Home

CodonCode Aligner User Manual

1. When Unassemble existing contigs assemble from scratch lis selected any contigs in your selection will be unassembled before assembly and gaps in the samples will ibe removed Help Cancel Choose Unassemble existing contigs assemble from scratch the click on Assemble Aligner will first unassemble the contigs you selected and then assemble all the samples in the contig s and any other samples you had selected You will see a progress dialog while Aligner is assembling Note that the resulting number of contigs may be different from the initial number of contigs if you want to just re assemble contigs without merging the contig with other samples make sure to just select one contig before choosing Assemble from Scratch If your selection contained only unassembled samples assemble from scratch will do exactly the same thing as Assemble would unless you also have preprocessing options selected Compare contigs to each other A common DNA sequencing application is to first sequence the genes from several sources for example different species or patients and to then compare align the consensus sequences to each other CodonCode Aligner allows you to do this by creating contigs of contigs as follows e Assemble the contigs separately for example generating one contig from several forward and reverse reads for each species e Select the contigs you want to compare in the proj
2. A typical use example is a group of several scientists who want to share a locked set of preferences so that all analyses will be performed with the same settings This can be done as follows 1 Change all preferences to the desired settings 2 Open the Preferences dialog and select Preference options on the left 3 Save a copy of the preferences by using the Save copy button The following dialog will appear Preference Options 205 CodonCode Aligner User Manual eoo Allow Changes Should users be allowed to make changes to this saved settings file You may want to select No if this saved copy will be shared by multiple users who should always use the same settings Allow Changes A on t Allow Changes If you want to protect the saved file against changes press the Don t Allow Changes button A Save As dialog will be shown next where you can choose the name and location the preferences are saved to Choose a folder that all users can access for example on a file server or shared disk 4 Each user that want to use the shared preferences now has to choose this file by starting CodonCode Aligner opening the Preference options dialog and clicking the Select button After selection the locked shared preferences file they will see the following dialog eoo Preferences Not Changeable dom The custom preferences file you selected is non modifiable Changes you make to these preferences wil
3. Go to the Sample menu and select Find Heterozygous Indels When Aligner is done with the previous step select the Unassembled Samples folder in the project view Go to the Contig menu and select Assemble e When the assembly is done select the contig Contig1 in the project view Alternatively select the two samples in Contigl in the project view e Go to the Sample menu and select Process Heterozygous Indels You will progress dialog appear which shows that CodonCode Aligner does the following steps e Aligner finds all samples that have a heterozygoteIndel tag and then identifies wild type traces for each since we have only 2 traces here this is trivial Aligner replaces the basecalls in the indel region as follows 1 Aligner looks for secondary peaks in the indel region and replaces the base calls with ambiguity codes for the the two bases 2 Aligner compares the ambiguity codes to the consensus sequence and removes the consensus base call This leaves the base call that often corresponds to the base in the mutated allele Aligner create a new artificial sequence by subtracing the wild type trace from the heterozygous indel trace starting at the start of the heterozygoteIndel tag The wild type traces are scaled the traces vertically and horizontally as needed with the goal to subtract the trace that is due to the unmutated allele and leaving the mutated allele Next Aligner base calls
4. Print vi Add Samples V Add Folder Eod Add Assembly C Export Samples Export Consensus f Export Assembly Export Features New Folder C Undo Y gt Haera A Description The toolbar preferences control which toolbar buttons are shown in the different views If no buttons are selected for a view the toolbar will not be shown C B On the left side you can choose whether or not to show toolbars for all windows and if toolbars should be shown as buttons text or buttons and text You can also restore the default settings by clicking on one of the Defaults buttons The Defaults icons only button will restore the initial buttons settings on Windows where buttons are shown as icons only The Defaults icons amp text button will restore the initial buttons settings on Mac OS X where toolbar buttons are by convention shown as icons and text and therefore need more space However you can use either button one both operating systems On the right side you can select which buttons will be shown for the different views Select the view to customize at the top then check or uncheck the items you want to see or not see in the toolbar If you want to see toolbars in some views but not in other views you can simply use the Select None button to de select all buttons for the views where you do not want to see the toolbars Toolbar Preferences 2
5. Selects the sample with the given select sample or contig name ats selectAll hoe Sect everything in the current view selectAllUnassembledSamples hoe Sect all unassembled samples selectAllContigs hoe Sect all contigs Unselects the sample or contig with unselect sample or contig name the given name End clips the currently selected samples f Makes the named sample a reference sample or contig name sequence Finds heterozygous indels in the findHeteroIndels none ye selected samples Assembles the selected samples and assemble none contigs assembleFromScratch hone Assembles from scratch assembleByName Assembles in groups by name Compares contigs to each other using compareContigs Clustal or muscle optional Clustal or muscle if specified otherwise the current default assembleUsingPhrap hone Assembles contigs with PHRAP Aligns selected samples to a reference sequence Scripting CodonCode Aligner 24 CodonCode Aligner User Manual Aligns to reference sequence by name in groups Finds mutations in the selected findMutations contigs Please note that scripting is intended only for users who have some experience in scripting applications and are able to sort through problems that are likely to appear when using scripts Scripting CodonCode Aligner 25 Organizing Samples And Contigs In Folders Aligner projects always contain the Unassembled Samples folder and the Trash
6. Closing Projects Choose Close Project from the File menu to close the currently open project and all its windows Aligner will first check if you made any changes to the project since the last time the project was saved If any changes were made Aligner will ask you if you want to save the changes before closing the project If you answer Don t save all changes you have made since the last save will be lost Opening Existing Projects 17 Adding Sample Files to Aligner Projects CodonCode Aligner can import sequences from a variety of different file formats including chromatogram files in ABI and SCF format and text files in FASTA Genbank NBRF PIR PHD or plain text format Files in FASTA Genbank or NBRF PIR format can contain multiple sequences per file You can add sequences to Aligner projects by dragging and dropping files onto Aligner project views or by using one of several Open and Import options in the File menu 1 by opening single sample files 2 by adding samples from several files 3 by adding entire folders of samples 4 by adding an entire assembly or project Aligner will always create copies of the samples you import Keep in mind though that these copies will be created only when you save the project so save on a regular basis For files that have pointers to associated files Aligner will also try to located and import the related files for example PHD files and FASTA files may point to a chromat
7. Print Reverse Previous Feature NextFeature View Traces Colors Mask Matches Help lt lt CFTR 1 R CFTR 2 F CFTR 3 F lt lt CFTR 3 R CFTR 4 F lt lt CFTR 4 R CFTR 5 F lt lt CFTR 5 R CFTR Norm F lt lt CFTR Norm R Contigl Pos 162 330 Qual 20 o9 9 9 9 9 9 9 9 9 9 9 9 9 e 9 o9 o9 o9 on s 9 9 9 9 9 9 9 9 9 je o9 o o9 o9 on GGATAGAGAGCTGGCTTCAAAGAAAAATC CTAAACT To revert back to the normal display where all bases are drawn just select Mask Bases Matching Consensus or the correspondig toolbar button again Sorting Reads in the Contig View In the contig view samples can be sorted in one of several ways by position in the contig the default by sample name by direction forward or reverse and then by position in the contig by the user The default sort method for samples in the contig view can be set in the contig view preferences If you change the sort method in the contig view preferences the new setting will affect only contig view windows opened after the change To change the sorting of reads in an open contig view window right click OS X command click anywhere in the aligned bases panel to display a popup menu like this Masking Bases Matching the Consensus 154 CodonCode Aligner User Manual View Bases View Quality
8. CodonCode Aligner User Manual On OSX Application CodonCode Aligner Phred Phrap workstation_phred Application CodonCode Aligner Phred Phrap phredpar dat e On Windows C Program Files CodonCode AlignerPhred Phrap Workstation phred exe C Program Files CodonCode Aligner Phred Phrap phredpar dat Note that since Aligner version 1 2 5 beta 5 Aligner will use the workstation versions of Phred and Phrap by default The workstation version of Phred can only be run from CodonCode Aligner and requires either a valid trial license or a valid full purchased license that includes a license for the Workstation Phred module Licenses purchased by academic customers automatically include a license for the Workstation Phred module free of charge users at for profit organizations need to pay a separate license fee for the workstation version of Phred If you started using CodonCode Aligner with a version before 1 2 5 beta 5 and would like to use the workstation version of Phred please 1 Check if your license includes a license for Workstation Phred go to the Help menu select License and check the module permissions in the license dialog 2 Click on the upper Select or Browse button in the base calling preferences and navigate to the workstation phred executable 3 Select workstation phred and then click OK in the file dialog and in the preference dialog One note of caution CodonCode Aligner us
9. Importing Phrap Assemblies To import a Phrap assembly into CodonCode Aligner select have the Phrap generated ACE file in the file dialog you see after choosing Import gt Add Assembly from the File menu you must have a project open for this option to be available In addition to the ACE file you should also have the PHD and SCF files for the assemble located in exactly the same directory structure as Consed would expect ad described below When importing Phrap assemblies all the contigs that Phrap has created will remain intact and detail information like unaligned ends and tags will be reserved Aligner will read the assembly information from the ace file and try to get additional information from the other files typically used with Phrap the PHD files in the sister folder phd dir and the chromatogram files in the sister folder chromat dir An Importing Sequencher Projects CAF Files 21 CodonCode Aligner User Manual overview of the typical directory structure used with Phrap assemblies is as follows v Project folder gt chromat dir T edit dir EL M contains the ACE file and related text files gt iE phd dir lt E contis the Phucd generated PHD files contains the chromatogram files ABI or SCF files Tags in Phrap assemblies Phrap assemblies can contain tags which are especially important when you are using PolyPhred Aligner will import and preserve tags and display tags ba
10. Move to Trash Sample Information Preferences Sort samples by name Sort samples by position Sort samples by direction Select any of the Sort samples by options at the bottom of the menu and the reads in this contig view will be re sorted Typically sorting samples by position will be the best way to sort samples For re sequencing and mutation detection projects sorting my name may work well if you followed a naming scheme that uses similar names for forward and reverse reads so that sorting by name will have the forward and reverse reads right underneath each other You can also manually sort the samples by selecting and dragging the sample names up or down After manually sorting samples in a contig Aligner will keep you manual sort order for this contig until you select one of the sort options in the popup menu changing the sorting in the contig view preferences will not change the sorting of contigs that have been sorted manually Automatic Trace Selection When checking or editing a contig you will often want to look at a few traces at a given position CodonCode Aligner can automatically pick traces to display while you are moving around in a contig You can turn this option on or off by selecting Auto Select Traces in the View menu You can also set the number of traces to be displayed in the Views preferences For automatic trace selection to work you need to first open both the contig view and
11. b 3 Contig2 2samples 755 720 3 11 3 11 03 gt 17 Trash 0 samples 0 3 11 3 11 03 I Assembly completed in 1 62 seconds 1 successful join 1 island remaining In the project window samples are treated like files and contigs are treated like folders directories in the Finder on MacOS or the Explorer on Windows Two other folders also exist in every project the Unassembled Samples folder and the Trash Any sample that have been added to a project but not yet assembled or deleted get added to the Unassembled Samples folder If you don t want a sample in your project anymore you can move it to the Trash by selecting the sample in the project window and then selecting Move To Trash in the Edit menu If you later change your mind you can move samples from the trash back to the Unassembled Samples folder Within the project view you can also use drag and drop to move samples and even contigs around You can drag samples from the Unassembled Samples folder to the Trash and the other ways round you can drag samples in contigs or entire contigs to the trash or to the Unassembled Samples folder and you can add samples to existing contigs by dragging them from the Unassembled Samples folder onto the contig you want to add them to of course the sample align with the contig for more details check the Assembly and Alignment help section Aligner Projects 15 Working with Aligner Projects
12. AorGorT N If at least one of the base calls in the samples at this position already is an ambiguity code determining the majority consensus is done as follows R W S Y K V H D B Each regular base call here gets a score of two For ambiguity codes each base represented by the code gets a score of one for example at a M call both A and C would gets a score of one The scores for all samples Quality based Consensus 70 CodonCode Aligner User Manual that have aligned bases at this position gets summed up Now if one of the four possible bases A G C or T got more than 50 of the total score this base is used as a consensus Otherwise and ambiguity code that represents all base calls at this position is used For example if there are just two samples one A and one W meaning A or T then A will be used for the consensus If one base is A and the other B then N will be used for the consensus For sequencing projects where the goal is to determine the correct sequence of a gene a quality based consensus sequence will generally be better than a majority based sequence For example if a region is covered by only two samples the majority consensus will contain ambiguity codes at all discrepancies while the quality based consensus will pick the higher quality base which is most often the correct one However a majority based consensus can make sense for other types of sequencing one example is gen
13. BeckmanCEQ terminator big dye Beckman CEQ 2 DT3100POPA4LR BD v1 mob terminator big dye ABI 3100 Samples missing primer ID primer rhodamine ABI 373 377 No matching primer ID primer rhodamine ABI 373 377 D Samples missing primer ID terminator rhodamine ABI 373 377 i DyePrimer 21m13 primer rhodamine ABI_373_377 New f Add r Description The Phred parameter file contains the information Phred needs to determine the best base calling parameters and lookup table for sequence quality values Each chromatogram contains a primer ID string that Phred looks up in this file to get the relevant chemistry dye and machine information If your sequencing machine is not listed select the machine class that is closest to your sequencer e g for samples processed on an ABI 3730 set the machine class to ABI 3700 Cancel At the bottom you see a newly added line in your case this may be more than one line you may have to scroll down to see the newly added entries Here is a brief description Editing the PHRED parameter file 31 CodonCode Aligner User Manual e The first column contains the primer ID string that you need to add Aligner already filled this out for you so you should not need to change anything here e The second column contains the chemistry which is primer for dye labeled primers and terminator for dye labeled terminator chemistry Most sequencing nowadays is done with dye labe
14. CUriTpre ram consedFixedGoldenPath contigEndPair contigName All Phrap tags v All Mutation tags L All processing tags All unlisted tags endClipped 4 Butcessnsenceaca sce ad Cancel th daii You can use the buttons and checkboxes on the left site to select or unselect groups of tags You can fine tune your selection in the list of tags on the right To make or change discontinuous selections use Control click on Windows and Command Click on OS X Your selections will take effect when you click OK in the tag selection dialog and then in the Preference dialog The list of tags in the tag selection dialogs may not show all the tags that are used in your projects To use any tags that are not listed make sure the All unlisted tags checkbox is selected Specifying subsets of tags 191 Highlighting Preferences You can select how Aligner highlights discrepancies ambiguities edited bases and tags in the highlighting preferences Preferences Base calling Base colors Consensus method Double clicking End clipping Features Highlighting License Server Memory Mutations Open amp save Phrap assembly Preference options Printing Protein translation Window placement Highlighting Select which items you want to highlight how Discrepancies base color Jj Ambiguities base color F Edited Bases underline 1 Tags box r Dimming v Dim unalig
15. License Server Memory Bandwidth max gap size 30 Mutations x Open amp save Word length 8 PU Phrap assembly Match score 1 Li Preference options Printing Mismatch penalty 2 Protein translation x Restriction maps Gap penalty 2 Ce Sample names Additional first gap penalty 3 Startup Toolbars Vector trimming Views Warnings Window placement Description The alignment preferences control settings for alignments to reference sequences Cancel During the alignment process the sequences are aligned successively against the reference sequence Each alignment is evaluated against the match criteria defined in the alignment preferences Only if the alignment meets all the criteria the sample will be added If the alignment does not match any one of the criteria it will not be added and remain in the Unassembled Samples folder The parameters are similar to the parameters for sequence assembly but you can assign different values for assembly and alignment parameters The meaning of each parameter is discussed in the next sections Please note that the alignment parameters will not be used when comparing contigs from the Assemble with Options dialog Alignment Preferences 165 CodonCode Aligner User Manual Algorithm The algorithm pulldown lets you choose how CodonCode Aligner compares seque
16. Memory Preferences The memory preferences allow you to see how much memory CodonCode Aligner is currently using On Mac OS X it also allows you to set the memory available to Aligner Preferences r Memory r Memory options Base calling DEN Base colors Maximum available memory MB 256 Consensus method Double clicking r Current memory use End ppg 16 MB used 240 of 256 MB available Features Highlighting r About these settings License Server gt Changes to these preferences will restart Aligner Mutations Open amp save Phrap assembly Preference options Printing Protein translation Sample names Startup Vector trimming Window placement Description Controls the maximum memory available to Aligner These preferences are disabled if your project has been edited Changes to these settings will restart the application The Memory options panel at the top shows you the maximum memory available to CodonCode Aligner The panel in the middle shows you how much memory CodonCode Aligner is currently using and how much memory is available Adding more samples to your project and opening views will increase the amount of memory used by Aligner Changing memory on OS X If you are working with large projects on OS X and Aligner runs out of memory you can try to increase the memory Aligner can use using this panel Memory Preferences 196 C
17. Reverse Complementing 107 Editing Sample Information To view information about a sample or to change a sample name e Select a single sample in the project view or in trace view or contig view Go to the choosing Sample menu and select Sample Information or use the keyboard shortcut control I on Windows command I on OS X This will show the sample information dialog e Sample Information va 16 x Name va 16 x Comments Tags b vi Allow manual edits You can add or change remarks about the sample in the comments field You can also designate a sample file as read only by unchecking the Allow Manual Edits checkbox Changing Sample Names You can change the sample name by editing the Name field Note that Aligner does not allow spaces or other funny character in the sample names since such characters could cause problems when writing sample files If you use any invalid characters Aligner will convert them automatically Viewing Chromatogram Information For samples that have chromatograms additional information about the chromatogram will be shown in the sample information dialog Editing Sample Information 108 CodonCode Aligner User Manual r e Sample Information Abi example file abl Name Abi example file ab1 Comments Chromatogram Information SPAC 10 507583 m LIMS c7 8fff6663 1211d89ed8000874938d7c GTYP Pop 7 Run_Start 2004 02 19 15 29 17 Run_Stop 2004
18. With the default settings aligning a cDNA sequence with several exons to a genomic sequence will typically fail or give a bad alignment However you can change this by selecting the Large Gap algorithm in the alignment preferences the Large Gap algorithm is specifically intended for cDNA to genomic alignments Assembly and Alignment 47 Sequence Assembly Before assembling Before perfoming an assembly in CodonCode Aligner you ll need to create or open a project and import the sample files you want to assemble You also may want to pre process your samples by end clipping and vector trimming it s a good idea to save your project now before starting the assembly How to assemble Go to the project view e Select the samples and or contigs that you want to assemble Choose Assemble from the Contig menu Note To make a continuous selection keep the shift key pressed while clicking on samples or contigs To make a discontinuous selection press the control key on Windows or the command key on OS X while clicking on samples or contigs The assembly will start and show a progress window i eo Sequence Assembler Progress Algorithm Phases Vv Initialization V Overlap Detection part 1 Overlap Detection part 2 Alignment Data Model Update dye Tete eri efi AREER HN DU B Pee Overlap Detection part 2 is 60 complete MT aS Cancel After the assembly is done the progress window will disappe
19. Any existing contigs in your selection will be unassembled before assembly After creating contigs by Assemble in Groups you can compare the contigs to each other by building contigs of contigs as described above Additional information about defining name parts is available on the Sample names preferences help page Pre process One step processing In addition to the different assembly choices described above Assemble with Options also lets you automate common pre processing steps like end clipping and vector trimming To set your pre processing choices click on the Preprocess tab Pre process One step processing 55 CodonCode Aligner User Manual eoo Assemble With Options Contigs Preprocess Algorithm v Pre process unassembled samples vi Base call samples without qualities _ Find heterozygous indels v Clip ends v Trim vector This panel lets you choose how Aligner should pre process any unassembled samples before assembly Note that your pre processing choices are not applied to samples that are already in contigs Help Cancel 22 M The checkbox at the top determines whether or now your samples will be pre processed before assembly the four lower check boxes let you pick the pre processing steps that will be done The choices are Base call samples without qualities Any samples that have chromatograms but no base specific quality scores will be base called with PHRED
20. Assembly Trace colors Base calling Base colors A s d Consensus method red m Double clicking Ts magenta End clipping G s pink Features orange Highlighting Cs yellow Memory ni black Mutations N s gray i Open amp save i Sho Other X background Phrap assembly Printing r Background colors Protein translation uality based 3 colors Startup e amy Vector trimming J Quality based continuous scale Views By nucleotide ignore quality Warnings Window placement Select your main color scheme specify details below r Background color details 3 colors Low quality from Medium quality from 20 to 29 medium green eJ High quality 30 and higher light green o to 19 JH Hj Description The base colors preferences control the colors used for drawing traces If By nucleotide is selected bases are drawn the same color as their trace colored bases use the same background color as traces Cre B To assign a color to a specific base use the drop down box to the right of the base As always any changes will only be saved when you click OK Note that the colors chosen will also be used to draw the sequence traces regardless of the background color scheme You can pick one of the pre defined colors or click on Other to choose a different color This will bring up the follow color chooser dialog Base specific colors 182 CodonCode A
21. Choose how to build contigs A7 J Add to existing alignments II Unassemble existing contigs align from scratch Align in groups by Species A Define Groups When Unassemble existing contigs align from scratch is selected any contigs in your selection will be unassembled before alignment and gaps in the samples will be removed Help 3 Cancel Choose Unassemble existing contigs align from scratch the click on Align M MIU MU e Rt l Aligner will first unassemble the contigs you selected and then align all the samples in the contig s and any other samples you had selected to your reference sequence s You will see a progress dialog while Aligner is aligning Note that the resulting number of contigs may be different from the initial number of contigs If your selection contained only unassembled samples align from scratch will do exactly the same thing as Align to Reference Sequence would unless you also have preprocessing options selected Align in groups If you want to compare samples from a number of different sources species patients isolates to a reference sequence the Align in groups option in CodonCode Aligner can simplify your work Align in groups uses sample names to groups samples together and to form separate contigs for each group A copy of a reference sequence will be included in each contig For a description of how to use sample na
22. Missing entries in the Phred parameter file Problems reading the Phred parameter file Wrong command line parameters Problems running the workstation version of Phred Many of the problems are related to the Phred parameter file This is a file used by Phred to determine which dye type sequencing chemistry and sequencing machine was used to a given trace For more information please read the About the Phred parameter file section below Cannot find base calling program If CodonCode Aligner cannot find the base calling program Aligner will show the following error message Base calling problems 32 CodonCode Aligner User Manual x eoo Cannot Call Bases Cannot find base calling program I Applications CodonCode Aligner phred Please use the Base Calling Preferences to specify the correct location of PHRED on your computer Help The name and location of the base calling program PHRED is defined in the base calling preferences if the name specified there is not correct for example because you moved renamed or deleted the program or the CodonCode Aligner folder then Aligner cannot find Phred To solve this problem do what the dialog says use the base calling preferences to specify where exactly on your system Phred is installed detailed instructions are given above for the workstation version of Phred that is installed with CodonCode Aligner For more information please read the Prerequis
23. and do any pre processing steps like base calling or end clipping that you want to do Then to add the sample to an existing contig 1 Go to the project view 2 Select both the contig and the samples that you want to add to it to make continous selections use shift click to make discontinuous selections use control click on Windows and command click on OS X 3 Go to the Contig menu 4 Choose Assemble or if your contig is an alignment to a reference sequence choose Align To Reference Sequence Aligner will try to merge the samples with the contig If samples share an overlap that meet the minimum criteria you defined they will be added to the contig Samples that do not overlap the contig or where the overlap is not good enough will remain in the Unassembled Samples folder You can also choose more than one contig and one or more samples for example two neighboring contigs and some finishing reads that bridge the gap between the contigs Alternatively you can use drag and drop in the project view to add samples to contigs First select the samples and or contigs you want to add in the project view and then drag and drop them onto the contig to which you want to add them this target contig cannot be in the initial selection Once you release the mouse CodonCode Aligner will start the assembly of the samples and contig s When you use the Assemble or Align To Reference Sequence menu with existing contigs the
24. artificial SCF file created with tools like mkt race or fasta2Phd perl a sequence from a PDF file was previously identifies as having artificial sequences by Aligner and has a corresponding tag in the PHD file Changing this value will not affect any sequences you previously imported If you want to change the assigned artificial quality values for a sequence in your project you currently have to remove the sequence and than import it again What are artificial qualities good for Good question They cannot be used for end clipping since end clipping requires real quality scores assigned by programs like Phred However the qualities are used to determine the consensus sequence during assembly and alignment to a reference sequence In general you should use low artificial scores like the default value of 15 However if you want to make sure that a sequence without real qualities is used as to contribute more to the consensus you can assign higher values all the way up to 90 Open amp Save Preferences 202 Phrap Assembly Preferences In the Phrap assembly preferences you can specify details needed for assembling samples with Phrap eoo Preferences Alignment Phrap Assembly Assembly Base calling Full path to the assembly program Phrap Base colors e e Cnm meth tions CodonCode Aligner Phred Phrap workstation phrap Double clicking End clipping Features Highlighting License Server Memory Mutations Open amp s
25. older ABI chromatogram files and files produced with the ABI base caller do not contain quality scores Chromatograms SCF format may or may not contain quality values depending on which program generated the SCF files SCF files generated by PHRED contain quality scores but some other programs like some versions of Sequencher do not write quality information into SCF files Quality Values In CodonCode Aligner 12 CodonCode Aligner User Manual When importing Phrap assemblies that where generated with quality scores Aligner will read the quality information from the corresponding PHD files regardless of whether or not the chromatogram files for the assembly where in ABI or SCF format When reading sequences from FASTA files Aligner will also read quality scores from qual files text files in FASTA like format that contain quality scores The name of the qual file must be the same as the name of the FASTA file with qual appended for example seq fasta and seq fasta qual The quality file must be in the same directory as the FASTA file Note that not all ABI chromatogram files have quality scores Only ABI chromatograms processed with the KB base caller have quality scores ABI chromatograms processed with the older ABI Basecaller do not have quality scores For questions about the KB base caller please read the KB Base Caller Frequently Asked Questions brochure When importing chromatogram sequences that do not hav
26. window to see the Preferences window select Preferences in the application menu on OS X and Preferences in the Edit menu on Windows This will show the following window Preferences End clipping i imi i i 0 1 Base calling Maximize region with error rate below Base colors Use separate criteria for start and end Consensus method r Trim from start until Double clicking J F nd clipping V Error rate is below 0 1 ina 25 base window Features There are fewer than 3 bases with quality Highlighting below 20 ina 25 base window License Server Memory r Trim from end until Kami Vv Error rate is below 0 1 ina 25 base window pen amp save Phrap assembly j There are fewer than 3 bases with quality Preference options below 20 ina 25 base window Printing Protein translation r After end clipping Sample names rent vi Move all sequences shorter than 25 bases to trash Vector trimming vi Move all sequences with fewer than 50 Phred 20 E bases to trash Window placement Description The end clipping preferences control how low quality bases are clipped from samples end clipping works only on samples with qualities Cancel GOED On the top you have the choice between two different end clipping methods a method that maximizes the region with an estimated error rate below the threshold you define and a method that uses different criteria at the beginning at at the en
27. workstation versions of PHRAP which can be only from CodonCode Aligner To run PHRAP from CodonCode Aligner you need either a trial license or a purchased license Licenses purchased for academic use allow the use of PHRAP free of charge Things to Note for Phrap Assemblies 59 CodonCode Aligner User Manual Non academic customers who want to use PHRAP must either install their own PHRAP executables or pay a separate license fee for PHRAP About Phrap 60 Alignments to a Reference Sequence To perform an alignment to a reference sequence 1 Open an existing project or create a new project see Creating Projects 2 Add the desired sample files see Adding Samples to a Project 3 Designate the reference sequence Select the reference sample in the project window Choose Make Reference Sequence from the Sample menu 4 Select the reference sequence and the samples you want to align to it in the project view 5 Choose Align to Reference Sequence from the Contig menu Note To select all unassembled samples simply click on the Unassembled Samples folder To make a continuous selection keep the shift key pressed while clicking on the samples you want to select in the project view To make a discontinuous selection press the control key on Windows or the command key on OS X while clicking on samples in the project view Alignment begins immediately and a progress window shows the status of the alignmen
28. 3353 pUR291 cloning vector CGCCGGTCGCTACCATTACCAGTTGGTCTGGTGTCGGGGA ATAAGCTGTCAAACATGAGAATTCT GAAGACGAAA CCGTCGACC gnl uv L09151 1 3249 3332 pUR292 cloning vector GCCGGTCGCTACCATTACCAGTTGG ATAAGCTGTCAAAC CTGGTG CAGGGGA gt pUR278 cloning vector bases 3239 3335 GCAGCCAAGC CCGTCGACC CCAGCTGAGCGCCGGTCGCTACCAT ACCAGT AGCTTATCGATGATAAGCTGTCAAACA GGTCTGG GTCAAAAAGGGGATCCGTCGACTCTAGAA GCAGCCAAGC CGA CGA The names for the entries are used when you select the vector sequences to screen against in the preferences that s why you cannot use plain text vector sequence files Using Custom Vector Files 45 Assembly and Alignment Sequence Assembly Assembly assembles sequence fragments into a larger sequence by identifying overlaps between sample sequences Samples that can be joined together are put into contigs Joins may fail because samples do not share overlaps that are long enough with other samples or contigs or because the overlap contains to many discrepancies Any sequences that cannot be put into contigs remain in the Unassembled Samples folder The result of the assembly can be one or more contigs plus samples that remain in the Unassembled Samples folder If none of the samples can be joined no contigs will be formed You can assemble any mix of unassembled samples and previously assembled contigs Cont
29. 400 Rev 305 Fwd 394 Fwd 406 Fwd 437 Fwd Estimated Error Rate 0 00E 00 2 20E 02 3 55E 01 0 00E 00 Contig Offset 0 0 1 1 396 385 18 19 18 133 Exporting Samples You can export samples to text files in FASTA format or to chromatogram files in SCF Standard Chromatogram Format format as follows Go to the project view e Select the samples you want to export use shift click to make continous selections and control click OS X command click to make discontinuous selections Choose Export gt Samples in the File menu This will display the following dialog E Export Sequences What to export fe Selected samples Q All samples Format FASTA Single file Include gaps in FASTA files TNEUUOENEEEPER LTT Cancel ee Using the radio buttons at the top select to export just the selected samples or all samples in the project The Format pull down menu gives you the following format choices Single FASTA file This will generate a single text file in FASTA format which contains all the exported sequences You can specify the name and location of the file in a Save As dialog box that will be shown when you click the Export button When exporting FASTA files you have the option to include gap characters in the output but checking the box labeled Include gaps in FASTA files If the box
30. 64 384P Edit the Xmx entry to change the amount of memory Using the example above this section reads Xmx50 64 384P This entry sets the maximum memory for Aligner to 50 of the system memory assigning at least 64M and no more than 384M To increase the memory available to Aligner to 70 of built in RAM or 512 MB whichever is smaller you would need to change this line to Virtual Machine Parameters Xms32M Xmx70 64 512P Save the changed file Quit Notepad Try starting Aligner If Aligner fails to start then the amount of memory requested is too high Edit the file again and request less memory If the problem persists try quitting other applications and or installing more memory Changing memory on OS X 197 Mutation Detection Preferences To change the mutation preferences select Preferences from the Edit menu on Windows or from the CodonCode Aligner menu on OS X and then click on Mutations on the left panel The mutation preferences dialog looks like this Preferences r Mutation detection r Point mutation detection sensitivity sites where there is an intensity drop Base colors Consensus method O Low 9 Medium O High Double clicking End clipping At sites where there is NO intensity drop Features A Ou J Low Medium High Highlighting hd e x License Server Data quality Minimum quality at ends 30 HJ V Use noise filter Phrap ass
31. 7 dar K GAAGTACAAPMENMICAAGGCATGTGGTGTACACAAG AGA 006a 22 r 110 120 130 gt ca22r Base 112 of 457 114 in contig Quality 21 Cons 90 _ Hiding lanes will affect only one trace and only until it is closed re opening the trace will show all traces again You can also press the shift key and or the alt key while clicking in the base boxes to hide more than just one trace Shift click to hide all traces except the one for the base you are clicking on in the current sample shift click again to show all traces again Alt click to hide the trace for this base in all samples in the trace view window alt click again to show the trace in all windows again OS X users can also use the command key instead of the alt key Alt Shift click to hide all other traces in all samples Repeat to show all traces in all samples again Try it out Hiding Some Traces 148 CodonCode Aligner User Manual Printing Traces To print the traces that are currently in your trace view first select the trace view and then choose Print from the File menu or use the keyboard shortcut Control P on Windows Command P on OS X This will show the a print preview dialog like the one below eoe Print Preview of Trace View r Trace Printing Options Page Setup What to print Entire traces HJ Vertical trace scaling f Scale each panel to highest peak 1 Fit traces to page l Print trimmed
32. C E LEES 137 ACTCPOImat TE a ae a nd ono DOO Ga doo a Ab Do RE M 137 NEXUSIPAUP Format Bx pores cou ce er ees pev plora e pill dne dees 138 Phylip Format BXpOLDS s pista oot ee a OE DERIT RMARE E AER HE REP EHAS Eaa 138 Other Bormats Tor Exportme Assemblies iei reo EE HEP E IE LH UPPER EV PARERE EE EHE REIP Ep a D 139 exporting Eeati0s cio rr FROM GO ER NM RERO REM Ma I ee 140 The Project View Window iei pn EE ER PES QUOI IONS sensei TINI PE EQUI ee ay EN MU IA MNI EVA ER ERANT EUM ire 142 Selestine Samples and Colt E ooo Wo eae Dao eH NN OM S S PM EI EE 142 Menu shortents Buttons and Popup metus cere cies Coro t ae a EE Oe e talbug ELO D V edd 143 Project View Colonmms And SOLDI unie rod DOE DUKE HO ERR AQUA O iaaa 143 SUHEUS TINGS SACS cs RTT CETT OU CU DOLEO 143 HEINRICO E me 145 General Difottdtite roo po TOR PH oA EE 145 Opening a Trace IS EE 145 cre lite and Scali g iit Trace View ied ete tome EA A N Edid 145 Trace Shape dE 146 Colors and Highl ching iiic iio tue pP UD aE Aa a EA TEERAA 147 Automate Trace Selecon an EEEE EE OEEO EA OTE RE UENEN 147 Hidi Sonme TACERE coss roO REX ara I AEE A Eu EASAN 147 MPRA MAN scendere tare nod da dora pec E A de a hd b EAE x s 149 Base Vien LATO QI irre ne eran ere rip eer etter nine meee reeene tr 150 D alty View WV NO TOES ese anne nina otis aa eens 151 Contig View Winda sep op HE ERU EVI NP EEIRRUE TUN M DINE nes a eerie aI 152 ome Viet dew POUBL scs oce titor rebel ter w
33. Creating New Projects To create a new project choose New Project from Aligner s File menu Aligner will create a new project and show a project view window for it The project will be empty except for the Trash and the Unassembled Samples folders You can specify where a project will be saved when you first save the new project If you prefer to set the project path when creating a new project you can change the Open amp Save Preferences accordingly Now when creating a new project Aligner will show the the Create New Project dialog r e Create New Project Folder Users peter Documents Projects Name MyProject f Cancel The simplest way to set the project name and location is to click on the Select button This will bring up a standard Save As dialog Save Select Project Folder and Name Save As MyProject Where Projects 4 fa M 5 America Online 4 MyProject1 1 3 Documents p 3 PhrapExample Projects A New Folder dd to Favorites f Cancel Save After clicking OK an new project window will be opened which contains no samples only the Unassembled Samples and the Trash folders Working with Aligner Projects 16 CodonCode Aligner User Manual Opening Existing Projects Choose Open from the File menu to open a project you have already saved Navigate to the directory your project is in and select the
34. Estimation of Errors in Raw DNA Sequences A Validation Study Genome Research 8 251 259 Available online at http www genome org content vol8 issue3 Viewing qualities 14 Aligner Projects An Aligner project contains all the information for a project you are working on the samples you added any contigs you may have assembled and so on Each project is contain in it s own directory which is created by CodonCode Aligner when you first save a project After an Aligner project is created sample files can be added Original files are never modified only copies are added to the project directory When alignments or assemblies are performed the resulting consensus is stored in the project directory Collectively all the files in a project directory are referred to as an Aligner project Only one project can be open at any point in time The contents of a project are shown in the project window 099 example_project is B i s Save Project Add Samples Add Folder Add Assembly Align to Reference Sequence Assemble Unassemble Name Contents Length Quality Position Added Modified v ul Unassembled Samples 2 samples 0 3 11 3 11 03 BU A454 s Trace 693 397 0 3 11 3 11 03 Bl A455 s Trace 750 343 0 3 11 3 11 03 v cs Contig1 3 samples 966 917 3 11 3 11 03 B A326 r Trace 628 375 0 3 11 3 11 03 E A060 s Trace 645 389 221 3 11 3 11 03 Bd A333 r Trace 646 370 320 3 11 3 11 03
35. Info plist which is inside the CodonCode Aligner package When you change the memory settings for CodonCode Aligner in the memory preferences Aligner will edit this file and then restart itself so that the new memory settings take effect Please always use the memory preferences to change the memory available to Aligner on OS X Please do not change the memory available to Aligner by editing the Info plist file directly if you make any mistakes Aligner may not be able to start or may behave erratically How Aligner memory on Windows is set 236 CodonCode Aligner Release Notes The release notes for the current version of CodonCode Aligner can be found in a separate file called ReleaseNotes txt in the Aligner directory CodonCode Aligner Release Notes 237 Checking for Aligner Updates You can check if your version of CodonCode Aligner is current by selection Check for Updates in the Help menu Aligner will then check CodonCode s web site to see if your versionis current therefore this requires that you have an active internet connection If you are not currently connected to the internet you will see an error message Unable to verify the current Aligner version The same message can also result from other problems for example if CodonCode s web site is down which hopefully will be rare If everything goes When you start Aligner Aligner also automatically tries to check for updates Aligner will let you know if a
36. PAS Em n 123 Jesh sis ec a ins MUNI EE EL 0S 0 LL 125 inii aku nossa one one mee oe oe 126 How To Roundtrip Edit with CodonCode Aligner seen 126 Re iii IAS ic oo goss Meere SEED MEMINI MEME MMC CE LM Ee es 127 Editt p Contig InFOEIOEBIT gogo bss ERR REEXAREERDRANS PREIS HERMAN a FUR nates scans sank tuac ees aes masa es 128 Search for Seguente TQ LUE Leti 129 BLAST SQarCnes rtp ve prs E E Ux TU mem dsc is Ree eA en 130 Maa BLAS Te m 130 he eeu RUPEE ETT TU eG ee ee ee 130 SE ep Lat Sd C DESDE ao cn a ro oO EROR RAE EROR DURO EROR A ES Fera odes Per ES 130 Translated PLAGE is 01 oe Er DEO DO peas D D Ei a MG a Ce ELE Dol rine I VET RS WR P DOE EA E LET d 130 CodonCode Aligner User Manual Table of Contents Exporting M 131 Export Project Summa y iioc desiit xen dE Ha usse tex ax unes apu eee eee 132 Exporting Samples ntes penne erre par YERRSEYPANE PEU A A E EUER NEENN ERES EEUN FREU RE EU EVR E PEY Ve 134 Sime b PAS REI S OLLI LUE 134 drido FASTA EEs ST Re Em UE 134 i NEUSTEN ERR tense tea aan 135 Expori p Consensus Sequences seers e eres pota obi ea Rp eano anas ue o pee e PEN NURSE SER USER Rune o OEEO aSr eE 136 Simmel FASTA Tc OT TT TD TO mm 136 Hr FASTA MIS INEO 136 DU IDEAS E TOTO
37. Sample Information Move to Trash Preferences Contig Information Preferences Project View Colomns And Sorting The project view contains a number of columns most of which are pretty self explanatory You can click on the column headers to sort the project view however the Unassembled Samples folder will always be on the top and the Trash folder at the bottom Here are descriptions of the columns from left to right the Triangles in the left most column let you expand or condense contigs and other folders the Name column shows the name of the folder or sample you can change sample and contig names through the Sample Information and Contig Information dialogs accessible through the Sample and Contig menus the Contents column tells you details about what is in a folder or contig or about the samples the Length column shows the length of a contig or sample the Quality column displays the number of bases with a quality score of 20 or above Phred20 bases for samples and contigs that have qualities the Position column shows the position of the first base of a sample within a contig only for samples in contigs not for unassembled samples or samples in the trash the Added column shows the date a sample was added to the project the Modified column shows the date a sample was last edited or otherwise modified the Comments column shows and comments you or a program may hav
38. Scroll together va 1 x Base 168 of 437 183 in contig Quality 21 Consensus 35 Note that all three traces that were characterized as heterozygous C T show a two peaks a blue C peak and a red T peak you colors may be different depending on your base color preferences Also note that the T peak in the heterozygous samples is only about half the height of the T peak in the homozygous sample at the top Aligner uses these two pieces of information the secondary peak and the reduction in peak intensity to identify heterozygous bases To get more information about a tag you can right click OS X control click on the base with the tag and select Show Tag from the popup menu the menu text will show the type of the tag selected for example Show Tag heterozygoteCT Selecting the Show Tag popup menu item will display the following tag dialog How To Find SNPs 78 CodonCode Aligner User Manual Tags for va 1 x at base 167 Tag Details Program Start 168 End 168 Date hu Jul 15 1 1 13 EDT 201 Notes Heterozygous 183 T C Cys61Cys Change 3E Delete Confirmed PRE E f Cancel You can quickly confirm a tag by clicking on the Confirmed checkbox delete the tag or add your comments in the Notes text area Fixing Errors There will be cases where you disagree with the classification made by CodonCode Aligner and want to change it Depending on the circu
39. The default type of the new tag is userDefined You can changes this to any of the other pre defined tag types using the pull down menu at the top You can also edit the start and end position and add comments about the tag in the Notes text field If you want a tag to extend to the start of a sequence just enter 0 in the Start field If you want a tag to go to the end of the sample enter a large number like 9999 in the End text field Changes will be saved when you press the OK button Instead of using the popup menu to add tags you can also go to the Sample menu and selecting Add Tag from the Tags sub menu Adding Tags 112 Saving Edits Edits to the consensus sequence or sample sequences are not saved until you save the project by selecting Save Project in the File menu or using the corresponding toolbar buttons or keyboard shortcut Command_S on OS X Control S on Windows If you are experimenting and think you might want to go back to a previous state that you project was in you should save the project under a new name by going to the File menu and selecting Save Project As This will save all data for your current project to a new location You can change the name of individual samples which will then save them under a different name the net time you save the project by selecting the sample and choosing Sample Information from the Sample menu and editing the sample name For more informatio
