vortex 10 Repeat steps 8 and 9 for a total of two washes with Blocking Storage Buffer 11 Remove the supernatant and resuspend the microspheres in 250 1000 uL Blocking Storage Buffer by vortex and sonication for approximately 20 seconds 12 Store the bound LumAvidin microspheres refrigerated at 2 8 C in the dark throughout this procedure Chapter 4 21 Coupling Biotinylated Peptides with LumAvidin Microspheres www luminexcorp com Page 60 BR_574 01_0613 Chapter 4 2 2 Coupling Peptides with ADH Adipic acid dihydrazide ADH is a suitable chemical spacer for extending the peptide away from the surface of xMAP Microspheres beads for optimum reactivity with sample and
117. noassay References POC OOHH OS EOOE EEO SEHEESEOHEEHOEHOEEEEOEEOOEOET OTOH ES OOHE EOS EOEE SETHE HOHE EET OEHESEOOEE SOSH OTH SEHSEE ESOS EOSOEHESEOHEESOOESEESSOEE SETHE EOOEEEEESOOHESHOEE EEE ESOS EDEE Biagini R E Schlottmann S A Sammons D L Smith J P Snawder J C Striley C A MacKenzie B A and Weissman D N Method for simultaneous measurement of antibodies to 23 pneumococcal capsular polysaccharides Clin Diagn Lab Immunol 10 744 750 2003 Pickering J W Martins T B Greer R W Schroder M C Astill M E Litwin C M Hildreth S W and Hill H R A multiplexed fluorescent microsphere immunoassay for antibodies to pneumococcal capsular polysaccharides Am J Clin Pathol 117 589 596 2002 Shichijo S Keicho N Long H T Quy T Phi N C Ha L D Ban V V Itoyama S Hu C J Komatsu N Kirikae T Kirikae F Shirasawa S Kaji M Fukuda T Sata M Kuratsuji T Itoh K and Sasazuki T Assessment of synthetic peptides of severe acute respiratory syndrome coronavirus recognized by long lasting immunity Tissue Antigens 64 600 607 2004 Chapter 4 1 3 Indirect Serological Immunoassay www luminexcorp com Page 54 BR_574 01_0613 Chapter 4 1 4 Combined Capture Sandwich and Competitive Immunoassay The following immunoassay protocol presumes that the user is familiar with general assay development and optimization including microsphere bead
118. ns 7 OU Goa D T ceacteecseadeueeacn nee eneatueeeesead ee nea see uaenccun nop eae bieannaneseeeuudejehenen mepeuuee soueecwek eee 8 32 Rede ents ad COU mieh x txdra ahaa inn oe E a anh ae awe wey add oe oh Rue ae ha eee I Eee eh aes Rae eae oes 10 Spo Mo Ee COUPE eT eee eee oe ee eee ee re eee ee eS ee ee re Te Ser ee en es TT 11 33 1 Antibody and Frote Coupling aaa se ee ee See een a ee ee ee ee eee eer ee ee ee eee eee ee EE 13 2c Antibody COUP Oe COMM MaMON ascessitaeentaaneateead vanes DAAN E ia ANF Ea ANNE eaa 16 Iaa NUGCEIE Cla COUN E ereer rrer r a E E E a ene E EET 19 3 34 Oligonucleotide Coupling Confirmation i rreseiirrsarinsrcreirararessen ri EErEE A EAEE a aAa 22 34 Optimizaton or MUNDE ceasrionee icine AINE a aa AANA T e A E neg ANANKE a 28 341 Optimization OF Minn OASSAy S ereer sererai ii rraeEArEA riewseeeed 16 Gaudin eal on onde en neeeed aor 29 Be A A O a A eo in E E AA an a A ap aa A E ee E 38 351 Imm ngassay Validato ireas naaar NE serene ah awn AANE A E EA a pan eerie ee ade 39 A Proteomic Applications sisvaoyeannciadepsncddeoabetdah sibs pond S0 eai nA eea e tbh aa e a a e a aa a aa 41 Al Common xMAP ImmMmU NOJSSayS escra renerne a aa a nes a E a ee AE E an ET EE aa 42 AILT Capt re Sandwich IMMUNOASSAY ac cau ante tv es de peewee we bas od AAN ohn A L ANN ae 43 41 2 Competitive Immunoassay s lt ccckccedsseue ede deb ennnen eeen 47 41 3 Indirect Serological IMMUNOASSAY aaguaeeenan cng nacsaeu cr ensdeuw a aos
119. ns can be done with the following PCR Cycling Parameters Temperature Time Cycle 95 C 15 minutes for enzyme activation 94 C 30 seconds 55 C 30 seconds 35 cycles 7A 30 seconds ee 7 minutes A C Hold Multiplex OLA Reaction Prior to making the 2X OLA Master Mix make stocks of 100 nM OLA TAG primer mix and 5 uM OLA reporter mix as directed in the OLA Buffer and Reagent Recipes section 1 Make a 2X OLA Master Mix as follows Reagent Amount 10X Tag Ligase buffer 2 0 uL Taq DNA Ligase 40 000 U mL 0 25 uL OLA TAG primer mix 100 nM each 1 0 uL OLA reporter mix 5 uM each O l ddH O Molecular Grade 5 75 uL Total volume 10 uL eoeceeereee eee eee eee eee eee eee eee eee eeseeeeeeeeeeeseeseeseeeseeeeeeeeeeeeeeeeeeeeeseeeeeeeeeeeeoeeeeeeeeeZeseeeeeeeseeeeseeeeeeeeeeeee eee eee Hoe EHO HH HEHEHE HOE HOE HOODEO OOOOH HEHEHE OHH OHH HO OEE Chapter 5 1 1 Oligo Ligation Assay OLA SNP Typing www luminexcorp com Page 81 BR_574 01_0613 2 Assemble OLA reactions in 20 uL total volume for each sample as follows Reagent Amount 2X OLA Master Mix 10 uL Amplified genomic targets 0 5 to 5 uL Y uL ddH O Molecular Grade as needed to 20 uL X uL Total volume 20 uL 3 Mix OLA reactions by pipetting up and down several times 4 Cover plate with a plate sealer and perform multiple rounds of ligation in a thermal cycler with the following parameters Temperature 96 C 2 minutes glag 15 seconds 37 C 1 minut
120. ollowing documents EP17 A Protocols for Determination of Limits of Detection and Limits of Quantitation MMO6 A2 Quantitative Molecular Methods for Infectious Diseases Ligand Binding Assays Development Validation and Implementation in the Drug Development Arena Edited by Masood N Khan and John W A Findlay Wiley Linearity A linear relationship should also be evaluated across the assay The linearity of dilution provides confidence that the analytes present are within the assay range can be diluted and accurately for relative quantitation Linearity of Sample Dilutions R2 Matrix IL 4 IL 6 IL 8 0 9962 09956 09995 09986 Cell Cuture 0 9998 0 9996 0 9955 eoeee eee e eee eee eee eee eee eee eee eee eee eeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeseeeeeeeeeeeeoeeeeeeeeeeseeeeeeeseeeeseeeeeeeeeeeeee eee eee eeseeeeeeeeeeeeeeeeeeeeeeeoeeeeeeseeeeeeeene Chapter 3 4 1 Optimization of Immunoassays www luminexcorp com Page 34 BR_574 01_0613 The R2 was determined by linear regression analysis of analytes measured in a 3 fold serial dilution of standard spiked samples within assay range in 3 matrices Binding kinetics and assay sensitivity Reducing the volume of the initial incubation with microspheres and sample and or increasing the initial incubation time may improve the kinetics for analyte binding thus improving sensitivity Though seemingly paradoxical improved sensitivity can be sometimes accomplished by
121. on antibody may be required for a no wash assay format To optimize detection antibody concentration for washed assays we recommend starting with 4 ug mL and titrating down to 1 ug mL by two fold dilutions e The optimal detection antibody concentration will depend on specific reagents and level of multiplexing Concentrations often need to be increased when increasing the number of multiplexed assays and when converting to a no wash assay format e The reporter concentration should be approximately one and one half times the concentration of the detection antibody When using streptavidin R phycoerythrin SAPE at concentrations gt 8 ug mL final concentration in a no wash format a dilution or wash step may be required to minimize background fluorescence prior to analysis on the Luminex instrument Materials Needed Reagents and Consumables Vendor MagPlex Microspheres antibody coupled For complete equipment and materials list see Appendix B Assay Wash Buffer PBS 1 BSA Sigma P3688 PBS BN buffer Sigma P3688 PBS TBN buffer Sigma P3813 Sigma A7888 Sigma P9416 96 well plate See Appendix B PE or Biotin labeled Detection Antibody streptavidin R phycoerythrin SAPE 1 5 mL microcentrifuge tubes Disposable pipettes tips Distilled deionized water ddH O 1 Also used as assay buffer 2 Also used as wash buffer Any suitable source Moss SAPE 0O01G75 Life Technologies S 866 or equivalent USA Scientific
122. onds each 2 Dilute concentrate an aliquot of each to 75 microspheres UL in 1 5X TMAC Hybridization Solution Vortex and sonicate for approximately 20 seconds Note 33 uL are required for each reaction to give 2 500 beads reaction 3 Add 33 uL of the 75 microspheres uL aliquot to each well of a bead hybridization plate as needed for each reaction 4 Add 17 uL of dH O to each background well 5 Add 5 to 20 uL of complementary biotin oligonucleotide 5 to 200 femtomoles to appropriate sample wells 6 Adjust the total volume to 50 uL by adding the appropriate volume of dH O or TE to each sample well 7 Cover the plate with MicroSeal A film to prevent evaporation Process in a thermal cycler with the following program 96 C for 90 seconds 37 60 C for 15 minutes 8 Dilute SAPE to 10 ug mL in 1X TMAC Hybridization solution Note 25 uL are required for each reaction 9 Add 25 uL of 10 ug mL SAPE to each well and mix by gently pipetting up and down several times Note Final concentration of SAPE should be 2 4 ug mL 10 Incubate at hybridization temperature for 5 minutes 11 Analyze 50 uL at hybridization temperature on the Luminex analyzer according to the system manual Chapter 3 3 4 Oligonucleotide Coupling Confirmation For complete equipment and materials list see Appendix B Note Luminex Tm Buffers are specific for MagPlex TAG low G C hybridization reactions TMAC buffers are best suited for custom coupl
