User Manual - System Biosciences
Contents
1. 19 29 nt in length usually longer oligos 25 27 nt have slightly better silencing efficiencies although 19 nt oligos are more commonly used Unique sequence 7096 Homology with other sequences in a RefSeq database 4096 5096 GC content No more than 4 consecutive A s or T s No more than 5 consecutive G s or C s No thermodynamically stable secondary structure lt O Kcal mol A 5 terminus on the anti sense strand that is more AT rich than the 3 terminus For each selected sequence two complementary siRNA oligonucleotides a sense strand and an anti sense strand need to be synthesized then annealed before the phosphorylation and ligation steps Below are guidelines for synthesis of the siRNA template oligonucleotides 1 2 A 50 nmol scale reaction for DNA oligonucleotide synthesis with regular desalting purification is sufficient for cloning into the pFIV Vectors For the best cloning efficiency we recommend using phosphorylated oligonucleotides which can typically be ordered from the supplier Alternatively you can phosphorylate the oligonucleotides after synthesis using T4 polynucleotide kinase The phosphorylation procedure is shown below in step B 2 In addition to the sense or anti sense siRNA sequence the oligonucleotide needs to include a 4 base sequence at the 5 end of each oligonucleotide AAAG on sense strand and AAAA on the anti sense strand These sequences form sticky ends that facilitate ligatio2. Annealing Buffer in step 3 a Setup 10 ul phosphorylation reactions for each experimental siRNA template as follows ul Annealed ds siRNA template oligos 100 ng ul ul 10X T4 Polynucleotide Kinase Buffer ul 10 mM ATP ul Deionized water 1 ul T4 Polynucleotide Kinase 10 U ul 10 ul Total volume or a For the insert minus control use 1 ul 1X Annealing Buffer For the positive control use 1 ul of the Luciferase Control Oligonucleotide b Incubate the phosphorylation reaction at 37 C for 30 minutes To stop the reaction heat at 70 C for 10 min c Use 1 pul 10 ng for the following ligation reaction Page 10 ver 2 041015 www systembio com Double Promoter pFIV H1 U6 siRNA Vectors Cat 4 SI110A 1 SI111A 1 3 Ligate the Template siRNA a Setup 10 ul ligation reactions for each phosphorylated siRNA template as follows 2 5 ul Linearized pFIV H1 U6 Vector 20 ng ul 1 0 ul Phosphorylated ds siRNA template step 2 10 ng ul 1 0 ul 10X T4 DNA Ligase Buffer 4 5 ul Deionized water 1 0 ul T4 DNA ligase 5 U l 10 0 ul Total volume For controls use insert minus and positive control from step 2 b Incubate the ligation reaction at 16 C for 2 4 hrs 4 Transform E coli with the ligation product a For each experimental siRNA template use the whole volume of ligation product for transformation b Follow the manufacturer s protocol for transforming the competent cells Plate an appropriate amount of ce
3. Biosciences SBI 888 266 5066 Toll Free 650 968 2200 outside US Page 27
4. gene under the control of a constitutive CMV promoter and a WPRE regulatory element to enable selection of target cells stably expressing the siRNA template The pFIV H1 U6 copGFP Vector Cat 4 SI111A 1 contains a copGFP reporter gene under the CMV promoter and WPRE element CopGFP is a novel fluorescent protein derived from copepod plankton Panalina sp which is similar to EGFP but has a brighter color D Double Promoter pFIV siRNA Vectors The unique double promoter lentiviral pFIV H1 U6 siRNA Cloning Vectors contain opposing modified RNA polymerase III promoters H1 and U6 that flank the siRNA template Fig 1 The pFIV H1 U6 Vectors already have terminator sequences Ts just upstream of the transcriptional start sites see Figs 1 and 2 After transcription the resulting ds siRNA product has the same structure as natural double stranded siRNA and does not require the dicer processing step as is the case with short hairpin RNA also known as shRNA The 888 266 5066 Toll Free 650 968 2200 outside US Page 3 System Biosciences SBI User Manual double promoter pFIV H1 U6 Vectors also provide higher stability of siRNA template inserts during propagation in E coli because it does not contain a hairpin structure that is often removed during bacterial replication This increased stability is very critical for construction of representative high complexity siRNA libraries In addition shorter siRNA sequences are less costly t