40. Usually you should not see this dialog but if you see it the first thing to try is to do the base calling again it might work without problems the second time One thing that may cause this problem is renaming the Phred executable Aligner looks at the program name to determine whether you are using the workstation version of Phred or the regular version If you have a regular non workstation version of Phred and you rename it to workstation phred you will see the dialog above If you did not rename the executable and the problem persists it s time to contact CodonCode support Please send an email and include the following as attachments The Basecalling errors txt file the error dialog will tell you where exactly to find it The Aligner errorlog txt file from the CodonCode Aligner directory The status log file from the project directory A screen shot of the error message Please send all this by email to support codoncode com More about the Phred parameter file The newest versions of PHRED from the 2002 releases on optimize the base calling for different sequencing chemistries dye types and machines This requires that Phred can somehow determine the chemistry dye type and machine Phred does this by extracting the primer ID string from the input files The primer ID string looks something like this DyePrimer 21m13 or ET MegaTerm or DT3700POP5 BD v3 mob PHRED looks up the primer ID string
41. With Phrap section Phrap Assembly Preferences 204 Preference Options CodonCode Aligner offers the option to save and load copies of Aligner s preferences in the Preference options panel of the Preferences dialog 608 Preferences Alignment Preference options Assemb e Preference file location Base calling Base colors fe Default location Consensus method Double clicking Users peter Library Preferences CodonCode Aligner Preferences End clipping Custom location Features Loads the preferences from the specified file and saves any future Highlighting changes back to this file To create a new preferences file please use License Server the Save copy function Memory Mutations Select Open amp save If selected any changes to the preferences since Aligner started will Phrap assembly not be saved Preference options Printing Do not automatically save changes made to preferences Protein translation Sample names r Advanced functions Startup Saves a copy of your current preferences that you can later reload Vector trimming Views Warnings Load a previously saved set of preferences This option will NOT Window placement change the file used for saving your preferences Description The Preferences options allow you to use a custom preferences file You may also save a copy of the current preferences or load preferences from an existing file
42. a EENE E KO EI EV REESE 67 Aligner Algorithms for Assembly and Alignmensts 4 eeeeeee scene eene ee ette sten etas etna etos sees te seen tn setas etna e 68 Alignment toa Reference Sequence ico rr HERE inion ea A 68 wr IN mone E 68 Consensus Calculation iucooer riri ni Et Dao eoa ERE RE RA CUERO PEE ae aa ELT ER D b dia v 69 Quality based Consensus scie uci re ip HERR RP EGERIT ERE ATA GEXR FE RCR RE ARMEN EARSR EXPE GRE Kiia kb a AXE iaka 69 IET WIRES IE 70 Using the Reterence Sequence as COmBOTBIS aoo eia r nisn Ennes EPEE A SEEEN ESRR eee al Local large gap dnd end to end Alignments sssrini cas tie reru anise vita das vets vidas oa eas eu dr ves ree gave 71 R gions of Interes Beaters ici acciectsascosts cuss iE era E pa eS SUE r n tue RUN petu suba a up De quo se FM REP e NEDE 73 ciu be aues oso o DEEP A ODD n 73 Moving ta POHCUF S oos ecu a eI ee Ed eee AU M CM EDU LED RR HE ed RUE 74 Seu Prnt Expott Cau ces oscar oe e Qo MSRP decnasbadaesienanteavedansianieuamaceusasantaacnmtiamaatans T3 Finding WIutabiants as EEEE E ae 76 VOU NI E T T E A ads E A E 76 How Von SIND ooi i Ert bM buo e Ee peu 76 Bing Errors anni anti emi neal uw ania ea en ee en 79 Tags ior Rindar NA ooo Soto Po VOU EORUM eet RR COTON POR TD OUTRE VEG RN I RES 80 Defining the Coding Basin ccssansrnaicos aan pce On a ns rie RR aR nae 80 Numbering the Coding Sequenti ue FIRME H Apt deN E ER HN I anime 82 Excluding Regions Iram Analysis nix ee
43. add new samples to existing alignments Go to the project view e Select the aligned contig and the samples you want to add to it Go to the Contig menu and choose either Align to Reference Sequence The end result should be pretty similar in most cases If you choose Align to Reference from Scratch the current contig will first be dissolved so that you loose any manual edits So if you have done any manual editing that you want to preserve use Align to Reference Sequence Instead of using the menu you can also use drag and drop in the project view to add unassembled samples to an existing alignment select the samples you want to add and then drag and drop them onto the contig that you want to add them to You can also choose Align to Reference from Scratch with just a contig selected as long as the contig contains a reference sequence Note All tags that had been added to the consensus sequence including tags added by Aligner s mutation finding will be lost when you add sequences to an existing alignment We hope to change this in a future release if this is important to you please let us know Advanced alignment options Align from scratch this will unassemble any existing contigs in your selection before starting the alignments This option can be useful to if you want to undo manual introduction or movement of gaps or to try different alignment parameters Align in groups with this option CodonCode Align
44. bases In all samples that have aligned bases at a given position Aligner examines the traces in each direction Aligner looks for both secondary peaks and for drops in intensity that indicate a heterozygous base For text samples that do not have chromatograms Aligner just compares the base to the consensus base 4 When a potential heterozygous base is found Aligner examines the peaks and secondary peaks in the other samples at this position and in the same direction to see if the secondary peak may be due to random noise This noise filter can be turned off in the mutation detection preferences 5 Aligner classifies each base as homozygous or heterozygous based on the height of the secondary peak and the intensity drop Note that peaks may be classified as heterozygous even if there is no clear intensity drop for example if all bases at this position are heterozygous 6 If any of the samples at a given consensus position was classified as having a heterozygous base tags are added to all analyzed samples at this position unless Add tags only to mutated bases is selected in the mutation detection preferences The sensitivity of the detection can be adjusted in the mutation detection preferences Keep in mind however that Aligner may classify some bases incorrectly and miss some heterozygous bases regardless of the setting Limitations CodonCode Aligner s detection of heterozygous point mutations is intended for research use
45. can also drag and drop contigs in folders onto empty space in the project view to see the same menu You cannot move unassembled samples to the top level and the top level option will not be available if your selection contains unassembled samples Renaming Folders To rename a folder you created click on the folder in the project view wait a little bit and click on it again You will see when the name becomes editable it may take a second or so When you are done editing the name press enter or click on any other item in the project view If you change your mind about renaming the folder you can press escape while you are still editing or select Undo from the Edit menu right after you changes the name Deleting Folders To delete a folder that you created first remove all of its contents then Organizing Samples And Contigs In Folders 26 CodonCode Aligner User Manual e Select the folder in the project view then Choose Delete Folder from the File menu Only empty folders can be deleted If a folder still contains samples or contigs the Delete Folder menu item will be disabled To delete a folder that contains samples first move the samples to the trash and then delete the folder You cannot delete the Unassembled Samples folder or the Trash folder Deleting Folders 27 Removing Samples from an Aligner Project To remove samples from an open project Go to the project window e Selec
46. ciicking Full path to the Phred parameter file End clipping Features plications CodonCode Aligner Phred Phrap phredpar dat Select Highlighting License Server options 4 Edit Memory Mutations Additional command line options Open amp save Phrap assembly p Preference options Printing Protein translation Sample names Startup Vector trimming Views Warnings Window placement Description The base calling preferences let you specify the location of the base calling program Phred the Phred parameter file and for experts only additional command line parameters for Phred You specify the location and name of the base calling program in the upper text field Currently Phred is the only base calling program that is supported by Aligner In the second text field you specify the location of the Phred parameter file which is typically called phredpar dat For more information about the Phred parameter file please check the base calling help page It also gives you some more details about how to edit the Phred parameter file which you can do by pressing the Edit button If you installed Phred with Aligner the path to Phred and to the Phred parameter file should be correct and not need any changes However if you use your own installation of Phred you may need to specify the location of both files on your system The default location and names are Base Calling Preferences 174
47. contigs for editing in MacClade or similar Use MacClade to move gaps around Export the edited assembly from MacClade Re import the edited assembly into CodonCode Aligner thereby updating the position of gaps in the contig of contigs Verify and edit discrepancies between the species in CodonCode Aligner you can quickly go back to the original sequence traces by double clicking in the contig view for the contig of contigs Export the final assembly in PIR format or similar for further analysis How To Roundtrip Edit with CodonCode Aligner Here s how to roundtrip edit in CodonCode Aligner The starting point assumes you have a project where you already have a contig or contig of contigs that you would like to edit with an external editor like MacClade 1 Check names before exporting check the names of the contigs you want to export Many export formats and external editors restrict how long names can be and which characters can be used in names To be safe use short names with only numbers and letters Names of 10 or fewer characters are safest although up to 30 characters may also work 2 Select the contig s to export in the project view 3 Go to the File menu and select Export Assembly From the format pulldown menu select a format that works for the program you want to use for example Interleaved NEXUS PAUP and then export the file Import the file you just created in your favorite sequence editor for exa
48. data files Aligner Windows and Views This section describes the most important Aligner windows or views briefly For more detailed descriptions follow the links for each window or read the sub topics in the Aligner Windows help section The Main Window On Windows opening CodonCode Aligner will open the main application window root window which contains the application menu and all other windows opened by Aligner Since CodonCode Aligner follows the common user interface standards for Windows and Mac OS X there are some user interface differences between the Windows and OS X versions On Mac OS X there is no such root window Instead the main menu bar at the top of the screen is used When you first start Aligner on Mac OS X a startup dialog is displayed that allows you to open an existing project or create a new project e CodonCode Aligner Startup Aligner 9 Open a recent project Users Shared Projects MyProject1 7 Open an existing project Create a new project No longer show this dialog FROME Cancel After selecting or creating a project the project window described in the next section will be shown If you hit cancel or previously selected the No longer show this dialog checkbox you will not see this window the application will have only a menu bar without any windows On Windows the same dialog is also shown upon startup CodonCode Aligner Features 7 CodonCod
49. dee ae pPH SERE om up Es topi i 197 Restriction Map Preferences oerte iaa E ERRAEEASFENEEDERE ERUUETEEKE NUR SERE EE XE UR EURO RPEDNUEEN PUE MEINEK HL UE VMEL 211 Selecting EI vane s sioe epo EAE EOE NN NE UR PPAR UI SEENE OEA ELENA NUR 211 Respriction Map OPONE assina rE ENEE Ens PORE URS TAIN FUA Psp IR psc rH ask REUS 213 Sample Name Preferenebs uo sese ipee en VERON EEA ERAT ERN ENEMY ERE ENEE 215 Defining sample names uoiec ite coo RP DE Poe ever RE EDS cO ev Le I ae ee ad Stet 215 Denmas deleto a N E A E LR eee 218 viii CodonCode Aligner User Manual Table of Contents Startip Preferences EI OL SLE The Strtip Bit UE ddxdidXditE e E T seve tasshas sess inaessatoussuasas baad as ean eese me aaIeen Vector Trimming Preterences snini viernes waaay ee Eau ie Y I PEEAN ER NEUE QUE View POLE RRC OS T D m UU et Warning PRetene nice is earccivsexsisictencessatiescuseeus osauneses Lee Window Placement Prefer nt s psoe a teat EOS V VE RM AN ue Um Ee kave nc Un iv am Pa uM KE EU eK e NE REPRE CodonCode Aligner Help by WEeHL usse ah posito vr qu3S pP SNR LEE anie ein P eX NS Ea eroan FE SUNT OPE PIN INE E QR Aigner Memi onr NIac OS A Gn cs ies calc le tae ee 6 Darei doro bone Raub ie nS MS E ME VIS ade es EAA ee ame LEM LL MEME tere a mtn tn D Cu UII ED MEL LL ND EOIUNISDU c idt eae ics seni ite MIEMO MN IDEE MILLE IL NERA D Al DSL I cde laid LOADER T Mem MCN EE Memor
50. each panel is useful if the intensities for the four bases are very different in your samples This will calculate separate scaling factors for each of the four traces in each panel based on the highest peak in this section of the trace If you select Fit traces on one page Aligner will try to fit everything onto one page scaling traces as needed If you chose to print Entire traces each sample will be printed onto a separate page If the Fit traces on one page checkbox is not checked the height of each panel will be determined by the height of the trace view windows defined in your View Preferences when printing entire traces or by the height of the panels on the screen when printing only visible regions Usually only the trace between the first called base and the last called base is printed If you want to also print the trace before the first base and after the last base make sure Include trimmed ends when printing is checked Contig View Printing The Page Layout used when printing is determined by the first set of radio buttons note that this is not the same thing as selecting the page orientation i e Portrait or Landscape in the Page Setup dialog The page layout options for contig printing are e Normal Prints the sample and contig names with as much of the sequences as will fit across the page If space permits additional rows with sample and contig names followed by the sequences will be included on t
51. ends Cancel C Print On the left you can choose whether to print the entire traces or just what you see on the screen how to scale traces and a few more options On the right side you get a preview of the print results with your current settings The different options are decribed in detail on the Printing Preferences page Printing Traces 149 Base View Window Choose Base View from the View menu to display the bases for a sample or consensus e080 1 51 101 151 201 251 301 TTTGTTGTGG CAGGTGCTGC ATGTAGCTTG GCCTCTCATT AGCCACAAGA CCCATCAATT TTCTTGTACT TCcTACTAT CACTCATCCA TGAAGGAGAG GGAAGCCTTG TCCAAGACCG TAATGCTAGA TTCTCTGTGA CACAGAGACC ACACAGGTGT ACCTGAGCCC TCTCTGCCAG ACCCACTCAT TGGAGGAGGT GGATGCCATG AGCAGTCAAA TTTACAGTAG CACTCACTCA BecacaTGBB 351 401 451 501 551 601 A TTGGT ccactccoccH cc cc TTAAAAATTG GcTGGAGAGG GOCGNGCGCGG TGGcTCAAGC hae A M A A060 s Base 261 of 628 Quality 16 You can edit sequences in the base view if they are editable but for sequences with traces it s generally a better idea to edit in the trace view The bases are displayed according to your color preferences At the bottom of the base view window you see the name of the sample the current cursor position and if the sample has qualities the quality at the cursor Base View Window 150 Quality View Window Choose Quality Vie
52. folder However if your projects contain a lot of unassembled sequences or many contigs you may want to organize the sequences a bit better CodonCode Aligner allows you to create folders in projects to which you can move samples and contigs by drag and drop or by using the Move To menu item Creating Folders To create a new folder for organizing unassembled samples select New Folder from the File menu This will show a dialog where you can name the new folder Folders created this way can hold unassembled samples contigs or a mix of samples and contigs Moving Samples and Contigs to Folders You can move samples or contigs to and from folders in several ways By drag and drop Select the folders or samples you want to move in the project view and drag amp drop them onto the target folder Using Move to in the Edit menu Select the samples you want to move then choose to Move to from the Edit menu In the dialog that appears select the target folder that you want to move the samples to them press OK Using Move to in the popup menu Select the sample or samples you want to move in the project view and then right click OS X control click on one of the samples From the popup menu select Move to To move contigs from folders back to the same level as Unassembled Samples and the Trash select the contig choose Move to from the popup or Edit menu and then select top level You
53. for ABI sequencing is terminator big dye ABI 3700 The Phred parameter file can be in different locations on different systems On Mac OS X the default location is usr local genome lib On Windows the default location is C Program Files CodonCode To find out where the Phred parameter file is located Phred checks the environment variable PHRED PARAMETER FILE This environment variable is temporarily set by Aligner when Aligner starts Phred using the location of the Phred parameter file defined in the base calling preferences Aditional tips for common problems with running Phred can also be found at http www codoncode com support faqs phedpar html If you want to you can read more about Phred in the original Phred documentation which is available at http www codoncode com support phred doc html About Phred The base calling program Phred was developed by Phil Green and Brent Ewing at the University of Washington Phred was widely used for base calling in the Human Genome Project and still is often regarded as the standard for base calling CodonCode Corporation distributes Phred executables for a variety of platforms including Windows and Mac OS X under license from the University of Washington Academic users can obtain the source code for Phred for restricted use directly from the authors at the University of Washington For more information on this please visit http www phrap org Trial versions of CodonCode Alig
54. it much easier to see that there are indeed 3 Cs after the G not 2 or 4 Looking at the sharpened traces can be a useful tool when working with less than perfect data To go back to the original traces just click the little button in the bottom left corner again You will notice that showing the sharpened traces may take a few seconds the first time especially if the trace view shows several traces This is because the trace sharpening is rather computation intensive When looking at the sharpened traces keep in mind that you are looking at a mathematical artifact which occasionally may give an incorrect impression so always look back at the original traces too and use your scientific judgement Colors and Highlighting The colors in the Trace view are determined your color preferences in the example above a quality based 3 color scheme was used You highlighting preferences determine how discrepancies edits and tags are displayed For more information please check the Preferences help section Automatic Trace Selection For trace views that show samples in contigs CodonCode Aligner can automatically pick traces to display while you are moving around in a contig You can turn this option on or off by selecting Auto Select Traces in the View menu You can also set the number of traces to be displayed in the Views preferences For automatic trace selection to work you need to first open both the contig view and the corre
55. menu Aligner will look for overlaps between the contigs and merge the contigs if the overlap meets the minimum assembly criteria If the overlap between the contigs is not good enough for example because it is very short or has a high discrepancy rate Aligner will reject the merger and leave the contigs as they were When you use Assemble with existing contigs Aligner will compare the consensus sequences of the two contigs to look for an overlap The relative arrangement of the samples in each contig will remain unchanged Changes are limited to any gaps that need to be introduced reverse complementing if needed re building of the consensus sequence and possibly changing the extend of unaligned regions at the end of samples There are two alternatives to using the Assemble menu item using Assemble with Phrap and Assemble from Scratch Both options will first unassemble the existing contigs and then assemble the existing reads using either Phrap or CodonCode Aligner s build in assembly algorithm to build the contigs for profit users need to have a separate license for Phrap The potential drawback of both of these options is that any edits made by moving gaps or samples around will be lost but other edits like change base calls or removed ends will of course remain Merging Contigs 118 Removing Samples from Contigs Occasionally Aligner may put a sample into a contig where it does not belong or you may want to remove a
56. mutation In a trace view or contig view right click OS X control click on the mutated base and then choose Add Tag from the popup menu This will bring up the Add tag dialog an example is shown a bit further below Select the tag type for your mutation from the pullup menu near the top for example heterozygoteCT or homozygoteA A Aligner will show the amino acid effect in the Notes section Click OK when you re done If Aligner misses a lot of mutations in your project or if finding all mutated bases is important to you Fixing Errors 79 CodonCode Aligner User Manual you may want to make sure that you have set the mutation detection sensitivity to High in the mutation detection preferences The three actions described above Show tag Add tag and Mark as False Positive are also available from the Sample gt Tag menu but usually using the popup menu as described will be faster and easier Please note that any mutation tags that you change or add except for False Positive tags are usually deleted when you repeat Find Mutations for the same contig Tags for Finding Mutations To fine tune mutation detection you can use tags to Define the coding region in your consensus or reference sequence Exclude regions in samples or the contig from mutation finding Defining the Coding Region You probably noticed that the tag content contains a summary of the mutation which also indicates the amino ac
57. new Feature view windows _ to the right of kA Preference options Printing the Project view HJ window Protein translation Sample names Startup Vector trimming the Contig view window Description These preferences allow for placement of new windows relative to other windows or the screen If no placement option is selected for a view new windows will be added cascaded Cancel OED Using the check boxes and drop down menus you can select where Aligner places contig views trace views and feature views when opening new windows For contig views you can select any of the four corners of the screen or the root window on Windows For trace views you can select where to place trace views relative to the contig view common choices are to put trace views below or to the right of the corresponding contig view For feature views you can select where to put newly opened feature view windows relative to the project view or relative to the corresponding contig view If the check boxes are unchecked or if a window used for relative placements are not shown Aligner will add windows cascaded so that each new window will be a bit lower and to the left of the window that was opened Window Placement Preferences 229 CodonCode Aligner User Manual last Window Placement Preferences 230 CodonCode Aligner Help by Menu File Edit Go Sample Contig View Window Help Aligner Men
58. of the same length Importing Phrap Assemblies 22 CodonCode Aligner User Manual Aligner will check the sequence names in the project to see if you are re importing contigs that have been edited with an external sequence editor like MacClade and offer the option to update existing contigs For more information read the Roundtrip Editing help page e PHD files text files that contain information about base calls and quality scores PHD files are typically created by PHRED but a number of other programs including Aligner can also write PHD files PHD files typically contain the name of the chromatogram file they refer to which Aligner will then also read to get the trace data Plain text format text files that have only DNA sequence without any annotation Aligner will read all base letters ACGTUacgtu and IUPAC ambiguity symbols and ignore any spaces line endings and numbers Plain text files cannot contain any binary characters when creating text files in programs like Microsoft Word make sure the safe the files as Plain text not in native formats like Microsoft Word Document doc In addition to these sample files CodonCode Aligner can read sequence assembly files in ace format produced by Phrap or Consed and assemblies in CAF format produced by Sequencher as described above Sample Names When reading chromatogram files Aligner will use the name of the file as a sample name Since version 1 4 0 samp
59. on OS X the names of the directories will start with bscl 2 Aligner will write SCF files for each selected sample into the first folder from which PHRED will read the data 3 Aligner checks if all necessary entries are present in the Phred parameter file to process the traces you selected If any entries need to be added Aligner will show a warning dialog and then allow you to add the required entries using the Phred parameter file edit dialog as described below 4 Next Aligner will start PHRED using the path to the program that you can define in the base calling preferences the default is workstation phred in the Phred Phrap folder inside the CodonCode Aligner folder Aligner will also pass the location of the Phred parameter file as defined in the base calling preferences to PHRED Aligner will use the id and cd options to tell PHRED where the input files are and where to write the result files to 5 Aligner will wait for PHRED to finish If you are base calling several hundred traces this may be a good time for a coffee break If it s just a few traces it should take only a few seconds 6 When Phred is done Aligner will check to see if PHRED produced the expected number of result files if not Aligner will try to look at the PHRED output to find out what the problem was see below Aligner will also write the progress and error messages generated by PHRED into two files in the Aligner folder the file names are Basecal
60. point mutations Aligner will change the call for all heterozygous point mutations it identifies to IUPAC ambiguity codes You may also need to be able to identify homozygous mutations in exported sequences If you mark the checkbox Change homozygous mutations to lower case Aligner will change the base calls of all homozygous mutations it identifies to lower case e g from A to a Please note the changed base calls and the tags are currently not linked if you would want to manually change a base that Aligner identified incorrectly as a heterozygote you will need to change both the base and the tag Finding only homozygous mutations In some projects you may know that you do now have any heterozygous mutations for example when you are sequencing clones rather than PCR products When looking for mutations in such project make sure that the checkbox look only for heterozygous mutations is checked Of course when looking for homozygous mutations you could just look for any discrepancies rather than using Aligner s mutation finding However there are several reasons to use Aligner s Find Mutations Aligner can automatically ignore the low quality regions at the end as defined in the Data quality pulldown Aligner adds mutation tags which can be printed and exported for analysis in other programs like Microsoft Excel Finding indels When looking for mutations you have the option to also look for heterozygous insert
61. project file The project file has a proj extension which you may not see depending on your system settings This will read all the contents of the project as it was last saved and show the contents in a new project window Alternatively you can also use the Open Recent submenu in the File menu This will show the projects you worked with recently If a project is not longer available for example because you deleted or renamed it s folder then it will be grayed out in the Open Recent submenu Saving Projects Choose Save Project from the File menu to save your project if the project is a new project for which you have not set a name and location before you will be prompted to do so now To save a copy of an existing project under a different name and or at a different location choose Save Project As from the File menu The Save Project As command will always create a new project directory and put copies of all files into this new directory if you try to create a project with the same name as an existing folder you will get a warning dialog It s a good idea to save projects on a regular basis and especially before major processing steps like end clipping vector trimming or assembly If you are using CodonCode Aligner in Demo mode you can only save projects that a do not contain any contigs and b where you have not used any of the advanced Aligner functions like end clipping sequence assembly and so on
62. quality Hon below 20 ina 25 base window License Server Memory r Trim from end until Mutations v Error rate is below 0 1 ina 25 base window Open amp save Tu Phrap assembly L There are fewer than 3 bases with quality Preference options below 20 ina 25 base window Printing Protein translation After end clipping cea names vi Move all sequences shorter than 25 bases to trash Vector trimming v Move all sequences with fewer than 50 row f Phred 20 HJ bases to trash Warnings Window placement Description The end clipping preferences control how low quality bases are clipped from samples end clipping works only on samples with qualities Help Cancel You can choose to trim from the start until the estimated error rate drops below the cutoff you choose and also specify the length of the window over which to calculate the expected error rate Alternatively you can clip until there are only very few low quality bases in a window specifying the window length the maximum number of low quality bases and what low quality means to you typically Phred scores lower than 20 You can also combine these two measures or choose neither one if you do not want to end clip at the start The same applies to clipping from the end you can choose different numbers at the end of sequences For example it often makes sense to use longer windows at the end than at the start since the quality rapidly improves at the
63. quality bases are clipped from samples end clipping works only on samples with qualities On the top you have the choice between two different end clipping methods 1 a method that maximizes the region with an estimated error rate below the threshold you define and 2 a method that uses different criteria at the beginning at at the end of the reads The first methods is similar to the way Phred trims sequences with the trim alt option The second method gives you more options and is hopefully a bit easier to understand With typical parameters both methods tend to give similar results and remove the junk sequence at the end of chromatograms The methods are explained in more detail on the End clipping algorithms help page If you choose the first method you only have to specify one parameter which is the maximum error rate for the clipped region If you select the second trim method you can define the end clipping stringency in more End Clipping Preferences 187 CodonCode Aligner User Manual detail as illustrated below eoe Preferences Alignment End clipping Assembly A E Base calling 7 Maximize region with error rate below 0 1 Base colors II Use separate criteria for start and end Consensus method r Trim from start until Double clickin e I r End clipping da ERU V Error rate is below 0 1 ina 25 base window Features f There are fewer than 3 bases with
64. read from a contig for other reasons To remove a sample from a contig select the sample in the contig view by clicking on it s name or a base in it Then choose either Move to Unassembled Samples or Move to Trash from the Edit menu Before removing the sample from the contig Aligner first checks if removing the sample would introduce any gaps in the contig This happens if there are reads to both sides of the sample and the sample is the only sample that covers one or more bases of the consensus sequence In this case removing the sample would in effect split the contig into two pieces and at least currently Aligner will refuse to do so If splitting the contig is what you wanted to do you will first have to_split the contig yourself and then remove the sample from the new contigs formed after splitting An example where removing a read would split a contig into two is shown below f e 9o Contig1 _ djs74 1432 s1 A WERE ALL ees Hi mi djs74 824 5s1 djs74 3174 5s1 dis74 2689 s1 Contiql Translation Pos 1515 Len 3008 Here removing the selected sample djs74 1432 s1 would split the contig into two parts However the other samples could be removed without problems since they only cover regions that are also covered by other reads Removing Samples from Contigs 119 Deleting Parts of Contigs T
65. separate criteria at the start and the end of thesequence 41 Trimming Vector Sequences Vector sequences in your sample sequences can lead to incorrect assemblies and therefore should be trimmed before assembly or alignment f you also plan to use end clipping to remove low quality sequence we strongly suggest that you do the end clipping before the vector trimming To remove vector contamination from samples follow these steps 1 Check your Vector trimming Preferences Make sure that you have selected the cloning vector s that you used 2 Since vector trimming cannot be undone it s a good idea to save your project now 3 In the Project window select the samples that you want to screen You can screen only unassembled samples not samples in contigs Typically just select the Unassembled Samples folder to screen all unassembled samples 4 Select Trim Vector in the Sample menu Aligner will start to look for matches between the samples you selected in the project window and the vectors you selected in the Preferences You will see a progress window e Vector Trimming Progress Find Matches Find Matches is 16 complete XXE Mes Cancel P You can cancel the vector trimming at any time before it is complete 5 After Aligner has found all vector matches that fit the criteria you defined in the Preferences a new window will show the results Vector Trimming Results Sample Nam
66. start of sequences but only slowly deteriorates at the end Automatically removing short and low quality sequences after end clipping You have the option to automatically identify bad sequences after the end clipping and move those to the trash Such bad sequences can be due to failed sequencing reactions or any number or other problems We Automatically removing short and low quality sequences after end clipping 188 CodonCode Aligner User Manual suggest to move all sequences that are too short for example less than 25 or 100 bases after clipping to the trash A second widely used method to identify low quality sequences is to count the number of bases with quality scores above 20 Phred 20 bases With the settings shown in the picture above any samples that have fewer than 350 Phred 20 bases after the end clipping would be called bad and moved to the trash We suggest that you experiment with the different parameters for end clipping and find a setting that works for your data For example if you sequence short PCR products you should definitely reduce the number of Phred 20 bases required for a sequence to be kept or perhaps uncheck this option The results of end clipping are not saved until you save your project you can use this to try out different parameters Just close the project without saving open it again and end clip with different settings until you found settings that feel right to you Automatically removin
67. the folder where the files are created in a Save As dialog that will be shown once you click on the Export button All files will be created in the same folder the names of the files will be the sample name with fasta appended Aligner will also create a separate quality file in FASTA format for each sample The name of the quality file will be the name of the corresponding FASTA file with qual appended at the end of the name When exporting FASTA files you have the option to include gap characters in the output but checking the box labeled Include gaps in FASTA files If the box is not checked the exported sequences will be ungapped Exporting Consensus Sequences 136 Exporting Assemblies You can export Aligner projects for importing into other programs for example the contig editor Consed You can export entire Aligner projects or parts of Aligner projects for example single contigs First select the contig s you want to export in the project window Then choose Export Assembly from the File menu This will bring up the following dialog Ez Export Assembly 1 r What TOCEX DOTT rt A Current selection Entire project Format FACERE You can choose to export the current selection or the entire project Currently only two formats are supported e the ACE format that is used by the Phred Phrap Consed package and also supported by other contig editors e the NE
68. the newly created trace or traces with Phred which requires that you have a trial license or a full license When Phred is done with base calling Aligner moves the initial subtracted trace which still has the original base calls to the trash and imports the subtracted trace with the new Phred base calls Finally Aligner re aligns or re assembles the original contig adding the newly created subtracted traces Here is what the final result looks like Processing Heterozygous Indels 91 CodonCode Aligner User Manual oo Hetero indel i B i m x Save Project Add Samples Add Folder Add Assembly Align to Reference Assemble Unassemble Contents Length Quality Position Added Mo C gt ul Unassembled Samples 0 samples 0 0 4 28 3J v BS Contigi 3 samples 595 0 3 16 3 wildtype Trace 592 510 09 26 3 heterozygous_indel Trace 590 155 5 9 26 3 BB heterozygous indel Trace 580 436 12 3 16 3 gt C Trash 1 samples 0 4 28 3 Gi Processing heterozygous indels completed Contig1 v Scroll together heterozygous indel Base 173 of 590 178 in contig Quality 39 F The newly created subtracted sample is called heterozygous_indel_sub Note that a its sequence after the single T insertion is identical to the wild type unlike the original sample where the extra peaks led to extra base calls and that b the quality scores of the sequence after the T i
69. to find CCCGGG Start searching from the beginning from the cursor Search in Selected sample s 47 Consensus only O all f Cancel When searching in contigs you can specify where you want to look for your search sequence only in the currently selected sample s only in the consensus or in all sequences and the consensus Note You can repeat any search by choosing Search Again from the Go menu Search for Sequences 129 BLAST Searches To start a BLAST search from CodonCode Aligner e Select the sample or contig that you want to BLAST in the project view or select the bases you want to search in a contig view trace view or base view Go to the Go menu and select one of the options from the BLAST Search submenu Aligner will open web browser page for the NCBI BLAST server and paste the selected sequence into the Search field You can now change the search options or database to search against on this web page and start the BLAST search If your security settings are very strict so that Aligner is not allowed to open a browser page nothing may happen you will need to change the security settings first For all BLAST searches except MegaBLAST the selection must be a single sequence or part of a single sequence For MegaBLAST your selection can include more than one sequence MegaBLAST MegaBLAST is a BLAST version that has been optimized for aligning sequences that diff
70. to the intensity of the first peak This method can sometimes be useful in mutation detection Please note however that it is much simpler than the methods used in CodonCode Aligners Find mutations function and therefore much more prone to both false positives and false negatives For example the Find mutations function compares peaks at a given position to other peaks in other samples at this positions and can therefore detect heterozygous bases from a drop in peak intensity even if the secondary peak is very small Change ambiguities to single bases This is the reverse of the previous function any bases with ambiguity codes will be converted to regular bases A C G or T according to the highest peak at the base position This option is useful if you have sequences that contain ambiguity codes but you know that there are no heterozygous bases for example because you sequenced a clone not a PCR product Change low quality bases to N This option allows you to change all bases with a quality below the given threshold to N Match consensus 101 CodonCode Aligner User Manual Undo auto edits When selected this option will undo all previous auto edits any of the options described above for your current selection and convert bases back to the base calls before the first auto edit To function properly this requires that the auto edit tags that Aligner added originally are still present As long as your samples stay in
71. unaligned dangling ends of both reads Since Aligner does local alignments two aligned sequence may have unaligned bases at the same end This will happen for example when aligning two different copies of a repeat sequence or if one of the samples is a chimeric clone It can also happen if the sequence of one or both clones has a very high error rate as typically seen towards the end of reads that have not been end clipped To illustrate how this parameter is calculated consider the following diagram 123456 7890123456 7890123456 7898 tctctctctcAGCGATCAATaaaaattttt LLEELELET TL LG I gggggAGCGATCAATaggcccaggcccgggacccag 12345 12345678901234512345 The sequence at the top has 10 unaligned bases at the start and end and 10 aligned bases in the middle The bottom sequence has 5 unaligned based at the start and 20 unaligned based at the end Between the two sequences there are 15 additional bases that could possibly have been aligned the 5 unaligned bases at the start of the bottom sequence and the 10 bases at the start of the top sequence Aligner calculated the relative amount of unaligned sequence that could have been aligned by dividing the overlapping bases in the unaligned ends by the length of the shorter sequence In our example this is 15 30 the length of the top sequence or 50 With the default setting of 70 for the Maximum Unaligned End Overlap our example would have passed at least for this parameter
72. user Some of these things are Phrap disregards previously formed contigs and always assembles from scratch this is different from Aligner s assembly method which leaves pre existing contigs as they are and looks for overlaps between the contig sequences e Phrap sometimes generates contigs with only one read in it This happens if the sample has a significant overlap with other samples but the overlap was not good enough to justify a merging Aligner will unassemble such single read contigs and move the samples into the Unassembled Samples folder For very large assemblies or on computers with low amounts of memory Phrap may run out of memory Before running out of memory Phrap may need to use virtual memory which can slow Phrap down dramatically In extreme cases for example trying to assemble a bacterial genome on an underpowered computer this can even lead to system crashes Phrap tries to identify different copies of repeats during assembly based on the quality scores of samples This means that assemblies will be better if you have accurate quality scores rather than just dummy qualities If your samples have high quality discrepancies for example because you are trying to assemble samples with homozygous mutations this may lead to a higher number of contigs than you would expect Occasionally contigs created by Phrap will contain reads that are not aligned to the consensus sequence You can manually remo
73. 02 19 16 33 52 I BCAL KB bcp BCSW KB 1 0 4 No tags Mi Allow manual edits f Cancel 9 Eo The example above shows information extracted from an ABI file Note that the last two lines show which base caller was used for this sample In this case the KB base caller which assigns quality scores to each base was used the alternative is the ABI base caller which does not assign quality scores For chromatograms that were base called with PHRED the last lines in the Chromatogram Information will still point to the KB or ABI base caller But if you scroll through the chromatogram information you can see entries added by PHRED Viewing Chromatogram Information 109 CodonCode Aligner User Manual 1 e Sample Information PHRED example file ab Name PHRED example file ab1 Comments Chromatogram Information BCSW phred 0 040406 a m NAME e LANE 32 GELN PROC RTRK CONV phred version 0 040406 a T COMM Y No tags v Allow manual edits In the example above you see an entry labeled BCSW for base caller software version that point to PHRED and list the version of PHRED that was used A second entry which starts with CONV also shows that PHRED was used The chromatogram information is read from ABI files or from the comment field in SCF files You cannot edit this information Viewing Sample Tags Sample may also contain tags which have been added by users other programs like P
74. 22 CodonCode Aligner User Manual Toolbar Preferences 223 Vector Trimming Preferences In the vector trimming preferences you specify which vector sequences Aligner screens against and what the minimum criteria for a vector match are e608 Preferences Alignment r Vector trimming Assembly r Vector Library Base calling Base colors I UniVec Consensus method O UniVec Core Double clicking __ lt lt lt OVO End clipping From File Jigner Data Vector CustomVectors txt Features Select vector sequences to screen against Highlighting BlueScribe cloning vector E License Server BlueScribe M13 Plus cloninc M1 ue BlueScribe M13 Minus ning vector SYNBLM131 a BlueScribe KS Minus cloning vector SYNBLKSMV v Open amp save Phrap assembly Preference options Search Criteria Printing npn TT Protein translation Minimum identity 80 Sample names Min overlap length 20 Minimum score 10 Startup Max distance from start 40 Max distance to end 100 Vector trimming Views r After Vector Trimming oe vi Move sequences shorter than 50 bases to the trash Window placement Description The vector trimming preferences control which vectors are used to screen against what the minimum match criteria are and how far vector matches can be from the ends of sequences To setup or change your vector screening parameters fol
75. 3 Delete Consensus method Direction iv underscore E REPER Double clicking End clipping Features Highlighting License Server Memory Mutations Open amp save Phrap assembly Preference options Printing Protein translation Startup Vector trimming Window placement Yoon Add name part Define delimiters Preview Description The sample names preferences allow you to define how Aligner interprets sample names You can define different meanings for parts of sample names and then use these name parts to assemble samples in groups based on their names In the screen shot above Aligner would interpret samples as follows e Everything from the beginning of a sample name to the first period would be interpreted as the clone name The part after the first period up to the next underscore would be interpreted as the direction typically F would indicate forward reads and R reverse reads Anything that follows afte the underscore will simply be ignored You change the meaning of a name part and the delimiter that indicates the end of a name part using the respective combo boxes You can add more name parts using the Add name part button and delete name Sample Name Preferences 215 CodonCode Aligner User Manual parts using the Delete button next to the part you want to delete You can view how sample names will be interpreted by clicking on the Preview butto
76. 5 EVO UU or 166 Minimi Percent FIBI sas iie pri eto pd e ono a A a esten as be emu ppu tubis iei ds 166 Minimum Overlap LEenptiliie ins oh WERE E EE ane eames 166 us Rava VTL Ua c DES TTE SCOE iii To To PERO pd dte ROUTER GN M SOME NUR DT GM Pee 166 Maximum Unalisned End Cerb uie tee teem meio een des POS ERE HE abus Ra 167 Bandwidth Maximum Gap SIZE hssr iiec red Ere ERR isan iiaia UELLE S AGER ERAS EE ianiai ia 167 Word Length TRI 168 Ja PA ESEE PMID EO TT TTE 168 Restoring debut PAC BEER eie cede eed Eina er pra Eee nis Fern porn elabi pn rU Pay uda cra 168 Assembly PEOIeFelCBS iios aspe i o MEE EEUQ TI OU a eee ees 169 JATSODIIE oobis cedat eo euo bo uo TO o umet nno Sas ODD NM M EU LN SR a 170 Minimumi Percent Ment ooo ons cente roa HO ebd eet via bu a eR o noil ilr ep ee Fu Pet ad d 170 Nur Overlap Length iio riti eo EHESERGI UD ISEEREDRUREHMA QUEE RUM EE IER HANE E Ri 170 Minimum Alignment SCORE eicere ERSTE ERE n E EA NEA I REI AE E SEE PEENSUEEH EE EENI 170 Maximi tnabened End Ata sts sxa3sccsevesassssgaaccoannncean EO URERESGER UDIN EHYIA ENSE KEMRMIR UE aaa 171 Bandwidth NIS nU ra ES SO oec ecu esas va o er d e vas reed ra d hr n ub p Ed rea n 171 boogie R 172 Maximi Successive lanl esc ODDO eee 112 huEedalue siut E oat 172 Restoring default Drabisbers nu rics oo corni cores e are UL EE EUG Auto Dile Lu UG i aV EE ZERO AUG Ea 173 Base Calling Pref
77. 70 Ner a mi a aal TAAG GG AAATAG G ACAACTAAAATAT 4 s L 4 Quality 68 Cons 68 E O crFrR Nom R Base 43 of 290 43 in contig Base View Window CodonCode Aligner User Manual Each contig has its own trace window which can show the traces for one or more sequences If the traces for all sequences cannot be shown in the window at the same time you can use the scroll bar on the right to scroll through the different sequences Quality View Window For sequences that have qualities for example Phred generated SCF files you can get a quick overview of the quality by selecting the sample in the project window and then choosing Qualities in the View menu This will open up a window like this one eoo A060 s 7 140 A060 s Base 157 of 628 Quality 10 4 The picture shown above is pretty typical a bit of low quality sequence at the beginning followed by rapidly increasing sequence quality and then several hundred hases where the quality is mostly very high except for some short problem regions If you open a trace view window for the same sequence then clicking somewhere in the quality view will reposition the trace to the same region This allows you to quickly check out problem regions in the sequence try it out Contig View Window The contig window show detailed information about contigs a graphical overview about how the samples are aligned the aligned bases and the