123. oooooooooooooooosoosoooooooooosooooooooooooooooooooocoooooooosooooooocoosooooosooooooooooooooooooooooooooooooooooooooooo Deshpande A J Nolan P White Y Valdez W Hunt C Peyton and C Wheeler 2005 TNF amp promoter polymorphisms and susceptibility to humanpapillomavirus 16 associated cervical cancer Journal Of Infectious Diseases 191 6 969 976 e Ros Garcia A R A Juste and A Hurtado 2012 A highly sensitive DNA bead based suspension array for the detection and species identification of bovine piroplasms International Journal For Parasitology 42 2 207 214 Sun K X F Chen X B Zhu H L Hu W Zhang F M Shao P Li Q L Miao Y R Huang and Z Li 2012 A New Molecular Diagnostic Approach to Assess Y Chromosome Microdeletions in Infertile Men Journal of International Medical Research 40 1 237 248 Taniuchi M C C Walters J Gratz A Maro H Kumburu O Serichantalergs O Sethabutr L Bodhidatta G Kibiki D M Toney L Berkeley J P Nataro and E R Houpt 2012 Development of a multiplex polymerase chain reaction assay for diarrheagenic Escherichia coli and Shigella spp and its evaluation on colonies culture broths and stool Diagnostic Microbiology and Infectious Disease 73 2 121 128 eoeceeeee eee eee eee eee eee eee ee eee eee ese eeeeeseeeeeseeeseeeeeseeeee eee eee eeeeeeeeeeseeeeeeeeeeeeoeeeeeeeeeeseeeeeeeseeeeseeeeeeeeeeeeeeeeeeeeeeeeeee e
124. ording to the system manual An example of typical results is shown below Figure 5 Figure 5 Plot of typical results for anti species IgG PE conjugate titration Antibody Coupling Confirmation of antibody coupled microspheres as 14000 measured by a Luminex analyzer a i a 10000 D 9 D ar a 3 LL 6000 ge oO 2 2000 7 O O 1 2 3 4 5 Anti Species IgG PE conjugate ug ml Antibody coupling references de Jager W te Velthuis H Prakken B J Kuis W and Rijkers G T Simultaneous detection of 15 human cytokines in a single sample of stimulated peripheral blood mononuclear cells Clin Diagn Lab Immunol 2003 10 133 9 Giavedoni L D Simultaneous detection of multiple cytokines and chemokines from nonhuman primates using Luminex technology J Immunol Methods 2005 301 89 101 Lawson S Lunney J Zuckermann F Osorio F Nelson E Welbon C Clement T Fang Y Wong S Kulas K and Christopher Hennings J Development of an 8 plex Luminex assay to detect swine cytokines for vaccine development Assessment of immunity after porcine reproductive and respiratory syndrome virus PRRSV vaccination Vaccine 2010 28 5356 64 Chapter 3 3 2 Antibody Coupling Confirmation www luminexcorp com Page 18 BR_574 01_0613 Chapter 3 3 3 General guidelines for nucleic acid coupling to xMAP Microspheres PPPS oH L EEO SELES E TEE HE EEEEE ESET EEEEESEEOEHE SHEE ESET EE EEEEE
125. otected from prolonged exposure to according to the instructions described in the Product Information Sheet provided with your microspheres beads 2 Combine 2500 microspheres of each set per reaction Note If needed an Excel based bead calculator is available for determining the method and volumes needed for making the bead mix Contact your Luminex representative or visit www luminexcorp com 3 Dilute concentrate the MagPlex TAG microsphere mixture to 100 of each microsphere set per uL in 2X Tm Hybridization Buffer and mix by vortex and sonication for approximately 20 seconds 4 Aliquot 25 uL of the MagPlex TAG microsphere mixture to each well 5 Add5 to 25 uL of each ASPE reaction to appropriate wells Note 1 5 uL is usually sufficient and add 25 uL of dH O to each background well 6 Adjust the total volume to 50 uL by adding the appropriate volume of dH O to each sample well that received less than 20 uL of extension reaction 7 Cover the plate with MicroSeal A film to prevent evaporation and hybridize in a thermal cycler with the following parameters 96 C for 90 seconds 37 C for 30 minutes 8 Pellet the MagPlex TAG Microspheres by placing the plate on a magnetic separator for 30 to 60 seconds 9 After the beads have pelleted remove the supernatant being careful not to disturb the bead pellets 10 Resuspend the pelleted MagPlex TAG Microspheres in 75 uL of 1X Tm Hybridization Buffer on a magnetic separator for 30 to
126. otein protein interactions modulated by signal transduction and small molecule drug inhibition Smith SE Bida AT Davis TR Sicotte H Patterson SE Gil D Schrum AG PLoS One 2012 7 9 e45722 doi 10 1371 journal pone 0045722 Epub 2012 Sep 21 PMID 23029201 Does Luminex recommend sources for antibody pairs Luminex has used several sources including R amp D Systems Pharmingen Rockland OEM and Fitzgerald but recommends that customers consult their preferred vendor Quality and purity are of utmost importance Manufacturers of ELISA kits often sell matched pairs that are easily transferable to microspheres Examples include but are not limited to DuoSets from R amp D Systems Wood et al 2011 and eBioscience Rizzi et al 2010 Many publications list the source catalog number and clone number for their antibodies used Bjerre et al 2009 Carslon amp Vignali 1999 de Jager et al 2003 de Jager et al 2005 de Jager et al 2009 Dernfalk et al 2004 Dernfalk et al 2007 Lawson et al 2010 Ray et al 2005 Skogstrand et al 2005 Many of the assays built in these publications are common and Luminex suggests you use these as a starting point to save time The Antibody Resource website http www antibodyresource com is a good starting point to search for antibody suppliers When choosing raw materials antibodies and recombinant proteins select vendors that have rigorous quality control procedures and provide as much informa
127. oupling may be achieved at a higher coupling pH 3 Alternative coupling buffer for proteins that do not couple well at pH 5 6 4 Also used as assay buffer 5 Also used as wash buffer Appendix A Common buffers used in xMAP protocols www luminexcorp com Page 113 BR_574 01_0613 Appendix B Equipment needed for xMAP protocols Immunoassay Equipment Vendor Luminex xMAP analyzer with xPONENT software Luminex Magnet for 1 5 mL microcentrifuge tube washing Dynal MPC S Magnetic Particle Concentrator Invitrogen 120 20D or equivalent Magnet for 96 well plate washing See list below Balance Any suitable brand capable of weighing down to 0 1 mg Microcentrifuge Any suitable brand Hemacytometer or Cell Counter Cellometer Auto 1000 TC10 Cell Counter Countess Automated Cell Counter Vortex mixer Any suitable brand Sonicator bath Ultrasonic Cleaner Cole Palmer A O8849 00 or equivalent Rotator Any suitable brand capable of 15 30 rpm Microtiter plate shaker Any suitable brand capable of 800 rpm 96 well plate Nucleic Acid Assay Equipment Vendor Thermocycler with 96 well Head and Heated Lid Any suitable brand 1 Note MAGPIX has the ability to perform a final wash step prior to reading the plate 2 Note If a magnet is not available use a microcentrifuge 8000 x g for 1 2 minutes 3 Note If a magnet not available use a centrifuge compatible with 96 well plates 8000 x g for 1 2 minutes 4 Note L
128. over others resulting in losses that may be universal or specific Isolation of total RNA has no bias toward particular miRNA species Traditional methods such as phenol chloroform extraction may also be use for total RNA extraction Some older bind and elute methods are not suitable as they do not recover miRNAs Please make sure that a total RNA extraction method that maximizes the recovery of miRNAs is used Adjust the sample s total RNA concentration to deliver from 250 ng to 500 ng per sample in a volume of 2 5 ul or less Example If the sample RNA concentration is 1 mg ml 1 000 ng ul then combine 0 5 ul RNA with 2 0 ul of hybridization buffer to achieve 500 ng in the 2 5 ul recommended sample volume MicroRNA Analysis www luminexcorp com Page 107 BR_574 01_0613 Protocol 5 2 miRNA Analysis POCO OCS SHOES OEE EESEHE EE ESOS TOSSES OOH OEHOOEE SO ESOEE SOHO ESOS TOTO OSES EES OSHOEHSEEEE SESE ET OHSEEESOOS EO HSOHESOOEEE OOOH EE SOOT OTHE O SESE EESOEHEEHOEEEEEESOEEDOOEE 1 In a nuclease free tube for each sample and ano RNA negative control make Note Microspheres should be a sample master mix as follows with 20 overage The total RNA samples protected from prolonged exposure to should be delivering 250 ng to 500 ng of RNA in 2 5 ul light throughout this procedure Reagent 1rxn N rxns 20 Hybridization buffer 16 25 ul 16 25 uL x N 20 Sample Total RNA or H O for Neg control 2 5 ul ZSewixN 20 Chimeric Probe mi
129. porter molecule gives highest signal of all the dyes we have compared Use either PBS 1 BSA or PBS TBN as the Assay Buffer When using SAPE at gt 8 ug mL final concentration in a no wash assay a dilution or post labeling wash step may be required to minimize background fluorescence prior to analysis on the Luminex instrument Coupling should be allowed to proceed for 2 hours with end over end mixing on a rotator For scaling up to 50 200 million microspheres per coupling reaction couple in 2 mL using a 15 mL polypropylene centrifuge tube or a 4 mL microcentrifuge tube Place tube at a 33 45 degree angle in a tube rack and mix on a plate rotator for the 2 hour coupling incubation After washing allow microspheres to block over night in Blocking Storage Buffer at 4 C in the dark if possible Too high of an antibody concentration may lead to passive adsorption and can manifest itself as a very high signal initially with continued decline over time as the antibody becomes detached Additionally cross reactivity can occur if beads are stored as a multiplex Chapter 3 4 1 Optimization of Immunoassays www luminexcorp com Page 30 BR_574 01_0613 Factors affecting multiplex assays POCO OSE HOHE SOOHHEESEHEE SESE EO SHEE EES OOHEESOOEESESSOE ESOS ESOS HOSE OSES EES OSEO EH SEEEE SESE EO OHSEEESEOHE ESSE ES HOSES OOOH EE SSO EOEHOEE SESE ESOOHESHSEEESESEOEEDOEE Assay dynamic range cross reactivity and biological matrix are factors tha