5. of 3 ALTR to ensure self inactivation of the lentiviral vector after transduction and integration of the sequences into the genomic DNA of the target cells To avoid any possible contamination and maintain a clean laboratory environment we also recommend following these standard safety practices e Wear double gloves face protection and lab coat at all times e Perform work in a limited access area in a Biological Safety Cabinet Class Il and post biohazard warning signs e Minimize splashes or aerosols with careful pipetting e Take precautions with needles blades etc e Decontaminate work surfaces at least once a day and after any spill of viable material e Decontaminate all cultures stocks and other biological wastes before disposal using approved decontamination methods such as autoclaving Before decontamination the biological materials should be placed in a sealed durable leak proof container for transport from the laboratory Page 8 ver 2 041015 www systembio com Double Promoter pFIV H1 U6 siRNA Vectors Cat 4 SI110A 1 SI111A 1 Il Protocol A siRNA Oligonucleotide Design and Synthesis Typically 4 or 5 target sequences in the gene of interest need to be selected and tested to identify functional siRNA oligonucleotides with at least 70 silencing efficiency of target mRNA Although there is no standard rule for selecting the target binding sites for siRNA sequences we have found the following criteria useful
6. plasmid form into the cells with low to medium efficiency using conventional transfection protocols However by packaging the lentiviral siRNA vector construct in viral particles you can obtain highly efficient transduction and heritable expression of siRNA even with most difficult to transfect cells like primary stem and differentiated cells Page 2 ver 2 041015 www systembio com Double Promoter pFIV H1 U6 siRNA Vectors Cat 4 SI110A 1 SH11A 1 The lentiviral siRNA expression system consists of three main components 1 The lentiviral expression vector 2 The lentiviral packaging vector 3 A packaging cell line The lentiviral expression vector contains the genetic elements responsible for packaging transduction stable integration of the viral expression construct into genomic DNA and expression of the siRNA effector sequence The packaging vector provides all the proteins essential for transcription and packaging of an RNA copy of the expression construct into recombinant viral particles To produce a high titer of viral particles transiently co transfect packaging cells e g HEK 293 cells with the expression and packaging vectors The most popular lentiviral expression system is HIV based Abbas Terki 2002 Qin 2003 Wiznerowicz 2003 In spite of improved biosafety features third generation HIV cloning vectors still pose a slight biohazard risk due to possible recombination with endogenous viral sequences to form a self re
7. these siRNA constructs in a wide range of cells It is biologically safer than similar siRNA expression vectors that are based on HIV e pFIV PACKTM Lentiviral Vector Packaging Kit Cat 4 LV100A 1 A unique lentiviral vector that produces all the necessary FIV viral proteins and the VSV G envelop glycoprotein from vesicular stomatitis virus required to make active pseudoviral particles 293T cells ATCC Cat CRL 11268 transiently transfected with the pFIV PACK and one of the pFIV siRNA Vectors produce packaged viral particles containing a pFIV siRNA Vector e Packaged Transduction Control pFIV copGFP Reporter Vector Cat LV200A 1 Page 24 ver 2 041015 www systembio com Double Promoter pFIV H1 U6 siRNA Vectors Cat 4 SI110A 1 SI111A 1 O Useful Oligonucleotide Conversion Factors e The average molecular weight of a nucleotide is 330 N bases of single stranded DNA 330 X N N bases of double stranded DNA 660 X N e 1iguMz1 umol L 1 nmol ml 1 pmol u e Mass concentration to molar concentration ug ul uM X molecular weight 109 Sample calculation for a 20 mer Calculate the mass concentration for 100 nmol of a 20 base single stranded oligonucleotide in 500 ul of water Molecular weight for a single stranded 20 mer 20 x 330 6600 Molar concentration for 100 nmol in 500 ul 100 nmol in 500 ul 200 nmol ml 200 uM Mass concentration for a 200uM solution 200 uM X 6600 10 1 32 ug ul E Technical Supp
8. 0 5 ul 5 ul Taq DNA polymerase approx 5 U ul 24 0 ul 240 ul Total volume Optional To confirm the insert in the reverse direction replace the first two components with the H1 PCR primer and the sense strand siRNA oligonucleotide Mix the master mix very well and aliquot 24 ul into each well of 96 well PCR plate or individual tubes Add 1 ul of each bacterial culture from C 1 into each well or tube from C 2 b Mix Proceed with PCR using the following program 94 C 4 min 1 cycle 94 C 0 5 min then 68 C 1 min 25 cycles 68 C 3 min 1 cycle Take 5 ul of PCR product from step d and run it on a 2 396 agarose EtBr gel in 1X TAE buffer Only those clones with a correct insert will amplify For 19 bp siRNA templates the expected size of amplified siRNA inserts should be 87 bp if using the U6 PCR primer and anti sense strand siRNA oligo If you are using the H1 PCR primer and sense strand oligo the product should be 95 bp Grow a positive clone in an appropriate amount of LB Amp Broth and purify the plasmid construct using an endotoxin free plasmid purification kit see Section I F 888 266 5066 Toll Free 650 968 2200 outside US Page 13 System Biosciences SBI User Manual D Transfection and Analysis of Silencing Efficiency If you are planning to use SBI s pFIV siRNA vectors for viral delivery first screen the siRNA constructs generated in section C to determine their effectiveness at knocking down expression o