78. Apal BamHI Bsp68l EcoRV Hincll Hindlll Kpnl Notl Pael Sacl Sacll Sall Smal Xhol Xmil The multiple line map displays a separate graph for each enzyme The number after the enzyme name tells you how often this enzyme cuts In the screen shot above fragment sizes rather than cut positions as in the first screen shot are displayed The fragment sizes are displayed in base pairs in the middle of each fragment For example BstXI cuts one time generating two fragments with 1073 bp and 600 bp At the bottom of the map a list of all enzymes that do not cut in Contig1 is given It is possible to shown only cutting enzymes only non cutting enzymes both or no summary at all You can choose what to display in the restriction map preferences Text Map The text map for the same example displaying fragment sizes is shown below eoe Contig1 Eco Hind x Enzymes Options Restriction map for Contig1 1673 bases linear DNA Displaying fragment sizes in base pairs BstXI 1 600 1073 EcoRI 1 634 1039 Pstl 3 47 273 454 899 Xbal 1 661 1012 Non cutters Acc65l Apal BamHI Bsp68l EcoRV Hincll Hindlll Kpnl Notl Pael Sacl Sacll Sall Smal Xhol Xmil Multi Line Map 159 CodonCode Aligner User Manual The text map displays the cut results for each enzyme seperately like the multi line map In the screen shot above you see the fragment sizes generated from the contig by each enzyme The restrict
79. Assembly with Phrap however you can assemble using Aligner s own assembly algorithm Finding mutations and heterozygous indels Processing of heterozygous insertions or deletions indels If you would like to fully test Aligner with your own data you can request a license key for a time limited trial as explained in the next section Time limited Trials The first time you use CodonCode Aligner you will automatically receive a time limited trial that enables you to use all functions for 30 days After the initial trial expires Aligner will revert to Demo mode You will still be able to open any existing projects you may have but your ability to save or print will be limited as described above If you need additional time to evaluate CodonCode Aligner please contact us by email to support at codoncode com We will need to have your name and email address to send you a trial license note that the email address cannot be an anonymous email address like xx 9 yahoo com Licenses for CodonCode Aligner 3 CodonCode Aligner User Manual Single user Licenses Single user license keys that you purchased from CodonCode Corporation allow the use of CodonCode Aligner on a single computer To enter a single user license key that you received from CodonCode start Aligner and press the Enter License button in the startup dialog If Aligner is already running select License from the Help menu and then press the Enter New License b
80. Code Aligner special workstation versions of Phred and Phrap are also installed These workstation versions are identical to the regular Phred Phrap versions except that e the workstation versions of Phred and Phrap can only be run from CodonCode Aligner not from the command line or scripts they require a valid license for the Workstation Phred and Workstation Phrap modules as shown in the license dialog Single user Licenses CodonCode Aligner User Manual r eoo CodonCode Aligner License CodonCode Aligner CodonCode Aligner License Licensed To CodonCode Corporation Demo Use License Type Single User License Serial Number DD0502 Computer ID NP4104 Module Licensed Expires view amp Edit Trace Functions Yes 2004 10 03 Data Processing Functions Yes 2004 10 03 workstation Phred Yes 2004 10 03 workstation Phrap Yes 2004 10 03 Enter New License Note that the Licensed column in the example above says Yes for all modules indicating that you can use the workstation versions of Phred and Phrap that were installed with Aligner Time limited trial license will generally allow the time limited use of workstation Phred and Phrap Licenses purchased by academic users will also generally include licenses for workstation Phred and Phrap since Phred and Phrap can be obtain by academic users free of charge Licenses purchase by users at for profit institutions however will not include permis
81. CodonCode Aligner Acknowledgements The sequences used for the examples shown herein are from the PolyPhred examples by Dr Deborah Nickerson s group available at http droog mbt washington edu example csft2 tar gz The names of the sequences used from this collection were changed for illustrative purposes We thank Dr Nickerson and all others who have made traces with heterozygous indels available to us The use of trace subtraction to identify heterozygous point mutations was originally described by Staden Rada and Bonfield and implemented in the program TraceDiff Bonfield JK Rada C and Staden R 1998 Nucl Acids Res 26 3404 3409 Early work on the algorithms for analyzing heterozygous insertions and deletions used in CodonCode Aligner was funded by the National Cancer Institute SBIR grant 1R43CA83384 01 Interpreting Results 94 Editing Samples CodonCode Aligner allows you to edit your sequences but before you start editing remember that You may not need to edit This is because Aligner will examine the quality scores of all aligned bases at each contig position when building the consensus in other words Aligner typically builds a quality based consensus rather than a majority based consensus In the days before Phred quality scores editing discrepancies was important consensus sequences where always majority based and the only way to make sure that the consensus sequence was indeed correct was to look at the disc
82. CodonCode Aligner User Manual CodonCode Aligner User Manual Table of Contents About Codont ade AH gner sipsirin RR POH TOR EE E ERE MY RN EAN N EEAO EA RECHNEN EO RS 1 System RequiFCIDISREs secco rere oct IRL ERR EP R EIER ee pu ve N A OFE E HU ATONE OOE IRIURE PEU ERR RUE 1 Mote for Mac OS X 10 3 USEER Goose ERE VEEE FEE ENREER PUER ER URCEY E REENRF ERE VERF EE FAY GENE CIE sia punters FER DEET ERR E DOD 2 E D ere vec Ir 2 Licenses Tor CodonCode ABE seisine a n E Ep TUM KE END r 3 Derne Mod oea SIT UTI T UU E 3 Timne kied H oa pelea da DEL ene ee Ra ree P s TUER ER 3 butele uset LICEE sos ie SO Ete EPIRI HEIDI ERI HAE de Mu IH II IUUD cip MEM 4 Using Phred ind Phrap from Codon C ode Alger terret reed Er E nE ANPE TR 4 Replacement 1Cense IOS serer re PG EE eee MOR o Ie Boh PIRE FUA 5 Laccnec Server WICC Re yu ovata obra o DE vs UOCE GARD Gra ores Een X eo p wo edP ol d 5 Firewall ports Tot License Server usd cope aa HEREDI bee obbes EEA EE e Lapi pe ae ie UM ERIS Ra 6 CodonCode Aligner Pe3tures sisii n RON EH EnXE REGE UL EU ILU DARFUR E FRED UR HAIR RE GREEK KU FR UL KXRR DRAK E ERU RS 7 Aligner W indows and VIS c osos noo ew d eeu POR CAP ELA RD KR en TONS CE RU ae enna T The Ne esti VR CIO aaa eee arse T PROPECT A Te OA A a a 8 Pase Vien Wina ON aie sce ccs pies ENEE EE tbe dpa m Ud pete ae eie scarpe uio UO ere kun 8 Tace Wg TN T T E E E ea PECES 9 Ouality View Window saiae ieaie k ak e aA Ibidem In leat p nip E Ti 10 C
83. Contig1 Contig2 and so on and shown as folders in the project view If you select a contig in the project view and then double click on it or choose Contig from the View menu you will see the contig view which shows a graphical overview as well as the aligned bases You can edit samples in contigs as described in the Editing Samples section and you can edit contigs as described in the Editing Contigs section Here is an example of a contig view eo Contig1 djs74 2361 51 lt lt djs74 1532 lt lt djs74 1802 djs74 996 s2 djs74 2689 s1 lt lt djs74 237 4 djs74 2350 sl djs74 1180 s1 lt lt djs74 1432 Contigs 66 Unassembling Contigs To dissolve an existing contig and return the samples in it to the Unassembled Samples folder select the contig in the project view and choose Unassemble from the Contig menu or click on the Unassemble button in the project window toolbar Any gaps created by Aligner are removed and samples that were reverse complemented are returned to their normal state You can also unassembled contigs by first selecting the contig in the project view and then dragging amp dropping the contig onto the Unassembled Samples folder Before unassembling contigs this way Aligner will show a warning dialog asking you if you really want to unassemble the selected contig s Unassembling Contigs 67 Aligner Algorithms for Assembly and Alignments Cod
84. IPs Ras RISUS coc 48 H uctodssemble eo obo d be ROSE DER HE EMILE e ME IM E 48 Advanced assembly options iacet erri err Ib or etr PC REL DER EHOEVe FIRE PUER PE E E rp e Uu E ea eine 48 osse nile Mone SOR ath scsi re Od EDEN FER UR EO RS Fen o BOS IS RR QUO Rie RU PACEM E 49 Compare conige to BITE occum b ura cea Pe aes ald usui xia ORUM U i ecd e ig 50 CodonCode Aligner User Manual Table of Contents Sequence Assembly zxssotnble WCPO UNS oer reno ve te LR UP A E VIP AN VPE LR IMPER VR PRMURRER 53 Pie process Ono ete D DEDDOSSEMO oos usse aE PUO aaa eas PI OE ERO 55 Sequence Assembly With Phitaps iccistssscssnccoiswssctnnnier tensed NN E N 57 How Aligner assembles using Phr p o ooo rero rn I EUR CHREE adi ee ea 58 Things 1o Note tot Phrap Assembles oes re ito Oe HOD RO OR OR Sa en E 59 About PISO osi code eto DUST MG GEH perge UE cuida NEU ERU EIE E Ar QUEUE HM UU TN REN AUR ZUG EERIE 59 Alignments toa Referente Seg Wen ce secare ren pr step P Lv era v Pr sqb aS eeoa vU EN MEER US QR pr Pus ESO Ee reve Erba uve E OSEE E viua uud 61 Addas Samples to APENS aor atio pours FE ENESE RESI E v AERIAL PEE Res AS 62 Advanced dhoDIeBU ODORE osise at ren cto boe oa nr nieve es eo eee 62 Align to reference frei sotatehi iai ence aperti ener bdo abb IER a HLEb bn I XR CE T o ped Ee ERO e IER ER RE MEA 62 Alian in grops sonrie m 63 Pre process One BIO Pr OCES ME oco ces AA EE E E E es cca 64 CODES E PEPE ELT 66 Linassembling Contlgss ov ad d n be
85. MIG CHEESE MEINEM PM Vale ae Scroll together RTL aE uit Base 172 of 582 Quality 39 Up to base 174 you have a nice clean sequence but from base 172 on you see double peaks at many but not all locations Many of the peaks are also less tall than the peaks before base 172 This is typically caused by an insertion or deletion indel in one of two chromosomes that you sequenced by a heterozygous indel Let us look at a homozygous wild type sequence at this location eoe Traces from Unassembled Samples CCAGAGAAATTGGTCAGGAGCACAAAGGGGCACTAAGAGCAAAA 180 190 lt gt x g A e A f DA ja gt A CY v Scroll together wildtype Base 172 of 582 Quality 62 If you compare the wild type sequence to the indel sequence above you will notice the additional red T peak at base 172 You also can see that the first yellow G peak is only about 50 of the intensity in the wild type trace followed by 3 G peaks of regular height and then an extra G peak that is half as high as the three preceding G peaks From this we can conclude that the indel event here is a one base T insertion on one of the two chromosomes sequenced Analyzing heterozygous indel traces this way is possible but it can be tedious and error prone especially if the insertions or deletions are longer than one or a few bases CodonCode Aligner provides two functions that can help you in analyzing heterozygous inser
86. RAS PE FELIPE UM eaten 20 importing Sequencher Projects CAF FES oeocoto tienen de ake D VO RAO Ra s S EE 20 CodonCode Aligner User Manual Table of Contents Adding Sample Files to Aligner Projects Organizing Samples And Contigs In Folders csccssscssscssssccssccssccssccsccssecscescseccssccscssscessccssesscsseseoes 26 Creatina Poldo Loi osa cepit cd oon OC QR dvo HI OPUS Iste NE opes UD a AR Len ana OUR EUG puel ati eid DIO 26 Moving Samples and Contigs to Folders cariche sitter ert nat hr t cn EE LEER Fu rA CHE KRe ce ek din ia 26 Renaming Polderg esos eriet prt HEE EP RTENE E EE A AO 26 BISTRO IU CS TO OU cmm 26 Editing thie PHRED parameter D is eiie rete e pH a gre tg Fas Pom UNS RD EAD ER S Fd M eT asian ads 30 Base cain DEODUSTS uisi cy na a ae ba ea Ford gu prb leni v pn a Vp pitt gna ird 32 Cannot find base calling DUOSTSID oi sedecsee disceret aer ertt dea hot da bed cR Ed AE CR eer eb pF edes dea bte ache 32 phen the Phred parameter file ee NOTA m EE PE NIE E PE AIE A ars iov A 35 PERTE rq i EAA NENNT EPEE E 36 Vector Rival E AA minnie 44 Using UniVec Library Files FS ILU RE ELLE CI INL MEL 44 Usna Custom Vector Pes auos noe dO ERU ss a E UU CMM E 44 Assembly and A lienm enl aecoee rette tenor heap von Foto ee PR EIE SEE EFIE EU VVENRU SERA EERCEE MER SEE LK REE SER EEUN SENE EE VRER E e Ex PER Ula QEed 46 Sequence Assembly eec ttp tete eane etr E Shaki N EAA ce Ute ir S spe bud cited N 48
87. Sequences Export Features Aligner will then show a dialog box where you can set options like file formats Next Aligner will present a standard Save As dialog where you can choose the folder for your exported files and if you are exporting to single files the file names Be default all files will be exported into a folder called export dir inside the project directory You can choose to export to any directory you want but be careful not to accidentally overwrite any existing files Aligner might need If you are exporting multiple items to individual files Aligner will automatically determine the file names and extensions If any files with the same name already exist in the folder where you want to save your files Aligner will warn you that the existing files will be replaced Exporting 131 Export Project Summary This allows you to export project data like sample names read lengths and so on to text files that can be imported into external spreadsheet programs or databases The information exported will be the information you see in the project view window and optionally summary information about your project To export project summary information go to the File menu and select Project Summary from the Export sub menu This will show the following dialog r e Export Summary r Project data to export M Project overview vi Contig summary vi Sample summary Format Comma Separated Valu
88. The codonStart tag identifies the first base of the first complete codon and therefore must be assigned to any of the first three bases in the first coding region see Notes below Here is an example of what the Add Tag dialog looks like in this case e Add tag to ReferenceExample New Tag Type codonStatt Tag Details Program Use Start 90 End 90 Date 08 EDT 2 Notes 3301 f Confirmed f Cancel If you prefer you can write basenumber 3301 or your number of course or basenumber 3301 in the Notes field You do not have to enter this information when adding the tag you can do it later by editing the tag in the Show tag dialog Numbering the Coding Sequence 82 CodonCode Aligner User Manual e Tags for ReferenceExample at base 89 Tags Tag Details codingSequence Program User Start 90 End 90 Date Thu Jul 15 19 48 08 EDT 20 Notes AL LSSSELEDLLLELLLLLLLU LELL D basenumber 3301 C Confirmed The number you set this way for the codonStart tag is the nucleotide number of at this position Note Keep in mind that the codonStart tag identifies the start of the first complete codon in this exon Therefore 1 You must add codingSequence tags before adding the codonStart tag 2 The codonStart tag must be in the first three bases of a codingSequence tag 3 You can add only one codonStart tag per gene in yo
89. To use this option you will need either a trial license or a purchased license base calling is not enabled in demo mode Additional information about base calling can be found at the Base calling help page Please note that one important difference to the normal Call bases menu choice in automated pre processing samples that already have quality values for example from the ABI KB basecaller or from calling bases on the sample before will not be base called again Find heterozygous indels This option will look for potential heterozygous insertion deletion indel mutations in the unassemble samples that have a chromatograms and b quality scores If you are sequencing PCR products from genomic DNA that may contain heterozygous indels you should check this option if you are sequencing from cloned DNA this option should not be checked For more information please read the Heterozygous insertions and deletions help page Clip ends This will remove low quality sequence from samples that chromatograms and quality scores For more information please read the End clipping help page Trim vector When checked this option will identify and remove vector sequence contamination from the samples in your selection You may need to set your vector trimming preferences before using this option For additional information please read the Vector trimming help page You will see progress dialogs for each of the steps performed after you cli
90. XUS PAUP format which is used by many phylogenetic analysis programs the Phylip format another format often used by phylogenetic analysis programs Please note that many formats may not really export the entire selection or project For example the ACE file generated when exporting in the ACE file format will contain only contigs but not unassembled reads or samples in the trash ACE Format Exports The ACE format for exporting projects is modeled after the format used by the Phred Phrap Consed package which is also supported by other sequence editors Exporting will create three directories as illustrated below 600090 gt export dir 10 items 24 2 GB available Name i v edit dir j Contigl ace v chromat dir A455 s A454 5 A326 r v phd dir O Ad55 s phd 1 O A454 s phd 1 4326 r phd 1 Exporting Assemblies 137 CodonCode Aligner User Manual The folder edit dir contains a single file the ace file This is a text file that contains the information about the assembly for example the number of contigs and the consensus sequences The second folder chromat_dir contains the chromatogram files format for the exported traces The trace files are in SCF Standard Chromatogram Format format The third folder called phd_dir contains PHD files for each sample The PDH files are text files which contain the base calls qualities and additional information like tags You should
91. You may need to adjust this value depending on the kind of project you are doing If you aligned cDNA sequences to genomic DNA use values of or near 10046 since large stretches of exons may be unaligned But if you expect your samples to match end to end and pre processed your sequence with end clipping and vector trimming you can use lower values to reduce the chance that different copies of repeats will be incorrectly assembled together Bandwidth Maximum Gap Size The bandwidth parameter allows you to set the half width of the diagonal used during the banded alignment This has an effect on the maximum size of gaps insertions or deletions in one sample that can still be aligned A bit simplified if one sample has an insertion or deletion that is larger than the bandwidth number the alignment will typically stop at the insertion deletion and the rest of the sample will be unaligned If the insertion or deletion is shorter than the bandwidth the alignment will continue after introducing the necessary number or gaps in one sequence as long as the aligned parts after the gaps is long enough the aligned regions before and after the gaps must be at least 1 and 1 2 times as long as the number of gaps and longer for any mismatches or ambiguities The discussion above is a bit simplified in reality what counts is the total number of gaps in one sequence minus the total number of gaps in the other sequence at any position since the alignm
92. a Save As dialog that will be shown once you click on the Export button All files will be created in the same folder the names of the files will be the sample name Individual FASTA files 135 Exporting Consensus Sequences To export the consensus sequences of contigs select the contigs of interest in the project view and then choose Export Consensus Sequences from the File menu This will bring up the following dialog x e Export Consensus What to export rs fe Current selection J All consensus sequences Format FASTA Single file Include gaps in FASTA files X Cancel Using the radio buttons at the top select to export the consensus sequences for just the selected samples or all contigs in the project The Format pull down menu gives you the following format choices Single FASTA file This will generate a single text file in FASTA format which contains all the exported consensus sequences You can specify the name and location of the file in a Save As dialog box that will be shown when you click the Export button Aligner will also create a quality file in FASTA like format The name of the quality file will be the name of the FASTA file with qual appended at the end of the name Individual FASTA files This option allows you to create a separate file for each consensus sequence Again this is a text file in FASTA format each file contains exactly one sequence You can choose
93. a number of bases in a row The consensus sequence is automatically updated with any changes if such changes introduce a change in the consensus sequence Edits made in one View are automatically updated in other Views of the same sample If you edit a consensus base then the change will be applied to all samples that have aligned bases at this position so once again be careful Automatic edits CodonCode Aligner offers several functions to automatically change bases for example to call heterozygous bases or to convert low quality bases to N To auto edit bases select that bases you want to edit go to the Edit menu and choose Change Bases This will show the following dialog e00 Change Bases 7 SSFP Match consensus Options cinsmmeimansenmenmmtl o Call second peaks higher than 25 96 of first peak Change ambiguities to single bases 7 O Change bases with quality below 20 ri to N Undo auto edits vi Change only selected bases v Show results summary dialog Use the radio buttons to choose how you want to change bases see below You can also choose if you want to change all bases in the selected sample s or just the selected bases and whether or not you want to see a dialog summarizing the changes CodonCode Aligner will add tags to all auto edited bases You can undo all changes right after you made them or later with the Undo auto edits selection in this dial
94. al e Sequence quality must be high and base specific quality scores must be reasonably accurate but need not be perfect Mistakes are most likely in low quality parts of samples and may affect other samples at this position Mistakes at the beginning and end of samples can be reduced by increasing the minimum data quality requirement at the start and end in the mutation detection preferences e If any samples contain heterozygous insertions or deletions they should be identified before searching for heterozygous point mutations for example by checking the Look for heterozygous indels check box in mutation detection preferences Otherwise many false classifications may result especially if the minimum quality at start and end is set to low values You should always adjust the mutation detection preferences to your specific needs All results obtained with Aligner should be checked by a qualified scientist If you find any examples where Aligner s classification seems to be incorrect and is not due to low quality data or similar potential causes decribed above please let us know by sending an email with your data attached as a Stuffit or Zip archive to support codoncode com Limitations 86 Heterozygous Insertions and Deletions When sequencing PCR products from genomic DNA for mutation analysis you will sometimes encounter traces that look like this eoe Traces from Unassembled Samples Eu S E LA RE NIE cd GAGCAC AA A
95. al misassemble contigs You can manually split misassembled contigs into two parts as follows Open the contig view for the contig in question e Set the cursor to the position where you want to split up the contig e Select Split contig from the Contig menu Aligner will create two new contigs one containing the samples that were to the left of the point where you split the contig and one containing the samples to the right For any samples that had aligned bases at the position of the split Aligner will put this either into the new right or the new left contig the right contig will be chosen for samples that had more aligned bases to the right of the split point and the left contig for samples that had more aligned bases to the left of it Here s an example of a contig before splitting F 099 Contig be djs74 1432 s1 e E oo a MM SS Hn djs74 824 5s1 djs74 3174 s1 Contiql ation After splitting at the position indicated 1448 the two new contigs look like this Splitting Contigs 123 CodonCode Aligner User Manual OQ Contigl right k djs74 2350 s1 k djs74 1180 s1 H djs74 996 s2 1js74 1532 s1 1js74 1802 s1 IHs74 423 s1 Note that the sample djs74 1432 s1 ended up in the leftt contig Splitting Contigs 124 Unassembling Contigs To unassemble one or more con
96. allows Aligner to take edited bases into account when it matters for example when counting Phred20 bases When calculating the consensus quality Aligner will substitute the quality scores with the scores you specify here the default values are 10 for low quality edits and 30 for high quality edits One exception where you may not want to use a quality based consensus are re sequencing projects where you align your sequences to a known reference sequence In such projects you may want to use the majority consensus uncheck the box at the top so you can see most common base at each position in the consensus sequence for details about how Aligner builds the majority consensus check the Algorithms section Instead of building a majority consensus Aligner can also use the reference sequence as the consensus sequence for contigs that were generated by alignment to a reference sequence To do this check the box labeled Use the reference sequence as the consensus Whenever the reference sequence is used to build the consensus Aligner will also use tags for mutation finding that are added to the reference sequence in particular codingSequence and dontGenotype tags Tip If you want to compare a lot of samples against a reference sequence in separate projects it s a good idea to first create a project with the reference sequence only and to add the codingSequence and if needed codonStart and dontGenotype tags to the reference sequen
97. amples to Lnasserabled Samples uus sa rco eee DRE prep mares IRE au CEU DU LV 105 Inserting Gapsand ES S EE LL E Ee 106 Addin Bases ut the Bed ot Redds eso sore eR Epor EO riv e v nes aeRO 106 Reverse Complementing KA APE A PEA E deans EH serie HE diuidi 107 CodonCode Aligner User Manual Table of Contents niv uA PCet RET 111 Viewing Local Tagair ned aaa eee 111 POG ELSE RC 112 Savio ENS r EENAA AEQ RCM DOR EXER EEES 113 HRRERBEHIMPTEOR TIT 114 Cops and P ste eorpore EPEE SERE A A E 115 Co selected sequstici ocio coto Ness Uo de cLs a 115 SE Te etre are M I LU ME MM RM MM M M E E A ONAE 115 Editino CONS iion EE HEXODGERHIR RE PRO DOVER EOD CARD atin anti aration 116 Adding Samples to Contigs usted isere iriso specie aio pe t prx vue e N pe Faut ped ener dap aise ences 117 Duplicatie SAMIR caseros eren del Or lC ona VE LEEREN en EE Ep Maen 117 IVICEEHID COINS 2o eibi Gracie pe Core Pe P XN PEUPLE HAS U EE TIN dM woe us QMPIE PD EP P FINES SIMA Si ues opes pe RUNE DRRR MEET ies 118 Rem viup Samples froi C ODDS cereo coo eectnt te Ub RE uS MKk Dna cup irse c Ies Ro ERN pa LR AREE Miu axe pe SUE KDRE EM EET REP TUE 119 D le ng Partsqi Comi Serrone eae DAE Ld NOn MNA oL E ARE ES 120 Alisnment Locations Start and Exil erroe renta eo un pnt ninh aS noui Sm UE ben Kiko ER a pYn S pe pliE nu KE RAE RET RENE R URP UNE EN 121 Reever se Mcd 122 SOOO
98. anes E E kx v eU RIA pena bxsepk os Ep RES EIST 152 Navigating using the overview panel onnon aed enl us soa EE epee Eai 152 Moving Around e eT 153 Contig quality inthe overview panel ecce reb ee Hoe ER cian aie awoke esl ee 153 eed Bases and Proter Translatie nt E PON ye ROGO Ec E evans 153 Masking Bases Matching the Consensus vos corone eoa cius terti P aee ee cotes elg PUEEL UE RUE DU e ERE CU ud DV ERE Cg 154 vi CodonCode Aligner User Manual Table of Contents Contig View Window Sorting Reads iii the Conta Vote Wy s see xis sdsaedessocescadaaes HERE BE IS NNERIGL RIS ERA EREINEN E IRURE EIE Node 154 AMOS Trace SELON urs ioa quo VER UFU p DERE GU E RED Far ud Fel edo Pub QR CO EAD EER EE 155 Pnfinc C GR sooo reo T eb ea nra ae c Pe E rd eid eh bd Ep ea neo 155 P atur WV INTO Wo oo ieioos e Pe tope re LUUD IP teu SPEC IU UE RIU SEPIUS SNP e DUE Neo QUU S Ee oU EOS OU Ne OU RUE uu Rec enu PUO n Np Pr OU dEPE eu EN EPR CUN 157 RGR TCO Map Viies O enesnee 158 Smgle Line GIG ai oso Erro REI S HMM tae IEEE RE enema 158 hit Bird E 158 SOR rc R M REESE 159 este SUNT IE EE deo bra tela dendo po qu dde E nh aoe via db co oe p eee 160 Restriction Enzymes d ADIPDet ciinei kea HET EEH a REE REHAB DI OR bo TUN DP Id RE ees 161 LESE UNSERES OE ESL 162 Preler nces and Settings usos am EEE RUPEE DLE XX enantio 163 Alignment Prelerentes iue oon tod p FEE UE HORE EU R 16
99. anual 90090 Contigi 651 CTCTGATCTG TCTAGATTTG TTGTGGGGAA AGATCCTGAA GGAGAGCACA 701 GAGACCTGGA GGAGGTCAGG TGCTGCA HMM LYCEE 751 HhdteutbudE wd ESSE wer wie ee GATTCCCCAMTCAATTTCCA GACCGACCT 801 251 TCE HYS RI ZIXIXXXE 901 Hip Xd ACT AG CC TCTCATT ACHTCATCCATTCHTCTGTGAAAT 9 951 KARARLA Aw vd ele FEAET v vl cb V pci Ed ALALLE ep Ne GCGCGGTGG 1001 TCTTAGCTCCHCATGGGCTTAMAAAATTGGGT 1051 ERE HEXELIIZXI Mae tcccac CCCGAGGCAG GCAGATCATG 1101 AGGTCAGGAG ATCGAGACCA GCCTGGCCAA CGTGG TGAA ACCCCATCTC Contigl 346 bases 728 1073 of 1673 Quality 90 The selection also works the other way round When you select some bases in the base view trace view or contig view they will be highlighted blue in the restriction view Restriction Enzymes in Aligner The restriction enzymes used in Aligner are read in from a file This file is a text file called rebase_bairoch txt and is located in the folder Aligner Data in the CodonCode Aligner folder The enzymes in this file are listed in a certain format compatible with known formats such as the ones from EMBL PROSITE and SWISS PROT The file was obtained from REBASE RestrictionEnzyme dataB ASE http rebase neb com The rebase file used is the file in rebase format 19 also called Bairoch format The current file and a help file describing its structure can be downloaded from http rebase neb com rebase rebase f19 html Aligner uses only the type II restriction enz
100. any collection of vector linker etc sequences that you want to screen against in FASTA format An example custom vector file called CustomVectors txt is installed in your Vector folder inside your Preferences folder It includes some common vectors like BlueScript M13 pBr pGEM and pUC Custom files can be kept in the same vector folder as the UniVec files or in any folder that you choose To add sequences you want to screen against we suggest that you make a copy of the Custom Vectors txt file and edit the copy If you use linkers or PCR primers in your subcloning it s a good idea to add the sequences of the linkers and primers to the custom vector file and select them to be included when screening in the Vector trimming preference panel When screening against short sequences like primers however keep in mind that short matches may not meet the minimum match criteria and therefore not be masked Minimum match criteria are discussed under Vector screening preferences Vector Library Files 44 CodonCode Aligner User Manual Note When editing a custom vector file please make sure that it is saved text txt file Aligner will not be able to read files in other formats like Microsoft Word s doc format Custom vector files must be in FASTA format each sequence must have a line that has a greater than gt sign followed by the name The file can have multiple entries here is an example gnl uv L09150 1 3248
101. ap can be displayed in three different map styles Single Line Map Multiple Line Map and Text Map Single Line Map The single line map is shown below eee Contig1 Eco Hind x Enzymes Options Restriction map for Contig1 1673 bases linear DNA Displaying cut positions EcoRI 635 Xbal 662 Pstl 274 Pstl 728 BstXI 1074 Pstl 1627 Unique cutters BstXI EcoRI Xbal Enzymes that cut two times None Enzymes that cut three times Pstl Enzymes that cut four and more times None Non cutters Acc65l Apal BamHI Bsp68l EcoRV Hincll Hindlll Kpnl Notl Pael Sacl Sacll Sall Smal Xhol Xmil In the example above you see a single line map for linear DNA that displays cut positions The cut positions are shown behind the enzyme names A summary of the cutters and non cutters is shown at the bottom of the map You can change how the map is displayed and what enzymes to use in the restriction map preferences You can open the preferences through the icons in the toolbar of the restriction map view Multi Line Map The multi line map for the same example is shown below Restriction Map View 158 CodonCode Aligner User Manual eoe Contig1 hind E Enzymes Options Restriction map for Contig 1 1673 bases linear DNA Displaying fragment sizes in base pairs 1073 600 BstXI 1 634 1039 EcoRI 1 273 454 899 47 Pstl 3 661 1012 Xbal 1 Non cutters Acc65l
102. ap will be inserted after the current base so that you can add bases to the end of reads If you want to insert a gap and shift the bases before the gap to the left instead of the bases after it to the right select Insert gap gt Shift Bases Left from the Sample menu Alternatively use the keyboard shortcut Shift Space keep the shift key pressed while pressing the space bar If you are working in the contig view and have a consensus base selected gaps will be inserted in the consensus and in all sequences at this position To insert a base e insert a gap character as described above then type the letter of the base you wanted to insert Since the gap you just inserted was selected after you inserted the gap you just replaced it with the character you typed Adding Bases at the End of Reads To add bases to the end of a read 1 Select the last base of the sample 2 Press the space bar to insert a gap 3 Press the letter of the base you want to add to change the gap to the base 4 Repeat steps 2 and 3 for each base you want to add The gaps and bases that are added this way will not necessarily line up exactly with the peaks instead they will be spaced evenly with the same spacing as the last 20 or so bases before the last base This is usually ok if you need to add just a few bases If you need to add many bases you may be better off repeating the Base Calling for this sample if the sample is in a contig you fi
103. ar and the project window will now show the newly formed contig s unless no joins were successful in which case you will see a dialog telling you so When CodonCode Aligner assembles pre formed contigs the if looks for matches between the consensus sequences and leaves the alignment of reads in the contig mostly unchanged If contigs are merged with other reads or contigs any necessary gaps will be added Advanced assembly options In addition to the simple assemblies described above CodonCode Aligner also supports several advanced assembly options including Assemble from scratch this will unassemble any existing contigs in your selection before starting the assembly This option can be useful to if you want to undo manual introduction or movement of Sequence Assembly 48 CodonCode Aligner User Manual gaps or to try different assembly parameters Compare contigs to each other this option allows you to compare several contigs for example when studying genes from different species isolates or patients The consensus sequences will be assembled into a new contig to check out any differences double clicking on a sequence in this contig of contigs will bring you straight to the sequence traces e Assemble in groups with this option CodonCode Aligner can automatically group samples based on their names and form separate contigs for each group This option can be a real time saver in phylogenetic and medical studie
104. arrangement of the samples in the contig will remain the same changes are limited to any gaps that need to be introduced re building of the consensus sequence and possibly changing the extend of unaligned regions at the end of samples In addition the contig may be reverse complemented during assembly If you do not care about keeping the current arrangement of the samples in a contig you can choose Assemble from Scratch or Align To Reference from Scratch instead This will first unassemble the existing contigs and then re assemble or re align all reads that were in the contig s plus any other reads you have selected Duplicating samples You can duplicate samples in a project and create text sequences from consensus sequences as follows 1 Select the sample s or contig s you want to duplicate 2 Go to the File menu 3 Select Duplicate This will create a copy of every selected sample and a new text sequence for every selected contigs Before using this option to align consensus sequences however please look at the help for Compare contigs in CodonCode Aligner you can compare contigs directly to each other and keep the relation to the sequences and their traces in a contig intact Adding Samples to Contigs 117 Merging Contigs To merge two or more contigs 1 Go to the project view 2 Select the contigs you want to merge you can also select reads in Unassembled Samples 3 Choose Assemble from the Contig
105. ases to the right of the cursor for the selected sample Deleting Bases 103 Deleting Samples Deleting samples in Aligner is a two step process first you move samples to the Trash folder and then you empty the trash To move a sample to the trash select the sample for example in the project view and then choose Move to Trash from the Edit menu For samples in contigs some special considerations apply as described in the Editing Contigs section Samples in the trash can be re used by selecting them in the project view and then choosing Move to Unassembled Samples from the Edit menu To permanently delete samples from the trash and remove them from your project choose Empty Trash from the File menu The corresponding sample files in your project folder will be deleted when you save the project the next time Deleting Samples 104 Moving Gaps and Samples Sometimes you may find that some of the gaps introduced during assembly are not quite at the right positions and should be moved around a bit aligning gaps in all reads may even enable you to remove an entire column of gap characters Moving gaps in contigs To move a gap select the gap in the contig view or in the base or trace view and then select Move Gap Left or Move Gap Right from the Sample menu You can also use the keyboard shortcuts Option F5 for Move Gap Left Option F5 for Move Gap Right Due to a Java bug on OS X the ke
106. assembled before assembly and gaps in the samples will be removed SEE EE Help Cancel Assemble Click on the Algorithm tab Select the Use PHRAP radio button The dialog should now look like this Sequence Assembly With Phrap 57 CodonCode Aligner User Manual eo06 Assemble With Options f Contigs Preprocess rFor Unassemble existing contigs Use built in assembly algorithm Use PHRAP r For Compare keep existing contigs f Use ClustalW Use built in algorithm When Use PHRAP is selected the program PHRAP will be lused to generate assemblies INote that PHRAP will ONLY be used when Unassemble existing contigs is selected on the contigs panel For the other options the built in assembly algorith will always be used Help Cancel e Click on the Assemble button The assembly will start and show a progress window Depending on the size of your selection your depth of coverage and the number of repeats the assembly may take a while assemblies with several hundred reads typically take a minute or a few minutes How Aligner assembles using Phrap Aligner uses Phrap to assemble your selection as follows 1 Aligner checks if the Phrap program is indeed at the location specified in the Phrap Assembly preferences for example in the default location usr local genome bin on Mac OS X If the Phrap program is missi
107. ave Phrap assembly Preference options Printing Protein translation Sample names Startup Vector trimming Views Warnings Window placement Additional command line options Description The Phrap assembly preferences let you specify the location of the assembly program Phrap and for experts only additional command line parameters for Phrap You specify the location and name of Phrap assembly program in the upper text field If you want to use the workstation version of Phrap that was installed with Aligner the path to Phrap should be correct and not need any changes However if you use your own installation of Phrap you may need to specify the location of the file on your system Please note that using Phrap from Aligner requires that you have a trial license or a purchased license Phrap use is not enabled in demo mode Academic users who purchased a license for CodonCode Aligner can use the workstation version of Phrap free of charge for academic research users at companies will have to purchase a separate license to use Phrap In the bottom text field you can specify additional command line options for Phrap In general please leave this line blank only experts who really know what they are doing should specify command line options Phrap Assembly Preferences 203 CodonCode Aligner User Manual here For more information about assembling with Phrap please read the Sequence Assembly
108. be able to directly open the exported project in Consed and hopefully in other contig editors that support the ACE file format However if you transfer the exported files to a different operating system make sure that the files are transfered correctly The chromatogram files must be transfered as binary files and the other files must be transfered as text files Incorrectly transfered files will likely cause problems when you try to open them NEXUS PAUP Format Exports The NEXUS PAUP format allows you to export projects for phylogenetic analysis programs like MacClade or PAUP Only contigs will be exported with a single file being created for each contig Note that the exported files only contain information about the bases and gaps but not about associated chromatograms or sequence qualities You have a choice of exporting in either interleaved or sequential format Different phylogenetic programs have different restrictions on which kind of files they can read so you may need to try both to see which one works for the program you plan to use If you have sample names that are very long and or contain spaces or other unusual characters it may be necessary to truncate or change the name of the samples in the exported files Again different programs have different restrictions If sample names may to be changed in the exported files Aligner will present you with a list of choices on how to change the sample names Phylip Format Exp
109. be fixed by enabling all fonts in the FontBook application For more details please visit http www codoncode com aligner problems htm Licenses After installing Aligner will start in Demo mode Demo mode allows you to use Aligner for viewing sequence traces as well as printing and editing unassembled traces You can also open existing Aligner projects However you cannot print save and export projects that contain contigs in demo mode Demo mode also allows you to try out most of Aligner s functions including end clipping assembly and so on but again you will not be able to but not to save import export or print after trying these functions in demo mode The first time that you use CodonCode Aligner you will automatically receive a time limited trial which will enable you to use all functions for 30 days For more information about how to get licenses for regular use please check the Licenses for Aligner section Acknowledgements CodonCode Aligner contains licensed copyrighted material from LI COR Inc The Mac OS X version uses functionality provided by MRJAdapter Copyright Steve Roy and the Quaqua Look and Feel Copyright Werner Randelshofer and therefore is subject to the terms of the QuaQua Look and Feel License Agreement a copy of which is provided in the Mac OS X application package directory System Requirements 2 Licenses for CodonCode Aligner After installing CodonCode Aligner will start up i
110. ber or other criteria which you can define in the feature preferences To exports features for a set of contigs Go to the contig view e Select the contig s for which you want to export features or if you want to export features for all contigs select any contig Choose Export Features in the File menu A dialog will appear where you can specify details about the output format e Export Features Export features for fe Current selection O all contigs Format Comma Separated Value CSV J Use the radio button at the top to select whether you want to export only the selected sample or all samples in the contig Then use the pull down menu to select the file format and click on the Export button Next Aligner will show you a Save As dialog where you can select the location of the exported file or files The exported files are text files and can be opened with text editor or spread sheet programs One thing to note when exporting features is that CodonCode Aligner will always export all features in the consensus sequence and in all samples in a given contig This is true even if you used the Feature preferences to specify to look for features only in the consensus sequences or the samples or the current selection when navigating this selection does apply only for navigating not for feature views or exports Here is an example of what exported features from the PolyPhred example project can look like after
111. boring bases 5 Pick the nucleotide or the gap character that has the highest quality Assign the calculated confirmed quality score to the consensus sequence The maximum quality score assigned to a consensus base is 90 Several points to remember when trying to understand this algorithm e The base quality scores are error probabilities on a logarithmic scale therefore the error probabilities can simply be added as long as the probabilities are independent e Error probabilities for confirming reads in the same direction are NOT independent since most sequencing errors are due to systematic problems like polymerase stops GC compressions etc Assembly 69 CodonCode Aligner User Manual Therefore qualities of confirming reads in the same direction cannot simply be added e Arguments can be made for and against subtracting the quality scores of discrepant bases Some scientists feel that having a discrepant base should make a difference in the consensus quality while others use statistical arguments why qualities of discrepancies should not be subtracted You can decide for yourself and change this in the Preferences if you have a confirmed high quality base and a low quality random discrepancy the difference in the consensus quality will be zero or very small anyway The algorithm used by Aligner is similar to the algorithm used by the assembly program Phrap but it is not identical Phrap s algorithm is more complicated and us
112. ca 9 r Contig2 229 229 homozygoteTT polyPhred ca 23 s Contig2 229 229 homozygoteTT polyPhred ca 9 s Contig2 229 229 polyPhredRank1 polyPhred Contig2 Contig2 229 229 COMMENT co dataNeeded polyPhred ca 22 s Contig2 333 722 A heterozygoteCG polyPhred ca 22 r Contiq2 401 401 J A feature view window shows the features for one or more contigs depending on your selection when you opened the feature view You can also look at the features for all samples in the Unassembled Samples folder by selecting it in the project view and then opening a feature view You can determine which features are shown in the feature preferences In the example above low quality consensus regions and tags are shown You can sort the table by clicking on the column headers You can also print and export features through the corresponding file menu items you may have to switch to the project view first and select the contig or contigs you want to print or export in the project view You can double click on any item in the feature view to take a closer look at the feature This will open the views as defined in the double clicking preferences typically the trace view for the sample and the contig view for the corresponding contig unless you have changed the preferences Feature Window 157 Restriction Map View Choose Restriction Map from the View menu to display a window showing the restriction map for the selected sample or contig A restriction m
113. ce Then save the project and save a copy under a different name For more information check the Find mutations section The bottom panel only concerns the consensus of imported assemblies You can choose whether to keep the consensus sequence when you import entire assemblies of to re calculate the consensus based on the current settings Even when you decide to keep the imported consensus sequence however Aligner will re calculate the consensus sequence when you later change a contig for example by editing bases or removing samples Consensus Preferences 185 Double Clicking Preferences The double clicking preferences allow you to choose what happens if you double click on one or more samples in the project view windows Preferences Base calling Base colors Features Highlighting License Server Memory Mutations Open amp save Phrap assembly Preference options Printing Protein translation Window placement r Double clicking in Project View r Views to open When double clicking on samples in project view open f Quality view vi Trace view C Base view r Samples in contigs If a sample is in a contig double clicking on it will f9 also open the contig view O only open the contig view O not open the contig view Description The double clicking preferences let you control what happens when you double click on samples or contigs in the project view Y
114. ch new sequence starts with a line that starts with a gt sign followed by the name of the sequence If the FASTA header line also contains the name of corresponding PHD or SCF files Aligner will try to read these files too GenBank files text files exported from Genbank and many other programs Genbank files are often used for the reference sequence in re sequencing and mutation detection projects When reading Genbank files Aligner will read the CDS coding sequence annotation including the codon start tag this tag indicates the number of the base after the CDS start which start the first whole codon and can either be 1 2 or 3 In Aligner the CDS region is shown as a codingSequence tags and the codon start annotation as a codonStart tag EMBL files text files exported from ENSEMBL and many other programs in EMBL format Like Genbank files EMBL files can be used for the reference sequence in re sequencing and mutation detection projects Aligner will read the CDS coding sequence annotation similar to the way described for Genbank files e NBRF PIR files text files in NBRF PIR format a simple format that can contain multiple sequences per file Sequences in NBRF PIR format may contain gaps in the sequences as well as at the start and end of sequences When importing sequences from NBRF PIR files CodonCode Aligner will check if the imported sequences contain gaps If the sequences contain gaps and are all