130. proximately 100 events per cytokine per sample comparable results from fewer events may be possible Several studies not published have concluded that a minimum of 35 events is required to obtain a statistically valid median result Customer may want to carry out a similar study to determine the optimal number of events to collect In determining how many microsphere events to collect in your sample keep in mind that the output of the assay is median fluorescence determined from the sample microspheres Chapter 4 3 Proteomics FAQ s www luminexcorp com Page 74 Genomic Applications Chapter 5 Genomic Applications www luminexcorp com Page 75 BR_574 01_0613 Chapter 5 1 The following nucleic acid assay protocols presume that the user is familiar with general assay development and optimization including microsphere bead coupling This introduction is intended to review the genomic assay development process only at a high level xMAP Technology is capable of a number of genomic assay formats such as gene expression analysis microRNA analysis single nucleotide polymorphism SNP analysis specific sequence detection and other applications Assays may be developed by coupling sequence specific capture oligos to MagPlex beads or TAG sequences may be incorporated into assay reactions to capture onto MagPlex TAG beads without the need to couple oligos Ce Figure 13 Figure 13 Schematic of nucleic a
131. pter 3 3 4 Oligonucleotide Coupling Confirmation Once oligonucleotides have been coupled to xMAP Microspheres beads it is strongly recommended to assess coupling efficiency before proceeding to assay development The coupled microspheres can be reacted with biotinylated target oligonucleotide labeled with streptavidin R phycoerythrin SAPE and analyzed on a Luminex instrument followed by SAPE labeling To determine the optimum amount of oligo that provides the highest signal several coupling reactions at different oligo concentrations should be carried out Beads from each coupling reaction can then be hybridized with a complementary biotin labeled oligonucleotide 5 to 200 fmols to analyze coupling efficiency and signal optimization We recommend purchasing sequence specific 5 biotinylated complementary oligos for each capture sequence as the most reliable method since precise amounts of probe with a single biotin group can be used in the hybridization reaction The following protocol may be used for confirmation of oligonucleotide coupling reactions Summary of Protocol Add microspheres to Add biotinylated oligo Move to thermal cycler reaction tube probe 96 C for 90 s 37 60 C for 15 minutes Add SAPE Incubate 37 60 C for Read 50 uL on Luminex gt 5 min analyzer Chapter 3 3 4 Oligonucleotide Coupling Confirmation www luminexcorp com Page 22 BR_574 01_0613 Materials Needed Reagents and Cons
132. r MAGPIX 23 PE MEFI What third party data processing tools does Luminex recommend Millipore MILLIPLEX Analyst http Awww millipore com bmia flx4 multiplex assay analysis software Bio Rad BioPlex Manager http www bio rad com evportal en US LSR Category 45938d9d c2ec 4ae4 9ed3 e7358a98d30b Bio Plex Software MiraiBio MasterPlex QT http Awww miraibio com masterplex gt qt luminex quantitative data analysis software e Excel Sigma Plot How do samples containing biological fluids perform on the Luminex Instruments POCO OO TEETH EEOEEOEEHEHTEEEEOEE SETS EE EEHH TEESE ESCO HEHE ES EHO EES OHS ES EEOE ETO EHE ESE OEE SEES EEO OHHH ETO OTO THESE TEESE EEETESETOEETOETOT EES EHOEESEEHO LESSEE ESOS EEEE ESOL ESTEE As long as the reagents function in the biological matrix the assay should work on the Luminex platform with the proper optimization e A 1 5 dilution is a recommended starting point for samples containing serum or plasma Urine CSF and synovial fluid may be run without dilution following centrifugation or filtration Assays can be performed in undiluted biological fluids and then diluted before running on the Luminex platform Often routine assay processing includes a sufficient dilution with the addition of the microspheres detection antibody and fluorescent reporter Assays may not be as sensitive in biological fluids as they are in buffer because the fluids are less purified and may contain interferents
133. r dynamic range for the assay The reporter concentration should be approximately one and one half times the concentration of the detection antibody When using streptavidin R phycoerythrin SAPE at concentrations gt 8 ug mL in a no wash format a dilution or wash step may be required to minimize background fluorescence prior to analysis on the Luminex instrument Materials Needed For complete equipment and Reagents and Consumables Vendor materials list see Appendix B MagPlex Microspheres antibody or antigen coupled Assay Wash Buffer PBS 1 BSA Sigma P3688 PBS BN buffer Sigma P3688 PBS TBN buffer Sigma P3813 Sigma A7888 Sigma P9416 96 well plate See Appendix B PE or Biotin labeled Detection Antibody or Analyte Any suitable source streptavidin R phycoerythrin SAPE Moss SAPE 001G75 Life Technologies S 866 or equivalent 1 5 mL microcentrifuge tubes USA Scientific 1415 2500 or Eppendorf Lo Bind 022431081 Disposable pipettes tips Any suitable brand Distilled deionized water ddH O Any suitable source 1 Also used as assay buffer 2 Also used as wash buffer Chapter 4 1 2 Competitive Immunoassay www luminexcorp com Page 48 BR_574 01_0613 Protocol 4 1 2 1 Competitive Immunoassay Format 1 eecccce PCOS EHH EEO TEOE EES OEHO SHEE EEEOEHOE ES OOH EEE SOEST EO SOOE ETHOS ETH OEEHEESSOEEEEHOOEESEHHEESOEHEEHSEEEE ESSE ETOH EETOOT EO SSOHESOOHOE OOOH ESEOEEEEHOETESESEEESOOEEEESS Note Microspheres should
134. r visit www 5 Add 2 5 uL of dH O to each background well luminexcorp com 6 Add 2 5 uL of each sample to the appropriate wells 7 Cover the plate with MicroSeal A film to prevent evaporation and hybridize in a thermal cycler with the following parameters 96 C for 90 seconds 37 C for 30 minutes 8 Prepare Reporter Mix by diluting SAPE to 10 ug mL in 1X Tm Hybridization Buffer 9 Add100 uL Reporter Mix to each well Mix gently 10 Incubate at 37 C for 15 minutes 11 Analyze 100 uL at 37 C on the Luminex analyzer according to the system manual Recommendations for Optimization and Troubleshooting xTAG with ASPE Assays Low Reporter Intensity 1 Verify the production of the PCR products ASPE templates on agarose gels 2 Verify the hybridization assay by direct hybridization to 5 and 50 femtomoles of labeled oligonucleotide targets Ci e biotinylated TAGs 3 Titrate the target input to determine the optimal amount for hybridization 4 Titrate the template input to determine the optimal amount for ASPE 5 Titrate the biotinylated dCTP input to determine the optimal concentration for ASPE 6 Increase the number of cycles in the ASPE reaction 7 Decrease and or increase the ASPE annealing temperature 8 Check the primer and template sequences for potential secondary structure 9 Redesign the PCR primers 10 Redesign the ASPE primers for the opposite DNA strand 11 Lengthen the ASPE primers Poor Discriminat
135. ray J G Multiplexed molecular interactions of nuclear receptors using fluorescent microspheres Cytometry 44 326 337 2001 Drummond J E Shaw E E Antonello J M Green T Page G J Motley C O Wilson K A Finnefrock A C Liang X and Casimiro D R Design and optimization of a multiplex anti influenza peptide immunoassay J mmunol Methods 334 11 20 2008 Komatsu N Shichijo S Nakagawa M and Itoh K New multiplexed flow cytometric assay to measure anti peptide antibody a novel tool for monitoring immune responses to peptides used for immunization Scand J Clin Lab Invest 64 535 545 2004 Schlottmann S A Jain N Chirmule N and Esser M T A novel chemistry for conjugating pneumococcal polysaccharides to Luminex microspheres J Immunol Methods 309 75 85 2006 Chapter 4 2 Other Coupling Moieties www luminexcorp com Page 58 BR_574 01_0613 Chapter 4 2 1 Coupling Biotinylated Peptides with LumAvidin Microspheres A sample protocol for binding of biotinylated molecules to LumAvidin Microspheres beads is described below However with this approach a biotin streptavidin system cannot be used for reporter labeling and an alternative reporter labeling method such as a direct conjugation of PE to the detection reagent would be necessary Summary of Protocol Add LumAvidin Wash microspheres w Add PBS BSA blocking Microspheres buffer buffer
136. reactivity between antibodies for different targets is observed it may be necessary to replace with other reagents Selecting other antibodies pre screened during coupling optimization steps may be required Multiplexed assays should be tested for specificity and cross reactivity with see illustration below individual analytes and corresponding reporter antibodies to determine if analytes cross react with non target beads 2 individual analytes and multiplexed detection antibodies to determine if reporter antibodies cross react with non target analytes 3 multiplexed analytes and multiplex detection antibodies to determine sensitivity and to confirm there is no cross reactivity or interference in the complete assay Sample cross reactivity protocol POCO OSE HOHE OOOH EE SOHHE ETHEL OSHS E EOS OOHEEEOOEE SESS ETOH SEE STOO TOTES ESOS SOSH EE SEEEEEESOEEOOHEEEE SOOO SOOO S OSE E OOOH EESSOSE TOTO EE TESTES OOH EEHEEEEEEESOEEDEDEE Figure 10 3 plex cytokine assay Figure 10 Immunoassay cross reactivity protocol Test 1 Test multiplex capture Test 1 Test 2 Test 3 beads with 3 separate titrations of IL 4 Multiplexed Beads Multiplexed Beads Multiplexed Beads IL 6 and IL 8 using appropriate monoplex reporter antibody for each titration Test 2 Test multiplex capture beads with 3 separate titrations of IL 4 IL 6 and IL 8 using multiplexed reporter antibodies Test 3 Test multiplex capture beads with 5 5 5 5 mult
137. reagents ADH provides a 10 atom spacer with an active amine group for coupling to peptide carboxyls A sample protocol for modifiying x MAP Microspheres with ADH is described below Summary of Protocol Add uncoupled Add EDC Materials Needed Reagents and Consumables Vendor MagPlex Microspheres Adipic acid dihydrazide ADH Coupling Buffer 0 1 M MES pH 6 0 1 Ethyl 3 3 dimethylaminopropyl carbodiimide hydrochloride EDC PBS pH7 4 Storage Buffer PBS TBN buffer 1 5 mL microcentrifuge tubes Disposable pipettes tips Distilled deionized water ddH O Wash microspheres w microspheres buffer Incubate 1 hour Nolo ND g Wash and resuspend microspheres w buffer For complete equipment and materials list see Appendix B Luminex Sigma A0368 Sigma M2933 Pierce 77149 See Appendix A Sigma P3813 Sigma A7888 Sigma P9416 USA Scientific 1415 2500 or Eppendorf Lo Bind 022431081 Any suitable brand Any suitable source Chapter 4 2 2 Coupling Peptides with ADH www luminexcorp com Page 61 BR_574 01_0613 Protocol 4 2 2 Modification of microspheres with adipic acid dihydrazide ADH POCO OPES EHH EEO OEHOE ETOH SESE ESHEETS OHH EEHOOEE SESE ESOS ESOT OTOH ESEOHE ES OSEO EH SEEEE SESE TOTS E ESOS EE SOOHES HOSE T ESOS EE SOOTHE OTHE EO SESH EESOOHEEHSESEEEESOEEDOES Note Microspheres should be protected longed to light 1 Resuspend the stock microsphere suspension according to the instruc
138. regions containing the SNP s of interest 2 PCR primers should not be labeled 3 Amplicon size is not restricted These primers can be purchased from multiple vendors Upon receipt the primers should be dissolved or dilute with molecular grade ddH O to a concentration of 1 mM 1 nanomole uL They can be stored as individual stocks at 20 C Pooled mixes can be made to deliver 0 2 uM of each primer PCR reaction or as your gDNA protocol requires ASPE primers with 5 TAG ASPE primers can be ordered from several oligo manufacturers such sequence as IDT Upon receipt they should be resuspended in molecular grade ddH O to 1 mM 1 nanomole uL Individual stocks and concentrated mixes should be stored at 20 C When designing the ASPE 1 ASPE primers should be synthesized for all sequence variants and primers the following should be from the same DNA strand for each target sequence factors should be 2 ASPE primers should be matched for melting temperature at 51 considered 56 C 3 ASPE primers should extend out to and include the SNP variant base as the 3 nucleotide 4 Use oligo design software to select an appropriate TAG sequence 5 The ASPE primer is designed to include the TAG sequence in its 5 end 6 If two SNPs are close enough such that the TAG ASPE primers will overlap target the second SNP on the opposite strand dNTPs These can be purchased from several vendors such as Life Technologies 10297 018 A 25 m
139. res beads www luminexcorp com Page 96 BR_574 01_0613 Recommendations for Optimization and Troubleshooting POCO ESE HHH THOSE EHHOHHE SESE TOTO ES OOHEE ESOS SHES ESOS EO SOSE EOS OEEE SHOES SOSH EHSOEEE SESE SOTO E ESOS ESOOTE SHOE E HOES EESSOSEEETOOTO SHEET ESOOHESHSEEEEEESOEEDOEE Low Reporter Intensity Verify production of amplified products on agarose gels Verify labeling of amplified target Try increasing and decreasing the target input to determine optimal amount Check primer and target sequences for potential secondary structure Check primer and target sequences for specific sequence complementarity Redesign PCR primers to target a different region if needed Try increasing amount of SAPE NOURWN Poor Discrimination Decrease the target input 2 Increase the hybridization temperature to 45 C 3 Verify PCR primer sequence specificity and binding characteristics 4 Redesign PCR primers to target more unique regions High Background 1 If not using SAPE already containing BSA i e Moss SAPE O01G75 dilute SAPE in 1X Tm buffer containing BSA Final BSA concentration in the reaction should be 0 1 BSA in the reaction 2 f high background is isolated to one or a few microsphere sets test individual PCR TAG amplicons with the bead mix to determine if the high background is related to specific target cross hybridization with the microspheres 3 Redesign targets with high background 4 f high
140. rget sequences and development of a hybridization prediction algorithm Nucleic Acids Research 38 21 E195 EU175 Yang L D Tran and X Wang 2001 BADGE BeadsArray for the Detection of Gene Expression a High Throughput Diagnostic Bioassay Genome Research 11011 1888 1898 Chapter 51 4 Direct DNA Hybridization Sequence Detection www luminexcorp com Page 103 BR_574 01_0613 Chapter 5 1 5 A number of PCR based and direct hybridization assays are available for the analysis of miRNA expression levels Most of the PCR based approaches can only be run as single plex assays in individual reactions or on costly chips increasing processing times requiring more sample and limiting the number of samples that can be processed rapidly Jang Simon et al 2011 Taylor Satoor et al 2012 Marco Ragusa 2013 Hybridization assays can be multiplexed to different degrees with the use of special costly probes cassettes and analysis instruments Cascione Gasparini et al 2013 Naduparambil Korah Jacob 2013 Many of these chemistries are suitable for analysis of expression levels but often lack the ability to distinguish between closely related miRNA targets that differ by a single base In addition to the lack of single base resolution these assays can also be costly per sample with low sample throughput capabilities To overcome these obstacles the Luminex based nuclease protection approach takes advantage of a unique combinat
141. rmed correctly Make sure all reagents are added at the bottom of each well Accurate pipetting is critical for achieving tight CVs between replicates Low Microsphere Count 1 Microsphere Mix was diluted incorrectly Make sure you thoroughly vortex the Microsphere Mix vial and prepare the dilution according to the instruction manual 2 Microspheres were lost during washes Use the recommended magnetic plate separator V amp P Scientific VP771LD 4CS or suitable substitute see Appendix B When performing a manual wash make sure the plate sits properly on the magnetic separator Be careful not to hold the pipette tip directly above or near where the microspheres are pelleted Remove the supernatant carefully and slowly When using automatic plate washers make sure the washer settings are programmed according to the plate washer instruction manual Make sure the washing protocol has been optimized for the magnetic separator and plate type used 3 Incorrect probe height adjustment on instrument Adjust the probe height according to the instructions in the Adjust the Probe Height section 4 Incorrect protocol set up on the Luminex instrument Make sure you enter assay parameters and bead regions correctly when you create your protocol 5 Microspheres shifting out of region in the bead map on the Luminex instrument Make sure wash buffer was prepared correctly Make sure the microsphere solution is stored in the dark at 4 C to prevent photo b
142. s Qiagen HotStar Taq 2X Master Mix ExoSAP IT or separate Exo and SAP Platinum Tsp DNA polymerase 10X PCR Buffer 50 mM MgCl Biotin 14 dCTP dNTPs stocks 2X Tm Hybridization Buffer 1X Tm Hybridization Buffer streptavidin R phycoerythrin SAPE 96 well PCR Plate 96 well Bead Hybridization Plate optional MicroSeal A Magnetic separation plate special order Disposable pipette tips multi and single channel 2 1000 mL 25mL reservoirs divided well RNase DNase Free Microcentrifuge Tubes 1 5 ml Barrier Pipette Tips Chapter 5 1 2 Allele Specific Primer Extension ASPE SNP Typing Luminex IDT or other vendor IDT or other vendor Qiagen 203443 or equivalent GE Healthcare US78200 or equivalent Invitrogen 11448 024 or equivalent Invitrogen 19518 018 or equivalent Life Technologies 10297 018 or equivalent See Buffer and Reagent Recipes section See Buffer and Reagent Recipes section Moss SAPE 001G75 Life Technologies S 866 or equivalent BioRad MSP9601 Corning Costar 6509 BioRad MSA5001 V amp P Scientific VP771LD 4CS or equivalent Any suitable brand Any suitable brand USA Scientific or Equivalent Any suitable brand Ce eoooooooocoooocococooooooooooooooooocooo ooood ooolol lo Figure 16 Genomic DNA is amplified in the region of each SNP prior to performing ASPE assay using standard multiplex PCR amplification Amplified targets may be of various lengths and m
143. s and improve overall assay performance and sensitivity Instrument settings and reporter fluorescence POCO SE HHH SESE EEO EESEHEEE EHO OOTOEEE SHOES EH OOEE SEES OE ESOS EE OSES SOSH OS EOHE ES OSEO EH SEEEE ESHEETS OTHE EO TEOEEESOOH ES OOEEE ESOS E ETOH SOTHO O TEESE ESOOEEEHSEEEEESSOEED ODES Optimization of assay performance and meeting requirements for sensitivity dynamic range ease of use and time to result should be kept in mind when developing the multiplexed assay To improve sensitivity or increase signal many factors may be considered including adjustment of the PMT setting on Luminex 100 200 and FLEXMAP 3D instruments selection of different vendors or types of SAPE reporter and incorporation of dendrimers rolling circle amplification or additional reporter labeling steps Chapter 3 4 1 Optimization of Immunoassays www luminexcorp com Page 36 BR_574 01_0613 Other reagent optimization PCOS OSES E HHH S OSES ESOHHEE ESO O SHOE EES HOHE E HOES EH ESOE HOES ESOS TOTO O SHOES OSEOE HS EEEE SESE ESOT SOE ESOS O HOOT SHOE ESEESEE OTOH EETEEE OSES EESOOHEEHOEEESEESOEED ODES Finally the fully multiplexed assay is performed to determine sensitivity and interference when all analytes and reagents are present in the reaction Multiplexed assay development can be an iterative process requiring further optimization as complex interactions between assay components are observed Assay conditions such as buffer system bloc