115. cific amount of times For example the restriction map will show only unique cutters if you have only the 1x checkbox selected You can set the map style A Single Line map displays a graphical map where all enzymes that cut are shown together on a single line The Multiple Lines map shows a separate graph for each enzyme that cuts The Text map lists the cut results in text format Restriction Map Options 213 CodonCode Aligner User Manual The results can either be displayed as Cut Positions or as Fragment Sizes in the map The cut positions and fragment sizes are shown in base pairs You also have the option to list the cutters in a summary at the bottom of the map The summary shows the cutters sorted by the number of cuts A summary of non cutters is always listed if the Display Non Cutters checkbox is selected In the second section you set the DNA type used for the digest to be either linear or circular DNA This can affect your results for fragment sizes and cut positions shown in the map Restriction Map Options 214 Sample Name Preferences Defining sample names CodonCode Aligner can interpret parse sample names to automatically group samples and assemble samples in groups You can define how sample names should be parsed in the Sample name preferences Preferences rDefine sample name parts Delimiter Meanin Base calling Go f s Clone z Base colors period H
116. ck the Assemble button Note that any samples that are already in contigs will not be pre processed Pre process One step processing 56 Sequence Assembly With Phrap While CodonCode Aligner allows you to do assemblies with its own built in assembly algorithm Aligner also supports assembly with the assembly program Phrap see below for more information about Phrap Phrap s assembly algorithm is more sophisticated and better tested than Aligner s build in assembly Phrap is also better suited for large projects and will often be faster You will need to have Phrap installed on your computer to be able to assemble with Phrap and the Phrap Assembly preferences must point to where Phrap is installed on your system To assemble sequences with Phrap e Select the samples and or contigs that you want to assemble in the project view e Choose Assemble with Options from the Contig menu On the dialog that appears click on the radio button Unassemble existing contigs assemble from scratch The dialog should now look like this eee Assemble With Options f Contigs yntigs Preprocess Algorithm Choose how to build contigs Merge existing contigs 9 Unassemble existing contigs assemble from scratch Compare keep existing contigs O Assemble in groups by Clone E Define Groups When Unassemble existing contigs assemble from scratch lis selected any contigs in your selection will be un
117. clip settings After making your changes and selecting OK the clipping preview window will re appear showing the effects of the new parameters The clipping preview window is shown in the next picture eoo Clipping Preview Preview of clipping results Number of samples clipped Average length before clipping 595 Average length after clipping 461 Average number of 5 bases clipped Average number of 3 bases clipped 129 Number of samples moved to Trash a Cancel Change parameters I Please note that you do not have to end clip sequences before assembly or alignment the assembly will typically work fine without end clipping However you can get cleaner and sometimes better assemblies by end clipping sequences before vector screening and assembly To each sequence that is clipped Aligner will add a processing tag which states how many bases were clipped at the beginning and the end You can see these tags in the feature view window if you have the End Clipping 38 CodonCode Aligner User Manual processing tags included in your definition of features and in the tag dialog that is accessible from the sample information dialog End Clipping Parameters You can change the stringency of the end clipping in the end clipping preferences Either press the Change parameters button in the clipping preview window as described above or select the End clipping preference panel in the Preferences
118. cription The printing preferences control how Aligner prints Cancel gt Currently you can only set options for trace view printing and contig view printing If you would like more options for printing other views please let us know Trace View Printing What to print when printing traces is determined in the first pull down menu Your options are Entire traces this will print the entire sequence trace for each sample currently in the trace view Each sample will be printed using several panels on one or more pages before the next sample is Printing Preferences 207 CodonCode Aligner User Manual printed Only visible regions this will print just the part of the traces that is currently showing on the screen If your trace view window contains multiple traces one panel for each trace will be printed similar to the way the sequences are shown on the screen The vertical trace scaling lets you select how the traces are scaled when printed Use Trace view scaling will print traces using a constant scale factor for all panels in a sample the scale factor used will be the one currently used for this sample in the trace view e Scale each panel to highest peak will calculate a separate scale factor for each panel in each sequence based on the highest peak in this section of the sequence This will give you a nicer looking printout more even peak intensities when printing entire sequences Equalize traces for
119. cted a single contig in the project view then the consensus sequence for this contig will be copied If you have more than one sample or contig selected copy will not be available Paste The Paste menu item in the Edit menu is disabled since Aligner is not intended to be used as a text editor You can however paste any sequence that you copied see above into programs outside of Aligner for example BLAST web pages Please note that any gaps in sequences will be removed in the copied sequence since most programs or web pages you might paste the sequence into will expect ungapped sequences If you need to copy and paste gapped sequences please let us know There are also some dialogs that support paste through the keyboard shortcuts control V on Windows command V on OS X The most notable is the Search Sequence dialog accessible from the Go menu Copy and Paste 115 Editing Contigs CodonCode Aligner lets you manipulate contigs in a number of different ways You can edit the samples in a contig as described in the previous section Several other common tasks with contigs are e Adding new samples to existing contigs Merging contigs e Removing samples from contigs Reverse complementing contigs e Splitting contigs Unassembling contigs Editing contig information Editing Contigs 116 Adding Samples to Contigs To add new samples to an existing contig you need to first add the samples to the project
120. d of the reads The first methods is similar to the way Phred trims sequences with the trim_alt option The second method gives you more options and is hopefully a bit easier to understand With typical parameters both methods tend to give similar results and remove the junk sequence at the end of chromatograms The methods are explained in more detail below End Clipping Parameters 39 CodonCode Aligner User Manual You have the option to automatically identify bad sequences after the end clipping and move those to the trash Such bad sequences can be due to failed sequencing reactions or any number or other problems We suggest to move all sequences that are too short for example less than 25 or 100 bases after clipping to the trash A second widely used method to identify low quality sequences is to count the number of bases with quality scores above 20 Phred20 bases With the settings shown in the picture above any samples that after the end clipping have fewer than 150 Phred20 bases or are shorter than 200 bases would be called bad and moved to the trash We suggest that you experiment with the different parameters and find a setting that works for your data For example if you sequence short PCR products you should definitely reduce the number of Phred20 bases required for a sequence to be kept or perhaps uncheck this option Additional details about the end clipping parameters can be found on the End Clipping Prefere
121. d parameter file and by making educated guesses for the entries that need to be added Before running Phred Aligner checks all samples which you selected for base calling to see if their primer ID string can be found in the Phred parameter file If any entries are missing you will see the Prerequisites 30 CodonCode Aligner User Manual following dialog 5 eoc Phred parameters missing A The Phred parameter file does not have the required entries A to process all of your samples Please confirm the new entries for the Phred parameter file When you click OK Aligner will bring up a new dialog that allows you to edit the Phred parameter file It shows all the current entries in the Phred parameter file as well as one or more entries that need to be added ec oc Phred Parameter File 4 rPhred Parameter File Entries Primer ID Chemistry Dye Class Machine Class Status DT3700POP6 37C mob terminator big dye ABI 3700 P DT3700POP6 BD 40deg vl mob terminator big dye ABI 3700 DT3700FSP BD v1 mob terminator big dye ABI 3700 DT3700POPS dRhod v1 mob terminator d rhodamine ABI 3700 DT3700POP6 dRhod v3 mob terminator d rhodamine ABI_3700 DT3700POPS ET mob terminator energy transfer ABI_3700 DT3 100POP6 dRhod v1 mob terminator d rhodamine ABI 3100 DT3 100POP6 BD v2 mob terminator big dye ABI 3100 DT3 100POP6 BDv3 v1 mob terminator big dye ABI 3100 MegaBACE Mobility File unknown energy transfer MolDyn MegaBACE
122. e CSV Cancel gt When you press the Export button a standard Save dialog appears where you can choose the name and location of the exported file The file is a text file and can be imported into word processors or spread sheets like Microsoft Excel you may need to select All Files in the Open dialog to be able to import the file Here is an example of what the exported data look like after importing into Microsoft Excel Export Project Summary 132 Contig count Sample count Total sample bases Average sample length Average sample quality Average contig length 10 Average contig quality 12 Contig Name 13 Unassembled Samples 14 Contigi 15 Contig2 16 Trash 18 Sample Name 19 va 1 x 720 va 13 x _21 va 23 x _22 va 16 x 23 ca 9 r 24 ca 22 r 25 ca 22 s 26 ca 9 s ii ca z1 5 28 ca 23 s Export Project Summary Poly Phred_summary cs v CodonCode Aligner User Manual PolyPhred summary csv PolyPhred proj 11 21 03 10 01 f UsersfShared Documents Projects PolyPhred 2 io 9018 901 387 597 o Number of Samples 4 6 Sample Location Contigi Contigi Contigi Contigi Contig2 Contig2 Contig2 Contig2 Contig2 Contig2 Contig Length 0 473 722 0 Sample Length 1058 1020 1240 1025 869 860 765 742 745 694 Quality Coverage 0 0 3 9 0 4 0 0 Quality Direction 372 Fwd 406 Fwd 354 Fwd 382 Fwd 415 Rev
123. e Aligner 5 CodonCode Aligner User Manual If Aligner License Server is available for your laboratory or department you can choose to use the Aligner License Server in the dialog that CodonCode Aligner displays when starting up eee FREE trial of CodonCode Aligner Congratulations As a new CodonCode Aligner user you are entitled to a free t trial You will be able to use all functions of CodonCode Aligner for a limited E time After 30 days the program will automatically revert to Demo mode In Demo mode CodonCode Aligner is a fully functional trace editor you can also open and view existing projects If you already have a license for CodonCode Aligner please use the Enter license or Use License Server button Use License Server Enterlicense If you click the Use License Server button Aligner will attempt to locate a License Server for CodonCode Aligner on your local network If a License Server is found and a license is available it will be checked out and you can start using CodonCode Aligner The license key will be returned so that someone else can use it when you quit CodonCode Aligner If CodonCode Aligner cannot find a License Server the following dialog will be displayed Enter License Server Aligner was unable to find a License Server You may enter the name or IP address of the server to use Name or IP address of License Server Cancel Use Server If you
124. e Aligner User Manual Project Window To do anything in CodonCode Aligner you must create a project or open a previously created project This will create a Project Window where the contents of the project are shown similar to the way the Finder or Explorer show contents of disks and folders e088 example_project m us B ra m i bs Save Project Add Samples Add Folder Add Assembly Align to Reference Sequence Assemble Unassemble Name Contents Length Quality Position Added Modified v ui Unassembled Samples 2 samples 0 3 11 3 11 03 B A454 s Trace 693 397 0 3 11 3 11 03 B A455 s Trace 750 343 0 3 11 3 11 03 Yv 3 Contig1 3 samples 966 917 3 11 3 11 03 B A326 r Trace 628 375 0 3 11 3 11 03 Ed A060 s Trace 645 389 221 3 11 3 11 03 H A333 r Trace 646 370 320 3 11 3 11 03 gt a Contig2 2samples 755 720 3 11 3 11 03 gt C7 Trash 0 samples 0 3 11 3 11 03 G IG Assembly completed in 1 62 seconds 1 successful join 1 island remaining In the project window you can add samples entire folder of samples or Phrap assemblies using the buttons on the top or the corresponding items in the File menu Newly imported samples will be in the Unassembled Samples folder Any contigs that are created or imported from other assemblies are shown as separate folders In the project view you can also select samples and contigs by clickin
125. e S Bases 5 Vector djs74 2361 s1 0 djs74 237 s1 djs74 996 s2 djs74 564 s1 djs74 690 x1 djs74 561 s1 djs74 824 s1 djs74 932 s1 djs74 423 s1 0 Phage M13 genome eo ouc a amp N 3 Bases 3 Vector 6 Cloning vector pBR322 4 oomoocoococcococ o K X Cancel You will see a different dialog if no matches between your samples and the vector sequences were found You can now choose to apply the trim results and remove the bases at the start or end of the samples that had vector matches or you can press cancel and not apply the trim results for example to try different parameters You can repeat the vector trimming for example if you forgot to include a vector sequence the first time you trimmed To each sequence that has bases removed due to vector trimming Aligner will add a processing tag which Trimming Vector Sequences 42 CodonCode Aligner User Manual states how many bases were trimmed at the beginning and or the end You can see these tags in the feature view window if you have the processing tags included in your definition of features and in the tag dialog that is accessible from the sample information dialog Trimming Vector Sequences 43 Vector Library Files Vector sequences for vector trimming can be read from several files that were supplied with CodonCode Aligner or from your own custom files A Vector folder is created in the Aligner Data folder in the folder where C
126. e added to the sample Status messages The area at the bottom of the project view window is used by Aligner to display messages status messages warning and error messages If you click on this area the Message history dialog will be displayed which Selecting Samples and Contigs 143 CodonCode Aligner User Manual shows all previous messages r n Status Log Status Message History Date Time Status Message 3 11 03 17 33 40 Assembly completed in 2 50 seconds 6 successful joins 1 island remaining 3 11 03 17 33 38 Started Assembly of 7 reads ED yar t cl ear Messages gt Close 9 A You will have to close this window before you can do anything else in Aligner You can press the Clear Messages button to erase all old messages Status messages 144 Trace View General Information In Trace View you can view and edit samples that have trace data Files with trace data that can be opened in a Trace View include standard chromatogram files scf from LI COR and other manufacturers and Applied Biosystems ABI trace files abi ab1 e 66 Traces from Contig1 GTGAAT JMAAACTATGTTAAGGGAAATAGGACAACTAAAATA cc CTTR Nbrm R 50 60 70 A Y s un eda a rs TATGTTAAGGG AAATAG G ACAAC TAAAATAT CFTR Norm F 29 4 50 A v Shelf T7 A 4 i CFTR Norm R Base 43 of 290 43 in contig Quality 68 Cons 68 _ Each contig has one trace view window in which all select
127. e complemented before alignment Alignment results in one new contig that contains the reference sequence as well as any samples that could be aligned to it If no samples could be aligned to the reference sequence with the current alignment criteria no new contig will be formed and all samples will remain in the Unassembled Samples folder The new contig will be limited to the length of the reference sequence plus any gaps introduced during alignment When building the consensus sequence for contigs that result from alignments to a reference sequence the consensus preferences determine how the reference sequence is considered By default the reference sequence is excluded from the consensus sequence In this case any regions where none of the samples overlap with the consensus sequence will be result in gap characters in the consensus sequence Alternatively you can choose to use the reference sequence as the consensus sequence Assembly and Alignment 46 CodonCode Aligner User Manual Limitations Currently the implementation of alignments has several limitations These include e The numbering in the aligned contig is not relative to the reference sequence numbering and includes any gaps introduced in the consensus sequence However if you use the Find mutations function the numbering used in the mutation tags will be relative to the reference sequence and if present the coding sequence annotation of the reference sequence
128. e contig view move to the right sometimes by a few bases sometimes by many bases To see what kind of feature you just navigated to look at the project view window The status panel at the bottom Defining Features 74 CodonCode Aligner User Manual shows a brief description of the feature in our example Feature Low Quality Consensus twice in a row then Feature Discrepancy Use the keyboard shortcuts to move forward and backward between features You can also try changing the definition of features in the preferences View Print Export Features To get an overview of features in one or more contigs select the contig s in the project view and then choose Feature View from the View menu This will open a feature view window showing a table of all features in the contig or contigs You can double click on any feature to take a closer look at the feature or print the feature view for more information please read the feature view help page You can also export features from a selection of contigs or all contigs in a project to text files as described on the Exporting features help page Moving to Features 75 Finding Mutations When working with sequence traces from genomic PCR sequencing CodonCode Aligner can help you to find and analyze homozygous and heterozygous mutations SNPs both point mutations and insertions and deletions of course you can also look for homozygous mutations by simply defining discrepancie
129. e cursor to the last aligned base in the current sample In addition to the menu items in the Go menu and their keyboard shortcuts you can also use the home key to go to the first base of a sequence and the end key to go to the last base of a sequence Cursor Positioning and Movement 98 Selecting Bases To select bases move the mouse cursor over the first base you wish to select in the base view contig view or trace view Click and hold down the mouse button drag the cursor horizontally over the base s and release the mouse button after dragging over the last base This can be a bit slow for large selections if you want to select all bases to the start or end of the sequence it can be a lot faster to use one of the options described below so please read on Selected bases are displayed with a different background color than surrounding bases If the selection was made in the consensus the selection is also shown in all samples that are part of the consensus Selecting from sequence start to current cursor position To select all bases from the start of the sequence to the current cursor position choose Select from Start to Here from the Edit menu The selection will include any unaligned bases at the start of the sequence up to the cursor position You can accomplish the same thing without having to use the menus by keeping the shift key pressed while pressing the home key Selecting from current cursor positi
130. e first item then press shift while clicking on the last item you want to select control click OS X command click to make a discontinous selection Your current selection determines which menu items and buttons are active For example you need to have at least two samples or contigs selected before you can choose Assemble from the Contig menu or the Assemble button at the top of the window the Unassemble menu item and button require that your The Project View Window 142 CodonCode Aligner User Manual selection contains only contigs and so on If a menu item is not available and the button is grayed out you have not selected the item or items required for this action Menu shortcuts Buttons and Popup menus The most commonly used actions are available as buttons on the top of the project view and as popup menus You can hide the buttons by selecting Toolbars Hide Toolbars in the View menu If you do not see the toolbar at the top select Toolbars Show Toolbars in the View menu to make them visible If you press the right mouse button on Windows or control click on Mac OS X in the project window a popup menu with the most commonly used actions will be displayed The content of the popup menu will depend on what you currently have selected just try it out Two example popup menus are shown below View Bases View Contig View Quality View Quality View Features Move to Trash Unassemble
131. e in Genbank format and contained a simple CDS annotation Aligner will use this to automatically create codingSequence and codonStart tags However any CDS tags in Genbank sequences that point to other sequences or join multiple sequences will be ignored You can add as many codingSequence tags as you like You can add the codonStart tag only to one of the first three bases in the first codingSequence if you try to place it anywhere else it will be ignored After defining you coding region Aligner will use this information next time you choose Find Mutations for this contig There are a few things to keep in mind though The content of mutation tags is not updated when you change your reference sequence or consensus you can simply find mutations again to get the current results e If both the reference sequence and the consensus have a codingSequence tag the tag from the consensus will be used e The codingSequence tag from the reference sequence will only be used if the contig you are analyzing is an alignment not an assembly Defining the Coding Region 81 CodonCode Aligner User Manual Numbering the Coding Sequence In mutation analysis projects you will often want to assign a base number to the first base in your coding sequence for example because it is not the first exon in a gene In Aligner you can do this by adding a codonStart tag and entering the corresponding nucleotide number in the Notes field
132. e numbers in the text boxes The most commonly used numbers are 0 to 19 for low quality and 20 29 for medium quality and 30 and higher for high quality You can also assign background colors for each of these ranges We suggest to use darker colors for lower qualities and lighter colors for high quality bases These colors will be used to draw the bases in the base view contig view and the trace view windows Here is an example of the base view with this setting eoe 51 BGcTCCCTCA ccTT TGABT 101 151 201 251 301 351 401 451 501 551 601 A326 r Switching color schemes CCTCCCACAT TCAAACTTGT Gitaccacaa GCGGATCTCT AGCACAGAGA 3 e e e 3 A326 r ATGCATAAAG AGTGGCCCTG GTGGTTTCAA GATCTGTCTA CCTGGAGGAG GTGGATGCCA CCAGAGCTTC TCTCTCCTCA TCTAATTCTG TTTTATTGAT GGAACAACCT GATTTGTTGT GTCAGGTGCT TGABAGTGAT Base 201 of 612 AGGAGCCCEG NETACTONEN m AGACCTTGTC ATCATAAATC GCAAACCTAA TTAAGGATGG GGGGAAAGAT GCAGCCACNEN reeecaT CNN TTCCTCAGCT TGTTACACTC TGGAGATTT AATTCTTGAA CCTGAAGGAG Nc ca Nc gtr TTTCCAGGAC Quality 13 LID ASI RE E NONN IN M OT m r idan aiin iia P o ile Ai ln a a nie i aidin TIN PR VEAS m 177 CodonCode Aligner User Manual Notice that there is a short stretch of low quality bases at the start of the sequence and a longer stretch at the end which is a typical picture There is also a short stretch of low quality bases near ba
133. e one shown below Finding Mutations 76 CodonCode Aligner User Manual e00 Mutation tags in Contig1 J Feature Source Found In Parent Start End Content mutationSumm Aligner Contig Contig 14 mutated bases at 8 positions in 1626 bases analyzed heterozygoteAT Aligner va l x Contig 107 107 Heterozygous 107A T STP36Leu heterozygoteAT Aligner va 23 x Contigl 107 107 Heterozygous 107A T STP36Leu homozygoteAA Aligner va 13 x Contig 107 107 No mutation homozygoteAA Aligner va 16 x Contigl 107 107 No mutation polymorphism Aligner Contig Contigl 107 107 2 diffs 0 homo 2 hetero 2 not mutated heterozygoteCT Aligner va 13 x Contigl 183 183 Heterozygous 183T gt C Cys61Cys heterozygoteCT Aligner va l x Contig 183 183 Heterozygous 183T gt C Cys61Cys heterozygoteCT Aligner va 23 x Contig 183 183 Heterozygous 183T gt C Cys61Cys homozygoteTT Aligner va 16 x Contig 183 183 No mutation polymorphism Aligner Contig Contig 183 183 3 diffs 0 homo 3 hetero 1 not mutated heterozygoteGT Aligner va 13 x Contigl 216 216 Heterozygous 216G gt T Gln72His heterozygoteGT Aligner va 23 x Contig 216 216 Heterozygous 216G T Gln72His homozygoteGG Aligner va 16 x Contig 216 216 No mutation homozygoteGG Aligner va l x Contig 216 216 No mutation ri polymorphism Aligner Contig Contigl 216 2162 diffs 0 homo 2 hetero 2 not mutated A The table shows the characterization of samples at each consensus base where Aligner found at lea
134. e quality scores Aligner will assign artificial quality scores to all bases as described in the next section You can identify sequences without quality scores quickly in the project view the Quality column shows 0 as the number of high quality bases for such sequences To assign sequence quality scores to chromatograms without qualities you can base call the samples with PHRED which may require a separate license for PHRED Artificial qualities There may be times where you need to use sequences that do not have quality values for example Genbank sequences When importing such sequences into CodonCode Aligner Aligner will assign artificial qualities to all bases in these sequences The default value for artificial qualities is 15 but you can change this in the Open amp save preferences If you import sequences into Aligner which have quality scores that seem artificial for example because all scores are 0 or 1 or all scores have the same value Aligner will also assign artificial quality scores Gap qualities Quality values are associated with base calls so gaps do not really have quality values However since it is often convenient to have some quality value even for gaps Aligner does assign qualities to gaps the assigned quality is the average of the two bases on either side with gaps characters and edited bases being ignored For bases at the start or end of the sequence that have only one neighboring base the quali
135. e secondary peak is weak On the other hand a high sensitivity setting will miss few if any heterozygous point mutations but may incorrectly identify some secondary peaks as heterozygous point mutations when they are really caused by noise in the sequence traces Your choices in the Data quality panel also affect the false positive to false negative balance At the start and end of sequence traces secondary noise peaks are most common which can lead to false positives Aligner tries to reduce this problem by examining sequence quality at the start and end of each trace and excluding low quality regions You can determine the stringency of this step by setting the Minimum quality at start and end The value chosen there is the sequence quality Phred quality required before Aligner starts analysing choosing higher values e g 40 will give fewer errors near the end of sequences You can see which regions Aligner excluded from analysis by looking at the dataNeeded tags which are shown as yellow boxes depending on your highlighting preferences In general the medium sensitivity settings should work reasonably well however you should adapt the settings to the particular needs of your project and the quality of your sequence data If identifying every single potential point mutation is important select high in the sensitivity check boxes and uncheck the Use noise filter check box We strongly suggest that you try the differe
136. e suggest that you do not write Not confirmed but rather use different words like Disagree or Incorrect The contents of the Notes field are shown in the Content column in the Feature View and when exporting features to text files Viewing Local Tags You can also view tags at specific locations in a sample from trace view base view and contig view windows Select a base that contains a tag and then right click OS X control click on it to display the popup menu The first item in the popup menu will be Display Tag but only if you clicked on a base with a tag This will bring up the tag dialog as above except that only tags at this position in the sample will be shown Instead of using the popup menu you can also go to the Sample menu and selecting Show Local Tags from the Tags sub menu Confirming Tags 111 CodonCode Aligner User Manual Adding Tags You can also add your own tags to any base or range of bases in a sample Open a view that shows the bases a trace view base view or contig view select the bases you want to tag and then right click OS X control click on it to display the popup menu The first or second menu item in the popup menu will be Add Tag Selecting it will bring up the following dialog e Add tag to va 16 x k New Tag Type Tag Details Program User Start 168 End 168 Date Tue Jan 06 12 44 12 EST 20 Notes C Confirmed Cancel
137. east for this parameter You may need to adjust this value depending on the kind of project you are doing If you aligned cDNA sequences to genomic DNA use values of or near 10046 since large stretches of exons may be unaligned But if you expect your samples to match end to end and pre processed your sequence with end clipping and vector trimming you can use lower values to reduce the chance that different copies of repeats will be incorrectly assembled together Bandwidth Maximum Gap Size The bandwidth parameter allows you to set the half width of the diagonal used during the banded alignment This has an effect on the maximum size of gaps insertions or deletions in one sample that can still be aligned A bit simplified if one sample has an insertion or deletion that is larger than the bandwidth number the alignment will typically stop at the insertion deletion and the rest of the sample will be unaligned If the insertion or deletion is shorter than the bandwidth the alignment will continue after introducing the necessary number or gaps in one sequence as long as the aligned parts after the gaps is long enough the aligned regions before and after the gaps must be at least 1 and 1 2 times as long as the number of gaps and longer for any mismatches or ambiguities The discussion above is a bit simplified in reality what counts is the total number of gaps in one sequence minus the total number of gaps in the other sequence at an
138. ect view You can also include individual sequences for example text sequences that you downloaded from sequence databases Choose Assemble with Options from the Contig menu n the dialog that opens choose Compare contigs to each other The dialog should now look like this Assemble from scratch 50 CodonCode Aligner User Manual eoo Assemble With Options Preprocess Algorithm Choose how to build contigs Merge existing contigs Unassemble existing contigs assemble from scratch f Compare keep existing contigs Assemble in groups by Clone Es Define Groups When Compare keep existing contigs is selected Aligner lwill build contigs from the consensus sequences of the contigs in your selection contigs of contigs One typical application would be to compare genes you sequenced from idifference species qmm Help Cancel Assemble e Click on Assemble Aligner will start comparing the contigs to each other showing you a progress dialog during the assembly By default CodonCode Aligner version 1 6 and newer will use the program ClustalW to generate contigs of contigs ClustalW is a program that is widely used to generate alignments for phylogenetic studies a copy of the program is included with the CodonCode Aligner distribution and installed in the Phred Phrap folder inside the CodonCode Aligner install folder To generate alignments with C
139. ed traces for this contig will be shown The same is true for the Unassembled Samples folder it has its own trace view window The number of traces in a trace view window is limited only by available memory and operating system limitations however displaying many traces may be slow Opening a Trace View A trace view for a sample that has trace data associated with it can be opened by Selecting the sample then choosing Trace View from the View menu e Right clicking on the sample and choosing Trace View Double clicking on the sample if you selected to open a trace view in the double clicking preferences Scrolling and Scaling in Trace View The vertical sliders at the right side of each trace let you scale a trace vertically to make the peaks larger or smaller Trace View 145 CodonCode Aligner User Manual You can use the sliders at the bottom of each sample to scroll a trace If the Scroll together checkbox is checked then all traces will be scrolled together when you scroll one of the traces If the trace view window contains more traces than currently fit on the screen the vertical slider on the right allows you to scroll between the traces You can remove traces from the trace view window by clicking on the read X button on the left You can move individual traces up and down by clicking on the up and down arrows on the left If you have a mouse with a scroll wheel you can also use the scroll wheel to move ar
140. eep in mind that matches between sample sequences and vector sequences are local matches that is the matches do not necessarily extend to the beginning or the end of the sample If there is low quality sequence at the beginning or end of your samples errors in these parts will often lead to alignments that start a few bases into the sequence and or do not extend all the way to the end Aligner uses the Max distance parameters to determine how far from the start or end of a sample a match can be For example if a match starts 35 bases from the start of the sample and the maximum distance from the start is set to 50 then Aligner will trim the first unaligned 35 bases plus the bases that actually match But if the maximum distance from the start was set to less than 35 Aligner would ignore this match and not trim If you use end clipping before vector trimming you can use low numbers for the max distance parameters for example 20 and 50 With samples that are not end clipped first higher numbers like 50 for the start and 150 250 for the end may make more sense The alignment score is calculated based on the number of matches discrepancies and insertions deletions in a match Each matching bases gives a score of 1 while mismatches and insertions deletions reduce the score Therefore your minimum score should be lower than the minimum overlap length Keep in mind that there is always a trade off between sensitivity and specifici
141. elow the threshold however they are not included when they are flanked by higher error regions The maximize region method is very similar to the method used by the base calling program Phred with the trim alt option and based on the Mott algorithm for sequence trimming It s a bit hard to understand but works rather well Method 2 Using separate criteria at the start and the end of the sequence In this method the clipping is done by coming in from the start and from the end of a sequence and chewing into the sequence until a region that is good is encountered There are two different ways to define what is a good region End Clipping Algorithms 40 CodonCode Aligner User Manual 1 the average estimated error rate in a region calculated from the quality scores and 2 the number of bad bases bases with a quality below the defined threshold You can also define the length of the region and use different regions at the beginning and at the end of a sequence At the beginning where sequence quality improves rapidly a short window e g 20 bases can make sense while at the end where the sequences quality drops of slowly a longer windows e g 50 bases can make sense You can use either one of the two definitions or you can use both together The advantages of this method are that a it is a bit easier to understand and b it gives you more options to tune the trimming exactly like you want it Method 2 Using
142. embly r Marking mutations Preference options Printing M Remove unedited Hy existing mutation tags Protein translation V Add tags only to mutated bases Restriction maps ES ee Use ambiguity codes for heterozygous point mutations l v Change homozygous mutations to lower case r Mutations to look for _ Look only for homozygous mutations Mi Look for heterozygous indels Window placement Description Allows you to determine the sensitivity of detecting heterozygous mutations Low sensitivity settings reduce false positives high sensitivity reduces false negatives Detection sensitivity At the top you can set the sensitivity for detection of heterozygous point mutations The first set of radio buttons determines the sensitivity at places where a secondary peak is accompanied by a drop in intensity of the primary peak compared to other samples at this position The second row of radio buttons applies to places where there is no clear drop of intensities for example because all samples at this position are heterozygous There is a trade off between sensitivity and accuracy With detection sensitivity set to low most or all point mutations identified by Aligner will be real in other words the false positive rate will be low However Mutation Detection Preferences 198 CodonCode Aligner User Manual Aligner may miss some heterozygous point mutations for example if th
143. ent uses a banded Needleman Wunsch algorithm The bandwidth parameter has an impact on the alignment speed larger values mean slower alignments For large projects you may want to reduce the bandwidth value for projects where you know that you have larger Maximum Unaligned End Overlap 167 CodonCode Aligner User Manual insertions and deletions you may want to increase it Note however that increasing the bandwidth will typically not be enough to extend alignments through very large gaps like large introns Support for Large gap alignments will be added to later versions of Aligner The bandwidth parameter does not apply to large gap alignments in large gap alignments gaps between aligned parts can extend for thousands of bases Word Length The word length parameter determines the size of words that CodonCode Aligner uses when looking for potential overlaps between sequences Only sequence pairs that have perfect matches of at least this length will be considered for merging If you are trying to align sequences with high error or mutation rates reducing the word length may help to get samples aligned For very large projects or projects with many repeat sequences larger numbers may give better results The impact of the word length setting on the alignment speed depends on the size of the project for large projects larger word length values can lead to faster alignments Match scoring The last four alignment pa
144. epc ptr tM FLU EIS AERE ENERE PRESERVAR EE SE HEP EIE RUE 84 How Alpner Pits SN Eper osrin ne OPER PURIS ene Eu uS equ ee Rw A RATS 85 LETTERS t NANE ETE to tn dy Gee vio een oe N paola we vegan Voorn rtp ce 85 Heterozygous Insertions and Deletions ssssssssssssssscsssssssscsssessssssssssscssccssssssssssssssessssscssscsssssssssessssscesees 87 Pardi Herez sous Mdk ea ane ear are EE ere adde o dit see adt Teeter eee errr ey 88 Hetero Indel SSOP S a oue seca rr n ERE Dor DERE GG kr dp bal Deuda ids wage ERO VER EE nase TN 89 CodonCode Aligner User Manual Table of Contents Heterozygous Insertions and Deletions EET EI RESTE SEE 89 IEEE eod CRIT Nx 90 Splitine Heterozyeous Macis moraris ernis er ble rl eof E On rci bil cri an eq dd rl ni redu 90 Processing Heterazyecus Indelsuiieeekie i aeie need a cepe e ep RA INNEN E Duke dde hod aiaa 90 ET EO E A OT SO TETTE 93 Processmpb Pre Requisites and Lins orroit pasne ine aE ERO NE ERI 93 Interprete Resuli ooo ou ci ob REO A O 93 FACIEI m TE 94 Editing Samples nire tr bed tese irte rc ER reine me eee 95 Windows for Editing Samples eden hd n Ed TT neu noo bee un wenn Birds 07 Cursor Positioning and MOVE docere uo ea n EHI ER ER an REX RE VE eX EXE REEF XR E EXER E REN UE E Fax RES EVE VE Y FEE EU RES 98 Moving to Features Ambiguities Mismatches or Edited Bases sssssssessss 98 Salete BASO aici ii ASH ee ee eee UNI D DING MI MEI EP an ne 99 Selec
145. equence Right Mark Start Alignment Location Go Menu 232 CodonCode Aligner User Manual End Alignment Location Tag Show Local Tags Show All Tags Add Tags Mark as False Positive Make Reference Sequence Sample Information Contig Menu Assemble Assemble with Options Align to Reference Sequence Align with Options Unassemble Find Mutations Process heterozygous indels Delete From Contig Start To Contig End Split Contig Contig Information View Menu Qualities Features Restriction Map Select Enzymes Restriction Map Options Mask Bases Matching Consensus Switch Color Scheme Auto Select Traces Protein Translation Frame 3 Frame Forward 3 Frames All 6 Frames Preferences Toolbars Show Toolbars Hide Toolbars Sample Menu 233 CodonCode Aligner User Manual Window Menu Close Help Menu Aligner Help Quick Tour License Aligner Web Site Check for updates Window Menu 234 Memory Requirements CodonCode Aligner is currently intended for projects with up to several hundred reads On computers with sufficient RAM 512 MB or more CodonCode Aligner can handle projects with up to several thousand reads each about 500 1000 bases long The size of projects that CodonCode Aligner can handle is determined by the amount of memory available to Aligner Details depend on the operation system used On Windows CodonCode Aligner will try t
146. equence is used as the consensus sequence as defined in the consensus method preferences Adding tags to a region in a sample can be useful to skip regions with sequence artifacts which can throw off Aligner s analysis Adding tags to the consensus sequence or the reference sequence in alignments can be useful to limit the analysis to a region of interest or to avoid regions where all sample traces have artifacts How to add tags is described above of course you need to choose dontGenotype as the tag type to exclude regions from analysis Excluding Regions from Analysis 84 CodonCode Aligner User Manual How Aligner Finds SNPs When searching for heterozygous point mutations CodonCode Aligner does the following 1 Each sequence is analyzed for low quality sequence at the start and at the end Regions that fall below the threshold set in the mutation detection preferences are marked with a dataNeeded tag and ignored in the subsequent analysis 2 Aligner looks for heterozygous insertion deletion tags heterozygoteIndel in each sequence and excludes regions identified as heterozygote indels Note that the tags need to extend to the start or to the end of the sample tags that do not extend to the start are assumed to go to the end This step is omitted if Look for heterozygous indels is deselected in the mutation detection preferences or when only looking for homoygous mutations 3 Aligner loops through all the consensus
147. equences have heterozygous indels the subtraction does not work Ideally the wild type sequence should be not have any heterozygous mutations however isolated heterozygous point mutations may be tolerable The wild type sequence must be the same direction and chemistry and preferably use the same primer The subtraction step relies on the peak patterns being very similar in the two sequences This is generally not the case for sequences produced with different sequencing chemistries or sequenced from different strands The wild type sequence must be largely identical to one of the two alleles in the mutated sample This is typically the case when analyzing sequences from human samples however it may not be the case when analyzing regions with a high degree of lengths polymorphisms for example intronic sequences from different species The analysis may fail in obvious or non obvious ways While the trace subtraction should always produce a new subtracted sequence the resulting trace may not correctly show the presumed mutated allele In obvious cases the subtracted sequence will have peak patterns that are clearly incorrect and low quality scores In less obvious cases the subtracted sequence may look reasonable but individual peaks and corresponding bases may be missing Therefore it is essential to closely look at all three sequence traces together the indel sequence the wild type and the subtracted sequence If you happen to have
148. er can automatically group samples based on their names and form separate contigs for each group This option can be a real time saver in phylogenetic and medical studies where you look at sequences from many species isolates or patients Preprocess in addition to the choices above Aligner can also automatically do common pre processing steps like end clipping and vector trimming before assembly To use the advanced alignment options select the samples you want to align and then choose Choose Align withOptions from the Contig menu This will display a dialog where you can choose the different advanced options as described below Align to reference from scratch Sometimes you may want to re assemble a contig for example after you did some editing and ended up messing up the alignment of reads Or you may want to merge a contig with another contig and or additional samples without preserving the existing alignment of reads in the contig To re align one or more contigs from scratch Go to the project view Adding Samples to Alignments 62 CodonCode Aligner User Manual e Select the contig contigs or contig s and sample s you want to assemble from scratch keep the shift control or command key pressed to make continuous or discontinous selections as described above Choose Align with Options from the Contig menu This will open the following dialog le 66 Align With Options d igs Preprocess
149. er only slightly for example because of sequencing errors It can be up to 10 times faster than other BLAST versions and allows the submission of multiple sequences in a single search Nucleotide blastn The Nucleotide blastn option can be used to initiate a comparison of nucleotide sequences against nucleotide databases Translated blastx The Translated blastx option can be used to initiate a comparison of a protein translation of your nucleotide sequences against protein databases Translated tblastx The Translated tblastx option can be used to initiate a comparison of a protein translation of your nucleotide sequences against a protein translation of the nucleotide databases For more information about BLAST please visit http www ncbi nlm nih gov blast BLAST Searches 130 Exporting Sooner or later you will probably want to use the data you see with Aligner with other programs For example you may want to use BLAST to compare the consensus sequences to nucleotide databases or you may want to export read names and reads lengths for importing into spreadsheets or data bases You can export the key data in Aligner projects using the various sub menus in the Export menu in the File menu To export samples or consensus sequences first select what you want to export in the project view Then choose one of the following export options Export Project Summary Export Samples Export Consensus
150. ere ntis erapr e E S S FEL mU us ea RI e ER VERE N ERIS PU MEN poH REV E UE VADE 174 Base Color Pro ri EE Lt 176 Switching colot schenies iieis peii ir ec ap He IER EEe aaa Een S pede abb esI aee Eo aen ee Ape b E IR Eos dis 177 alty based 3 color scheme ssnin menan a 177 vii CodonCode Aligner User Manual Table of Contents Continuous quality based background colors eee ee eee esses sees ee eese eee etes testa setas etas senes esses 179 Baseupeclfie calop cnidr Ger ERE ERE PER mr on ae EDI EU dI eR ee epee ERE GO UL LO REPE MEA Iu cad REI n RUE 181 Consensus Preferente T DT TOT c 184 Double Clicking PEefevelnces ue aniaun s rae eEFRERE EIE EI EE EPI CENE minions UEQUHE EI NEIEN 186 End Clipping Preberen ces EE Io m 187 Automatically removing short and low quality sequences after end clipping 188 Feature Preler eliCes ois cie ne or rone dp mae Fa s Rina cu MI MM wee Ee E M i MEE E EM iE EM EE E E EE EET 190 SOOT WINS SUNSETS OI LAOS c 2055 2 eA 5 0 1 e 191 Highlighting Prefereuces iieecceesis eost turo pta eoe enu EERNRE PARRA MEE SEES RES AEn ES ENSEM aN ani aE URS SANE RR Era Mae EAN RE POR aikaa 192 License Server Preferen bks uescciesisrioni esi iri REEF REFERENCE URN VE EEER PETER EN RU RET PR REYUIRER iieiaei 194 Memory Prefer eric ee TTE E DO o o D LS LOL 196 A an T E D e Aes A rriv one n le Fede ri an e p hr ge ed 196 Memory on Windows sirnaa boi tied E bb pda peteqi ce
151. es for example confirmed sequence segments rather than individual bases However the quality scores assigned by Aligner will often but not always be identical to the scores Phrap would assign to the same assembly Majority Consensus The majority method will be used to make the consensus sequence if you unchecked Use quality based consensus whenever possible in the consensus preferences unless the contig is an alignment and you selected to use the reference sequence to build the consensus The short description Basically Aligner will use the most common base at each position as the consensus unless no base accounts for more than 50 of the base calls there in which case an ambiguity code will be used Well this is actually a bit simplified here is how the majority consensus is determined in detail The long description First Aligner looks at all the bases and gap characters in the aligned parts of all samples at this consensus position If more than 50 of the samples have a gap here the consensus will be a gap Otherwise the gaps will be ignored for the following analysis If none of the base calls are ambiguities here the rest is simple If one base A G C or T accounts for more than 50 of all non gap base calls here it is used as the consensus base If no base accounts for more than 50 a IUPAC ambiguity character is used based on all the base calls here The IUPAC ambiguity codes are Ambiguity Code M CorG
152. es or to cancel the import Importing Sequencher Projects CAF Files Many current and former users of the assembly program Sequencher have expressed the desire to import existing Sequencher projects into CodonCode Aligner While CodonCode Aligner cannot read Sequencher project files directly it is easy to export Sequencher projects in a file format that CodonCode Aligner can read the CAF file format for Common Assembly Format Exporting Sequencher Projects as CAF Files To import a Sequencher project into CodonCode Aligner you must first export the project from Sequencher in CAF format as follows 1 Open the project in Sequencher 2 Select the reads and contigs you want to export use Select AII from the Select menu to export the entire project 3 Go to the File menu and select Export gt Selection As Subproject This will open a Save dialog 4 Click on the File Format pulldown menu and select CAF 5 Use the New folder button or icon to create a new folder to export your project to 6 Choose a name for the exported file Make sure that the name ends with caf Here is an example of what the dialog looks like with Sequencher 4 1 on Mac OS 9 Adding Entire Folders of Sample Files 20 CodonCode Aligner User Manual CPNewFolder Export Selected Icons as example caf File Format Export Chromatograms as SCF Version 2 0 Q SCF Version 3 0 O Export Contents of Selected Refrigerator