144. s are typically desalting or HPLC purifications The carbodiimide coupling reaction is most efficient at low pH level i e pH 5 6 however for proteins sensitive to lower pH conditions coupling reactions may be carried out at higher pH to ensure stability and functional conformation of the protein Oligonucleotide coupling performs best at pH 4 5 Monoclonal antibodies should be used for capturing the analyte to the microsphere surface to achieve best sensitivity and specificity If a polyclonal antibody is used for capture it should be monospecific and affinity purified The optimal amount of capture reagent may vary depending on the reagent used and should be titrated For antibodies 5 ug of antibody per 1 million microspheres performs well For antigens the amount will vary depending on the size and composition of the antigen being coupled Chapter 3 3 Microsphere Coupling www luminexcorp com Page 12 BR_574 01_0613 Chapter 3 3 1 Antibody and Protein Coupling General guidelines for antibody coupling to xMAP Microspheres POSSE OS HEEEHEOEHE EH OEHHEEOEEOHEHOHSEH OOOOH SE SOEETEHEEOHE SETHE SHOEHEH OSES H OO EHHEHEOOHOEEHSEHHO SOSH SE SESE EOOEOHSSSOETEEEEEHHETEHEETEEEHEEOEEEHSOSHEE OS EOHHESOEEHEEESEEEDEDEE Luminex has made coupling of antibodies or other proteins easy with the xMAP Antibody Coupling AbC Kit containing all of the reagents necessary to covalently couple antibodies or other proteins to Luminex MagPle
145. se the manual inversion wash method Take care not to disturb the microspheres c Repeat steps a and b above 20 Remove the plate from the magnetic separator and resuspend the microspheres in 50 uL of Assay Buffer by gently pipetting up and down several times with a multi channel pipettor 21 Dilute SAPE reporter to 4 ug mL in Assay Buffer 22 Add 50 uL of the diluted SAPE to each well Note 50 uL of diluted SAPE is 23 Mix the reactions gently by pipetting up and down several times with a multi required for each reaction channel pipettor 24 Cover the plate and incubate for 30 minutes at room temperature on a plate shaker set to approximately 800 rpm 25 Place the plate into the magnetic separator and allow separation to occur for 30 60 seconds 26 Use a multi channel pipette to carefully aspirate the supernatant from each well Take care not to disturb the microspheres Chapter 4 1 1 Capture Sandwich Immunoassay www luminexcorp com Page 45 BR_574 01_0613 27 Leave the plate in the magnetic separator for the following wash steps a Add 100 uL Assay Buffer to each well b Use a multi channel pipette to carefully aspirate the supernatant from each well or use the manual inversion wash method Take care not to disturb the microspheres c Repeat steps a and b above 28 Remove the plate from the magnetic separator and resuspend the microspheres in 100 uL of Assay Buffer by gently pipetting up and down several times with a multi
146. shed vs homogeneous and evaluate the performance of the optimized assay with test samples The assay results below are specific with lt 1 cross reactivity among the cytokine targets Cross reactivity was calculated using the median fluorescence intensity MFI of individual and multiplexed detection antibodies and capture antibody coupled beads in the presence of single antigen at the third highest concentration in the standard curve Target IL 4 IL 6 IL 8 IL 4 IL 6 IL 8 a e s a o woo poo o o wooo o a o o ea e e o o Sensitivity Limit of Detection Precision and Linearity The working assay range will also need to be determined during assay development Limit of Blank LoB Limit of Detection LoD and Limit of Quantitation LoQ are used to determine the smallest concentration of a measurand that can be reliably measured by an analytical procedure LoD is the lowest analyte concentration likely to be reliably distinguished from the LoB and at which detection is feasible LoD is determined by utilizing both the measured LoB and test replicates of a sample known to contain a low concentration of analyte LoB is the highest apparent analyte concentration expected to be found when replicates of a blank sample containing no analyte are tested LoQ is the lowest concentration at which the analyte can not only be reliably detected but at which some predefined goals for bias and imprecision are met The LoQ may be equival
147. spheres with low background to test hybridization buffers for contamination 5 Replace all coupling buffers and recouple Low Bead Count 1 Microsphere Mix was diluted incorrectly Make sure the Microsphere Mix is vortexed thoroughly and prepared correctly 2 Beads were lost during washes When using a manual wash make sure the assay plate is properly seated in the magnetic separator Make sure you selected a suitable magnetic separator based on the type of plate and reaction volumes used in the assay Guidelines for plate selection can be found at http www luminexcorp com blog selecting the right plate magnet for luminex assays and in Appendix B Be careful not to hold the pipette tip immediately above the beads bead pellet be sure to aim away from the pelleted beads Carefully remove the supernatant slowly When using automatic plate washers make sure the washer settings are programmed according to the plate washer s User s Manual and the appropriate separator is used 3 Incorrect probe height adjustment Adjust probe height according to the instruments User s Manual Chapter 5 1 4 Direct DNA Hybridization Sequence Detection Note Some of these problems and solutions will be unique to the chemistry used to generate labeled targets and not all are addressed in the following recommendations www luminexcorp com Page 102 BR_574 01_0613 4 Incorrect protocol set up on the Luminex instrument Make sure correct bead reg
148. ssays www luminexcorp com Page 42 BR_574 01_0613 Chapter 4 1 1 Capture Sandwich Immunoassay The following immunoassay protocol presumes that the user is familiar with general assay development and optimization including microsphere bead coupling Assay Principle and Overview A capture sandwich immunoassay is used to detect an antigen target with the use of a capture antibody attached to the surface of a microsphere and a detection antibody that incorporates a fluorescent label forming a sandwich This assay is commonly used to measure a large number of hormones blood products enzymes drugs disease markers and other biological molecules The general steps to performing a sandwich immunoassay with xMAP Technology are as follows Summary of Protocol Add capture anti body coupled micro spheres Add labeled detection antibody Add antigen containing sample Wash microspheres w Assay Buffer Wash microspheres w Assay Buffer Read 50 uL on Luminex analyzer Chapter 4 1 1 Capture Sandwich Immunoassay www luminexcorp com Page 43 BR_574 01_0613 Technical Notes POCO OSE HOHE HOSE EEHOHHE SESE OO HOE EES OOHEE HOES SO SSOE EO OHOEE ESOS EOS OOEO EEE E SOSH E HEHE EE ESOE ET OHSEE ETOH TOSSES HOSE E OOOH EE SOOT ETEEEE SESE ESOEHEEHOEEESESSOEEDEDEE For Capture Sandwich immunoassays 2 4 ug mL detection antibody is usually sufficient however up to five fold more detecti
149. t e g antibody or protein etc should then be purified of extraneous primary amines prior to chemical coupling to the microspheres which are then washed and resuspended in buffer Coupled beads should be enumerated with a hemocytometer or other device to estimate the resulting bead count in the stock solution eee erec eee cece ere ec eee er ee eee eee eee eee cere eee eee eee ee Figure 12 Figure 12 Common assay formats for ue immunoassays include A capture C 3 sandwich assay requiring two A monoclonal antibodies to your analyte target B competitive antibody assay S p Y y requiring a single antibody and a labeled positive target and C indirect antibody assay or serology assay requiring both a Capture Sandwich Competitive Assay Indirect Serological Assay yt SY y req amp target protein and an anti IgG antibody Microsphere coupling reactions are then confirmed in the assay buffer system using an appropriate detection reagent The background fluorescence should be assessed in the target matrix to evaluate nonspecific binding and cross reactivity and positive control reagents similar to the sample should be used to assess positive binding reactions sensitivity and specificity Monoplex microspheres can then be combined into a multiplex assay testing for new non specific binding cross reactivity or loss of signal in multiplex conditions Chapter 4 1 Common xMAP Immunoa
150. t with the use of a capture protein antigen and a detection antibody This assay is useful for serology assays where serum antibodies are measured to determine infection allergy or autoimmune activity The general steps to performing a serology immunoassay with xMAP Technology are as follows Summary of Protocol Add capture Add antibody Wash microspheres w antigen coupled containing sample Assay Buffer microspheres Add labeled detection Wash microspheres w antibody Assay Buffer Chapter 4 1 3 Indirect Serological Immunoassay Read 50 uL on Luminex analyzer www luminexcorp com Page 51 BR_574 01_0613 Technical Notes POCO OCS OHHH E HOHE EEHEHH OE ESOEE SOHO ES OOHEE HOES SO SSOE HOHE EO SOSE EOS OOEOEEEH EES OSHS OSEEEE SESE TOTS E ETOH TOSSES OSE E ESHEETS SOSEEETEEEE SHEET ESOEHEEHOEE EEE ESOEED OEE e For Indirect Serological immunoassays 2 4 ug mL detection antibody is usually sufficient however up to five fold more detection antibody may be required for a no wash assay format To optimize detection antibody concentration for washed assays we recommend starting with 4 ug mL and titrating down to 1 ug mL by two fold dilutions The optimal detection antibody concentration will depend on specific reagents and level of multiplexing Concentrations often need to be increased when increasing the number of multiplexed assays and when converting to a no wash assay format e The reporter concentration should be approx
151. t need to be uniquely and specifically addressed in multiplex assays in order to ensure optimal results Understanding the biological range of each analyte the binding specificity of assay reagents and the unique makeup of your sample plasma culture media urine etc allows you to develop the most effective multiplex assay Assay conditions such as buffer system blocking agents sample volume and dilution total reaction volume number of microspheres per reaction 2000 5000 per region per well concentration of capture reagent for coupling detection antibody and reporter concentration assay format washed vs unwashed and incubation times should be optimized to provide best results according to the specific assay requirements The final assays performance should be evaluated and validated with known samples Concentrated biological samples and samples of a highly complex nature such as serum plasma or tissue lysates should be diluted at least 1 5 to prevent interference or microsphere agglutination from matrix effects Any reagents that show interference cross reactivity or poor performance should be replaced Optimization of assay performance and meeting requirements for sensitivity dynamic range ease of use and time to result should be kept in mind when developing the multiplexed assay These factors and others are described in more detail below Amount of detection antibody POCO HS SOOT SEES ESEHHE SETHE SOOEHO EES OSH EEO
152. tal results for oligo coupling as measured by a Luminex analyzer Results show that 0 2 nmol for a 5 million microsphere coupling yielded highest MFI values Optimal amount for typical coupling is usually 0 2 to 1 nanomole per 5 million microspheres eoeeee eee eee eee eee eee eee eee eee eee eee esses eseeeeeeee www luminexcorp com Page 26 BR_574 01_0613 To determine the optimum ratio for scaled up or for smaller coupling reactions use the following table as a guide for adjusting the amount of reagents used in the coupling reactions Recommendations for Scaling Oligonucleotide Microsphere Coupling Number of Reaction Probe Input EDC Tween 20 SDS Wash Final Volume Microspheres Volume Concentration Wash Volume Volume 1x 10 10 uL 0 04 0 1 nmol 0 5 2 5 mg mL 0 5 mL 0 5 mL 20 uL 2 5 x 10 25 uL 0 1 0 2 nmol 0 5 1 mg mL 0 5 mL 0 5 mL 50 uL 5x105 50 uL 0 2 1 nmol 0 5 1 mg mL 1 0 mL 1 0 mL 100 uL 10 x106 50 uL 0 5 1 nmol 0 5 1 mg mL 1 0 mL 1 0 mL 200 uL 50 x 10 50 100 uL 1 4 nmol 0 5 1 mg mL 1 0 mL 1 0 mL 1000 uL 100 x 10 100 uL 1 4 nmol 0 5 1 mg mL 1 0 mL 1 0 mL 2000 uL a We recommend titrating the probe input to optimize coupling for the particular application b EDC input was not adjusted for reactions containing less than 5x10 microspheres c Resuspension volume of TE pH 8 0 for 50 000 microspheres uL assuming 100 recovery Oligonucleotide coupling references eecoococosoocosoooocoooooooocooooooocoooooooosooooo
153. te at One Excitation Observe Three Emission LLLA 10 0 0 0 0 0 0 0 0 0 Wavelength Wavelengths LOPS SES SSE SL SCS eee eee eee Chapter2 xMAP Technology www luminexcorp com Page 5 BR_574 01_0613 Figure 2 Figure 2 In addition to detection of internal bead dyes shown in Figure 1 A A a second excitation wavelength allows observation of a separate fluorescent reporter molecule B that allows detection of a biological assay on the Excite at One Excitation Observe One Emission surface of the microsphere Wavelength Wavelength Multiple light sources inside the Luminex analyzer excite 1 the internal bead dyes that identify each microsphere particle and 2 any fluorescent reporter molecules captured during the assay The instrument records dozens of readings for each bead set and produces a distinct result for each analyte in the sample Using this process XMAP Technology allows multiplexing of up to 500 unique bioassays within a single sample both rapidly and precisely This revolution in multiplex biological assays has been licensed by Luminex to a number of kit developers in the clinical diagnostics pharmaceutical and life science research markets Commercially available kits include molecular diagnostics immunodiagnostics kinase profiling cytokine chemokine genotyping gene expression and others In addition to commercial kits Luminex supports custom assay development This document is asummary of methods a
154. ter intermediate The reactive intermediate is then replaced by reaction with the primary amine of the target molecule antibody or peptide to form a covalent amide bond Oligonucleotide coupling is a one step process where microsphere carboxyl groups activated by EDC form a covalent amide bond with primary amines on amine modified oligonucleotides Chapter 3 3 Microsphere Coupling www luminexcorp com Page 11 BR_574 01_0613 xMAP Antibody Coupling AbC Kit MagPlex TAG Microspheres LumAvidin Microspheres A number of factors affect the coupling chemistry Some common additives to proteins and buffers can interfere with the coupling reaction including amine containing compounds such as Tris BSA or azide In addition glycerol urea imidazole and some detergents may also interfere with coupling chemistry Any of these compounds should always be removed from the protein peptide or oligonucleotide as purified materials are most commonly used Common antibody purification methods include Protein A Protein G ion exchange size exclusion and analyte specific affinity chromatography Affinity purification is the method of choice as it reduces nonspecific immunoglobulins and other interfering molecules In some cases where interfering substances cannot be removed such as detergents or urea a sufficient dilution of the agent to be coupled can be performed to improve coupling efficiency Oligonucleotide purification method
155. ti A Ferro H Alder G He A Vecchione C M Croce C L Shapiro and K Huebner 2013 Integrated microRNA and mRNA signatures associated with survival in triple negative breast cancer PLoS One 8 2 e55910 Jang J S V A Simon R M Feddersen F Rakhshan D A Schultz M A Zschunke W L Lingle C P Kolbert and J Jen 2011 Quantitative miRNA expression analysis using fluidigm microfluidics dynamic arrays BMC Genomics 12 144 Marco Ragusa R C Andrea Russo Lidia Puzzo Teresio Avitabile Antonio Longo Mario D Toro Cinzia Di Pietro Michele Purrello Michele Reibaldi 2013 MicroRNAs in vitreus humor from patients with ocular diseases Molecular Vision 19 430 440 Naduparambil Korah Jacob J V C Tamara N Yee Jidhin Jacob Hansjuerg Alde Priyankara Wickramasinghe Kirsteen H Maclean Arnab Chakravarti 2013 Identification of Sensitive Serum microRNA Biomarkers for Radiation Biodosimetry PLoS One 8 2 Sorensen K 2011 Individualized miRNA Assay Panels Using Optically Encoded Beads Next Generation MicroRNA Expression Profiling Technology Next Generation MicroRNA Expression Profiling Technology Methods and Protocols J B Fan Humana Press 822 131 141 Taylor C J S N Satoor A K Ranjan M V Pereira e Cotta and M V Joglekar 2012 A protocol for measurement of noncoding RNA in human serum Exp Diabetes Res 2012 168368 Chapter 51 5 MicroRNA Anal
156. tion as possible about the antibodies or proteins Request that the vendor provide purity information from SDS and non denaturing PAGE Also Chapter 4 3 Proteomics FAQ s www luminexcorp com Page 69 request profiles of the antibody from capillary isoelectric focusing to compare lots from the same vendor Luminex recommends that you devise your own incoming materials quality control procedure to compare lots from antibody suppliers See other references for sources for antibody pairs Bjerre M Hansen T K Flyvbjerg A and Tonnesen E Simultaneous detection of porcine cytokines by multiplex analysis Development of magnetic bioplex assay Vet Immuno Immunopathol 2009 130 53 8 Carson R T and Vignali D A A Simultaneous quantitation of 15 cytokines using a multiplexed flow cytometric assay J Immunol Methods 1999 227 41 52 de Jager W te Velthuis H Prakken B J Kuis W and Rijkers G T Simultaneous detection of 15 human cytokines in a single sample of stimulated peripheral blood mononuclear cells Clin Diagn Lab Immunol 2003 10 133 9 de Jager W Prakken B J Bijlsma J W J Kuis W and Rijkers G T Improved multiplex immunoassay performance in human plasma and synovial fluid following removal of interfering heterophilic antibodies J Immunol Methods 2005 300 124 35 de Jager W Bourcier K Rijkers G T Prakken B J and Seyfert Margolis V Prer