153. es the location and name of the Phred executable to determine whether you are using the workstation version or the regular version both versions perform identically but the workstation version can only be run from Aligner with a valid license Aligner will assume that you are using the workstation version if it finds workstation phred anywhere in the name which includes the directories Therefore please do not change the name of the Phred executable installed by Aligner If you are using your own copy of Phred rather than the workstation version please make sure to not call it workstation phred or put into a folder hierachy that contains workstation phred In the bottom text field you can specify additional command line options for Phred In general please leave this line blank only experts who really know what they are doing should specify command line options here Also note that Aligner uses the id and the cd options to specify input and output directories for Phred for more details please check the base calling help page Base Calling Preferences 175 Base Color Preferences CodonCode Aligner can use several different color schemes to display bases You can control and fine tune these schemes in the Base Color Preference dialog e0060 Preferences Alignment r Base colors Assembly Trace colors Base calling Base colors As Moreen E Consensus method We A di red Double clicking v5 E End clipping G s
154. es visible in the contig view as the range for printing but you can edit both numbers to print any section of your contig The options in the lower half are described in detail in the Printing Preferences Printing Contigs 156 Feature Window Select a contig in the project view and then choose Feature View from the View menu to display a window showing features for a contig eoe Features in Contig2 Feature Source Foundin Parent Contig Start End Content dataNeeded polyPhred ca 23 s Contig2 22 25 e heterozygoteCT polyPhred ca 22 r Contig2 119 119 Confirmed heterozygoteCT polyPhred ca 22 s Contig2 119 119 Confirmed heterozygoteCT polyPhred ca 21 s Contig2 119 119 Confirmed homozygoteCC polyPhred ca 9 r Contig2 119 119 Confirmed homozygoteCC polyPhred Cca 23 s Contig2 119 119 Confirmed homozygoteCC polyPhred ca 9 s Contig2 119 119 Confirmed polyPhredRank1 polyPhred Contig2 Contig2 119 119 COMMENT co heterozygoteGT polyPhred ca 22 r Contig2 172 172 heterozygoteGT polyPhred ca 22 s Contig2 172 172 heterozygoteGT polyPhred ca 21 s Contig2 172 172 heterozygoteGT polyPhred ca 23 s Contig2 172 172 homozygoteGG polyPhred ca 9 r Contig2 172 172 homozygoteGG polyPhred ca 9 s Contig2 172 172 polyPhredRank1 polyPhred Contig2 Contig2 172 172 COMMENT co heterozygoteGT polyPhred ca 22 r Contig2 229 229 heterozygoteGT polyPhred ca 22 s Contig2 229 229 heterozygoteGT polyPhred ca 21 s Contig2 229 229 homozygoteTT polyPhred
155. examples of where the algorithm did not work as a expected we would certainly appreciate if you could send us your trace files so that we can continue to optimize CodonCode Aligner s algorithms Interpreting Results When interpreting the results of heterozygous indel processing done with CodonCode Aligner always keep in mind that CodonCode Aligner is only a tool that helps you to come to conclusions You will need to use caution whenever interpreting what you see Some specific things to keep in mind e The subtracted sequence you see is not a real allele sequence For example any mutations you see after the indel site could be on either allele or on both alleles e The base specific quality scores close to and after the indel site in the subtracted sequence should be used for guidance only They do not have the same mathematical accuracy as quality scores for real sequences However we believe that you can use the quality scores to quickly get an idea if the Limitations 93 CodonCode Aligner User Manual subtraction worked or not The algorithms for analyzing heterozygous indels have been developed and tested only on a limited number of sequences and have not been experimentally validated This is by no means a complete list so be cautious CodonCode Aligner is intended for research use only and has never been validated for any clinical or medical applications You should not base any medical decisions on any results obtained with
156. file formats restrict the length of sequence names The only edits currently supported are gap movements if you edit insert or delete bases the updating will fail e If the exported contig had unaligned dangling ends the updating will likely fail One way to create dangling ends is to generate contigs of contigs using the built in algorithm and then remove samples or contigs at the beginning or end of the contig This cannot happen if the contig of contigs is generated with ClustalW since ClustalW creates end to end alignments We plan to remove some of these restrictions in future releases How To Roundtrip Edit with CodonCode Aligner 127 Editing Contig Information You can rename contigs and add comments by selecting the contig in the project view and then choosing Contig Information in the Contig menu This will bring up the following dialog box 9 Sample Information Contig1 Name Contigl Comments You can change the name in the Name textfield at the top You can also add remarks about the contig in the larger text area below these will be shown in the Comments column in the project view If a contig has tags for example polymorphism tags added from finding mutations the button that is labeled No tags in the image above will be labeled Tags and become active Clicking on it will bring up a tag dialog that shows all tags for the consensus sequence The checkbox at the bottom i
157. from the restriction map view by clicking on the restriction map icons in the toolbar The restriction map preferences are displayed in two different tabs One tab allows to change the restriction map options the other tab allows to select enzymes for the digest The tabs are shown at the top of the restriction map preferences and you can switch from one to the other by clicking on the tab Selecting Enzymes The Restriction Enzymes tab in the restriction map preferences allows you to select enzymes for the digest Restriction Map Preferences 211 CodonCode Aligner User Manual eoo Preferences Alignment Restriction maps Assembly Base calling Rest 1 nz Restriction Map Options Base colors Double clicking Subsets End clipping Features By Manufacturer Highlighting f Invitrogen Corporation E License Server By Size Of Recognition Site Memory Mutations 4 base cutters Open amp save C S base cutters Phrap assembly Preference options Printing vi 6 base cutters large base cutters gt 6 Protein translation By Cut Result Sample names all cutters Restriction maps N estricion maps 5 overhan Startup Ss g Vector trimming Enzyme Name J 3 overhang Views EcoRI O blunt cutters Warnings Recognition Sequence 3 Window placement DAT C _ Include degenerate sites L Description The restriction map preferences control which e
158. ft Word s doc format 4 Make sure that the file has the correct line endings especially on OS X due to it s mixed origins OS X files can have either Macintosh style line endings or UNIX style line ending Phred requires UNIX line endings on OS X You can use tools like BBEdit Lite or LineBreak 2 2 to convert line endings if needed Wrong command line parameters If you see the following error message e Base calling error The following error occured during base calling e Phred produced no result files probable cause wrong command line option Check error messages in file Basecalling errors txt Missing entries in the Phred parameter file 34 CodonCode Aligner User Manual then you did not read the for experts only part in the Base Calling Preferences did you Or perhaps you just mistyped an option go back to the base calling preferences and change the Additional command line options If you leave this line blank as we suggest you should not see this error message Problem running the workstation version of Phred When Aligner uses the workstation version of Phred you may see the following error message r M eoo Base calling error The following error occurred during base calling Phred produced no result files Probable cause problem running PHRED workstation version For more information check the error messages in I Applications CodonCode Aligner Phred Phrap Basecalling errors txt
159. g or shift clicking and then view the bases traces or contigs assemble the samples and so on Base View Window The base view window shows all the bases for a sequence as shown below Project Window e208 1 CodonCode Aligner User Manual TGGAGGAGGT 51 TTTGTTGTGG C c CACAGAGACC 101 CAGGTGCTGC AGCCACAAGA GGAAGCCTTG ACACAGGTGT GGATGCCATG 151 ATAGH MTTC CCCATCAATT TCCAAGACCG ACCTGAGCCC AGCAGTCAAA 201 GGGGTGGGCT TTCTTGTACT TAATGCTAGA TCTCTGCCAG TTTACAGTAG 251 ATGTAGCTTG Brectactat TTGTTCGTCC ACCCACTCAT CACTCACTCA 301 GCCTCTCATT CACTCATCCA TTCTCTGTGA erg BecacaTGEB 351 cc PeGcatccese 401 Acc TcTAATOCC 451 GAGGTCGAGA 501 CAACAANGAT 551 GTGGGATTCT w 601 D A060 s Base 261 of 628 Quality 16 4 As in the other windows that show bases the quality scores for each base can be shown as a colored background In the example above base calls with qualities below 20 low quality bases accuracy below 99 are shown with a dark blue background base calls with quality scores between 20 and 30 on light blue background and base calls with qualities above 30 very high quality bases accuracy above 99 9 on a white background You can change the colors and thresholds in the Preferences dialog Trace Window The trace window allows you to view and edit sequences that have chromatogram data for example ABI and SCF files eoe Traces from Contig1 GTGAAT EAAACTATGTTAAGGGAAATAGGACAACTAAAA TA cen NbrmR R 50 60
160. g short and low quality sequences after end clipping 189 Feature Preferences Aligner allows you to define criteria for places that you want to examine more closely called Features Your definition of features can include low quality consensus bases low coverage regions gaps ambiguities and tags you make your choices in the Features preferences Preferences r Features Feature Criteria Regions of Interest Base calling s z Base colors vi Low quality consensus quality lower than 30 r Consensus method V High quality discrepancy quality at least 40 Double clicking Low coverage regions _ Total coverage less than 3 pm Highlighting _ Covered in just one direction License Serves O Ignore tags All tags O Some tags Memory Mutations f Gaps in sample Any ambiguity Edited bases Open amp save M Gaps in consensus 2 Any discrepancy Phrap assembly ERES Preference options When navigating Printing rLook for features in Protein translation Sample names 7 Startup 7 Consensus only Vector trimming O All samples only Current selection only Consensus and all samples Window placement At each consensus location O Find all features Find just the first feature Description The features preferences let you define features Regions of Interest that are shown in the feature view windows Features are also used for
161. gion The default parameter of 70 is relatively relaxed you may want to use a more stringent setting for your projects especially if you did use end clipping before the alignment Be careful about setting this value to the 10096 only samples that fully match each other in the overlapping regions will be assembled samples with even a single discrepancy will not be aligned Minimum Overlap Length This is the minimum length of the aligned region If the aligned region is shorter than the value you set here with 25 being the default alignments will be rejected and samples will remain in the Unassembled Samples folder Minimum Alignment Score This parameter is similar to the Minimum Overlap Length but it takes discrepancies into account Scores will be scaled so that a match gives a score of 1 for each matching base in the aligned region a score of 1 will be added With the default settings a score of 2 will be subtracted for each mismatch for single base insertions or deletions a score of 5 will be subtracted 3 gap introduction penalty and 2 gap penalty additional gaps in the same run lead to a subtraction of 2 per base In general your minimum alignment score should be lower than your minimum overlap length to allow for some level of discrepancies between the sequences Algorithm 170 CodonCode Aligner User Manual Maximum Unaligned End Overlap This parameter is perhaps the hardest to understand After doing an al
162. gs that were created by aligning to a reference sequence rather than by assembling you can choose to have the reference sequence be used as the consensus sequence This can be useful in mutation detection and clone verification projects You can set which consensus method is used in the consensus preferences Quality based Consensus To determine the consensus base and quality score for assemblies where the samples have qualities CodonCode Aligner tries to emulate what human finishers typically do Aligner identifies the highest quality base at each position taking into account confirmations by reads in the opposite direction Slightly simplified here is the algorithm in detail 1 For each possible nucleotide A G C T find the sample with this base at the given position that has the highest quality Take this score as the initial consensus score for the nucleotide use 0 if no sample has this nucleotide 2 Find the highest quality confirming base from a read in opposite direction and add the score of the confirming base 3 Optionally find the highest quality discrepant base and subtract the score This subtraction can be turned on or off in the Consensus preferences The default setting is to not subtract the discrepant score 4 Calculate the score for a gap in the consensus the same way using gaps at this position in the individual samples The quality scores of gaps in samples are taken as the average of the two neigh
163. h Aligner you can choose to see only the more severe error messages and warning dialogs by selecting the checkbox in the second row If you really know what you are doing and do not want to see any warning dialogs select the checkbox in the third row In the lower section you can choose if Aligner should warn you before opening many windows for example because you accidentally double clicked on the Unassembled Reads folder which contains many samples You can also set the treshold for how many windows can be opened before Aligner shows a warning Please note that the warning dialog will not be shown if you turned off all warnings in the Warnings preferences Some warning dialogs also allow you to turn off the optional warnings which has the same effect as selecting Only severe warnings and errors Some dialogs can be turned off individually while others affect all optional warnings Warning Preferences 228 Window Placement Preferences You can control how windows are arranged in CodonCode Aligner in the window placement preferences Preferences Window placement r Contig view Base calling g Base colors Mi Place new Contig view windows at the _ top left x Consensus method corner of the screen Double clicking End clipping r Trace view Features Highlighting fV Place new Trace view windows blow ss License Server Memory Mutations rFeature view Open amp save Phrap assembly fV Place
164. he Phred parameter file as described above Cannot find base calling program 33 CodonCode Aligner User Manual At the top of the file it tells you the known chemistrie dye types and machines pick the one that is closest to what was used for your sample For example the line you add may read DT3730POP7 BD mob terminator big dye ABI_3700 for the most commonly used sequencing chemistries from ABI 3700 or ABI 3730 sequencers Save the changed Phred parameter file make sure to save it ina Text only format if using Word as the editor and try the base calling again Problems reading the Phred parameter file If PHRED cannot find or read the Phred parameter file you will see the following error message E 17 eoo Base calling error The following error occurred during base calling Phred produced no result files Probable cause problem finding or reading Phred parameter file For more information check the error messages in Applications CodonCode Aligner Phred Phrap Basecalling errors txt Help 3 To fix this problem you can do the following 1 Make sure that the path to the Phred parameter file that is specified in the base calling preferences is correct and that the Phred parameter file is readable 2 Check the Basecalling errors txt in the Aligner directory for hints about what is wrong 3 Verify that the Phred parameter file is a plain text file and not a binary format like RTF or Microso
165. he page Poster Prints the sample and contig names with as much of the consensus sequence as will fit across the page Continues printing the sequences across additional pages without including the sample or contig names on those pages The Font size pull down menu selects the size of the font used for printing the contig If the Include colors and highlighting checkbox is checked the contig will be printed as it appears in the contig view including colored bases colored backgrounds and other highlights If this box is unchecked then the bases will be printed as a black letters on a white background ignoring all highlights other than underlining To print sequences grouped every 3 5 or 10 bases with spaces in between check the box labeled Print bases in groups of bases If this box is not checked bases will be printed continuously across the page Trace View Printing 208 CodonCode Aligner User Manual Usually unaligned ends of samples are printed with the contig If do not want to print the unaligned ends uncheck the Print unaligned ends checkbox Contig View Printing 209 Protein Translation Preferences The organism for which the sequence translation is being performed can be selected from the Organism list In the Display section you can choose if you want to see the translation of one frame three frames or all six frames Preferences Base calling Base colors Consensus method Do
166. hile looking at your traces one by one The analysis may take a few seconds per trace Aligner will show the results for each sequence analyzed in the status area and add heterozygoteIndel tag to Finding Heterozygous Indels 88 CodonCode Aligner User Manual each sequence where it finds a putative heterozygous insertion deletion When all sample have been analyzed Aligner will show a dialog that summarizes the results F e Heterozygous Indel Search Results Finished analyzing 2 samples found 1 possible heterozygous indel If any indels were found Aligner will open a new window that shows information about these indels similar to a feature view window 0 OOA Heterozygous indels in heterozygous_indel Feature Source Found In Parent Contig Start End Content heterozygotelndel Aligner heterozygous_indel Unassembled Samples 172 582 Score 29 i f I L Double clicking on any line in the table above will open a view for this sample so that you can verify the results typically the trace view will be opened unless you have changed the double clicking preferences To try this out with an example project that is included with CodonCode Aligner you can open the Hetero indel project in the Example Files folder in the directory where you installed CodonCode Aligner Hetero Indel Scores All heterozygous indels found by CodonCode Aligner will receive a score that is shown in the Content column Sco
167. hoose which name part Aligner should use to groups samples by in the Assemble with Options dialog In this example Choosing Gene would try to assemble all reads into one contig Choosing Exon would try to assemble the genes into 2 contigs one for exon 19 and one for exon Assemble in groups 54 CodonCode Aligner User Manual 20 Choosing Patient would assemble the samples for each patient separately Assuming that there is enough overlap between the exon 19 and exon 20 sequences this would generate one contig for each of the three patients Without sufficient overlap between the exon 19 and exon 20 sequences the assembly would generate 2 separate contigs for each of the patients for exon 19 and for exon 20 for a total of 6 contigs e Choosing Direction would assemble all the forward F reads together and all the reverse R reads separately The contigs created will be named according to the name part used to group samples for example assembling by patient would create contigs called JJM NWS and XHS It is possible that the assembly will create more than one contig for each group for example if some of the samples in a group do not overlap or are too different from each other If more than one contig per groups is created the contigs will be named by adding numbers to the end for example JJM and JJM1 Assembling in groups will try to group and assembly all samples and contigs in your current selection
168. id change 183 T gt C Cys61Cys in the example above Unless to give Aligner more information this annotation will be relative to the first base in the consensus sequence However the coordinates used will be ungapped after removing any gaps from the consensus while other coordinates shown by Aligner are typically gapped they include the count of gaps in the consensus In the example above the gapped and ungapped coordinates are identical since the consensus does not contain any gaps The amino acid change or lack of change is shown for the first of the three possible forward reading frames In you own analysis that may not be what you want your coding sequence may start at base 2 or 3 or even further in for example because you included a part of the sequence before the start codon in your reference sequence To define where the coding region is you can add a codingSequence tags to the consensus or to your reference sequence If you have a reference sequence you should add codingSequence tags to the reference sequence not to the consensus sequence create your contigs by aligning to a reference sequence not by assembling you can use the Contig information menu item in the Contig menu to verify this if in doubt For contigs formed by alignments to reference sequences the coding sequence tags will always be taken from the reference sequence not from the coding sequence If your original sequences were in Genbank
169. ignment Aligner looks at the unaligned dangling ends of both reads Since Aligner does local alignments two aligned sequence may have unaligned bases at the same end This will happen for example when aligning two different copies of a repeat sequence or if one of the samples is a chimeric clone It can also happen if the sequence of one or both clones has a very high error rate as typically seen towards the end of reads that have not been end clipped To illustrate how this parameter is calculated consider the following diagram 123456 7890123456 7890123456 7890 tctctctctcAGCGATCAATaaaaattttt LILEEEE T TG LG I gggggAGCGATCAATaggcccaggcccggacccgg 12345 12345678901234512345 The sequence at the top has 10 unaligned bases at the start and end and 10 aligned bases in the middle The bottom sequence has 5 unaligned based at the start and 20 unaligned based at the end Between the two sequences there are 15 additional bases that could possibly have been aligned the 5 unaligned bases at the start of the bottom sequence and the 10 bases at the start of the top sequence Aligner calculated the relative amount of unaligned sequence that could have been aligned by dividing the overlapping bases in the unaligned ends by the length of the shorter sequence In our example this is 15 30 the length of the top sequence or 50 With the default setting of 70 for the Maximum Unaligned End Overlap our example would have passed at l
170. igs are assembled as they are they are not dissolved first However the consensus sequence of contigs may change where new samples are added Several advanced options for sequence assembly are available through the Assemble with Options item in the Contig menu These include e Assembling from scratch this option dissolves existing contigs before assembly With this option you also have a choice between two assembly algorithms the built in assembly algorithm and the assembly program PHRAP note that users at companies may have to pay a separate license fee to use PHRAP Comparing contigs this lets you build Contigs of contigs for example for phylogenetic studies Again you can choose between two algorithms the built in assembly algorithm and the alignment program ClustalW Assemble in groups this option lets you define how CodonCode Aligner should groups samples based on their names Aligner will then build separate contigs for each sample group Pre processing before assembly this enables you to pre process unassembled samples automatically before assembly by base calling end clipping and or vector trimming Alignment to a Reference Sequence Alignment to a reference sequence is used to determine differences between sequences and a known sequence This requires that you first designate one sequence as the reference sequence All other samples are then aligned to this sequence If necessary the samples are revers
171. importing an exported feature file into Microsoft Excel Exporting Features 140 CodonCode Aligner User Manual Contigl csv C D i Found In Parent Contig Start heterozygoteCG va l x Contigit heterozygoteCG va 23 x Contigit homozygotecC va 16 x Contigi 53 homozygoteCC polyPhred va 13 x Contigi 6 polyPhredRank3 polyPhred Contigit Contigi heterozygoteAT polyPhred va 13 x Contigi 8 hemezygoteAA polyPhred va i x Contigi homozygoteAA polyPhred va 16 x Contigit homozygotes A polyPhred va 23 x Contigi polyPhredRanki polyPhred Contigi Contigi heterozygoteAC polyPhred va 16 x Contigi homozygoteCC polyPhred va 1 x Contigi homozygotecc polyPhred va 23 x Contigit 15 hormozygotecc polyPhred va 13 x Contigi 16 polyPhredRank3 polyPhred Contigi Contigi Contigl sv Sum OSCRL OCAPS 8 7 Exporting Features 141 The Project View Window The project window is the main window in CodonCode Aligner most actions are started by selecting samples or contigs in the project window and then choosing a menu option or one of the buttons at the top of the project window ORONS example_project is B i 5c Save Project Add Samples Add Folder Add Assembly Align to Referens nce Assemble Unassemble Name Contents Length Quality Position Added Modified v us Unassembled Samples 2 samples 0 3 11 3 11 03 BU A454 s Trace 693 397 0 3 11 3 11 03 B A455
172. in the Phred parameter file which tells it the dye type chemistry and machine through lines like this one DT3700POP5 BD v3 mob terminator big dye ABI 3700 There are many different dye primer strings and new ones get added all the time If your sequence traces contain one is not yet in the Phred parameter file PHRED will refuse to call the bases in this trace and generate an error message In Aligner this leads to the Missing entries in the Phred parameter file error described above As described above you will need to edit the Phred parameter file and add a new line for Problem running the workstation version of Phred 35 CodonCode Aligner User Manual each new primer ID string The possible entries are for chemistry primer terminator unknown for dyes rhodamine d rhodamine big dye energy transfer bodipy unknown e for machines ABI 373 377 ABI 3100 ABI 3700 Beckman CEQ 2000 LI COR 4000 MolDyn MegaBACE PHRED versions released in 2004 and later also support ABI 3730 as the machine type at the time of writing the new versions are still in beta testing and have not yet been released For more information please check the discussion groups on CodonCode s support site In general do not use the unknown tags If your dye or machine is not listed use the one most similar to it for example ABI 3700 for ABI 3730 XL sequencers if you are using PHRED version 0 020425 The most common combination
173. indow will exit Aligner again with the option to save unsaved changes in open projects On Mac OS X there is no main window You have to choose Quit in the Aligner menu to exit Aligner Closing Windows 162 Preferences and Settings You can customize many aspects of Aligner in the Preferences dialog To display the Preference dialog On Mac OS X select Preferences in the CodonCode Aligner menu or press Option return On Windows select Preferences in the Edit menu or press Alt Enter This will show the preference window which looks like this Preferences r Vector trimming r Vector Library Base calling x Base colors I UniVec Consensus method O UniVec Core Double clickin End clipping 3 From File Volumes Aligner Idea Aligner Data Features Select vector sequences to screen against oe BlueScribe cloning vector SYNBLUEV a BlueScribe M13 Plus cloning vector So Mutations BlueScribe M13 Minus cloning vector SYNBLM13l 4 BlueScribe KS Minus cloning vector SYNBLKSMV v aaa S F lt gt Phrap assembly Preference options Search Criteria Printing T s Protein translation Minimum identity 80 Sample names Min overlap length 20 Minimum score 10 Max distance from start 40 Max distance to end 100 r After Vector Trimming vi Move sequences shorter than 50 bases to the trash Window placement Description The vector trimming
174. ine how matches are scored The Match score is used when two aligned nucleotides are identical the Mismatch penalty when two base calls are different The Gap penalty and the Additional first gap penalty is used when one of the two sequences has a deletion relative to the other sequence For single base deletions the penalty score will be the sum of the gap penalty and the additional first gap penalty for additional deleted bases multiple gaps in a row the penalty will be just the gap penalty You can change the scoring within limits scores from 1 to 19 for matches and penalties of 1 to 19 In general we suggest that only experts change the match scores and penalties Bandwidth Maximum Gap Size 172 CodonCode Aligner User Manual Restoring default parameters To restore the default parameters click on the Defaults button near the bottom This will reset all parameters to the choices shown in the screen shot above Restoring default parameters 173 Base Calling Preferences In the base calling preferences you can specify details needed for running the base calling program Phred to use base calling in Aligner you need to have Phred installed on the system that you are running Aligner on of course OOA Preferences Alignment r Base calling Assembly Base calling Full path to the base calling program Phred rosis a ER tions CodonCode Aligner Phred Phrap workstation phred Select Double
175. ion maps can be printed and the text map and the summary of each map can be copied using keyboard shortcuts To copy a restriction map select the part you want to copy and use the keyboard shortcut Apple C on OSX and Ctrl C on Windows to copy and the keyboard shortcut Apple V on OSX and Ctrl V on Windows to paste Selecting Fragments The graphical restriction map views single and multi line map allow you to select part of the sample shown in the map by clicking on a fragment between two cut positions The selected part of the sample is highlighted in blue in the restriction view eee Contig1 Wind 5 Enzymes Options Restriction map for Contig 1 1673 bases linear DNA Displaying cut positions EcoRI 635 Xbal 662 Pstl 274 Pstl 728 BstXI 1074 Pstl 1627 Non cutters Acc65l Apal BamHI Bsp68l EcoRV Hincll Hindlll Kpnl Notl Pael Sacl Sacll Sall Smal Xhol Xmil In the screen shot above the fragment between the two enzymes PstI cutting at position 728 and BstXI cutting at 1074 is selected You can also make continuous selections by holding the Shift key pressed while selecting regions in the view with your mouse The selection updates accordingly in the other views like the base view the contig view and the trace view The region selected in the screen shot above from base 728 to base 1073 is now selected in the base view for this contig Text Map 160 CodonCode Aligner User M
176. ion of interest features check the feature help page Take the Quick Tour To quickly learn about the most important features in CodonCode Aligner we suggest that you take the Quick Tour available online at http www codoncode com aligner quicktour It takes about an hour to complete but will probably save you quite a few hours for example by showing you some very useful features that you otherwise might miss You can access the Quick Tour by selecting the Quick Tour menu item from the Help menu in CodonCode Aligner This will open a new web browser window and point it to the start of the quick tour Alternatively you can look at the Quick Tour in Adobe PDF format which was installed as QuickTour pdf in the directory where you installed CodonCode Aligner typically Applications CodonCode Aligner on OS X and C Program Files CodonCode Aligner on Windows you may not see the pdf extension depending on your system settings Contig View Window 11 Quality Values In CodonCode Aligner CodonCode Aligner was designed to make optimal use of base specific quality values both for pre processing and for sequence assembly Accurate base specific quality values that are linked to base calling accuracy were first introduced by the program PHRED that s why they are often called Phred qualities or Phred scores While you can do many things in Aligner even if your sequences do not have quality scores we strongly suggest that
177. ions and deletions by checking Look for heterozygous indels If you have already searched for heterozygous insertions and deletions for example before end clipping you can uncheck this checkbox and the mutation finding will be a bit faster Keep in mind that it is generally recommended to search from heterozygous indels before end clipping since end clipping may clip the entire heterozygous part Marking mutations 200 Open amp Save Preferences In the Open amp save preferences you can set what Aligner does when opening and saving projects Preferences r Open amp save Base calling Number of projects in Open recent Base colors Default folder for new projects Consensus method Double clicking Users peter Documents Projects End clipping Features Highlighting Users peter Documents Projects License Server Memory v Always use the last used folder for importing Default folder for importing files Mutations C Set the project path when creating a new project n en amp save I vis Phrap assembly r When importing samples without qualities Preference options Printing Set the quality score for each base to 15 Fu Protein translation Sample names Startup Vector trimming Window placement Description The open and save preferences allow you to select the default location for new projects and importing and how many recent projects Aligner remember
178. ipting CodonCode Aligner Some functions in CodonCode Aligner can be executed from scripts text files that contain a collection of commands and have the extension alscpt Scripts can be opened using Open from the File menu or by drag amp drop Compatible File Formats 23 CodonCode Aligner User Manual Some commands allow you to specify files or folders for example for importing Please note that any file or folder names that contains spaces must be surrounded with quotes If the file or folder names contain quotes change the quotes in the names to double quotes For example a file Users Shared Name with quote should be written as Users Shared Name with quote In scripts the same logic as when using CodonCode Aligner normally applies Specifically to do something like end clipping or assembling you must first select the samples or contigs to work with Here is an overview of the available commands Command Parameter Comments none Creates a new project full path to project file e g Users Shared My Project My Opens an existing project Project proj importFolder full path to folder Imports a folder of samples imporProect si ull path to project file Imports a project importSample full path to sample file Imports a sample none Closes a project none Saves a project full path to project file e g Users Shared My Project My Save the project at the given location Project proj
179. is not checked the exported sequences will be ungapped If the sequences have qualities then a quality file in FASTA format will also be created in the same file as the FASTA file The name of the quality file will be the name of the FASTA file with qual appended at the end of the name Individual FASTA files This option allows you to create a separate file for each sample Again this is a text file in FASTA format each file contains exactly one sequence You can choose the folder where the files are created in a Save As dialog that will be shown once you click on the Export button All files will be created in the same folder the names of the files will be the sample name with fasta appended When exporting FASTA files you have the option to include gap characters in the output but checking the box labeled Include gaps in FASTA files If the box is not checked the exported sequences will be ungapped Exporting Samples 134 CodonCode Aligner User Manual If the sequences have qualities then a separate quality file in FASTA format will also be created for each sample The name of the quality file will be the name of the corresponding FASTA file with qual appended at the end of the name SCF files SCF files contain the current base calls as well as the chromatogram data and allow you to import the sequences into programs that support the standard SCF format You can choose the folder where the files are created in
180. is not used to generate the assembly which can lead to incorrect assemblies especially in larger projects containing high identity repeats Aligner Algorithms for Assembly and Alignments 68 CodonCode Aligner User Manual You can adjust the stringency requirements for successful mergers in the Assembly preference panel Note that the assembly preferences apply only to assemblies generated with the built in algorithm not for assemblies with PHRAP or contig comparisons generated with ClustalW or muscle Consensus Calculation CodonCode Aligner offers three methods for determining the contig consensus sequence 1 Quality based consensus sequences This is the preferred method for most assembly projects since it gives the most accurate consensus sequence It requires that sequences have base specific quality scores for example from base calling with Phred which can be done directly from Aligner 2 Majority consensus The majority consensus simply counts all bases at a given position If one base or gaps are more than 50 of all calls the base or gap is used as the consensus otherwise and ambiguity code for the bases present is used this description is a bit simplified more details below 3 Inclusive consensus The inclusive consensus considers all aligned bases at a given position and uses the IUPAC ambiguity code that represents all bases present at a given location 4 Using the reference sequence as the consensus For conti
181. ites section Missing entries in the Phred parameter file Another possible error message you may encounter looks like this 7 eoo Base calling error The following error occurred during base calling Phred produced no result files Probable cause missing entries in Phred parameter file For more information check the error messages in I Applications CodonCode Aligner Phred Phrap Basecalling errors txt Help Gron This happens if Phred cannot find the dye primer string in the Phred parameter file since version 1 1 1 of Aligner this should not happen anymore since Aligner tries to help you in adding the missing entries before running PHRED as described above however you might still see this problem is you accidentally edited or misspelled a primer ID string pressed Cancel in the Phred Parameter File dialog or against all our warning used a text editor to edit te Phred parameter file Go ahead and open the file Basecalling_errors txt in Phred Phrap directory inside the CodonCode Aligner directory In there you will see one or more entries like this SampleFileName abi unable to match primer ID string skipping chromatogram unknown chemistry DT3730POP7 BD mob in chromat SampleFileName abi add a line of the form DT3730POP7 BD mob lt chemistry gt lt dye type gt lt machine type gt to the file usr local genome lib phredpar dat To fix this problem you need to add the line as requested to t
182. ively relaxed you may want to use a more stringent setting for your projects especially if you did use end clipping before the alignment Be careful about setting this value to the 100 only samples that fully agree with the reference sequence will be aligned samples with even a single discrepancy will not be aligned Minimum Overlap Length This is the minimum length of the aligned region If the aligned region is shorter than the value you set here with 30 being the default alignments will be rejected and samples will remain in the Unassembled Samples folder Minimum Alignment Score This parameter is similar to the Minimum Overlap Length but it takes discrepancies into account Scores will be scaled so that a match gives a score of 1 for each matching base in the aligned region a score of 1 will be added With the default settings a score of 2 will be subtracted for each mismatch for single base insertions or deletions a score of 5 will be subtracted 3 gap introduction penalty and 2 gap penalty additional gaps in the same run lead to a subtraction of 2 per base In general your minimum alignment score should be lower than your minimum overlap length to allow for some level of discrepancies between the sequences Algorithm 166 CodonCode Aligner User Manual Maximum Unaligned End Overlap This parameter is only effective when the Local Alignments algorithm is used After doing an alignment Aligner looks at the
183. k Start Alignment Location and Mark End Alignment Location If you use one of these option to extend the aligned region of a sample you will have to introduce any gaps required for proper alignment by hand If you import Phrap assemblies please note that unaligned regions of samples may extend beyond the ends of a contig on both sides the start and the end Alignment Locations Start and End 121 Reverse Complementing To reverse complement a sample or contig Go to the project view e Selec the contig or a sample in the Unassembled Samples folder Choose Reverse Complement from the Edit menu In most views you will be able to identify samples that have been reverse complemented by the prefix before the name and by the fact that the name is drawn in red In the project view you can identify reverse complemented samples by the icon it has red rather than black borders Reverse complementing of unassembled samples is possible but usually not necessary since samples will be reverse complemented as needed during assembly and alignment You cannot reverse complement samples in contigs directly since that would destroy the alignment to the consensus If you select Reverse Complement when a contig view is in the foreground the entire contig will we reverse complemented Reverse Complementing 122 Splitting Contigs Like other assemblers that use a greedy assembly algoritm CodonCode Aligner will occasion
184. know the computer name or the IP address for the license server computer you can enter it here if you do not know the name or IP address ask your local system administrator Firewall ports for License Server use If Aligner cannot connect to the License Server it may be because Aligner License Server is not running or because a firewall is blocking the network traffic between your computer and the license server computer Please make sure that the License Server is running and to allow communication on the following UDP and TCP ports 16030 16031 32156 32157 54643 and 54644 License Server Licenses 6 CodonCode Aligner Features CodonCode Aligner is a versatile powerful and easy to use DNA and RNA sequence assembler aligner and editor Aligner imports a wide variety of sample file types into projects Aligner projects are collections of sample files and their resulting alignments or contigs Aligner works best with sequences that have chromatograms and quality scores for example from SCF files generated with PHRED or ABI files that were base called with the KB base caller However you can also import text sequences without chromatograms and trace sequences without quality scores for example older ABI files or ABI files analysed with the ABI base caller Aligner protects your original sequence data by making copies of the original sample data when files are imported When you make edits in Aligner you change only the copied
185. l NOT be saved After clicking OK in this dialog and then also in the Preferences dialog the shared preferences will be used Note that each user can still change settings while Aligner is running however such changes will not be saved when Aligner quits To change back to separate preferences a user can select the Default location button Preference Options 206 Printing Preferences The Printing Preferences allows you to determine how different windows will be printed To see the printing preferences select Preferences from the Edit menu on Windows repectively the CodonCode Aligner menu on OS X On the left side of the preference dialog click on Printing your dialog should now look like this Preferences r Printing Base calling r Trace view Base colors What to print Entire traces Consensus method Double clicking Vertical trace scaling Scale each panel to highest peak He End clipping Features _ Fit traces on one page Highlighting License Server Memory V Show trace view options before printing Mutations f Print trimmed ends Open amp save r Contig view Phrap assembly a Preference options Page layout Normal m Paster Protein translation Font size 10 4 point Sample names Startup Vector trimming V Print bases in groups of 5 Es bases Include colors and highlighting vi Print unaligned ends Window placement i Des
186. le names can contain spaces accented characters and so on However if your sample have funny characters like accents or umlaute keep this in mind e The names may not be drawn correctly in all views due to minor bugs in Java On Windows importing a folder of samples with special characters in their names may not work Aligner may report that it cannot find some of the samples Similar adding samples to a project by drag and drop may not work if the sample name contains unusual characters However you should always be able to add samples using Import gt Add Samples e When exporting samples Aligner may replace unusual characters in the sample names with underscores Some files contain the sample name in the file e g FASTA files When this is the case the name specified in the file is used as the Aligner sample name When a file contains multiple samples the sample names must be specified in the file Within a project sample names must be unique If a sample name in a file already exists in the project the new sample is renamed so that the sample name is unique Samples are renamed by appending an underscore and a unique number e g name 1 To rename samples you can use the Sample Information dialog Alternatively you can first select the sample in the project view and then clicking on the sample name again similar to the way you would rename files in Finder windows on OS X or Explorer windows on Windows Scr
187. led terminators but check with the supplier of your sequences or sequencing kits if in doubt The third column contains details about which class of fluorescent dyes was used Most current chemistries from ABI are big dye while chemistries from Amersham Pharmacia are typically energy transfer The fourth column lists the kind of DNA sequencer used If you cannot find an exact match use the machine that is most similar to your machine For example if you are using PHRED version 0 020425 c use ABI 3700 for data from ABI 3730 and ABI3730XL sequencers and use ABI 3100 for data from ABI 310 sequencers You can also add new entries by pressing the Add button but that should usually not be necessary After verifying the new entries press the Save button to save your changes f you press Cancel your changes will not be saved and you will most likely see the Missing entries error described below You could also use a text editor to edit the Phred parameter file but unless you really know what you are doing we strongly suggest that you use Aligner s build in editor instead as described above You can also check and edit the Phred parameter file by pressing the button labeled Edit in the Base Calling Preferences Base calling problems When using Phred for base calling a number of things can go wrong This section describes the most common problems and how to solve them e Cannot find the base calling program
188. les in the contig is shown by arrows e Unaligned dangling ends of reads are shown in a light gray color in projects where ends were clipped before assembly samples will typically have no or just short unaligned ends A vertical blue line shows the current cursor position in the contig The currently selected sample or samples are drawn in a ligher color in the example the second read is selected Moving the mouse over an arrow will display the name of a read after a little while You can click in the overview panel to move around in a contig as explained in the next section Navigating using the overview panel You can click in the overview panel to move the cursor If you click on an arrow the corresponding read will be selected and selected read and base will be shown in the lower aligned bases panel If you click somewhere else in the white spaces the corresponding consensus bases will be selected you may have to use the vertical scroll bar to see bases for aligned reads at this location Contig View Window 152 CodonCode Aligner User Manual Moving Around You can move around in the aligned bases panel by using the scoll bar at the bottom or by using the keyboard When moving around in a contig view the gray rectangle moves indicating that a different part of the contig is shown but the blue line for the cursor position does not change until you also click on a base in the aligned base panel Using the keyboa
189. license that includes license permissions for the workstation version of PHRED CodonCode Aligner customers at academic and non profit institutions can use the workstation version of PHRED free of charge customers at for profit institutions need to purchase a separate license to for the workstation version of PHRED Using your own copy of PHRED If you already have a licensed copy of PHRED installed on the computer that you are using Aligner on you can use this copy for base calling First though you will need to tell Aligner where your copy of PHRED is installed you can do this in the base calling preferences Academic users who want to use their own copy of PHRED can obtain the source code for PHRED free of charge directly from the authors with certain usage restrictions please check www phrap org for details Base Calling with PHRED 29 CodonCode Aligner User Manual Users at for profit organizations need to purchase a license for PHRED Please check www phrap com for information about purchasing PHRED licenses from CodonCode What Aligner does In short all that happens is that the base calls in the samples will be replaced with PHRED base calls and PHRED s base specific quality scores But if you really want to know the details here is what happens when you start base calling in Aligner 1 Aligner will first create two temporary directories These are created in the system s default temporary directory for example in tmp
190. ligner User Manual Choose Other Color FIRES EERE E IEEE E CIE E PIRI E E B EIEEIBEEBEN E IN 5 TITI Eem ELIT TEN m INN ee ae ee JENNI TETTE COS E mj z M N fa El TITTTISIBINI ITITISBEE Beeps ees eee M a a T mmieie s ttt mamm tt I IESU I JEISISISIUNUN T T TCIEISISISINUM T TICIEISISIBINUM messi IESU IEEE mamm S S mamm tt S mamm y m E TT a a TITTTIEBINE EEEEE E ox 3 f Cancel Reset Select the new color then press OK to use this color or Cancel Preview Sample Text Sample Text Sample Text Sample Text 183 Base specific colors Consensus Preferences The consensus preferences allow you to specify how the contig consensus sequences are calculated Preferences r Quality based consensus determination v Use quality based consensus whenever possible Base calling Base colors u Subtract quality scores of mismatches onsensus method Ignore C Subtract Double clicking End clipping Default qualities for Features Highlighting Low quality edits 10 E License Server High quality edits 30 HA Align to reference sequence consensus determination Open amp save Phrap assembly Preference options rExternal Consensus Printing Protein translation Conserve external consensus Sample names e Startup 7 Rebuild ex
191. ling errors txt for error messages and warning and Basecalling output txt for regular output typically the names of the files processed 7 Aligner will then rename the samples that were base called move them to the trash and read the base calls from the new SCF files that PHRED has just created 8 Finally Aligner will delete all the temporary files it and PHRED have created The temporary directories will be deleted when you exit Aligner If anything went wrong Aligner will leave the samples as they were you will first need to correct the problem and try to do the base calling again The next section describes some of the most common problems and their solutions Editing the PHRED parameter file The first time you try to base call your own data with PHRED you will probably need to add entries to the Phred parameter file PHRED uses this file to determine which sequencing chemistry dye type and sequencing machine was used to generate each individual sequence PHRED does that by trying to match a primer ID string that is hidden in your chromatogram files with entries in the Phred parameter file Since sequencing vendors often come out with slightly changed chemistries that have a new primer ID string chances are that you have to add one or more strings to the Phred parameter file Fortunately CodonCode Aligner makes adding new entries to the Phred parameter file relatively easy by providing a convenient editor for the Phre
192. lity sequence at the ends a process called end clipping or end trimming If you plan to use Aligner s features to detect and process heterozygous insertions and deletions you should search for heterozygous indels before you end clip Otherwise end clipping will probably remove the parts of samples that have heterozygous insertions of deletions and some heterozygous indels may not be detected But if you first search for heterozygous indels end clipping will leave the parts of sequences that have heterozygous indel tags unclipped To end clip a set of sequences do the following 1 Select the sequences to be clipped in the project window Typically you can just select the Unassembled Samples folder to end clip all samples only unassembled samples can be end clipped Select Clip Ends from the sample menu This will show the Clipping preview window that summarizes the clipping results if you have selected many samples it may take a few seconds for the dialog to show up If the end clipping results look ok to you press the Clip button to apply the calculate clips The low quality bases at the end of each sequences will be removed and any sequences that do not match the minimim quality criteria will be moved to the trash If you would like to change the settings for the end clipping press the Change parameters button instead of the Clip button This will open a new window where you can change the end
193. low these steps 1 Choose the vector library by pressing one of the radio buttons on the top the vector library is a collection of vector sequences in FASTA format It s a good idea to select your own vector sequence file by pressing the Browse button Vector sequence files must be in FASTA format and can contain one or many sequences 2 Choose the vector sequences to screen against in the scroll pane below You can select multiple vector sequences by pressing the shift key while clicking on a vector name or the command or control key for discontinuous selections In general you should select only one or a few vector sequences to screen against 3 Set the search criteria for the stringency and sensitivity you desire The settings shown in the image above will work fine for most projects Vector Trimming Preferences 224 CodonCode Aligner User Manual 4 If you want Aligner to automatically move sequences to the trash if they are too short after vector screening check the check box at the bottom and enter a minimum sequence length for example 100 When Aligner finds a match between a sample sequence and a vector sequence it first looks at the minimum match criteria you defined If the match is not good enough for example because it is too short then it will be ignored Two parameters that need explanation are the Max distance from start and Max distance from end numbers To understand the meaning of these numbers k
194. lustalW CodonCode Aligner does the following 1 Aligner examines your current selection to see if any contigs or samples need to be reverse complemented before alignment and reverse complements these contigs and or samples 2 Aligner generates an input file for ClustalW 3 Aligner starts ClustalW and waits for the alignment to finish During this time a progress dialog is shown Please note that alignments with ClustalW can be slow especially if you align many contigs or samples and if you contigs are large 4 When ClustalW is finished CodonCode Aligner analyzes the output generated by ClustalW and create a new contig from the ClustalW alignment Aligner also calculates a consensus sequence for the alignment Algorithms for comparing contigs ClustalW muscle built in If you do not want to use ClustalW to generate contigs of contigs you have two alternative options to use either the program muscle or CodonCode Aligner s built in assembly algorithm to form contigs of contigs To do this click on the Algorithm panel in the Assemble With Options dialog and select the Use muscle or Use built in algorithm button in the middle of the dialog You dialog should now look like Compare contigs to each other 51 CodonCode Aligner User Manual this e ee Assemble With Options Contigs Preprocess Algorithm rFor Unassemble existing contigs Use built in assembly algorithm f Use PHRAP
195. m black H4 Features c Highlighting C s License Server options N s Memory Mutations _ Show traces on black background Open amp save Background colors Phrap assembly Preference options fe Quality based 3 colors Printing O Quality based continuous scale Protein translation By nucleotide ignore quality Sample names A R Startup Select your main color scheme specify details below Vector trimming r Background color details 3 colors Views La tf reen Hel Warnings Low quality from 0 to 19 g Window placement Medium quality from 20 to 29 medium green HJ High quality 30 and higher in white H4 Description The base colors preferences control the colors used for drawing traces If By nucleotide is selected bases are drawn the same color as their trace colored bases use the same background color as traces Cancel Eri c a E n a At the top you can set the colors used to draw the traces and if you are using the By nucleotide color scheme for the bases Usually traces will be shown on a white background If you prefer to see traces on a black background make sure the checkbox Show traces on black background is selected In the middle the Background color scheme panel allows you to choose one of three basic color schemes 1 three different background colors for low medium and high quality bases similar to Sequencher 2 continu
196. mes to group samples please see the Assemble in groups help page Align to reference from scratch 63 CodonCode Aligner User Manual Pre process One step processing In addition to the different assembly choices described above Align with Options also lets you automate common pre processing steps like end clipping and vector trimming To set your pre processing choices click on the Preprocess tab eoo Align With Options vi Pre process unassembled samples vi Base call samples without qualities _ Find heterozygous indels v Clip ends v Trim vector This panel lets you choose how Aligner should ipre process any unassembled samples before alignment Note that your pre processing choices are not applied to samples that are already in contigs Help Cancel The checkbox at the top determines whether or now your samples will be pre processed before assembly the four lower check boxes let you pick the pre processing steps that will be done The choices are Base call samples without qualities Any samples that have chromatograms but no base specific quality scores will be base called with PHRED To use this option you will need either a trial license or a purchased license base calling is not enabled in demo mode Additional information about base calling can be found at the Base calling help page Please note that one important difference to the normal Call bases menu choice in automated pre pr
197. mple MacClade Edit the alignment but limit your edits to moving gaps Export the edited alignment in NBRF PIR format with gaps Open the NBRF PIR file in CodonCode Aligner using drag and drop or File gt Open Sample You should see the following dialog NYDN Rountrip Editing 126 CodonCode Aligner User Manual eoo Update Existing Contig The samples you are trying to import are part of a contig Do you want to update the contig from the imported samples or add a new contig to the project e oS Do not show this warning again Add Click on Update Aligner will import the sequences and update the existing contig to reflect your edits Limitations Currently this Roundtrip Editing functionality is limited You can move gaps around in external editing programs but you cannot change or delete any bases Here is a list of additional restrictions Updating existing contigs will work only when importing files in NBRF PIR format All sequences in the file must be exactly the same length including leading and trailing gaps note that some programs e g BioEdit may not always make sequences of equal length when exporting in NBRF PIR format e The names of the samples in the imported file must be identical to or sufficiently similar to the names already in the project Note that some programs do not allow spaces dashes and other characters in sequence names and that many programs and
198. mstances this is what you can do False positives If you think that a base is not mutated you can change the tag to a false positive tag The fastest way to do this is by using the popup menu from the trace view or contig view Right click OS X control click on the base with the wrong tag and then choose Mark heterozygoteAC as False Positive from the popup menu If you did click on a base with a mutation tag this will be the second item in the popup menu The actual text will differ a bit depending on the original classification False positive tags get preserved when you re do the mutation detection Wrong classifications If a base is mutated but Aligners classification is incorrect you can change the tag in a two step process First bring up the tag information dialog as described just above right click resp control click on the base select Show tag from the popup menu In the tag dialog click on the Change button This will bring up another dialog where you can choose the correct tag from a pulldown menu This allows you to for example change a tag from heterozygote CT to homozygoteCC When you change a tag this way Aligner will update the notation that shows the amino acid effect in the Notes section of the tag unless you have annotated a coding region and the mutation is in a non coding section of you sample Missed mutations If Aligner missed a mutation you can manually add a tag that describes the
199. n This will bring up a preview dialog e00 Name parts preview Clone Direction EGFR exon19 JM EGFR_exon19 JJM EGFR_exon19 NWS EGFR_exon19 NWS EGFR_exon19 XHS EGFR_exon19 XHS EGFR_exon20 JJM EGFR_exon20 NWS EGFR_exon20 XHS EGFR exon20 XHS The default name scheme is clearly not a good one for these clones It seems that the name starts with the name of the gene EGFR followed by the name of the exon and a sample or patient identifier If we change the name parts definition to look like this Defining sample names 216 r eoo Alignment Assembly Base calling Base colors Consensus method Double clicking End clipping Features Highlighting Memory Mutations Open amp save Phrap assembly Preference options Printing Protein translation Startup Vector trimming Views Warnings Window placement Description The sample names preferences allow you to define how Aligner interprets sample names You can define different meanings for parts of sample names and then use these name parts to assemble samples in groups based on their names CodonCode Aligner User Manual Preferences rDefine sample name parts Exon M f dash H Patient period Hy Direction le plus HJ Meaning Delimier Gene M _ underscore A Add name part Define delimiters Cancel and then press Preview again we get Defining sample names 217 C
200. n please read the Sample Information Dialog help page Saving Edits 113 Undo and Redo In the current version of Aligner only limited support for undoing and re doing is provided Most actions for example adding samples assembling unassembling endclipping and vector screening cannot be undone Therefore please save your project frequently You can however undo simple edits Just choose Undo from the Edit menu to undo an edit and restore the sequence to the state it was before the edit If you change your mind you can choose Redo from the Edit menu to re do the edit that you just undid If you did anything else that is not undoable Undo from the Edit menu will be not available grayed out We plan to add Undo and Redo support for more actions in future Aligner releases If undo support for a particular feature is important to you please let us know about it Undo and Redo 114 Copy and Paste Copy selected sequence If your current selection is a single sample or contig or part of a single sample you can copy sequences and parts of sequences by selecting Copy selected sequence in the Edit menu If the active window is a trace view base view or contig view then the currently selected bases will be copied to the clip board If the currently active window is the project view and a single sample is selected then the entire sequence of this sample will be copied to the clip board If you have sele
201. n Demo mode The first time that you use CodonCode Aligner you will automatically receive a time limited trial which will enable you to use all functions for 30 days When you are ready to purchase a license you can choose between single user licenses and license server licenses All license keys other than the demo key are specific to a given computer and will not work if transferred to a different computer Certain changes on your computer for example installing a new operating system or replacing a system hard disk may also invalidate your license so that you will need to request a new license key Demo Mode In Demo mode CodonCode Aligner works as a fully functional trace viewer and editor you can open view edit and print unassembled sequences You can also save projects that contain only unassembled sequences unless you have processed any of the sequences with Aligner s functions for end clipping base calling sequence assembly and so on Aligner will warn you before doing anything that will disable saving and printing You can also open existing Aligner projects in demo mode for example the projects in the Example Files folder inside the CodonCode Aligner folder However if an opened project contains any contigs you will not be able to save import export or print in demo mode The demo mode also allows you to test most of Aligner s advanced functions with the following exceptions Base calling with Phred
202. n consensus you would have to look at all four regions and edit three or four times to come to the same end result Also note that Aligner uses the quality scores to estimate how likely it is that the consensus quality is correct this can be done with rather good accuracy since the quality scores are linked to error probabilities In the region shown above the estimated consensus quality is very high since one of the two sequences is of very high quality through the entire region When editing contigs with Aligner you can define quality thresholds for the consensus sequence in the Feature preferences and use this to very quickly move to regions that need your attention To build a quality based consensus two prerequisited need to be met 1 The sequences must have base specific quality scores if you import sequence trace files that do not have quality scores you should first do the Base calling with Phred to get quality scores 2 You must have selected to build a quality based consensus in the Consensus preferences this is the default setting when you install Aligner In addition to the quality based consensus there are two other factors that enable you to get cleaner assemblies with much less need for contig editing are The ability to automatically clip low quality sequence from the end of reads thereby reducing the total number of discrepancies The use of local alignments as opposed to end to end alignments region
203. n lets you choose how CodonCode Aligner compares sequences during assembly with the following options Local alignments When this algorithm is used Aligner uses local alignments this method is also used when assembling using Phrap This means the start and the end of sequences is not necessarily included in the alignment the alignments stop when the alignment score would not improve anymore This can be due to for example too many discrepancies or unremoved vector sequences The resulting unaligned dangling ends are shown on gray background in the contig view base view and trace view This was the default algorithm for CodonCode Aligner version 1 6 3 and older e Large gap alignments This algorithm is typically used when aligning cDNA to genomic DNA It allows for large gaps in between alignments without penalizing the large gaps The large gap algorithm can also be useful when analyzing samples with large insertions or deletions End to end alignment When this algorithm is used alignments always include the entire sequences When using this algorithm it is important that samples have been end clipped and possibly also vector trimmed This is the default algorithm for CodonCode Aligner version 2 0 1 and newer However if you used older versions of CodonCode Aligner before you may need to manually select this algorithm to use it Minimum Percent Identity This is the minimum percentage of identical bases in the aligned re
204. nces help page End Clipping Algorithms This section briefly explains the different end clipping methods algorithms It is intended for the curious you do not necessarily need to understand the end clipping algorithms to use them All methods use the base specific quality scores to find the low quality regions For the end clipping to work correctly the quality scores have to be reasonably accurate however they do not have to be perfect Method 1 Maximizing regions with error rates below a given threshold First the quality scores at each base call are converted into estimated error rates The quality scores are on a logarithmic scale a quality of 10 corresponds to a 10 error rate a score of 20 to 1 30 to 0 1 and so on Next Aligner finds the longest region in the sequence where the following conditions are met the average error rate over the entire region is below the user defined threshold e if the region would be expanded on either side then the added sections would have an error rate that is above the threshold The region found by this method can contain some lower quality parts in the middle where the estimated error rate is above the threshold However such regions will only be included if they are followed by a region that has a lower error rate which drops the combined error rate over both regions below the threshold Individual bases and short regions outside of the good region may also have error rates b
205. nces during alignment with the following options Local alignments When this algorithm is used Aligner uses local alignments This means the start and the end of sequences is not necessarily included in the alignment the alignments stop when the alignment score would not improve anymore This can be due to for example too many discrepancies or unremoved vector sequences The resulting unaligned dangling ends are shown on gray background in the contig view base view and trace view This was the default algorithm for CodonCode Aligner version 1 6 3 and older e Large gap alignments This algorithm is typically used when aligning cDNA to genomic DNA It allows for large gaps in between alignments without penalizing the large gaps The large gap algorithm can also be useful when analyzing samples with large insertions or deletions End to end alignment When this algorithm is used alignments always include the entire sequences this method is the default algorithm in other programs for example Sequencher When using this algorithm it is important that samples have been end clipped and vector trimmed This is the default algorithm for CodonCode Aligner version 2 0 1 and newer However if you used older versions of CodonCode Aligner before you may need to manually select this algorithm to use it Minimum Percent Identity This is the minimum percentage of identical bases in the aligned region The default parameter of 80 is relat
206. nd e Splitting will work only for heterozygous indels up to about 25 bases and only if the indel is in a region where peaks are reasonably well separated For other indels the sample traces that result from the splitting will typically have missing peaks or lots of double peaks The separated pseudo alleles are currently only intended for indel size estimates and manual verification Specifically any differences in peaks between the shorter and the longer allele after the indel site may or may not be real even real differences may be attributed to the wrong allele Processing Heterozygous Indels To analyze process heterozygous indels in Aligner the samples to be analyzed need to have a heterozygoteIndel tag These tags can be added by CodonCode Aligner or manually as described in the preceding section In addition the sample to be analyzed and the corresponding wild type trace must be in the same contig before heterozygous indels can be processed since CodonCode Aligner uses the alignment information when subtracting the wild type trace To illustrate the entire process of analyzing heterozygous indels let us process the Hetero indel example project that comes with CodonCode Aligner False Negatives 90 CodonCode Aligner User Manual Open the Hetero_indel example project in the Example Files directory inside the directory where you installed CodonCode Aligner e Select the sample named heterozygous indel
207. nderscores or periods Let is look at an example sample name EGFR_exon19_JJM_F abi If consists of e The gene name EGFR e The exon exon19 A patient identifier JJM e The direction F for forward The file type extension abi Most name parts are separated by underscores except for the last two parts which are separated by a period Obviously sample naming conventions will be different for different projects so you will need to tell Aligner how to interpret parse sample names You can do this in the Sample names preferences or by clicking on the Define Groups button in the Assemble with Options dialog For the example above the definition would look like this Assemble in groups 53 CodonCode Aligner User Manual eoo Sample Name Options i r Define sample name parts Exo A f underscore Delete Add name part Define delimiters Note that the last delimiter in this example does not matter since the last part of the sample name is the file type To verify that you name part definition is correct you can press the Preview button this will show the parsing of the currently selected samples in a separate window e00 Name parts preview Gene Exon Patient Direction File type EGFR exon19 JJM F abi EGFR JM EGFR_exon19_JJM_R abi EGFR exonl9 EGFR exonlg EGFR exonl9 EGFR exon20 EGFR exon20 After defining the name scheme you can c
208. ndicated whether a contigs is an alignment to a references sequence as in the image above or a regular assembly Please note that contig names and remarks as well as tags added to a consensus sequence will change or get lost when you later unassemble the contig or merge it with other contigs or unassembled reads Editing Contig Information 128 Search for Sequences Aligner allows you to look for short sequences within your samples and contigs First select the sample or contig that you want to look in and open a base view trace view or contig view for it Then selected Search Sequence from the Go menu This will display the following dialog r x e Search For Sequence Sequence to find Start searching from the beginning f from the cursor f Cancel You type the sequence to find in the text box at the top and then press the OK button The sequence you can look for may contain the four bases A G C and T as well as ambiguity codes gaps are ignored If you search for ambiguity codes note that you will get a match only if the ambiguity code is found for example AGTN will match AGTN but not AGTC If Aligner finds your search string it will position the cursor to the first occurence if Aligner cannot find the sequence it will tell you so If you started the search from a contig window the dialog will be slightly different x e Search For Sequence Sequence
209. ned ends Description The highlighting preferences control the base highlighting By default Aligner will highlight discrepancies and ambiguities by using a different background or foreground color depending on the color scheme and settings edited bases by underlining the base call and tags by a colored box that covers the bottom of the base An example is shown below Highlighting Preferences 192 CodonCode Aligner User Manual e880 Contig1 Pos 250 Len 4 Here discrepant bases the two T s near the middle are shown in red The lower case T in sample va 16 x was edited as shown by the underline The C s in the center have two different kinds of tags as shown by the pink and blue boxes You can change these settings for each of the four categories by choosing an option in the pulldown menu next to it Changes will take effect when you press OK Highlighting Preferences 193 License Server Preferences The License Server preferences allow you set whether CodonCode Aligner should use Aligner License Server and the name or address of the License Server computer used Most users will not need to use this preference panel since CodonCode Aligner can automatically find a local License Server to use when starting up Preferences rLicense Server M Use License Server Base colors Consensus method Double clicking 10 0 0 103 End clipping Features Name or IP address of License Serve
210. ner may include time limited trial versions of Phred Any use of such trial versions of subject to the license agreements displayed when you installed Aligner or Phred In particular you may not use the time limited trial versions for any commercial purposes Please note that Phred is a command line program not a typical Windows or Mac OS X application This makes it easy to run Phred through scripts or from programs like CodonCode Aligner but it means you cannot simple double click on Phred and expect to see a graphical user interface You can read the original documentation for Phred at http www codoncode com support phred doc html and more about Phred in the following two articles B Ewing B L Hillier L M C Wendl and P Green Base calling of automated sequencer traces using Phred I Accuracy assessment Genome Research 8 175 85 Available online at http www genome org content vol8 issue3 More about the Phred parameter file 36 CodonCode Aligner User Manual B Ewing and P Green 1998 Base Calling of Automated Sequencer Traces Using Phred II Error Probabilities Genome Research 8 186 198 Available online at http www genome org content vol8 issue3 About Phred 37 End Clipping Typically sequence chromatograms have low quality sequence at the beginning and at the end of the sequence If you have sequence traces with quality values you can use the quality values to automatically remove the low qua
211. newer version is available or if there are any problems during the update check If your version is current which should be the case most of the time you start Aligner you will not be notified Updates may be free or charge or they may require the payment of additional license fees depending on when you purchased your Aligner license and the terms of your license Visiting the Aligner Web Site You can visit the Aligner web site by selecting Aligner Web Site from the Help menu This will open a browser window and point it to the CodonCode Aligner web site the starting point for downloading updates requesting trial licenses and the latest Aligner news The address of the Aligner web site is http www codoncode com aligner Checking for Aligner Updates 238
212. ng Aligner displays a warning and stops here Aligner exports the selected samples to a single sequence text file in FASTA format and the corresponding qualities to a similar text file If you selected any contig then the samples in the contigs will be exported not the contig sequence since Phrap assumes that you always assemble from scratch The exported sequences will be without gaps Aligner now starts Phrap in a separate process telling Phrap the name and location of the input files that were created in the previous step Aligner waits until Phrap is finished with the assembly Aligner will display a progress dialog but since it cannot be predicted how long Phrap assemblies will take the progress window does not really indicate how far along the assembly is When Phrap is finished Aligner will read the Phrap result file the ace file and update the project based on the Phrap results Any samples in your initial selection that Phrap did not include in contigs will be in the Unassembled Samples folder How Aligner assembles using Phrap 58 CodonCode Aligner User Manual Please note that CodonCode Aligner is currently limited to projects with several hundred or at most a few thousand samples even though PHRAP can handle much larger assemblies Things to Note for Phrap Assemblies While Phrap typically produces very good assemblies Phrap also sometimes produces results that can be puzzling to the novice Phrap
213. not show tags False Positives Occasionally the indel finding may incorrectly identify artifacts in sequencing traces as heterozygous indels This can happen when the sequence quality suddenly drops dramatically in a sequence for example due to polymerase stutter after poly A runs Also please keep in mind the the heterozygous indel finding is intended only for sequences from genomic PCR You can easily remove incorrect heterozygous indel tags as follows Open a trace view that shows the indel tag the easiest way to do this is to double click on the line describing the indel tag in the report view shown above or in a feature view Right click OS X control click on any base with the indel tag to bring up the popup menu e Select Show local tags from the popup menu to open the tag dialog n the tag dialog select the heterzygousIndel tag then press the Delete button followed by the OK button Splitting Heterozygous Indels You can split heterozygous indels into two new pseudoallele samples as follows e Select the sample s with a heterozygous indel tag Go to the Sample menu and select Split Heterozygous Indels For each sample with a heterozygous indel two new samples will be created in the Unassembled Samples folder CodonCode Aligner will try to separate the traces from the indel site on into a longer and a shorter pseudo allele This often works reasonable well but please keep these limitations in mi
214. nsertion are higher as indicated by the lighter background colors Before getting too excited however please read the next section Processing Heterozygous Indels 92 CodonCode Aligner User Manual Limitations While we believe that CodonCode Aligner s functions for analyzing heterozygous insertions and deletions can be a valuable tool it is important to keep a number of limitations in mind limitations regarding the performance of the algorithms and limitations regarding the interpretation of the results Processing Pre Requisites and Limitations Finding heterozygous indels requires base specific quality scores The algorithm will not work on sequences that do not have quality scores Most testing so far has been done on sequences processed with the base calling program PHRED The analysis will work only in regions of reasonably high quality and not close to the start or end of sequence traces Both the finding and the subtraction step require that sequence quality before the heterozygous indel is reasonably high for example multiple peaks need to be well resolved and the indel cannot be closer than approximately 50 bases to the start or end of the sequence In addition indels in or after long mono or dinucleotide repeats will generally not be found since such repeats often result in polymerase stutter which looks very similar to heterozygous indels Trace subtraction requires a sequence without heterozygous indels If all your s
215. nt settings with your own data to find out which setting works best for you Note that most detection sensitivity settings only apply to samples that have chromatograms for text samples the bases can be analyzed as they are The only exception is the Data quality section low quality sequence at the ends of text sequences will also be ignored if the text sequences have quality scores Marking mutations The section labeled Marking mutations lets you fine tune how CodonCode Aligner marks mutations it finds The main method Aligner uses if to add tags to mutated bases To facilitate analysis with other programs however Aligner can also convert heterozygous mutations to ambiguities e g using R for heterozygous A G and change the case of homozygous mutations to lower case e g changing A to a Aligner will add mutation tags at bases where it finds a putative heterozygous or homozygous mutation except at bases where mutation tags have been edited or confirmed by the user and kept between successive rounds of mutation detection as explained in the next paragraph If you perform mutation finding more than once you should check the Remove existing mutation tags checkbox If this checkbox is checked Aligner will remove existing mutation tags in the samples that you have selected before finding mutations You can either remove only unedited tags or all tags If unedited is selected any tags edited or added by users and not the p
216. nual e00 Define Delimiters r Currently defined delimiters _ underscore period dash plus Delete star dollar space rAdd new delimiters For name parts separated by characters Define new character to separate name parts J For name parts separated by characters Name part is exactly characters long a Add To add a new character delimiter type the character in the text field after Define new character to separate name parts and then press the Add button next to it To use fixed length name parts select the length of your name part in the pulldown meny near the botton and then click the Add button to the right of it Repeat this for different lengths as needed The screen shot below shows an example of several custom defined delimiters e00 Define Delimiters r Currently defined delimiters space the character the character Use exactly 2 characters Use exactly 3 characters characters r Add new delimiters For name parts separated by characters Define new character to separate name parts c For fixed length name parts Name part is exactly 6 HJ characters long After clicking OK you will be able to use the newly defined delimiters in the sample name preferences Defining delimiters 219 Startup Preferences The Startup Preferences allow you to control what happens when you start C
217. nzymes to use for creating the restriction map and how to display the results aml aan A The left side of these preferences contains a list of enzymes This list reflects a set of enzymes that can be chosen on the right side of this view The two radio buttons on the top right side allow you to show either all enzmes or to show only a subset of enzymes in the list on the left side If the Show Subset radio button is selected you can choose your subset using the preferences in the Subsets section You can select a subset by manufacturer In the example above only enzymes from Invitrogen Corporation are shown in the list on the left side You have the option to choose a subset of enzymes by the size of their recognition site Above only 6 base cutters are included in this subset The cut result can also be used to specifiy a specific subset For example you can include only enzymes that generate a 5 overhang in your subset The Include degenerate sites checkbox allows you to in or exclude enzymes that have one or more ambiguities in their recognition site The list of enzymes on the left side updates according to the selection for the subsets You can select or unselect enzymes in the list through the checkboxes in front of the enzymes and by using the Select AII and Select None buttons above the list Selecting Enzymes 212 The enzyme name and recognition sequence for the enzyme currently selected are shown belo
218. o or heterozygous mutations To enable you to quickly find and navigate to your regions of interest CodonCode Aligner allows you to define features You can define a variety of different things as features for example gaps in sample or contigs discrepancies low coverage regions or tags that have been added by programs like PolyPhred After defining features you can view all features in a separate window the feature view quickly move to the next or previous feature in a contig export features to text files for later analysis Defining Features To define feature criteria select Define Features from the Go menu in CodonCode Aligner This will open the preferences dialog with the Features panel selected Regions of Interest Features 73 CodonCode Aligner User Manual Preferences r Features Feature Criteria Regions of Interest Base calling Base colors vi Low quality consensus quality lower than 30 wr Consensus method vi High quality discrepancy quality at least 40 e ppl Low coverage regions nd clipping OT E Cm m 77 C Total coverage less than 3 Rame 7777 Bs 9 Cm Highlighting LL Covered in just one direction License Server O Ignore tags All tags Some tags Memory ax E Mutations Gaps in sample C Any ambiguity Edited bases Open amp save M Gaps in consensus _ Any discrepancy Phrap assembly EET P
219. o delete all bases from the current cursor positon to the start of a contig 1 Select a contig base in the contig view 2 Go to the Contig menu 3 Go to the Delete submenu 4 Select From Contig Start to delete all bases to the start of the contig or select To Contig End to delete all bases to the end of the contig If any samples are completely within the removed contig region these samples will be moved to the trash If the menu items are disabled you probably do not have a contig base selected You may have clicked on a sample accidentally or perhaps a view other than the contig view is in the foreground Note Deleting from the contig start or to the contig end cannot be undone so you may want to save your project first or to save a copy of your project using Save As in the File menu Deleting Parts of Contigs 120 Alignment Locations Start and End During contig building by assembly or alignment Aligner automatically determines the useful parts of reads For each sample regions at the start and end with high levels of discrepancies to other reads will remain unaligned These regions are typically shown dimmed in the contig view Bases in the unaligned regions are not considered when determining the consensus sequence Unaligned regions are not aligned meaning that Aligner will not introduce gaps in unaligned regions You can change the start and end of sample alignments through two menu items in Sample menu Mar
220. o to the project view select the contig and then choose Contig Information from the Contig menu To convert a contig that contains a reference sequence to an aligment you can select the contig in the project view and then select Align with options from the Contig menu in the dialog that follows choose Align to reference from scratch However the resulting contig may be different from the initial contig for example not all reads may have been added some reads may have been moved to the Unassembled Samples folder Local large gap and end to end alignments By default CodonCode Aligner version 2 0 1 and newer will perform end to end alignments Assemblies and alignments generated this way will always end at the end of one sequence not before In contrast to the the local alignment algorithm end to end alignments will never generate dangling unaligned ends When Majority Consensus 71 CodonCode Aligner User Manual using this algorithm samples should always be end clipped and if necessary also vector trimmed When using the Local alignment algorithm Aligner automatically uses the maximum amount of each sequence without requiring end clipping before assembly When using local alignments the alignment only extends as far as the alignment scores improve This means that low quality ends of sequences where high error rates would reduce the alignment score are left unaligned or dangling Unaligned parts of seq
221. o use up to 50 of the build in memory RAM or 384 MB whichever is smaller On Mac OS X CodonCode Aligner the maximum memory available to CodonCode Aligner is limited to a default of 256 MB This is sufficient for projects with several hundred reads You can increase the memory available to Aligner using the memory preferences and may need to do so if working with large projects Please note that the memory available to Aligner should not exceed the amount of installed memory RAM on your computer if you try to assign more memory CodonCode Aligner may not start or behave erratically In addition the memory assigned to Aligner should not exceed about 1200 1400 MB even on computers with several GB of RAM If you are working on a computer with a limited amount of RAM for example 256 MB you may get better performance if you by quitting other open applications and by reducing the amount of memory available to CodonCode Aligner You can always check how much memory CodonCode Aligner is currently using in the memory preferences How Aligner memory on Windows is set On Windows the maximum memory is set in the file CodonCode Aligner ini in the CodonCode Aligner folder If you look at the file in a text editor like NotePad you can find a line that looks like this Virtual Machine Parameters Xms32M Xmx50 64 384P The numbers after Xmx sets the maximum memory available to Aligner The first number 50 limits the memory
222. ocessing samples that already have quality values for example from the ABI KB basecaller or from calling bases on the sample before will not be base called again Find heterozygous indels This option will look for potential heterozygous insertion deletion indel mutations in the unassemble samples that have a chromatograms and b quality scores If you are sequencing PCR products from genomic DNA that may contain heterozygous indels you should check this option if you are sequencing from cloned DNA this option should not be checked For more information please read the Heterozygous insertions and deletions help page Clip ends This will remove low quality sequence from samples that chromatograms and quality scores For more information please read the End clipping help page Trim vector When checked this option will identify and remove vector sequence contamination from the samples in your selection You may need to set your vector trimming preferences before using this option For additional information please read the Vector trimming help page Pre process One step processing 64 CodonCode Aligner User Manual You will see progress dialogs for each of the steps performed after you click the Align button Note that any samples that are already in contigs will not be pre processed Pre process One step processing 65 Contigs Successful assemblies or alignments result in one or more contigs Contigs are named
223. odonCode Aligner Aligner can automatically open the last project you worked on or present dialogs to open existing projects or create a new project or show the Startup Wizard dialog The following picture shows the startup preference dialog Preferences r Startup preferences At startup Base calling Base colors Consensus method Open an existing project Double clicking End clipping Features Show the startup dialog Highlighting License Server Memory Mutations Open amp save Phrap assembly Preference options Printing Protein translation Sample names Open the last project 7 Create a new project O Do nothing Window placement Description The startup preferences control how Aligner starts Help Cancel If you select Do nothing Aligner will start but not open any project or show any dialogs On Windows you will see an empty Aligner window On Mac OS X the only thing you see will be a change in the menu bar Aligner will not open any windows You will need to select Open Project New Project or Open Recent before you can do anything else other than looking at the online help The Startup Dialog If you choose Show the startup dialog the following window will be shown when Aligner starts Startup Preferences 220 CodonCode Aligner User Manual e CodonCode Aligner Startup Aligner Open a recent project O Open an existing
224. odonCode Aligner User Manual Changing the memory requires that CodonCode Aligner restarts Therefore you can not change the memory if a project has been edited you need to save your changes first If your project has unsaved changes this preference panel will be disabled The maximum amount of memory you can set here is determined by the amount of physical memory RAM installed in your computer On OS X Aligner will determine this amount and limit the memory you can set to the installed memory Memory on Windows On Windows memory used by CodonCode Aligner has to be changed by editing the file CodonCode Aligner ini in the folder where CodonCode Aligner is installed 1 2 Navigate to the folder where CodonCode Aligner is installed usually C Program Files CodonCode Aligner Locate the file CodonCode Aligner ini you may not see the extension depending on your settings Create a copy of the file If you are unable to create a copy of the file you likely do not have sufficient permissions to edit this file or folder Please contact your system administrator for assistance Note to Vista users Even if you are using an Administrator account you may not have permission to edit these particular files folders You may still need to adjust permissions to allow these edits Open the original CodonCode Aligner ini in NotePad Look for a line that looks similar to Virtual Machine Parameters Xms32M Xmx50
225. odonCode Aligner User Manual eoo Name parts preview Exon Patient Direction EGFR exon19 J M F jexon19 JJM EGFR_exon19 JJM R exon19 WJM exon19 NWS Jexon19 NWS exonl9 XHS exonl9 XHS EGFR exon20 JJM F exon20 JM GFR_exon20 JJM R exon20 JM exon20 NWS lexon20 NWS exon20 XHS EGFR exon20 XHS R exon20 XHS 4 aA nD Aa Aa DA yin Currently the only time where CodonCode Aligner uses the name part definition is when assembling by group available through Assemble with Options in the Contig menu When assembling by groups Aligner can use any of the name parts you define to groups sample together for forming contigs Aligner will try to assemble only samples that belong to the same group For additional information please read the assemble in groups help Defining delimiters CodonCode Aligner offers two different ways to parse sample names Using delimiters to separate name parts as shown in the example above Using a fixed number of characters for a name part Aligner has several pre defined delimiter characters if you want to use a different character as a delimiter or if you want to use a fixed number of characters click on the Define delimiters button in the sample name preferences or the Sample Name Options dialog from Assemble With Options This will show the following dialog Defining delimiters 218 CodonCode Aligner User Ma
226. odonCode Aligner was installed on OS X the default folder is Applications CodonCode Aligner on Windows the default folder is C Program Files CodonCode Aligner Three files are installed in this vector folder two UniVec files from NCBI and an example custom vector file with some commonly used vector sequences To set up vector trimming you 1 Open the Vector trimming preference panel 2 Select the vector library file to use typically from your own Custom Vector file 3 Select the sequences you want to screen against Using UniVec Library Files UniVec is a database created byt the NCBI where redundant sub sequences from vectors have been removed UniVec also contains sequences for linkers primers and adapters that are commonly used in cloning Two UniVec library files have been installed in your Vector folder inside your settings folder UniVec txt UniVec Core txt For more information about UniVec refer to http www ncbi nIm nih gov V ecScreen UniV ec html http www ncbi nIm nih gov V ecScreen Interpretation html Definitions The typical use of UniVec for vector screening would be to screen against all sequences in UniVec In CodonCode Aligner this is currently not supported it would take a really long time You can select several sequence fragments from UniVec to screen against but typically it s a better idea to use a custom vector file Using Custom Vector Files Custom vector files can contain
227. og Changing Bases 100 CodonCode Aligner User Manual Match consensus The Match consensus option will automatically change bases to match the consensus of the contig they are in it will have no effect on unassembled samples One example where this option is useful are dye blobs in DNA sequences where many bases are wrong because of artificial strong peaks This option is intended for low quality sequence and will not change high quality bases unless you change the settings by clicking on the Options button next to Match consensus This will show the following dialog E Match Consensus Options _ Minimum quality difference 10 i Maximum base quality to edit 29 A Cancel The number at the top is the minimum difference in sequence quality between the consensus and the mismatch base in question The default setting of 10 means that bases will only be edited if the consensus sequence quality is at least 10 higher corresponding to a 90 or higher probability that the edit is correct assuming that this is a random error The number at the bottom determines the highest quality a base can have to be edited with the default setting any base with a quality score of 30 or higher will not be edited Call second peaks higher than The Call second peaks option allows you to convert all bases with a significant secondary peak to ambiguities You can set the threshold of secondary peaks relative
228. ogram file in ABI or SCF format that contains the trace data Opening Single Sample Files To add a single sample to a project select Open from the File menu This will show the standard Open file dialog Select the file that you want to add to your project and click OK The file will be read and the sample s in it will be added to the Unassembled Samples folder Next Aligner will open one or more views for the sample s you just added based on your settings for which views to open when double clicking on a sample in the Double Clicking Preferences Adding Several Sample Files To add samples from a few files to a project select Import gt Add Samples from the File menu This will show an Open file dialog Select the files that you want to add to your project and click OK To select several files in a row click on the first file and then keep the shift key pressed while clicking on the last file To select several files that are not right next to each other keep the control key OS X the command key pressed while clicking on files The screen shot below shows an example of the Import Samples dialog with four selected files Adding Sample Files to Aligner Projects 18 CodonCode Aligner User Manual e 06 Import Samples gt chromat dir 4 ERE oem Network edit dir fa A326 r 3j PB800HD _ gt Examplel proj Gi A333 phd dir A454 s B Desktop A455 s _ Document