157. tions Jrom prolonged exposure to lig described in the Product Information Sheet provided with your microspheres 2 Remove an aliquot of 25 x 10 of microspheres and pellet by centrifugation at 24000 g for 2 min or by using a magnetic separator and remove Supernatant 3 Resuspend the pelleted microspheres in 1 mL of 0 1 M MES pH 6 0 by vortex and sonication for approximately 20 seconds 4 Transfer the resuspended microspheres to a recommended microcentrifuge tube and pellet the microspheres by microcentrifugation at 28000 g for 1 2 minutes or by using a magnetic separator and remove supernatant 5 Resuspend the microspheres in 1 mL of 35 mg mL ADH diluted in 0 1 M MES pH 6 0 by vortex 6 Add 200 uL of 200 mg mL EDC prepared immediately before use in 0 1 M MES pH 6 0 and mix by vortex 7 Incubate for 1 hour with mixing by rotation at room temperature 8 Pellet the microspheres by microcentrifugation at 28000 g for 1 2 minutes or by using a magnetic separator and remove supernatant 9 Resuspend the pelleted microspheres in 1 mL of 0 1 M MES pH 4 5 by vortex 10 Pellet the microspheres by microcentrifugation at 8000 g for 1 2 minutes or by using a magnetic separator and remove supernatant Repeat for a total of 3 washes with 1 mL of 0 1 M MES pH 4 5 12 Resuspend the ADH modified microspheres in 1 mL of 0 1 M MES pH 4 5 and store refrigerated at 2 8 C in the dark throughout this procedure Chapter 4 2 2
158. to capture in an assay Below is a standard coupling protocol for 5 million MagPlex Microspheres Coupled microsphere stability depends on the stability of the coupled nucleic acid but when properly stored coupled microspheres are usually stable for more than 1year The protocol for coupling amine modified oligos to beads only takes a few hours and can be scaled up when the optimum ratio of beads to oligo preparation has been determined Chapter 3 3 3 Nucleic Acid Coupling www luminexcorp com Page 19 BR_574 01_0613 Summary of Protocol Add microspheres Wash microspheres Add Add EDC solution to reaction tube with MES buffer oligonucleotide Incubate for Add 2nd EDC Incubate for Add Tween 20 30 minutes solution 30 minutes buffer Wash microspheres with SDS buffer and resuspend microspheres w TE buffer Materials Needed Reagents and Consumables Vendor For complete equipment and materials list see Appendix B MagPlex Microspheres Luminex Cjiqgma DO JISIid F 1 Ethyl 3 3 dimethylaminopropyl carbodiimide hydrochloride EDC Pierce 77149 D Ea nL 2 i DUTTEYr DA O U Distilled deionized H2O ddH20 molecular grade Any suitable source eoeereeee eee eee eee eee eee ees e eee eee ees eseeeeseeeeeseeeeeeeeseeeeeeeeeeeeeeeeeeeeeseeeeeeeeeeeeoeeeeeeeeeeseeeeeeeseeeeseeeeeeeeeeeeeeeeeeeeeZeeeeeo eee Eo EHO EOE OOH OHO OHO HEHEHE ORE OHHH ES Chapter 3 3 3 Nucleic Acid Coupling www luminexcorp com Page 20
159. to a complete biotinylated reporter molecule If the OLA TAG probe 3 base is not complementary to the SNP variant base little or no ligation occurs and no significant signal is generated for analysis Note that OLA probes do not have primer binding sites for PCR amplification as with other ligation chemistries With this chemistry signal amplification is achieved by prior amplification of genomic target regions and multiple cycles of the ligation reaction Figure 14 OLA Probe Design Figure 14 Oligo Ligation Assay OLA involves two target specific probes Amplified genomic target region PALEE PEER that align adjacent to one another A ee e k allowing enzymatic ligation if an exact match occurs at the target SNP site N QO a G Incorporation of TAG sequences enables A capture of each possible allele to a unique MagPlex TAG microsphere beads a e es OLA TAG Probes OLA Reporter Probe Chapter 5 1 1 Oligo Ligation Assay OLA SNP Typing www luminexcorp com Page 78 BR_574 01_0613 Materials Needed Reagents and Consumables MagPlex TAG Microspheres Primers for PCR amplification of gDNA target regions OLA TAG primers with 5 TAG sequence and biotinylated OLA reporter primers Qiagen HotStar Taq 2X Master Mix Taq DNA Ligase and 10X Ligase Buffer dNTPs stocks 2X Tm Hybridization Buffer 1X Tm Hybridization Buffer streptavidin R phycoerythrin SAPE 96 well PCR Plate
160. ture molecules and poor reproducibility may limit its broader application in the clinical or research laboratory Solution phase multiplex assays remain highly desirable to laboratories due to the following benefits reduced sample volume and other redundant consumables more data from the same amount of labor faster results due to solution phase kinetics Chapter1 Introduction www luminexcorp com Page 4 BR_574 01_0613 Chapter 2 In the late 1990 s scientists at Luminex invented xMAP Technology a major xMAP Technology Name Origin advance in multiplexed biological assays xMAP Technology draws from the strengths of solid phase separation technology but without the typical limitations x biomarker or disease panel of solid phase reaction kinetics By combining advanced fluidics optics and to be tested digital signal processing with proprietary microsphere bead technology xMAP MAP Multi Analyte Profiling xMAP multiplex biological testing of Technology enables a high degree of multiplexing within a single sample volume up to 500 analytes in a single Featuring a flexible open architecture design x MAP Technology can be configured sample volume to perform a wide variety of assays quickly cost effectively and accurately How does xMAP Technology work POPP OEE SOOO SEO EE EEE TEETH HOSE EOEEOE ETO OEEETOOEE TE TEEEHTOOEEE TOTO EEO OE EE SOOEE TOTO EEETEOE HEHEHE OTOH OOOH ETOOEE TOTO EHEOEEE
161. uld yield at least 10 000 MFI at standard PMT setting or on MAGPIX instrument at saturation for optimal use in immunoassays Protocol 3 3 2 antibody coupling confirmation POCO OHSS OHH E HOES EEEEHEE EHO TEETH EE SOSH EEO OOEEE OEE E EES SETHE SETHE ES HHEEESOOSO SOTHO OOEOOE SOOTHES ESOS OE SOOTESESEO ES OOHEOOSEOES SOTO T OSHS ESOOEEEEEEEE EE ESOEESEOES 1 Select the appropriate antibody coupled microsphere set or sets 2 Resuspend the microspheres by vortex and sonication for approximately 20 seconds 3 Prepare a working microsphere solution by diluting the coupled microsphere stocks to a final concentration of 50 beads uL in Assay Buffer 4 Prepare a solution of phycoerythrin labeled anti species IgG detection antibody at 4 ug mL in Assay Buffer Prepare a 1 2 dilution series of that detection antibody solution to a concentration of 0 0625 g mL as shown in the following table Dilution Volume of PBS 1 Volume of Detection Concentration Tube BSA Antibody 1 1 4 ug mL 1 2 500 uL 500 uL from Tube 1 1 2 ug mL 1 4 500 uL 500 uL from Tube 1 2 1 ug mL 1 8 500 uL 500 uL from Tube 1 4 0 5 ug mL 1 16 500 uL 500 uL from Tube 1 8 0 25 ug mL 132 500 uL 500 uL from Tube 1 16 0 125 ug mL 1 64 500 uL 500 uL from Tube 1 32 0 0625 ug mL 5 Aliquot 50 uL of the microsphere solution prepared in Step 3 into each well in Js columns of the 96 well plate 16 wells total 6 Add 50 uL of Assay Buffer as a blank sample into the wells i
162. ultiplexing with xMAP beads often allows this chemistry to be more reliable than other applications for typing SNP variations in the same reaction Chapter 5 1 2 Allele Specific Primer Extension ASPE SNP Typing Ce o Figure 15 Allele Specific Primer Extension ASPE involves target specific primer with 3 bases matching the possible SNP alleles of interest A A primer anneals to the target region with its 3 end aligned at the SNP site B If the primer finds a perfect match at the 3 base as with TAG1 probe then DNA polymerase is able to extend the primer thereby incorporating labeled dNTP s downstream Primers with a 3 mismatch at the SNP site as with TAG2 probe are not extended and no labeled dNTPs are incorporated Inclusion of TAG sequences enables capture of each possible allele to a unique MagPlex TAG Microsphere bead www luminexcorp com Page 85 BR_574 01_0613 Figure 16 Amplifications of gDNA target regions of interest Chr 1 pair Chr 2 pair Hs Chr 3 pair Chr 4 pair Chr 5 pair Targeted PCR Chr 7 pair Materials Needed POPP OOS SEO EE SOEEOTO CEE H SOHO ESOL EE EO TOEHETEHEEE SOOO T ETOH HEOOEET HELE T ETOH OTHE TOTO THSOTETESOTEEEOTEEEHTOOEEETOOEETESEEEHESEEEE TELE ESELOEE ELE EEE ES EEEEEEEEOSEEEOED Reagents and Consumables Vendor MagPlex TAG Microspheres Primers for PCR amplification of gDNA target regions ASPE primers with 5 TAG sequence
163. umAvidin beads are not magnetic and require MultiScreen Filter Plates Millipore MABV N12 and vacuum pump system manifold for vacuum pump system such as the MultiScreen Resist Vacuum Manifold from Millipore MAVMO960R eoecee eee se eee eee eee eee eee eee eee eee ees eee eeeeeeeseeeeeeeeseeeeeeeeeeeeeeeeeeeeeseeeeeeeeeeeeoeeeeeeeeeeseeeeeeeseeoeeseeeeeeeeee eee eee eo HOHE HOH HHH HEHEHE HEHEHE HOHE HOHE HEHE OEE HOHE O HEHEHE OEE OS Appendix B Equipment needed for xMAP protocols www luminexcorp com Page 114 BR_574 01_0613 Magnetic Separators for MagPlex Microspheres with compatible tubes and plates POPP eee SEO ESE EEE EEE EE EEE HEE EHO EEEEEEEEH OE EOEEESEOEE HH EEEOOTEOEE THOSE EEEEEEOSOEEOEHEEEHE SETHE HOHE EETEEEE EEO ES OOEEEHOEHOE LOSE HE EEE ELEEELELOEEEEEOEE EEE EEEOEE SOLES Product Use Source Compatible Tube Luminex Magnetic Tube Separator Coupling Luminex Corporation CN 0288 01 1 5 mL co polymer microcentrifuge tubes USA Scientific 1415 2500 Dynal MPC S magnetic particle Coupling Life Technologies A13346 1 5 mL co polymer microcentrifuge tubes USA concentrator Scientific 1415 2500 Product Use Source Compatible Plates Luminex magnetic plate separator Assays Luminex Corporation CN 0269 01 96 well round bottom polystyrene solid plates Costar 3789 or 3792 LifeSep 96F magnetic separation unit Assays Dexter Magnetic Technologies Inc 96 well round bottom polystyrene solid plates 2501008 Costar
164. umables Vendor MagPlex Microspheres oligonucleotide coupled 1 5X TMAC Hybridization Solution See Appendix A 1X TMAC Hybridization Solution See Appendix A TE Buffer pH 8 0 Sigma T9285 96 well bead hybridization plate Corning Costar 6509 Biotin labeled complementary oligonucleotide targets Any suitable source streptavidin R phycoerythrin SAPE Moss SAPE 001G75 Life Technologies S 866 or equivalent RNase DNase Free Microcentrifuge Tubes 1 5 mL USA Scientific 1415 2500 or Eppendorf Lo Bind 022431081 MicroSeal A BioRad MSA5001 Brayer roller soft rubber or silicon USA Scientific 9127 2940 Disposable pipette tips multi and single channel 2 1000 mL Any suitable brand Distilled deionized H O ddH O molecular grade Any suitable source A protocol for verifying oligonucleotide coupling is provided below A dose response increase in MFI should be observed as concentration of labeled target oligonucleotide increases In general an oligonucleotide coupling should yield at least 10 000 MFI standard PMT or MAGPIX at saturation for optimal use in hybridization assays Protocol 3 3 4 oligonucleotide coupling confirmation POCO OH SEE HE SEE OEEOE ETOH TEE EEO EEO ET OEE OEE S SESE E CESS EE SEES EET OESE SETHE SETHE ETE OOE SEH TOEEEEEEH EES ETSE TEESE TEETH TEETH CEES ESEEEEHEESEHSOEEOEHE LESSEE EEEEEEEEEEOE ES ENEE 1 Select the appropriate individual MagPlex coupled bead sets and resuspend by vortexing and sonication for 20 sec
165. uman serum J Pharm Biomed Anal 2005 36 1037 44 Rizzi G Zhang Y J Latek R Weiner R and Rhyne P W Characterization and development of a Luminex based assay for the detection of human IL 23 Bioanalysis 2010 2 1561 72 Skogstrand K Thorsen P Norgaard Pedersen B Schendel D E Sorensen L C and Hougaard D M Simultaneous measurement of 25 inflammatory markers and neurotrophinsin neonatal dried blood spots by immunoassay with xMAP technology Clin Chem 2005 51 1854 66 Wood B O Halloran K and VandeWoude S Development and validation of a multiplex microsphere based assay for detection of domestic cat Felis catus cytokines Clin Vaccine Immunol 2011 doi 10 1128 CV1 00289 10 Chapter 4 3 Proteomics FAQ s www luminexcorp com Page 70 Should peptides be synthesized with a linker PCOS S OHHH OSES ESOHHEE EHO OO HOE EES OOHE ES OOEE EO ESOE ESOS ESOS SOTO OS EOOEE SOSH EH HEEEE SESE TOTS ESOS OS OOTE SHOE EOSEESEESSOSE SETS EO SHEET ESOOHES HOES EE ESSE DOES Putting the linker on the beads makes peptide synthesis easier and cheaper e Adding a linker with a terminal amine on the peptide for coupling to carboxylated microspheres is a suitable alternative Does an assay involving peptides require alternate assay buffers t depends upon the assay format f assaying for peptide specific antibodies then a normal immunoassay buffer should suffice like PBS BSA W
166. uting SAPE to 2 8 ug mL in 1X TMAC Hybridization Solution Place plate on plate magnet for 30 60 seconds to pellet the microspheres After beads have collected on side of wells carefully remove the supernatant Remove plate from the plate magnet and return the sample plate to hybridization temperature Add 75 uL of Reporter Mix to each well and mix gently by pipetting up and down several times Incubate the reaction plate at hybridization temperature for 5 minutes Analyze 50 uL at hybridization temperature on the Luminex analyzer according to the system manual Chapter 51 4 Direct DNA Hybridization Sequence Detection Note Microspheres should be protected from prolonged exposure to light throughout this procedure Note If needed an Excel based bead calculator is available for determining the method and volumes needed for making the Working Microsphere Mixture Note Use the optimum hybridization temperature for the target sequences in the mix Note 75 uL of Reporter Mix is required for each reaction Note An 8 channel pipettor can be used to extract the supernatant in 8 wells simultaneously www luminexcorp com Page 101 BR_574 01_0613 Recommendations for Optimization and Troubleshooting POCO ESE HHH THOSE EHHOHHE SESE TOTO ES OOHEE ESOS SHES ESOS EO SOSE EOS OEEE SHOES SOSH EHSOEEE SESE SOTO E ESOS ESOOTE SHOE E HOES EESSOSEEETOOTO SHEET ESOOHESHSEEEEEESOEEDOEE Low Reporter Intensity 1 Verify coupling
167. wall skirted PCR Plates 384 well twin tec PCR plate 96 well microplate aluminum sealing tape Microseal A film Coupling Coupling Coupling Protein Unheated assays Protein Unheated assays Nucleic Acid Heated Protein Unheated Protein Unheated Protein Unheated Nucleic Acid Heated Nucleic Acid Heated Nucleic Acid Heated Nucleic Acid Heated Nucleic Acid Heated Nucleic Acid Heated Appendix B Equipment needed for xMAP protocols Analyzer s Luminex 100 200 FLEXMAP 3D MAGPIX Luminex 100 200 FLEXMAP 3D MAGPIX Luminex 100 200 FLEXMAP 3D MAGPIX Luminex 100 200 FLEXMAP 3D MAGPIX Luminex 100 200 FLEXMAP 3D MAGPIX FLEXMAP 3D FLEXMAP 3D FLEXMAP 3D FLEXMAP 3D FLEXMAP 3D FLEXMAP 3D MAGPIX Luminex 100 200 FLEXMAP 3D MAGPIX USA Scientific Eppendorf Samco Scientific Corning Costar Corning Costar Corning Costar EMD Millipore Greiner Bio One Greiner Bio One Corning Costar Thermo Scientific Bio Rad Eppendorf Corning Costar Bio Rad Catalog Number 1415 2500 22431081 233 3912 3915 3789 3792 6509 MABVN1250 655096 781906 3757 AB 2384 HSP 3805 951020702 6570 MSA 5001 Good for removing supernatant from coupling wash steps Can be used for washes with vacuum filtration for LumAvidin nonmagnetic beads www luminexcorp com Page 116 BR_574 01_0613
168. x Microspheres beads in approximately three hours Alternatively LumAvidin Microspheres are xMAP Microspheres pre coupled with avidin to allow simple non covalent binding of biotinylated targets such as peptides without having to chemically couple the reagents For users wishing to couple xMAP Microspheres with antibodies or other proteins without the xMAP Antibody Coupling AbC Kit below is a standard coupling protocol for 5 million MagPlex Microspheres Coupled microsphere stability depends on the stability of the coupled protein but when properly stored coupled microspheres are usually stable for more than 1 year Summary of Protocol Add microspheres Wash microspheres Add monobasic Incubate for 20 to reaction tube with water sodium phophate minutes sulfo NHS and EDC solutions Wash microspheres Add antibody or Incubate for 2 hr Wash and resus with MES protein pend microspheres with PBS TBN Chapter 3 3 1 Antibody and Protein Coupling www luminexcorp com Page 13 BR_574 01_0613 Materials Needed For complete equipment and Reagents and Consumables Vendor materials list see Appendix B MagPlex Microspheres Luminex Antibody Protein to be coupled Any suitable source 1 Ethyl 3 3 dimethylaminopropyl carbodiimide hydrochloride EDC Pierce 77149 Sulfo NHS Pierce 24510 500 mg or 24520 8 x 2 mg No Weigh Format Activation Buffer 1 0 1 M NaH PO pH 6 2 Sigma 53139 Coupling Buffer 2 50 mM ME
169. x 10 nM each probe 1 25 ul 1 25 uL x N 20 Total volume 20 0 ul 20 0 uL x N 20 2 Pipette 20 0 ul of the sample master mix to appropriate wells of a 96 well PCR plate 3 Seal plate with MicroSeal A with a brayer to secure the seal Vortex for 5 seconds followed by quick spin to ensure all reagents are at the bottom of the wells 4 Cover plate with silicon mat and place in thermal cycler programmed with the step down profile using the following parameters 90 C for 3 minutes 80 C for 6 minutes Program to drop 1 C every 6 minutes until 60 C is achieved i e steps will be 80 for 6 minutes then 79 C for 6 minutes then 78 C for 6 minutes etc to 60 C 37 C and HOLD until user intervention see steps 5 and 6 below 37 C for 30 minutes after user intervention 30 C and HOLD for user intervention see steps 7 to 9 below 30 C for 30 minutes END 5 Atthe 37 C HOLD step pause the thermal cycler and add 4 ul of the bead mix to each well Mix well by pipetting up and down or remove the re sealed plate vortex for 10 to 15 seconds and quick spin for 1 2 seconds Note See miRNA Buffer and Reagent Recipes on how to make the bead mix The bead mix should deliver at least 1000 beads region for each reaction 6 Resume step down program 37 C for 30 minutes 7 Nuclease Enzyme digestion 5 min prior to the completion of the 37 C bead hybridization step prepare a 1 500 dilution of the stock nuclease enzyme using th
170. ysis www luminexcorp com Page 111 BR_574 01_0613 Appendix A Common buffers used in xMAP protocols xMAP Buffers Buffer Activation Buffer Coupling Buffer Phosphate buffered saline PBS pH 7 4 PBS Tween buffer PBS BN buffer PBS TBN buffer Assay Wash Buffer 0 1 M MES Buffer pH 4 5 0 02 Tween 20 Wash 0 1 SDS Wash EDC TE Buffer pH 8 0 2X Tm Hybridization Buffer 1X Tm Hybridization Buffer 1 5X TMAC Hybridization Solution Composition 0 1 M NaH PO pH 6 2 50 mM MES pH 5 0 138 mM NaCl 2 7 mM KCI pH 7 4 PBS 0 05 Tween 20 pH 7 4 PBS 1 BSA 0 05 sodium azide PBS 0 1 BSA 0 02 Tween 20 0 05 sodium azide PBS 1 BSA pH 7 4 0 1 M MES 0 02 Tween 20 0 1 SDS 1 Ethyl 3 3 dimethylaminopropyl carbodiimide hydrochloride EDC Te 0 2 M Tris pH 8 0 0 4 M NaCl and 0 16 Triton X 100 0 1 M Tris pH 8 0 0 2 M NaCl and 0 08 Triton X 100 4 5 M TMAC 0 15 Sarkosyl solution 75 mM Tris HCL 6 mM EDTA pH 8 0 Appendix A Common buffers used in xMAP protocols Microsphere bead activation buffer for protein coupling Microsphere protein coupling buffer Alternate microsphere protein coupling buffer Microsphere wash buffer Microsphere blocking storage buffer Assay buffer Microsphere blocking storage buffer Microsphere wash buffer Assay buffer Assay buffer Oligonucleotide microsphere coupling buff

xMAP® Cookbook

Contents

Download Pdf Manuals

Related Search

Related Contents

xMAP&reg; Cookbook

Contents

Download Pdf Manuals

Related Search

Related Contents

xMAP® Cookbook