229. olyPhred or CodonCode Aligner during steps like end clipping or vector trimming If a sample contains tags you can click on the Tags button to display the tag dialog Viewing Sample Tags 110 CodonCode Aligner User Manual e Tags for va 16 x y Tags Tag Details nc ygoteT Program homozygoteCC Start 197 homozygoteAA heterozygoteAC End 197 dataNeeded Date vas tab Ghee EST 2007 dataNeeded Notes C Confirmed cSt m Cancel Delete You can also see all tags for a sample by selecting the sample in the project view going to the Sample menu and selecting Show All Tags from the Tags sub menu You can select tag on the left to view details about the tag on the right You can change the start and end position of tags and add comments about the tag in the Notes text field You can also delete tags Changes will be saved after you press the OK button Confirming Tags One common use of the tag notes is to mark tags as confirmed after looking at the trace data You could do this by typing Confirmed in the note box or simply by clicking on the Confirmed checkbox Clicking on the checkbox when it is unchecked will add the word Confirmed at the beginning of the text clicking it when is is checked will remove all occurences of the word confirmed from the check box Tip If you find a tag that is wrong you can either delete the tag or you could mark it in the Notes section W
230. on to the end of a sequence To select all bases from the the current cursor position to the end of the sequence choose Select from Here to End from the Edit menu The selection will include any unaligned bases at the end of the sequence up to the cursor position You can accomplish the same thing without having to use the menus by keeping the shift key pressed while pressing the end key Selecting all bases in a sequence To select all bases in a sequence choose Select AII from the Edit menu Alternatively you can use the keyboard shortcut Control A on Windows and Command A on OS X keep the control respectively command key pressed while pressing A The selection will include any unaligned bases at the start and at the end of the sequence If the project view is the active view then Select AII will select all contigs and samples shown in the project view The Unassembled Samples and Trash folders will also be included unless they are empty Selecting Bases 99 Changing Bases Selected bases can be changed To change a single base select the base and type a new base letter Letters for ambiguity codes can also be entered Be careful if more than one base is selected before you start typing all the selected bases will be replaced with a single base which may not be what you want After changing a base Aligner will automatically move the selection one base to the right This allows you to quickly edit
231. onCode Aligner uses a fast banded dynamic programming Smith Waterman algorithm for pairwise alignments in both assembly and alignments By default CodonCode Aligner version 2 0 1 and newer will use end to end alignments however you can instead choose to have large gap or local alignments This section describes how Aligner generates assemblies and alignments to reference sequences Alignment to a Reference Sequence When aligning to a reference sequence the selecteded samples are successively aligned to the reference sequence Alignments that meet the stringency criteria set in the alignment preferences are accepted those that do not meet the minimum criteria are rejected If your selection contains more than one reference sequence Aligner will align each sample to the reference sequence with which is shared the most words typically 8 mers first alignments to other references will be tried only if this alignment is reject Typically this will result in alignments to the reference sequence with the highest similarity however there can be exceptions to this rule When aligning to a reference sequence any sequence parts that extend beyond the ends of the reference sequence are not included in the alignment Assembly For assembling contigs the following simple greedy algorithm is used 1 Find potential overlaps between samples by looking for shared 12 nucleotide words in the sequence 2 Find the pair of samples tha
232. only It has not been verified for any diagnostic or clinical applications Aligner will miss certain mutation and incorrectly classify others False positive and false negative rates depend on the current sensitivity settings but are never expected to be zero All results obtained with Aligner should be checked by a qualified scientist The following is an incomplete list of some known limitations and suggestion Identification of heterozygous point mutations requires sequencing reactions generated from PCR products from heterozygous template DNA e Random peaks in sequence traces may cause mis classifications you can add a dontGenotype tag in such regions so that Aligner will ignore it the next time you choose Find Mutations Aligner relies on peak patterns that are very similar between the different samples in an analysis Any experimental changes including but not limited to the use of different sequencing primers kits enzymes dyes sequencing machines and running conditions may result in peak pattern variations that cause increased error rates The base calls need to be correct in the analyzed regions at heterozygous bases one of the two bases must be called correctly or the correct IUPAC ambiguity code must be used Homozygous bases that have ambiguity base calls are likely to be classified incorrectly Vector sequences in the samples may cause analysis errors How Aligner Finds SNPs 85 CodonCode Aligner User Manu
233. ontig View Window essor E ena N T AY 10 Recone Oi MEE e a Ou eed OD ED ME ES 1d Take the ick POUPT su un S Ee aa UM UAM UR A RUE ER UN NE NE I DELE T Oualitv Values In CoduanCode Alone 8 05 5ccsssesicacesssceusssveccassscenssve vance YE PUMP rO SEE ERN EE Esne SEPO Taeko p E vaot 12 OP ENG Desi ot 4 IOMie scere oo HE RERUM ERO NET ICE er UL Du E ee cena rere rae 12 W herc g alty vanes come EON dE aee pco oie ere edu lp ma etr ve eee e P ta eoii 12 JAtibictal qualite seco ditis A abba tau Md I ela ee a eae 13 Rea UAMUIGS cia m ET 13 DUET NSU NPN m sae Shes ie ese aaa as E E us A E ee ae 13 Additonal RESO ose pista gales pus ce eus Dee Maer et aaa aa pi Cep EE UU Ob pi RE RR RUE 14 Aligner Projetis m C i o eet 15 Working with Aloner Projecis oec roa si pne E NE e EI E EM e uU UN E M ERE MEE A E UEM EE E EE 16 Creatina New PrOIecls ione datacentre EG OA e 16 Opening Existing Projets uso err COE Gui ek DR nia ai ee pees 17 Savine PrO VU E T es a S LS LUE 17 MGs EHE EID ULT E 17 Adding Sample Piles to Aligner Pr jeClu eror t ertt r rrt eee rra po eon Mr RR HP PE CENE Iu Ee nE rea a vp E ERR Urs anu 18 Operum Sinale Sampie bres conso reote Fe RRO ROO COUR T Bar xia Re x AR ITE aoe eRe 18 Adding Severa Sampie FeS eere e rae d skein ba eda eil ko poo qula Pupil tfr Ce nu a d 18 Adding Entire Folders of Sample Pls sioe tert o Hp EE Dae et da boda box saath e Vae EIER HR Bee UNE 19 Adding Entire Assemblies i opo HEREDI ERU ER R RUE E
234. ontigl Contigl 343 343 1 diffs 0 homo 1 hetero 3 not mutated heterozygoteGT Aligner va 23 x Contigl 356 356 Heterozygous 6680 7 G gt T noncoding region polymorphism Aligner Contigl Contigl 356 356 1 diffs 0 homo 1 hetero 3 not mutated codingSequence User Reference Contig 363 375 heterozygotear Aligner va 13 x Contigl 371 371 Heterozygous 6688 A gt T Ser3Ser polymorphism Aligner Contigl Contigl 371 371 1 diffs 0 homo 1 hetero 3 not mutated heterozygoteAC Aligner va 16 x Contig 391 391 Heterozygous 6692416 C gt A noncoding reg The corresponding contig view of this region shows the coding sequence regions red boxes the codonStar tag light blue box and the mutations found pink boxes in the samples dark blue boxes in the consensus eo0 Contig1 7 Em Be eae eae ae 3 s GNE CTCTTTCCTGGG TGGRETCAGECTGCTCTTTGCTENETTCC 3 PiBlicc rer TTGETCATTTCC CCTGGAG TGCTCTTTGCTCATTTCC Pos 343 Len Excluding Regions from Analysis You can exclude regions from being analyzed when Aligner finds mutations by adding dontGenotype tags You can add dontGenotype tags to ndividual samples to exclude tagged regions in the sample only The consensus sequence to exclude the tagged region in all samples The reference sequence to exclude the tagged region in all samples if a the analyzed contig is an alignment to the reference sequence and b the reference s
235. or EMBL format that had coding sequence annotation this annotation will be used Otherwise you can add coding sequence tags manually To add a codingSequence tag Open a contig view for the contig you are working with you can also use a base view e Select the first base of your coding sequence in the reference sequence or the consensus sequence Right click OS X control click to show the popup menu and select Add Tag or select Add Tag from the Tag sub menu in the Sample menu Tags for Finding Mutations 80 CodonCode Aligner User Manual This will bring up the Add tag dialog r x e Add tag to Contig1 New Tag Type codingSequence Tag Details Program Use Start 62 End 99999 Date Thu Apr 29 03 05 EDT 2004 Notes Tip If you want the tag to extend to the end of the contig or sample just enter a very large number in the End field C Confirmed Cancel Select codingSequence as the tag type from the pull down menu at the top Then enter the end coordinate of your coding sequence at the bottom you could also select the entire coding sequence before choosing Add Tag When everything looks right press OK If the first base of your coding sequence is NOT the first base of a codon you can also add a codonStart tag the codonStart tag must be within two bases of the codingSequence start though If your reference sequence was originally read from a fil
236. orts The Phylip format allows you to export projects for phylogenetic analysis programs like MacClade or PAUP Only contigs will be exported with a single file being created for each contig Note that the exported files only contain information about the bases and gaps but not about associated chromatograms or sequence qualities You have a choice of exporting in either interleaved or sequential format Different phylogenetic programs have different restrictions on which kind of files they can read so you may need to try both to see which one works for the program you plan to use If you have sample names that are very long and or contain spaces or other unusual characters it may be necessary to truncate or change the name of the samples in the exported files Again different programs have different restrictions If sample names may to be changed in the exported files Aligner will present you with a list of choices on how to change the sample names ACE Format Exports 138 CodonCode Aligner User Manual Other Formats for Exporting Assemblies We plan to add support for other formats in the future If you need a specific format please let us know the format and the program that you need if for Other Formats for Exporting Assemblies 139 Exporting Features In Aligner Features are regions which for one reason or another deserve special attention They can include discrepancies regions of low coverage bases with tags or a num
237. otyping a number of samples where the majority sequence will show the most common allele Using the Reference Sequence as Consensus When you are comparing samples to a known reference sequence you may not be interested in building a consensus sequence you just want to know where your samples differ from the reference Aligner supports this by letting you use the reference sequence as the consensus sequence To use the reference sequence as the consensus sequence 1 In the consensus preferences select Use the reference sequence as the consensus sequence then click OK 2 Create your contig by Align to Reference Sequence not by Assemble or Assemble with Phrap Note that assembled contigs may contain the reference sequence that alone does not mean that the contig is an alignment to a reference sequence Only contigs that were created by Align to Reference Sequence can be alignments Note that if you merge an aligned contig with other contigs by using Assemble or Assemble with Options the contig will change from an alignment to a regular assembled rather than aligned contig however you can add unassembled samples to existing alignments without changing contig to a regular assembled contig Tips for dealing with alignments To find out if a contig is an alignment look at its icon Alignments icons have two vertical lines in the folder Alternatively you can check the contig information dialog To see it g
238. ou can choose which views windows Aligner should open in response to double clicks in Project View If the samples you selected are in contigs you can also choose if Aligner should also open the corresponding contig view or just open the corresponding contig view Double Clicking Preferences 186 End Clipping Preferences The end clipping preferences allow you to specify how Aligner will remove low quality sequence from the ends of samples and to set up minimum quality criteria after end clipping Preferences Base calling Base colors Consensus method End clipping fe Maximize region with error rate below 0 1 Use separate criteria for start and end r Trim from start until Double clickin nd clipping 2 Se v Error rate is below 0 1 ina 25 base window M D ESSERE Features There are fewer than 3 bases with quality Highlighting below 20 ina 25 base window License Server Memory Mutations Open amp save Phrap assembly Preference options below 20 ina 25 base window Printing Protein translation Sample names Startup Vector trimming Trim from end until PE v Error rate is below 0 1 ina 25 base window There are fewer than bases with quality r After end clipping vi Move all sequences shorter than 25 bases to trash v Move all sequences with fewer than 50 f Phred 20 4 bases to trash Description The end clipping preferences control how low
239. ound in the trace view window when the mouse pointer is positioned over a trace moving the scroll up or down will move horizontally to the right or to the left to scale a trace view vertically keep the control key pressed while scrolling with the mouse wheel this has the same effect as using the vertical scroll bar making peaks larger or smaller to scroll between traces if the trace view window contains more traces than currently fit on the screen move the mouse pointer over the vertical slider on the right allows and then use the scroll wheel You can change the default height of trace view panels in the Views preferences To scale the traces horizontally use the slider in the bottom left corner of the trace view Trace Sharpening If you are working with traces where the peaks overlap and are badly resolved CodonCode Aligner s trace sharpening can help you to get a better look at your data Here is an example of a badly resolved region in a sequence eoo Traces from Unassembled Samples how sharpened traces Base 410 of 693 Quality 21 When you click on the little button in the lower right corner CodonCode Aligner will try to sharpen the peaks in the displayed traces the result looks like this Scrolling and Scaling in Trace View 146 CodonCode Aligner User Manual PS Traces from Unassembled Samples A Y a Lo 4 i O jaj EI v9 A454 Base 410 of 693 Quality 21 In this example it
240. ous background colors that depend on the base quality with darker backgrounds for low qualities and lighter backgrounds for higher quality similar to Consed 3 colors that vary by base and ignore base quality Base Color Preferences 176 Switching color schemes CodonCode Aligner User Manual A quick way to switch between color schemes is to go to the View menu and select Switch Color Schemes This will switch between the different color schemes in the following order 1 Quality based 3 color scheme 2 Quality based continuous scheme 3 Base specific background colors 4 Base specific foreground colors Then the circle starts over again after base specific foreground colors comes the quality base 3 color scheme again Instead of using the menus you can also use the corresponding toolbar button if it is not showing change the toolbar settings in the Toolbar Preferences The View menu and the corresponding toolbar icon provide a fast way to switch between the color schemes For full control for example to change colors or threshold use the Base Color preferences Quality based 3 color scheme The picture above shows the settings for the 3 color scheme In this scheme the background behind the bases is shown in different colors for low quality bases medium quality bases and High quality bases You can set the ranges for low and high quality bases with medium quality being the range in between by changing th
241. ow the protein translation depending on how your preferences are set In the example above the translation for one frame is show you can choose to show no translation one frame three frames or six frames in the protein translation preferences and in the View menu The cursor position is indicated by a black line and the currently selected base or bases by a different background color in the example above by black background You can use the the cursor keys and the horizontal scroll bar at the bottom to move around in a contig You can resize the panels by dragging the bar between the panels The bases are displayed according to your color preferences In the picture above a quality based three color scheme was used The names of the samples are shown on the left side of the aligned bases panel Reverse complemented samples are indicated by before the name and by red sample names You can select samples by clicking on the sample Moving Around 153 CodonCode Aligner User Manual Masking Bases Matching the Consensus One way to focus on bases that differ from the consensus sequence is by going to the View menu and selecting Mask Bases Matching Consensus If checked any bases in aligned regions that are identical to the consensus sequences are replaced by dots only bases that differ from the consensus sequence and the consensus sequence itself are shown as letters Here is an example eoe Contigi amp N F EE o 7
242. ozygous indels this example may appear trivial after all we could determine the mutation quickly by looking at the original trace However CodonCode Aligner s algorithm will work as well even for large insertions or deletions which otherwise can be very hard to analyze There are of course some limitations which are described below Finding Heterozygous Indels CodonCode Aligner s Find Heterozygous Indel function analyses sequence chromatograms for characteristics that are typical for heterozygous insertions and deletions In traces where Aligner finds a putative heterozygous indel Aligner add a tag that extends from the start of the putative indel to the end of the sequence To find heterozygous indels do the following e Select the traces you want to analyze in the project view Traces can be unassembled or in contigs but must have base specific quality scores run base calling with Phred first if needed Heterozygous indel detection works best if the samples have not been end clipped End clipping will typically remove the parts of sequences that have heterozygous indels Whilw Aligner tries to compensate for this the detection rate for samples that have not been endclipped is slightly higher that for endclipped samples f your samples have been end clipped you can simply re do the base calling to get end to end sequences Go to the Sample menu and select Find Heterozygous Indels Aligner will show a progress bar w
243. played across all samples and the consensus Moving to Features Ambiguities Mismatches or Edited Bases The Go menu has selections for quickly moving through the sequence Next or Previous Feature Moves the the next or previous feature or region of interest Features can be discrepancies low quality consensus bases low coverage regions or a number of other things that may be of interest to you You can define your regions of interested in the feature preferences Tip the fastest way to navigate to the next or previous feature is by using the keyboard shortcuts On Windows use Control Right Arrow and Control Left Arrow on OS X use Command Right Arrow and Command Left Arrow Next or Previous High Quality Mismatch Moves the the next or previous high quality base that disagrees with the consensus Next or Previous Low Quality Consensus Moves the the next or previous place where the consensus quality is low Next or Previous Ambiguity Selects the next or previous ambiguity in the selected sample or consensus Next or Previous Mismatch Moves the cursor to the next or previous mismatch the selected contig Next or Previous Edited Base Selects the next or previous edited base in the selected sample Base Number Displays a dialog where you specify a specific base number in the selected sample or consensus First Aligned Base Moves the cursor to the first aligned base in the current sample Last Aligned Base Moves th
244. preferences control which vectors are used to screen against what the minimum match criteria are and how far vector matches can be from the ends of sequences On the left side you choose which specific preferences you want to edit In the image above Vector trimming is selected The right side changes according to the selection on the left side You can edit your settings on the left Any changes you made are only saved when you press OK or hit the return key If you click Cancel or press the escape key no changes to the settings will be made If you make any invalid entries in one of the fields Aligner will show a warning that indicates the problem and reset the field to the previous value Preferences and Settings 163 CodonCode Aligner User Manual By default the Preferences are specific for each user However Aligner offers the option to share preferences between different users detailed instructions are available on the Preference options help page Preferences and Settings 164 Alignment Preferences You can specify parameters for alignments to reference sequences in the Alignment Preferences eoo Preferences Alignment UPR n M Assembly f Base caling cepe End to end alignments ae od Min percent identity 80 0 E Double clicking Min overlap length 30 c End clipping Features Min score 20 ri Highlighting Max unaligned end overlap 90 0
245. project Users peter Documents Projects test1 Nc JUsers peter Documents Projects poly2 4 Sole aT PECs Users peter Documents Projects std23 No longer show this dialog f Cancel ox J This allows you to quickly open one of the projects you worked on recently or to open another project or to create a new project Note The first time you start CodonCode Aligner the list of recent projects will be empty The list will also be empty when you clear the recent project list by choosing Clear Menu in the Open Recent submenu in the File menu The currently open project and any projects that are currently unavailable will be unavailable grayed out in the Open Recent menu The Startup Dialog 221 Toolbar Preferences The toolbar preferences allow you to customize toolbars for the different views in CodonCode Aligner Preferences Base calling Base colors Consensus method Double clicking End clipping Features Highlighting License Server Memory Mutations Open amp save Phrap assembly Preference options Printing Protein translation Restriction maps Window placement r Toolbar preferences r Show toolbars Show toolbars Hide toolbars r Button style Show buttons as icons 3 Show text buttons Show icons and text rRestore defaults Defaults icons only Defaults icons amp text rButtons to show f Project view E v Save Project As
246. protein translation Trace Window 10 CodonCode Aligner User Manual Contigl D 1 i EE Ban djs74 1432 djs74 1180 5s1 djs74 2350 s1 djs74 2689 s1 lt lt djs74 1802 lt lt djs74 1532 XXXXXXXXXXXXXXXXXXXXXXXX IKXEXXXXEKX OXXXXXXXX x ee ee CTCACCTCCTCCACAAAAAAAGAACAAAAATACTAAGTAGATGATCA CTCACCTCCTCCACAAAAAAAGAACAAAAATACTAAGTAGATGATCA ACTCACCTCCTCCACAAAAAAAGAR ita ACTCACCTCCTCCACAAAAAAAGA ACTCACCTCCTCCACAAAAAAAGAI lt lt djs74 237 4 djs74 996 s2 dis 4 690 x1 Translation Pos 891Len 2 You can edit sequences directly in the contig window or select samples and then open trace base or quality windows for the sample You can also set if and how the protein translation is shown using the Protein translation sub menu in the View menu Regions of Interest One concept in CodonCode Aligner that deserves a closer look is the ability to define regions of interest more often called features Aligner lets you define what is of interest to you for example low quality consensus regions discrepancies mutation tags and so on You can then use this definition to get an overview of all the features in a contig or the entire project in a feature view window or to quickly navigate from feature to feature or to export features to text files For more information about reg
247. quick navigation using Next Feature and Previous Feature in the Go menu Cancel OED In the top panel you define the criteria of features interesting regions Any place where one or more of the selected criteria are met will become a feature This definition of features will be used by the Feature View window for contigs and when navigating in a contig view using Next Feature and Previous Feature in the Go menu In the lower panel you can define where Aligner should look for features when navigating in the consensus sequence and all samples or just a sub set of the consensus or samples This selection is used only for navigating the feature view windows will always show all features for the entire contig both in the consensus and in all samples Feature Preferences 190 CodonCode Aligner User Manual Specifying subsets of tags A number of different programs add tags to regions of sequences For example the assembly program Phrap adds tags for compressions and for regions that match regions in other contigs and PolyPhred uses tags to mark possible mutations it has identified You may want to use Aligner s feature view or feature navigation to look at only some of these tags for example only tags added by PolyPhred but not tags added by Phrap To do this click on the Specify button in the Feature preference dialog This will bring up the following dialog r eoo Tag Selection A Select tag types to use
248. r Changes to the License Server preferences will take effect the next time you start Aligner Mutations Open amp save Phrap assembly Preference options Printing Protein translation Window placement Description The License Server preferences allow specifying the License Server to use Changes to the License Server preferences will take effect the next time you start Aligner Cancel However you may need to specify the keyserver address here if Aligner cannot automatically find the correct License Server This can happen if The License Server is on a different subnet for example in a different department A firewall between or on your computer and the License Server computer blocks the automatic License Server detection CodonCode Aligner finds a License Server different from the one you want to use for example the one from the neighboring lab You are switching from a single user license to using the License Server License Server Preferences 194 CodonCode Aligner User Manual You can specify the License Server address either as computer name for example mylicenseserver myuniversity edu or as an IP address for example 10 123 012 20 If you do not know the name or address to use please contact your local system administrator Any changes made will take effect the next time you start Aligner after quitting your current Aligner session License Server Preferences 195
249. r Manual Samples folder Note Aligner will try to be reasonable when importing all files in a folder and not import some files that you probably did not really want to import For example Aligner not import hidden files like files where the name starts with a period also when importing an ABI runfolder Aligner will import the abi or ab1 files but ignore all abi seq files if the corresponding abi file was present Adding Entire Assemblies To add an entire assembly to your project select Import gt Add Assembly from the File menu This will show the standard Open file dialog Next select the assembly file which can be an Aligner project file the file name must end in proj e a CAF Common Assembly Format file produced by Sequencher the file name must end in caf non assemblies ACE files generated by Phrap the file name must end in ace ace 1 ace 2 etc The assembly files must have the correct extension either proj caf or ace ACE files can also have a number appended for example ace 1 Note that depending on your system settings you may not be able to see the extension After you selected the assembly file CodonCode Aligner will read the file and any associated files like chromatogram files If any of the samples or contigs in the imported assembly have the same names as files that are already in your project Aligner will give you a choice to either rename the fil
250. rFor Compare keep existing contigs Use muscle Use ClustalW gt Use built in algorithm When Use built in algorithm is selected the built in assembly algorithm will be used for Compare keep existing contigs For the other options the built in assembly algorithm will always be used When you click on Assemble and the Compare button is selected in the Contigs panel CodonCode Aligner s build in algorithm will be used to create contigs of contigs The following table gives an overview of some of the differences between the algorithms ClustalW CodonCode Aligner s built in algorithm Developed and optimized for sequence alignments newer than ClustalW Developed and optimized for Developed for shotgun sequence sequence alignments assemblies Uses local alignments that can include Always generates end to end Always generates end to end unaligned ends by default can also generate alignments alignments end to end alignments and large gap alignments Alignments may or may not include all Alignments formed generally Alignments formed generally impul sequences depending oi seuend include all input sequences include all input sequences similarities and assembly pardmietere Tends to be faster than Tends to be slow especially ClustalW alignments are often for alignments with many Tends to be faster than ClustalW better than ClustalW alignments contigs and or samples NNNM Compare con
251. rameters determine how matches are scored The Match score is used when two aligned nucleotides are identical the Mismatch penalty when two base calls are different The Gap penalty and the Additional first gap penalty is used when one of the two sequences has a deletion relative to the other sequence For single base deletions the penalty score will be the sum of the gap penalty and the additional first gap penalty for additional deleted bases multiple gaps in a row the penalty will be just the gap penalty You can change the scoring within limits scores from 1 to 19 for matches and penalties of 1 to 19 In general we suggest that only experts change the match scores and penalties Restoring default parameters To restore the default parameters click on the Defaults button near the bottom This will reset all parameters to the choices shown in the screen shot above Bandwidth Maximum Gap Size 168 Assembly Preferences The assembly preferences allow you to specify parameters for sequence assembly eoe Preferences Alignment Ehta MM e Base calling Algorithm End to end alignments Base colors SER 2n n lise os cul Min percent identity 70 0 Double clicking Min overlap length 25 E End clipping Features Min score 20 Highlighting Max unaligned end overlap 50 0 ES License Server Memory Bandwidth ma
252. rd you can move around as follows Move around with the right and left arrow keys you move one base at a time Press the page up and page down keys a few times this moves you by a full screen forward or backwards Try the home and end keys they move you to the beginning respectively end of the selected sequence If the consensus sequence is selected you go to the beginning and end of the contig if you select a read you move to the beginning or end of the read If you have a mouse with a scroll wheel you can also use the scroll wheel to move around in a contig Moving the scroll down will move forward in a contig moving up will move backwards If you have a contig with many reads in it then pressing the control key while scrolling with the mouse wheel will move the read list up and down Contig quality in the overview panel At the bottom of the overview panel the consensus quality is displayed as a horizontal bar The color coding depends on your color preferences in the example above three shades of green were used with darker colors corresponding to lower quality You can use this to quickly navigate to low quality consensus regions However keep in mind that the resolution may not be sufficient to show all low quality regions in this overview especially for larger contigs Aligned Bases and Protein Translation The lower half of the contig view shows the aligned bases for the samples in a contig It can also sh
253. reference options When navigating Printing rLook for features in Protein translation Consensus and all samples Sample names pos Startup J Consensus only Vector trimming All samples only C Current selection only Window placement rAt each consensus location O Find all features f9 Find just the first feature Description The features preferences let you define features Regions of Interest that are shown in the feature view windows Features are also used for quick navigation using Next Feature and Previous Feature in the Go menu Cancel OED You can change the definition of features here by using the various buttons and text fields For a more detailed explanation check the feature preference help page Moving to Features You can quickly move from feature to feature in contig views by using the Next Feature and Previous Feature menu items in the Go menu To try this out open a contig view for example for the contig in the Examplel project in the Example folder in the CodonCode Aligner folder Then select the Go menu The item we want to use is Next Feature Notice the keyboard shortcut shown in the menu it is Command Right arrow on OS X and Control Right arrow on Windows Similar the shortcut for Previous Feature is Command Left arrow respecively Control Left arrow Try the Next Feature keyboard shortcut out from the contig view You will notice that the the cursor and selection in th
254. repancies Typically scientists would simply correct any wrong base calls so that they would not have to look at the same region again With samples that have Phred or Phred like quality scores and sequence assembly algorithms that use the quality scores a lot of this editing is not necessary anymore Typically wrong bases will have lower quality scores and the correct consensus can be determined automatically by just looking for the highest quality base at any position The low quality discrepancies can often safely be ignored Here is a typical example a region covered by two sequences which differ at several places eo08 Contig v Scroll together A454 s Base 78 of 716 311 in contig Quality 62 Consensus 62 Editing Samples 95 CodonCode Aligner User Manual At the cursor position Aligner chose the A from sequence A454 s as the consensus since it is of much higher quality than the G in sequence A455 s the higher quality is indicated by the lighter background You can also see three other discrepancies in this region in each case the sequence from A454 s is high quality and correct and therefore chosen as the consensus sequence If you would look at the same region in an older assembly program that only supports a majority based consensus the consensus base at these four locations here would be an ambiguity or the single called base at places where one sequence has a gap character To get a clea
255. res assigned range from 11 to about 35 with higher scores indicating higher confidence Indels with a score below 15 are more likely to be false positives the proportion of false positives in indels with scores above 20 is substantially lower Indel scores are somewhat similar to Phred quality scores however unlike Phred quality scores indel scores are not accurately linked to error probabilities False Negatives The indel finding algorithm may sometimes miss real mutations especially if they are very close to the start or end of a sequence or if the sequence before the indel is of low quality In this case you can add a heterozygoteIndel tag by hand as follows n a trace view window select the base where the heterozygous indel starts for example base 175 in the heterozygous indel sample in the example project Bring up the popup menu by right clicking on this base on Windows or Control clicking on OS X e Select Add Tag from the popup menu This will open a new Add Tag dialog e n the Add Tag dialog select heterozygoteIndel as the tag type from the pull down menu at the top You can also enter 9999 in the End text field if you would like the tag to cover the entire rest of the sample instead of just one base Then click OK Hetero Indel Scores 89 CodonCode Aligner User Manual You should now see the tag displayed in the trace view for this sample unless you changed your highlighting preferences to
256. rogram will remain this includes confirmed tags and tags where the tag type was changed for example from homozygous to heterozygous When removing tags from previous mutation detection rounds Aligner will also undo automatic edits like changes to ambiguities done during previous Find mutation cycles If the Add tags only to mutated bases checkbox is checked Aligner will add tags only to bases that differ from the consensus sequence This is useful if for example you are looking for rare mutations SNPs In other cases for example when genotyping you may want to add a tag to all samples at each consensus position where a mutation is found to do so make sure the Add tags only to mutated bases checkbox is not checked Then Aligner will add tags that characterize the base at a given consensus position to all samples even if just one sample out of a hundred differs from the consensus base Detection sensitivity 199 CodonCode Aligner User Manual The last two checkboxes in the Marking mutations section determine if Aligner will change base calls at homo or heterozygous mutations The default behaviour is that Aligner will leave the bases unchanged and only add tags at mutated bases If you want to export your data for subsequent analysis with other programs for example the population genetics program Arlequin you may need to have ambiguity codes at heterozygous bases If you mark the checkbox Use ambiguity codes for heterozygous
257. rst have to move it to Unassembled Samples You cannot directly insert a gap or a base right before the last base in a sample but there is an easy workaround just insert a gap after the last base and then choose Move gt Gap Left from the Sample menu Note Aligner is not intended as an editor where you enter sequence by hand there are plenty of other programs out there that allow you to do that Aligner is intended to be used with sequence traces preferably traces with Phred or Phred like qualities Inserting Gaps and Bases 106 Reverse Complementing To reverse complement a sample or contig Go to the project view e Selec the contig or a sample in the Unassembled Samples folder Choose Reverse Complement from the Edit menu In most views you will be able to identify samples that have been reverse complemented by the prefix before the name and by the fact that the name is drawn in red In the project view you can identify reverse complemented samples by the icon it has red rather than black borders Reverse complementing of unassembled samples is possible but usually not necessary since samples will be reverse complemented as needed during assembly and alignment You cannot reverse complement samples in contigs directly since that would destroy the alignment to the consensus If you select Reverse Complement when a contig view is in the foreground the entire contig will we reverse complemented
258. s Specifically you can determine how many recent projects CodonCode Aligner remembers and displays in the Open recent menu set default folders for saving your projects set default folders for importing tell Aligner to remember the last location from where you imported files so that Aligner will return to this folder the next time you choose an Import command Add Samples Add Folder or Add Assembly specify if you want to set the name and path of a project right away when creating new projects if not the name and location will be set the first time you save a project set the default quality that will be assigned to sequences without qualities when they are imported Open amp Save Preferences 201 CodonCode Aligner User Manual The default quality for sequences without qualities you set here will be applies to any sequences imported later where Aligner determines that the sequence has no qualities or has artificial qualities This value is used whenever you import sequences from text files for example FASTA files that do not have qualities you import sequences from files like PHD or SCF files that have qualities but Aligner determines that the qualities are artificial because all qualities are the O or 1 for example if an SCF file was created from an ABI file without qualities all qualities have exactly the same value and the sequence is at least 15 bases long for example an
259. s When you click Save Sequencher will export your selection to a text file in CAF format In addition Sequencher will create chromatogram files in SCF format for all reads that have traces this is why we suggested to create a new folder in step 5 above You can now quit Sequencher and import the CAF file you just exported into any open CodonCode Aligner project using Import gt Add Assembly Please keep a few things in mind when importing CAF files e Sequences in old Sequencher projects often do not have base specific qualities but many functions in CodonCode Aligner either require quality scores or work better with quality scores For unassembled samples that have chromatogram traces you can use Call Bases to run Phred on the imported samples and thereby get quality scores Consensus sequences generated in Sequencher are not quality based and therefore likely to contain more errors and ambiguities than consensus sequences build in CodonCode Aligner You can choose to have CodonCode Aligner re build the consensus sequences when importing in the consensus method preferences CodonCode Aligner s support for CAF files is currently limited to CAF files exported by Sequencher Aligner will generally not be able to read CAF files produced by other programs If you encounter any problems when importing CAF files into CodonCode Aligner please send a description of your problem together with the CAF file to support codoncode com
260. s A612 r peter z Format All Files HJ When you are done making your selection press the Open button CodonCode Aligner will read the files you selected and add the samples to the Unassembled Samples folder If any problems where encountered during import Aligner will tell you so by showing a dialog box For example if you already have a sequence with the same name as an imported sequence in the project you will be given a choice to ignore the duplicated sequences or to automatically rename them Adding Entire Folders of Sample Files To quickly add many sequence files to a project it is easiest if you first gather all the files into one folder and then import the entire folder To import sequences from all files in a directory select Import gt Add Folder from the File menu This will show the standard Open file dialog Navigate to the directory you want to import select any file in this directory and then click OK Aligner will count the files in the directory and then ask you if you really want to import all the files e Import Folder of Samples Do you want to import 20 sample files from Documents l Do not show again If you click Yes Aligner will proceed to import sequences from all files in the directory This may take a while if the directory contains many files All imported sequences will be added to the Unassembled Adding Several Sample Files 19 CodonCode Aligner Use
261. s Trace 750 343 0 3 11 3 11 03 v 3 Contig1 3 samples 966 917 3 11 3 11 03 B A326 r Trace 628 375 0 3 11 3 11 03 E A060 s Trace 645 389 221 3 11 3 11 03 Bd A333 r Trace 646 370 320 3 11 3 11 03 3 Contig2 2 samples 755 720 3 11 3 11 03 gt Trash 0 samples 0 3 11 3 11 03 e Assembly completed in 1 62 seconds 1 successful join 1 island remaining D The project window is organized similar to the familiar list view in the Macintosh Finder or the detail view in Windows Explorer Every project has two folders e The Unassembled Samples folder contains samples newly added to a project and not yet assembled or moved to the trash e The Trash folder which contains samples marked for deletion but not yet removed from the project In addition projects that have been assembled or aligned will have one folder for each contig formed You can expand or condense folders by clicking on the little triangle on the left of each folder In the example above the Unassembled Samples folder and Contig1 are expanded showing details about the samples in Unassembled Samples and in Contigl Selecting Samples and Contigs For most things you do in CodonCode Aligner you start by selecting the samples or contigs you want to do something with for example vector screen or assemble You can click on a sample or contig to select the item shift click to make a continous selection press on th
262. s and gaps as features Prerequisites To find point mutations the following pre requisites must be met e Any sequences to be analyzed that have chromatograms must base specific quality scores You can use the_base calling with PHRED in Aligner to get quality scores if needed Sequences without traces text sequences do not need to have quality scores if they have quality scores the quality scores will be used to ignore low quality sequence at the ends The sequences must be in a contig The contig can be generated with Aligner by assembling or aligning to a reference sequence or it can be from importing an assembly Only samples that have sequence traces as well as base specific quality scores can be analyzed Detection of point mutations in Aligner is intended for re sequencing projects only The sequences to be analyzed should have the same sequencing chemistry and primers mixing different chemistries for example dye primer and dye terminator sequencing will likely result in many false identifications How To Find SNPs Go to the project view e Select the contig or contigs you want to analyze Choose Find Mutations from the Contig menu Finding mutations should take only a few seconds for small projects Aligner will show a progress dialog which allows you to cancel if things take to long When the finding of heterozygous indels is done Aligner will open a new window that shows the analysis results in a table like th
263. s only relevant for larger assemblies with tens or hundreds of reads It can be used to limit how long Aligner will try to merge contigs for very large projects with larger numbers meaning more tries and longer assembly times but potentially fewer contigs In detail Aligner will initially look for overlaps between all samples and then use this map of overlaps to merge samples into larger and larger contigs If two samples are already in contigs Aligner will try to merge the contigs If the merger is rejected and Aligner later finds two other overlapping samples in the same contigs Aligner will try to merge the contigs again If the contigs have changed in the mean time this can make sense since the merger may now work For very large projects with many repeats however this may mean that Aligner tries the same mergers many times The Maximum Successive Failures parameter can be used to stop such fruitless efforts after Aligner has tried this many times default 50 in a row to merge contigs without success the assembly will stop Yes we do realiize that the assembly algorithm could be made smarter here and we may modify it in the future but we think that most users will not be doing such large assemblies with Aligner anyway There are other assemblers out there that can handle large assemblies for example Phrap and you can import Phrap assemblies into Aligner for editing Match scoring The last four alignment parameters determ
264. s where you look at sequences from many species isolates or patients e Assemble with PHRAP this option will use the assembly program PHRAP rather than CodonCode Aligner s built in methods for sequence assembly It can be useful for larger shotgun assemblies Preprocess in addition to the choices above Aligner can also automatically do common pre processing steps like end clipping and vector trimming before assembly Assemble from scratch Sometimes you may want to re assemble a contig for example after you did some editing and ended up messing up the alignment of reads Or you may want to merge a contig with another contig and or additional samples without preserving the existing alignment of reads in the contig To re assemble one or more contigs from scratch Go to the project view e Select the contig contigs or contig s and sample s you want to assemble from scratch keep the shift control or command key pressed to make continuous or discontinous selections as described above Choose Assemble with Options from the Contig menu e This will open the following dialog Advanced assembly options 49 CodonCode Aligner User Manual eoo Assemble With Options f Contigs tigs Preprocess Algorithm Choose how to build contigs Merge existing contigs Unassemble existing contigs assemble from scratch Compare keep existing contigs Assemble in groups by _Clone Es s Define Groups
265. s with high error rates tend to end up in the unaligned ends and can also be ignored Of course there will be times where contig editing is necessary and CodonCode Aligner does provide many editing functions that are described on the next pages Editing Samples 96 Windows for Editing Samples You can edit sample sequences in several different views windows the base view the trace view and for assembled or aligned samples the contig view The only views that do not allow editing are the views that do not display the bases the project view the quality view and the feature view In general we suggest to do most editing in the trace view window simply because you can see the underlying data while editing One possible exception of this rule are sequences that are part of contigs sometimes it may make sense to edit in the contig view but having a trace view open that shows the sequence is still a good idea All windows are linked If you move the cursor or make a selection in a contig window Aligner will scroll to the same position in any open the base view and trace view windows for that sample Likewise when editing base calls changes are immediately made in all other open views for that sample Windows for Editing Samples 97 Cursor Positioning and Movement The cursor is positioned by clicking at the desired position in a sample or the consensus The cursor position is indicated by a vertical cursor position line dis
266. se 200 looking at the trace view you can see that this is due to multiple peaks at this location SEke Traces from Unassembled Samples X S CARACCTAATGGAGATTTB MEITACCAGAAGTGGTTTCAAGGA 190 200 210 20 l a A j ih dicas j f 4 ea A of eel dl 1 Y jai v Scroll together A326 x Base 201 of 612 Quality 13 Note that Phred typically lowers the quality scores of three bases not just one base in problem areas since neighboring bases are also more likely to be wrong The 3 color scheme is often useful to get a general idea of the sequence quality If you want more detailed color schading select the Quality based continuous scale color scheme Quality based 3 color scheme 178 Continuous quality based background colors In the continuous color scheme you can select two settings the background color for low quality bases and the minimum quality for which to use a white background e00 Preferences Alignment r Base colors Assembly Trace colors Base calling Base colors a s Moreen E Consensus metho Double clicking End clipping Features Highlighting License Server options Memory Mutations Open amp save Phrap assembly Preference options Printing Protein translation Sample names Startup Vector trimming Views Warnings Window placement G s Woa 5 _ Show traces on black background r Background colors O Quality based 3 colors f9 Quality based continuo
267. sed on your highlighting preferences You can add notes to existing tags and edit such notes To do so open a contig view select a base that contains a tag and then right click OS X control click on it to display the popup menu The first item in the popup menu will be Display Tag but only if you clicked on a base with a tag You can also view all tags for a sample in the Sample information dialog and add tags Compatible File Formats The following sample file types can be read by Aligner e SCF files Standard Chromatogram Format commonly available and generated by Phred LI COR software and many other programs This is the preferred format especially if the SCF files where generated by Phred It is also the format used by Aligner to store chromatogram information Note Sometimes SCF files have the the file extension scf this will be hidden in Windows even if you have your preferences set to display file extensions However Aligner will recognize this file extension ABI chromatogram files Files generated by systems from Applied Biosystems software Typically have the extension abi or ab1 but Phred generated SCF files will typically have the same name and extension Note that older ABI files may not contain base specific quality scores after importing ABI files that do not have quality scores you should first base call to get quality scores FASTA files text files with one or more DNA sequences where ea
268. sions to use workstation Phred and Phrap unless a separate license fee was paid If you have your own licensed copies of Phred and Phrap you can use these from Aligner instead of the workstation versions except when running in demo mode by changing the base calling preferences or the Phrap assembly preferences Replacement License Keys Under certain circumstances you may need a replacement license key This can happen if you replace your computer if you install a new operating system replace the hard drive and similar circumstances If you receive a replacement license you must make sure that the original license is not used anymore If Aligner detects that a replacement license and the original license are both used Aligner will invalidate one or both of the licenses and you may have to request another replacement license In general you should not move the folder where CodonCode Aligner is installed after the installation If you move the folder to a different location on the same computer you may have to re enter the license information License Server Licenses License Server licenses for CodonCode Aligner allow you to install CodonCode Aligner on an unlimited number of computers but limit concurrent use to the number of licenses you purchased Using License Server licenses requires installation of a separate program Aligner License Server on a computer that acts as the license server Using Phred and Phrap from CodonCod
269. sponding trace view for example by double clicking in the overview panel in the contig view Once both views are open Aligner will automatically add and remove traces when you go to a new location in a contig for example by clicking in the overview panel or by moving the cursor in the bases panel The trace view window will grow larger and smaller depending on the number of traces shown and the available space on your screen If you want to see more than 2 or 3 traces you may want to change the height of the trace panels to Small or Tiny in the Views preferences Hiding Some Traces Trace Sharpening 147 CodonCode Aligner User Manual You can hide traces for one or more bases by clicking on little colored boxes with the corresponding letter of the trace on the left side This can be very useful when analyzing heterozygous mutations where a peak for one base may obsure a second peak Below is an example the same traces as above but the T lane is hidden eoe Traces from Contig2 CAAGGCATGTGGTGTACACAAGT a 100 AGAGAAGTACAAPERMICAAGGCATGTGGTGTACACAAG ole Ca 2zz r D P ca22r Base 112 of 457 114 in contig Quality 21 Cons 90 _ The red line through the T box at the left indicates that the T lane is hidden Clicking on it again will show the T lane and clicking on the C will hide the C lane as shown below 8080 Traces from Contig2 TG AG AG AAGT ACAATACAAG GCATGTGGTGTACACAAGT ca 22 8 90 100 110 5 vi
270. st one mutated base Aligner has added tags at these points to each sample that describe Aligner s classification For example at consensus base 183 in the table above Aligner classified three samples as heterozygous C T mixes and one sample as homozygous T T Use the mutation preferences to adjust the mutation detection sensitivity whether Aligner should add tags to samples that are not mutated and so on You can use tags for example a codingSequence tag assigned to the reference sequence or dontGenotype tags to fine tune which regions Aligner analyzes and how the effect of mutations is described in the Content field this is described in detail below To take a close look at the results you can double click on any entry in the table This will bring up the views you have chosen in the double click preferences typcally the contig view and the trace view A screen shot of the contig view for example above is shown below 0089 Contig1 ER Hit SSS A A The tags added by Aligner are shown as blue and pink boxes blue boxes indicating homozygous bases and pink boxes indicating heterozygous bases unless you changed the display of tags in the highlighting How To Find SNPs 77 CodonCode Aligner User Manual preferences to something other than box The corresponding trace view for the four samples is shown below e e Traces from Contig1 Em TCCTG TTTGCTG CT Roath f M vi
271. t x eo Sequence Aligner Progress Algorithm Phases Vv Initialization Overlap Detection part 1 Overlap Detection part 2 Alignment Data Model Update Overlap Detection part 1 is 42 complete Mrs Cancel When the alignment is done you will see a newly formed contig in the project window The new contig will contain a copy of the original reference sequence leaving the original reference sequence unchanged Note that the new contig will be limited to the length of the reference sequence plus any gaps introduced during the alignment Any parts of sequences that extend beyond the start or end of the reference sequence will be marked as unaligned You will not be able to see the overhanding unaligned in the contig view but you can see them in the trace views and base views The alignment is performed using the parameters defined by the alignment preferences Samples that do not meet the minimum criteria will not be aligned and remain in the Unassembled samples folder If you wish to return the sample files to their unaligned state select the alignment contig in the project view and then choose Unassemble from the Contig menu When unassembling alignments the copy of the reference sequence that was included in the alignment will be move to the trash unless the original reference sequence was deleted or renamed Alignments to a Reference Sequence 61 CodonCode Aligner User Manual Adding Samples to Alignments To
272. t has the highest number of shared words Perform a pairwise alignment between the two samples or contigs in later cycles 4 If the alignment is good enough keep it as a new contig and calculate the consensus sequence otherwise reject the merger and leave the two samples separate 5 Find the next pair of sequences looking again for the highest number of matching words If a sample is in a contig use the consensus sequence for the contig If the two samples are already in the same contig get the next pair 6 Go back to step 3 and continue the pairwise joins until all possible joins have been tried or until the maximum number of merge failures in a row has occured ios The algorithm typically performs well enough for projects containing up to several hundred reads possibly more if you have enough memory available and a fast computer However it has a few weaknesses most of which are typical for such greedy algorithms If a project contains multiple copies of a repeat with high identity there is a good chance that they are mis assembled but Alu sequences are generally not a problem e Samples have to share at least one perfect word match to be considered for joining This means very short overlaps or short overlaps with errors or ambiguities may not be found The default word length is 12 bases but this can be changed in the assembly preferences Information from double ended sequencing or other ordering information
273. t the sample s you want to remove use shift click to make continuous selections use control click Windows or command click OS X to make discontinous selections e Select Move To Trash from the Edit menu or display the popup menu by right clicking OS X control clicking and choose Move To Trash from the pop up menu You can also select samples in contigs and move them to the trash This will remove the samples from the contig If removing of a sample would leave a gap in a contig thereby splitting a contig in two pieces you will not be able to remove the sample we plan to add the functionality to automatically split a contig in later versions You can also move entire contigs to the trash this way This will move the contig and all samples in it to the trash Moving samples to the trash does not delete them from your project If you change your mind about a sample in the trash you can select it and then choose Move To Unassembled Samples or Move To from the Edit menu To permanently delete samples from you project first move the samples to the trash and then choose Empty Trash from the File menu Removing Samples from an Aligner Project 28 Base Calling with PHRED Aligner works best if sequences have quality scores but what if you have sequence traces that do not have quality scores for example ABI files Well you can simply run Phred to re do the base calling and assign quality scores from wi
274. ternal consensus on import vi Use the reference sequence as the consensus Vector trimming Window placement Description The consensus determination preferences control how the consensus sequence is formed Cancel In the check box at the top you choose whether Aligner will use a quality based consensus or a majority based consensus For most projects we strongly suggest to use a quality based consensus whenever possible A quality based consensus mimics what a human contig editor would do to determine the correct consensus sequence Aligner looks for the highest quality sample at each position taking into consideration confimation by samples in reverse direction as well as disagreements You can choose whether or not you want Aligner to subtract the quality scores of discrepant bases when calculating the consensus quality score In general this is not necessary since discrepancies are typically errors that do not influence the correctness of the consensus base however you can tell Aligner that you think differently and subtract the quality scores of discrepant bases Consensus Preferences 184 CodonCode Aligner User Manual You can also set the qualities values used for edited bases when calculating consensus quality Internally Aligner uses qualities of 98 to low quality edits and 99 to high quality edits This follows conventions used by the contig editing programs Gap4 and Consed and it
275. the Font size panel you can set the font size used in the different views The project view settings affect only the project view the feature views settings affect feature views and mutation report windows and the other views setting affects the trace views base views contig views and other views View Preferences 227 Warning Preferences You can control how many warnings CodonCode Aligner shows in the Warning Preference dialog Preferences r Warnings Base calling r General Warnings Base colors Which warning dialogs should the program show Consensus method All warning dialogs Double clicking O oni E d End clipping J Only severe warnings and errors F7 Features No warning dialogs only severe errors Highlighting most warnings will still be shown in the status box License Server Memory r When Opening Windows Mutations m Open amp save vi Warn before opening more than 5 c Windows Phrap assembly V Warn before opening more than 20 trace view panels Preference options Printing Protein translation Sample names Startup Vector trimming Views Window placement Description The warnings preferences let you control which warning messages you will see Cte The upper section affects most warnings that Aligner can show For new users we suggest that you display all warning dialogs as shown above Once you are familiar wit
276. the corresponding trace view for example by double clicking in the overview panel in the contig view Once both views are open Aligner will automatically add and remove traces when you go to a new location in a contig for example by clicking in the overview panel or by moving the cursor in the bases panel The trace view window will grow larger and smaller depending on the number of traces shown and the available space on your screen If you want to see more than 2 or 3 traces you may want to change the height of the trace panels to Small or Tiny in the Views preferences Printing Contigs To print a contig open and select the contig view for the contig you want to print then choose Print from the File menu or use the keyboard shortcut Control P on Windows Command P on OS X Sorting Reads in the Contig View 155 CodonCode Aligner User Manual This will show the following option dialog eoo Contig View Print Options r Contig Bases To Print I Print entire contig Print contig from base 1 to base 36 r Contig Print Options Page layout Normal Poster Font size 8 E point vi Include colors and highlighting V Print bases in groups of 10 HJ bases M Print unaligned ends Cancel The top section of the dialog lets you choose how much of the contig to print either the entire contig or just a section of the contig Aligner automatically fills in the first and last bas
277. the same project this is usually not a problem However if you export samples and then re import them the tags will typically be lost and undoing auto edits with this options will not be possible Undo auto edits 102 Deleting Bases Using the Keyboard to Delete Bases Backspace Key Deletes the currently selected base or bases then for sequences in contigs the bases to the left of the cursor are shifted to the right Delete Key Deletes the currently selected base or bases then for sequences in contigs the bases to the right of the cursor are shifted to the left Note If the consensus is selected Delete or Backspace deletes not only the base s in the consensus but bases at that position in all samples having sequence at that position OS X Users On Macintosh keyboards the Backspace key is actually labeled delete not Backspace It is part of the main key group The Delete key is labeled del above an X in a box and usually is part of a small group of keys that include the page up and page down keys Menus for Deleting Bases Instead of using the keyboard shortcuts for deleting bases you can also go to the Sample menu select the Delete submenu and then choose one of the following items Selection Fill from Left Same as Backspace key Selection Fill from Right Same as Delete key From Sample Start Deletes all bases to the left of the cursor for the selected sample To Sample End Deletes all b
278. the top you choose how samples should be sorted in contig views For most projects the default of sorting samples by position in contig makes the most sense Samples will be sorted in ascending order based on their first aligned base in a contig Sometimes sorting the samples by name is more desirable One example is a mutation detection project where you forward and reverse reads have similar names like Sample 123 f for forward and Sample123 r for reverse and where you would like to have the forward and reverse reads right underneath each other If you select By direction and contig position all reads in forward direction will first be sorted by position and then all reads in reverse direction will be sorted Changing these preferences here will not affect any open contig view windows it will also not affect contigs where you previously sorted samples manually by dragging read names up or down To change the sorting in open contig view windows or to quickly try out the different sort options open a contig view and right click command click on OS X in the aligned bases panel to display the contig view popup menu then choose View Preferences 226 CodonCode Aligner User Manual Sort samples by In the Contig view Trace View interaction panel you can choose what happens when you have the contig view and the trace view for a contig open If the check box before Automatically pick 3 traces to show is checked Aligner
279. thin Aligner Phred was developed by Phil Green and Brent Ewing at the University of Washington more about PHRED below How to call bases with PHRED from Aligner To call bases for sequence traces with PHRED 1 Select the samples in the project view The sequences must be unassembled you can also select the entire Unassembled Samples folder If you want to call bases for samples that are already in a contig you must first unassemble the contig 2 Choose Call Bases from the Sample menu Depending on the number of samples you have chosen base calling may take a while up to a few seconds for each sample and you will need to wait until it s done before you can do anything else Prerequisites To use base calling in Aligner your sequences must have traces any sequences from text files that do not have traces will be ignored Furthermore base calling with PHRED requires that you have PHRED installed on the computer that you are running Aligner on This can either be the workstation version of PHRED that is included with Aligner or your own copy of PHRED Using the workstation version of PHRED When you install CodonCode Aligner a workstation version of PHRED is installed in the Phred Phrap folder inside the CodonCode Aligner folder This workstation version can only be run from CodonCode Aligner but is otherwise identical to PHRED To use it you must either have a valid trial license for Aligner or a full purchased
280. tigs Go to the project view e Select the contig s Choose Unassemble from the Contig menu All samples in the contig will be put into the Unassembled Samples folder and any gaps in the samples will be removed Any samples that were reverse complemented in the contigs will be returned to the original not reverse complemented state Unassembling Contigs 125 Rountrip Editing While CodonCode Aligner support manual editing of contigs Aligner does not provide all the functionality of programs that were specifically developed to edit sequence alignments However CodonCode Aligner supports Roundtrip Editing exporting existing contigs for editing in external programs like MacClade or Mesquite and re importing the manually edited contigs The re imported contigs maintain the connection to the original chromatograms so you can quickly check any discrepancies by looking at the original sequence traces A typical example where roundtrip editing can make sense is a phylogenetic project where you go through the following steps Create a project in CodonCode Aligner with sequence traces from a number of different species isolates Create separate contigs for each species for example using Assemble in Groups e Edit the initial contigs Create an alignment of the contig sequences a contig of contigs with Clustal W from within CodonCode Aligner using Compare in Assemble With Options Export the contig of
281. tigs to each other 52 CodonCode Aligner User Manual Comparisons alignments can Comparisons alignments Comparisons must include at least one be generated for samples only can be generated for samples contig for samples only use Assemble only You can work with the new contig of contigs the same way you would with normal contigs Double clicking on a base for one of the contigs in the contig of contigs will open the trace views for this contig You can open separate trace views for different contigs to quickly check any discrepancies To cite muscle Edgar Robert C 2004 MUSCLE multiple sequence alignment with high accuracy and high throughput Nucleic Acids Research 32 5 1792 97 muscle is available from http www drive5 com muscle To cite ClustalW Thompson J D Higgins D G and Gibson T J 1994 CLUSTAL W improving the sensitivity of progressive multiple sequence alignment through sequence weighting position specific gap penalties and weight matrix choice Nucleic Acids Research 22 22 4673 4680 Assemble in groups For sequencing projects where you assemble contigs from a number of different sources species patients isolates the Assemble in groups option in CodonCode Aligner can simplify your work by automatically grouping and assembling samples based on their names To use assemble by groups your samples must be named consistently with different parts of the name separated by characters like u
282. ting from sequence start To current CUTSOT POSIUOM xc ssessccsnsesraavecesnex GO Y EC KMNSSER ER ERO RR ER CE PENAS E 99 Selecting from current cursor position to the end of a sequence 99 Selestina all bases MA Sequelici ai ce pedecstode bte ae E REP das beee des SE EpL asd pias p die uM e tpa aes 99 Changing Basbs aitov teo R ain M ine tad Sed Mn aai iisa iN c tine Eel n E e aM epe eL ti DU eran epee 100 FANUNSLHENISES RR EEUU ES 100 Narc RESET mE 101 Call second peaks higher thai sois oe RIP EP PE par N EENEN EREE EE AATE 101 Chance ambisies to Sin Gls DABEN sspe o exeo ERO REF FU RDVRU ea ma ee eee 101 Change low quality bases TON aucem irnivre tr pie egeo e mls Fre seio irr ni El peur pay cu Ra cr RE 101 Undo 3INO CONS oeste oda E MI MM MM I E MIL PD S SML DE P EAE LA IE IM DER at 102 SHIP T 103 Usine the Keyboard to Delete Bases a sos caeci tive nico peu nol ios ep vOv e Ala uS ub p S V Y 103 Menus der Deleting Bases i rti pH Er xt aa PEE DRE bAQU E xb SUR aria 103 Deleting Sampl s coiere ti esteem RA REOR Ra Rr lune EN dee eH Miss cuts i Re iut et ast a niu Eu don cR Su eee 104 Moying Gaps and Samples serren N eU P NUR ERU EP RUIN SEIS HEEV PEN EUNENEEUSEN PUE EUER UE NN VRES FEDERE SURE RE VN E PEU VERE 105 Moving gaps IN CONES asinino CIR ER EXER IRE RE VU YPE ERE NaN eG RU Renee 105 Iowan samples TOOME s ostro te Lem e e a AONO RP tton E UR VET Peas 105 Moving s
283. tions and deletions The Find Heterozygous Indels function in the Sample menu can automatically identify potential heterozygous insertions and deletions The Process Heterozygous Indels function can help you see the sequence of the mutated allele CodonCode Aligner uses two algorithms to deduct the sequence of the heterozygous indel The first algorithm looks at secondary bands and the reference or consensus sequence and replaces the Heterozygous Insertions and Deletions 87 CodonCode Aligner User Manual basecalls in the indel region with the likely sequence of the second allele The second algorithm creates a new subtracted artificial sample by subtracting a scaled version of the wild type sequence base calling the new subtracted trace with Phred After this both sequences are re aligned or re assembled with the rest of the original contig Here is an example of a subtracted sequence that was created by CodonCode Aligner from the heterozygous indel trace shown above eoe Traces from Contig1 yECCAG AGAAATT G GTCAG G AGCAC AA ARG GG G CACTAAG AGCAAA I 170 180 190 v Scroll together heterozygous indel sub Base 173 of 594 178 in contig Quality 62 Cons 62 w a v jaie In the processed sequence where the allele that corresponds to the wild type sequence has been subtracted it is very easy to see the one base T insertion To someone experienced in analyzing sequence traces with heter
284. to 5046 of the built in physical memory RAM The next two numbers set further limits memory available to Aligner can never be less than 64 MB and never more than 384 MB regardless of the amount of built in RAM You can change these numbers with a text editor like NotePad For example to increase the maximum memory to 75 of the built in RAM or 512 MB whichever is smaller change the line to read Virtual Machine Parameters Xms32M Xmx75 64 512P Please note that CodonCode Aligner will not start if you increase these numbers too much Unfortunately what is too much depends not only on the built in RAM but also on other factors that influence the amount of available virtual memory for example which other programs are running your virtual memory settings and sometimes even how much space is available on your hard drive However the likelihood of startup problems increases if you increase the first percentage number to more than 75 and the last max MB number to more than 1000 increasing it to more than 1400 will cause Aligner startup Memory Requirements 235 CodonCode Aligner User Manual problems on most computers If you experience problems where CodonCode Aligner does not start you should change the line to read Virtual Machine Parameters Xms32M Xmx50 64 256P After saving the file try starting CodonCode Aligner again How Aligner memory on Mac OS X is set On OS X the maximum memory is set in the file
285. ty 13 4 Note that both quality based color schemes require samples that have Phred qualities or Phred like qualities Aligner will work best with sequences that have such qualities If you do not have qualities you can use the base specific color scheme 180 Continuous quality based background colors Base specific colors The third color scheme ignores sequence qualities and chooses the colors from the bases You can either have bases drawn on colored background or colored bases on white background Here s an example of a trace on a colored background Traces from Unassembled Samples G e7 A Fel Cc G en Texe 190 200 210 i w NW A i Iu Va j elus m NA tN A ALK of lech PR allen alk yale vi Scroll together A326 Base 201 of 612 Quality 13 The same trace with colored bases eoe Traces from Unassembled Samples x GATGCAAACCTAATGGAGATTTTHT TACCAGAAGTGGTTTCA A 190 200 210 22 i Nw J ih ii j Wa l elus m NA SEA ACA ofA laan allie oft pair v Scroll together A326 Base 201 of 612 Quality 13 The base specific color scheme makes most sense when samples do not have qualities or sometimes when looking for differences in aligned or assembles samples You can assign the color for each base in top section of the Base colors preference panel as shown below Base specific colors 181 CodonCode Aligner User Manual eoo Preferences Alignment r Base colors
286. ty If you use very stringent match criteria you are likely to miss some vector matches if you use very loose criteria you may end up trimming sequences from random hits Vector Trimming Preferences 225 View Preferences The view preferences allow you to set options for the different views eoo Preferences Alignment r View preferences Assembly r Contig view Base calling Base colors Sort samples by O Contig position Consensus method ry 94 5 Double clicking D Direction and contig position End clipping Sample name Features LE Highlighting __ Mask bases that match the consensus sequence icen NS V License Server r Contig view Trace view interaction Memory Mutations C Automatically pick 3 VJ traces to show Open amp save Phrap assembly r Trace view Preference options Printing Height for trace view windows Small Hl Protein translation Sample names r Feature view Santup O Show separate feature views for each contig Vector trimming MIEWS o o d Allow feature views to show features from multiple contigs Warnings z Window placement r Font Size Project view 13 B Feature views 11 Ke Other views 13 E L Description The views preferences allow you to set options for the various view windows Note that the changing the font size for the project view also will change the font size in dialogs In the Contig view panel at
287. ty value of this base is used Viewing qualities In CodonCode Aligner you can see quality values in a variety of ways to get an overview of the quality in a sample select the sample in the project view and then choose Qualities in the View menu to get information about the quality at any specific base you can click on the base in the base view window or the trace view window the quality of the selected base is shown at the bottom of the window you can also choose to have the background behind the bases in the base view trace view and contig view windows indicate the quality using either a continous scale or a three color scheme the Where quality values come from 13 CodonCode Aligner User Manual good the bad and the ugly you can set this in the Base colors preference panel Additional Reading R Durbin and S Dear 1998 Base Qualities Help Sequencing Software Genome Research 8 161 162 Available online at http www genome org content vol8 issue3 B Ewing B L Hillier L M C Wendl and P Green Base calling of automated sequencer traces using Phred I Accuracy assessment Genome Research 8 175 85 Available online at http www genome org content vol8 issue3 B Ewing and P Green 1998 Base Calling of Automated Sequencer Traces Using Phred II Error Probabilities Genome Research 8 186 198 Available online at http www genome org content vol8 issue3 P Richterich 1998
288. u on Mac OS X only About Aligner Preferences Quit File Menu New Project Open a sample Open a project Open Recent Close Project Save Project Save Project As Import Add Samples Add Folder Add Assembly Export Export Project Summary Export Samples Export Consensus Sequences Export Assembly Export Features New Folder Delete Folder Duplicate Samples Exit on Windows Edit Menu Undo Redo Copy selected sequence Paste Select from Start to Here Select from Here to End Select All Change Bases Reverse complement Move to Unassembled Samples Move to Trash Preferences Windows only CodonCode Aligner Help by Menu 231 CodonCode Aligner User Manual Go Menu Define Features Next Feature Next High Quality Mismatch Low Quality Consensus Ambiguity Mismatch Edited Base Previous Feature Previous High Quality Mismatch Low Quality Consensus Ambiguity Mismatch Edited Base Base Number First Aligned Base Last Aligned Base Search Sequence Search Again BLAST Search MegaBLAST Nucleotide blastn Translated blastx Translated tblastx Sample Menu Call Bases Find heterozygous indels Split heterozygous indels Clip Ends Trim Vector Insert gap Shift Bases Left Shift Bases Right Delete Selection Fill from Left Selection Fill from Right From Sample Start To Sample End Move Gap Left Gap Right Sequence Left S
289. uble clicking End clipping Features Highlighting License Server Memory Mutations Open amp save Phrap assembly Preference options Window placement r Protein translation ime Organism Universal HJ r Display No Translation O Single 1 Translation frame 1 O One Strand 3 Translations C3 Both Strands 6 Translations O Annotated Coding Region Presentation O Single Letter justification Left 5 Abbreviation 3 letter Codon Color Stop B red HJ r Description The protein translation preferences control the display of protein translations in the Contig view Amino acid names are commonly represented by a single letter A Alanine or an abbreviation Gly Glycine The Single Letter and Abbreviation choices let you set your preference The color of start and stop codons can be changed to make them easier to see Use the Start and Stop color lists to select the colors you want Protein Translation Preferences 210 Restriction Map Preferences In the restriction map preferences you specify which enzymes to use for generating restriction maps and how to display the results To change the restriction map preferences select Preferences from the Edit menu on Windows or from the CodonCode Aligner menu on OS X and then click on Restriction maps on the left panel You can also access the restriction map preferences
290. uences are shown on light gray background in the contig view they alignment end points can manually be changed using Mark gt Start Alignment Location and Mark gt End Alignment Location in the Sample menu The local alignment algorithm was used by default in CodonCode Aligner version 1 6 3 and older If you started using CodonCode Aligner before version 2 0 1 the local alignment algorithm is probably still being used unless you changed you assembly and alignment preferences When working with samples that have large insertions or deletions or if you are trying to align cDNA to genomic DNA you should change the alignment algorithm to Large gap alignment in the assembly preferences and or the alignment preferences This will allow the alignment of multiple parts in one sequence to different sections in a second sequence for example exons in a cDNA sequence to the corresponding regions in a genomic DNA Local large gap and end to end alignments 72 Regions of Interest Features When looking at sequences or contigs you often may want to not look at the entire sequence but rather move quickly to specific regions of interest Of course what is interesting to you will depend on the kind of project you are doing For example if you are assembling a shotgun sequencing project you may be interested in regions of low coverage or low consensus quality but in a mutation analysis project you may instead be interested only potential hom
291. ur reference sequence 4 If your reference sequence has several exons the codonStart tag must be added to the first exon in the reference sequence For example if your reference sequence contains exons 4 and 5 add the codonStart tag to exon 4 5 When specifying a base number in the codonStart tag the number refers to the nucleotide in the cDNA sequence Therefore the number must give a remainder of 1 when divided by 3 e g 1 4 7 10 3301 3304 Aligner will show a warning dialog when any one of these conditions is not met The easiest way to get the correct codingSequence and codonStart tags is by importing the reference sequence from a text file in Genbank format CodonCode Aligner will use the CDS features in the Genbank file and add corresponding codingSequence and codonStart tags If you have more than one coding sequence region defined Aligner will automatically keep track of the reading frame as the base numbering mutations in introns will be annotated using the standard n x or n y numbering Here is an example Numbering the Coding Sequence 83 CodonCode Aligner User Manual eo Mutation tags in Contig1 Feature Source Foundin Parent Start End Comete codingSequence User Reference Contig 327 340 F codonStart User Reference Contig 328 328 basenumber 6667 heterozygoteAC Aligner va 23 x Contig 0033 343 Heterozygous 667943 C gt A noncoding region polymorphism Aligner C
292. us scale O By nucleotide ignore quality Select your main color scheme specify details below Background color details continuous scale Color used for low quality bases Bo e Use white for quality 50 and higher Description The base colors preferences control the colors used for drawing traces If By nucleotide is selected bases are drawn the same color as their trace colored bases use the same background color as traces With the settings shown above bases with a quality of 0 will be shown on blue background and bases with qualities of 60 and higher on white background Bases in between will be shown on varying shades of blue with darker blues for lower qualities Continuous quality based background colors 179 CodonCode Aligner User Manual eoe A326 r l RRS B lcyccTcc ccacaccTTC accaccccEG METACTONEN m 51 crcccTca cCTTORGEENME T TCTCCTCA AGACCTTGTC TTCCTCAGCT i 101 CCTCCCACAT ATGCATAAAG TCTAATTCTG ATCATAAATC TGTTACACTC 151 TCAAACTTGT AGTGGCCCTG TTTTATTGAT GCAAACCTAA TGGAGAT TB 201 Gtaccacaa GTGGTTTCAA GGAACAACCT TTAAGGATGG AATTCTTGAA 251 GCGGATCTCT GAMcHGTCTA GATTTGTTGT GGGGAAAGAT CCTGAAGGAG 301 AGCACAGAGA CCTGGAGGAG GTCAGGTGCT AAGCCT 351 TGACACAGGT GTGGATGCCA TTTCCAGGAG 401 BGNEENNNGO CcacCAGTCN CTTAAT CTA s BATCTOTGEC AGTTTACEGT TTTOTTCGTC Ul ACBABSATEN TIAATENGC TERAGGOTTT C CcAKATGCOO GACCATTIGS o HS 60 CCE EH A326 r Base 201 of 612 Quali
293. utton This will display the Enter New License dialog eoe Enter New License CodonCode Aigne F Enter New License License String Name or Organization Cancel Paste License Apply Enter the license string you received from CodonCode Corporation into the License String field preferably by using copy and paste use the Paste License button or the keyboard shortcut for pasting in Aligner Command V on OS X or Control V on Windows Then click the Apply button Licenses are bound to a single computer ID If you try to install the license on different computer the license will not be valid A single user license allows you to install Aligner on one computer If you plan to use your license on one of several computers you need a License Server License Using Phred and Phrap from CodonCode Aligner CodonCode Aligner allows you to use the base calling program Phred and the assembly program Phrap to base call and assemble your sequence data Phred and Phrap are separate programs and distributed by CodonCode Corporation through a distribution agreement with the University of Washington Users at academic and non profit institutions may use Phred and Phrap free of charge users at for profit institutions have to purchase separate licenses for Phred and Phrap When installing Codon
294. ve these reads in Aligner using one of the different Move To options Like every assembly program out there Phrap will occasionally produce incorrect assemblies For example multiple copies of highly identical repeats may all be piled up on top of each other You can use Aligner s interactive features to move such misassembled reads to the trash or the Unassembled Samples folder About Phrap The assembly program Phrap was developed by Phil Green at the University of Washington Phrap was widely used for sequence assembly in the Human Genome Project and still is often regarded as the standard for sequence assembly CodonCode Corporation distributes Phrap executables for a variety of platforms including Windows and Mac OS X under license from the University of Washington Academic users can obtain the source code for Phrap for restricted use directly from the authors at the University of Washington For more information on this please visit http www phrap org You can read the original documentation for Phrap at http www codoncode com support phrap doc html Please note that Phrap is a command line program not a typical Windows or Mac OS X application This makes it easy to run Phrap through scripts or from programs like CodonCode Aligner but it means you cannot simple double click on Phrap and expect to see a graphical user interface there is none When CodonCode Aligner is installed the installer also includes a special
295. w from the View menu to display a graph of the quality values for the selected sample or consensus e608 A326 r 70 210 A326 r Base 200 of 628 Quali 13 The Quality View graphs quality value Y axis versus base position X axis for all base calls The quality graph can be enlarged or reduced by resizing the Quality View window click and drag a corner of the window Clicking in the quality view window will move the cursor in all views for this sample This can be useful to quickly check out problem regions like the low quality region near base 200 in the example above Just open a trace view and a quality view for a sample and click at the low quality regions in the quality view then look at this region in the trace view Quality View Window 151 Contig View Window Choose Contig View from the View menu to display a window showing an overview and the aligned bases for a contig 208 Contig1 djs74 2361 51 poo EN REDE AA 3 BESS lt lt djs74 423 4 Gi ARRCACCTACGGCAAAGAAG AGA lt lt djs74 1532 E djs74 1802 djs74 996 s2 AA AG djs74 2689 51 lt lt djs74 237 c djs74 2350 s1 djs74 1180 s1 djs74 1432 ox x xx Ia GAAACACCTA CAAAGAAIGGAGAGGGAAGCAAGGCA 1 2 Contig Overview Panel The upper half of the contig view shows a graphical overview of the contig the overview panel Some things worth noting e The location and orientation of individual samp
296. w the list CodonCode Aligner User Manual Restriction Map Options The Restriction Map Options tab in the restriction map preferences allows you to change how the map is displayed and which DNA type to use eoo Preferences Alignment rl abba mU Assembly f ECT come Base calling Restriction Enzymes Base colors Consensus method Double clicking End clipping Features Highlighting License Server Memory Mutations Open amp save Phrap assembly Preference options Printing Protein translation Sample names Restriction maps Startup Vector trimming Views Warnings Window placement M ix v Display Non Cutters vi Display Cutters r Show only enzymes that cut M 2x M 3x vi 4x amp More All r Map style fe Single Line C3 Multiple Lines O Text rShow results as Cut Positions Fragment Sizes Y List cutters at bottom of map DNA type e Linear DNA C5 Circular DNA Description The restriction map preferences control which enzymes to use for creating the restriction map and how to display the results In the first section you can select if cutting and or non cutting enzymes should be displayed If you choose to display cutters you can set how to show them and the cut results in the restriction map You have the option to show only those enzymes that cut a spe
297. will try to pick 3 traces to show everytime you move around in a contig Note that Aligner will not automatically open the trace view for you however You can choose how many traces Aligner should pick we suggest to use smaller numbers for faster performance In the Trace view panel you can set the default height of traces in trace view windows try it out In the Feature view panel you can determine how feature views will behave Since Aligner version 1 1 2 feature views can show the features for more than one contig For example you may be interested in viewing all PolyPhred tags in all of your contigs in a single table You can do this by selecting all contigs and then selecting Feature View in the View menu If you have Allow feature views to show features from multiple contigs checked you will get just one window But if you have Show separate feature views for each contig checked you will get an individual window for each contig you guessed that much didn t you There s just one thing to notice when you allow feature views to show features for multiple contigs any feature will be shown in only one window This means that Aligner may sometimes close older feature views If for example you have a feature view for Contigl and Contig2 open and then open a feature view for Contig2 and Contig3 Aligner will first close the older feature view and the show you the new feature view for Contig2 and Contig3 In
298. x gap size 30 Mutations x Open amp save Word length 12 PU Phrap assembly Max successive failures 50 Ti Preference options Printing Match score 1 Ce Protein translation f Restriction maps Mismatch penalty 2 Ce Sample names Gap penalty 22 mm Startup Toolbars Additional first gap penalty 3 Vector trimming l Warnings Window placement Description The assembly preferences allows you to set criteria for overlaps during assembly Cancel During the assembly process the sequences or contigs are aligned successively against each other Each alignment is evaluated against the match criteria defined in the alignment preferences Only if the alignment meets all the criteria the samples or contigs will be merged If the alignment does not match any one of the criteria the merger will be rejected The parameters are similar to the parameters for sequence alignment but you can assign different values for assembly and alignment parameters The meaning of each parameter is discussed in the next sections Please note that the assembly parameters will not be used when comparing contigs with ClustalW or muscle or when assembling with Phrap When comparing contigs the assembly preferences will only be used when the built in algorithm is selected in the Algorithm panel of the Assemble with Options dialog Assembly Preferences 169 CodonCode Aligner User Manual Algorithm The algorithm pulldow
299. xpected to ever become available Memory requirements How much memory CodonCode Aligner requires depends on the project size The default settings should allow you to process projects with several hundred chromatograms If necessary you can change increase or reduce Aligner s memory requirements as described in the Memory Requirements section Java requirements CodonCode Aligner is Java program and requires that the appropriate Java version is installed About CodonCode Aligner 1 CodonCode Aligner User Manual On Windows the installer will install a Java runtime version JRE specifically for Aligner You should not try to run Aligner with any other Java versions you ll just run into problems that can easily be avoided On Mac OS X Java 1 4 2 is used since CodonCode Aligner version 1 2 5 Note for Mac OS X 10 3 Users There are a two known problems with Java on OS X 10 3 which can cause the installer and or CodonCode Aligner to crash however these problems can easily be fixed Crashes after upgrading to OS X 10 3 9 Due to a bug in the OS X 10 3 9 updater many users saw that Java applications crashed after upgrading to OS X 10 3 9 Apple has released a Java update that fixes this problem For more information please visit http www apple com support downloads javaupdateformacosx1039 html e Java crashes due to disabled fonts On some OS X 10 3 versions Java will crash randomly if some fonts are disabled This can easily
300. y Requirenitents niari SEEN SERO CERE EE VER EEUNREREEENME ERU EEEPRXR NERA SEECET ores tearoom nore How Aligner memory onm Windows is Seb csse rtr ro ett eitis prio i EE RRA EEUU SENEN ARATE How Aloner memory on Mac OS X 18 S60 ucro o HO HIRUINO METRO AERUNSEA NOD eRe CodonCode Aligner Release Notes isi nero p ro REEF vran NEEN E EUR FREUE UFU UE Y YE FEE CEDERE REVENU About CodonCode Aligner copyrighted material from L1 COR Inc Copyright 2002 2007 CodonCode Corporation All Rights Reserved Contains licensed copyrighted material from LI COR Inc For technical support e mail support codoncode com WWW www codoncode com USA 781 686 1131 System Requirements Mac OS X Requires Mac OS X version 10 3 4 or newer 256 MB RAM 512 MB or more suggested and a 400 MHz or faster G3 or better processor Please note that OS X 10 2 is not supported anymore Apple has stopped development of Java for OS X 10 2 several years ago If you are using OS X 10 2 please upgrade to OS X 10 3 or newer before using CodonCode Aligner Windows Requires Windows 98 ME 2000 or XP 256 MB RAM 512 MB or more suggested and a 500 MHz or faster Pentium III or better processor Other operating systems Currently CodonCode Aligner is not available for other operating systems For Linux and UNIX many good alternative assembly and contig editing programs are available For Mac OS 9 x the required Java version 1 3 1 is not available and is not e
301. y position since the alignment uses a banded Needleman Wunsch algorithm The bandwidth parameter has an impact on the assembly speed larger values mean slower assemblies For large projects you may want to reduce the bandwidth value for projects where you know that you have larger insertions and deletions you may want to increase it Note however that increasing the bandwidth will Maximum Unaligned End Overlap 171 CodonCode Aligner User Manual typically not be enough to extend alignments through very large gaps like large introns Support for Large gap alignments will be added to later versions of Aligner The bandwidth parameter is ignored when the large gap alignments algorithm is used for assembly Word Length The word length parameter determines the size of words that CodonCode Aligner uses when looking for potential overlaps between sequences Only sequence pairs that have perfect matches of at least this length will be considered for merging If you are trying to assemble sequences with high error or mutation rates reducing the word length may help to get samples aligned For very large projects or projects with many repeat sequences larger numbers may give faster assemblies and better results The impact of the word length setting on the assembly speed depends on the size of the project for large projects larger word length values can lead to faster alignments Maximum Successive Failures This parameter i
302. yboard shortcuts are not always shown in the menus In the contig view you can also move single gaps around by drag and drop click on the gap to select it then click on it again but keep the mouse pressed and move the cursor to where you want the gap to be then release the mouse Moving samples in contigs You can also move entire sequences one base to the left or to the right within a contig by selecting the sequence and then choosing Move Sequence Left or Move Sequence Right from the Sample menu Moving samples to Unassembled Samples You can move samples from contigs or from the Trash folder to the Unassembled Samples folder by selecting the sample s and then choosing Move to Unassembled Samples from the Edit menu For samples in contigs some special considerations apply as described in the Editing Contigs section In the project view moving samples to the Trash or Unassembled Samples can also be done using drag and drop Moving Gaps and Samples 105 Inserting Gaps and Bases To insert gaps Position the cursor at the base after which you want to insert a gap Press the space bar or select Insert gap gt Shift Bases Right from the Sample menu A new gap will be inserted before the current cursor position If the sample is part of a contig the bases after the new gap will be shifted to the right One exception to this rule applies when the last base of a sample is selected in this case the g
303. ymes that have known recognition sites from this file You can edit or update the file used by Aligner However if you decide to modify the file it is a good idea to first make a copy of it This way you have a working enzyme file in case something unexpected happens when editing the file You can open and edit the file with a text editor When the file is open the version of the file is shown in the first line and the date of this version a few lines below To add your own enzymes to the file please make sure to use the right format Selecting Fragments 161 Closing Windows You can close regular Aligner windows for example the trace view and project view windows either by clicking on the close button at the top of the window or by choosing Close from the Window menu Aligner dialog windows for example the preference window can be closed by clicking on one of the buttons at the bottom often labeled Cancel and OK If a dialog window is active you need to close it before you can do anything else If you close the project view Aligner will check if the project has been modified since the last save If the project has unsaved changes Aligner will ask you if you want to save the changes first Closing the project window will also close all open windows that belong to the project If you are running Aligner on a Microsoft Windows operating system you also have a main root window which contains all other windows Closing the main w
304. you use sequences with quality scores For sequence traces that do not have qualities Aligner allows you to call bases with PHRED to get PHRED base calls and quality scores as described in the Base Calling with Phred section The following sections briefly explain the relation between quality scores and error probabilities which files Aligner can read quality scores from and how to view quality scores in Aligner Quality values explained Phred quality values represent the probability of error for each base call The quality value g assigned to each base call is defined to be q 10 xlogig p where p is the estimated error probability for the base call As indicated below a base call with a 1 in 100 probability of being incorrect will be assigned a quality value of 20 Quality Value Error Probability 10 lin 10 20 in 100 30 in 1000 40 in 10000 50 in 100000 For additional details about how Phred quality scores you can read the articles listed below Where quality values come from The first widely used program to produce highly accurate quality scores for each base call was the program PHRED Since then a number of other base calling programs have been introduced and modified to also produce Phred like quality scores The two most common file types with quality scores are e SCF Standard Chromatogram Format files produced by PHRED e ABI chromatogram files ab1 files processed with the KB base caller

CodonCode Aligner User Manual

Contents

Download Pdf Manuals

Related Search

Related Contents