9. 0 ul pFIV H1 U6 Puro M vector linearized 20 ng ul 25 ul Luciferase Control siRNA Oligonucleotide annealed 100 ng ul 25 ul H1 PCR primer 5 CTGGGAAATCACCATAAACGTGAA 3 10 uM 25 ul U6 PCR primer 5 GCTTACCGTAACTTGAAAGTATTTCG 3 10 uM e pFIV H1 U6 copGFP siRNA Cloning and Expression Vector Cat 4 SI111A 1 50 wl pFIV H1 U6 copGFP vector linearized 20 ng ul 25 ul Luciferase Control siRNA Oligonucleotide annealed 100 ng ul 25 ul H1 PCR primer 5 CTGGGAAATCACCATAAACGTGAA 3 10 uM 25 ul U6 PCR primer 5 GCTTACCGTAACTTGAAAGTATTTCG 3 10 uM The kits are shipped in dry ice and should be stored at 20 C upon receipt Properly stored kits are stable for 12 months from the date received F Additional Required Materials For Annealing siRNA Oligonucleotides e 2X DNA Annealing Buffer 20mM Tris pH 7 8 100mM NaCl 0 2mM EDTA For Phosphorylation of Annealed siRNA Oligonucleotides e T4 Polynucleotide Kinase Recommended New England BioLabs T4 Polynucleotide Kinase Cat 4 M0201S For Ligating and Transforming siRNA Vector Construct e T4 DNA Ligase and ligation reaction buffer Recommended New England BioLabs T4 DNA Ligase Cat M0202S Dilute to 5 U ul with the provided 1X reaction buffer just before use e Competent E coli cells RecA Recommended BDB Clontech Fusion Blue competent cells Cat 636700 e Petri plates containing LB Agar media with 50 ug ml Ampicillin For Screening siRNA Inserts e Taq DNA poly
10. 555 107 owned by The Regents of the University of California WPRE Technology System Biosciences SBI has a license to sell the Product containing WPRE under the terms described below Any use of the WPRE outside of SBI s Product or the Products intended use requires a license as detailed below Before using the Product containing WPRE please read the following license agreement If you do not agree to be bound by its terms contact SBI within 10 days for authorization to return the unused Product containing WPRE and to receive a full credit The WPRE technology is covered by patents issued to The Salk Institute for Biological Studies SBI grants you a non exclusive license to use the enclosed Product containing WPRE in its entirety for its intended use The Product containing WPRE is being transferred to you in furtherance of and reliance on such license Any use of WPRE outside of SBI s Product or the Product s intended use requires a license from the Salk Institute for Biological Studies This license agreement is effective until terminated You may terminate it at any time by destroying all Products containing WPRE in your control It will also terminate automatically if you fail to comply with the terms and conditions of the license agreement You shall upon termination of the license agreement destroy all Products containing WPRE in you control and so notify SBI in writing This License shall be governed in its interpretation an
11. SBI System Biosciences Double Promoter pFIV H1 U6 siRNA Cloning and Expression Vectors Cat SI110A 1 SI111A 1 User Manual Store kit at 20 C on receipt A limited use label license covers this product By use of this product you accept the terms and conditions outlined in the Licensing and Warranty Statement Ver 2 041015 contained in this user manual Double Promoter pFIV H1 U6 siRNA Vectors Cat 4 SI110A 1 SI111A 1 Contents l Introduction and Background A OVerVIeW o uel io I eese Etre a M er ia Re 2 B siRNA Technology oo eee eee 2 C FIV Lentiviral Expression System 2 D Double Promoter pFIV siRNA Transduction Vectors sss 3 E Listof Components sss 6 F Additional Required Materials sss 6 G Safety Guidelines ss 8 ll Protocol A siRNA Oligonucleotide Design and Synthesis 9 B Cloning of siRNA Template into pFIV H1 U6 Vector 10 C Identify Clones with siRNA Inserts 11 D Transfection and Analysis of Silencing Efficiency 14 Ill Troubleshooting A Using the Positive Control sss 15 B Troubleshooting Specific Results sss 15 IV References _ aaa 17 V Appendix A Features and Maps for pFIV H1 U6 Vectors 20 B Properties of copGFP Fluorescent Protein 24 C Related Products sss uuu 24 D Useful Oligonucleotide Conversions 25 E TechnicalS ppOrt 5 s s SEADE E AS a Da aa 25 VI Licensing and Warra
12. ci U S A 99 5515 5520 Tiscornia G Singer O Ikawa M Verma I M 2003 A general method for gene knockdown in mice by using lentiviral vectors expressing small interfering RNA Proc Natl Acad Sci U S A 100 1844 1848 Wiznerowicz M and Trono D 2003 Conditional suppression of cellular genes lentivirus vector mediated drug inducible RNA interference J Virology 16 8957 8961 888 266 5066 Toll Free 650 968 2200 outside US Page 17 System Biosciences SBI User Manual FIV vector reviews Curran MA Nolan GP Nonprimate lentiviral vectors Curr Top Microbiol Immunol 2002 261 75 105 Curran MA Nolan GP Recombinant feline immunodeficiency virus vectors Preparation and use Methods Mol Med 2002 69 335 50 Loewen N Barraza R Whitwam T Saenz DT Kemler Poeschla EM FIV Vectors Methods Mol Biol 2003 229 251 71 Naldini L Lentiviruses as gene transfer agents for delivery to non dividing cells Curr Opin Biotechnol 1998 Oct 9 5 457 63 Sauter SL Gasmi M FIV vector systems Somat Cell Mol Genet 2001 Nov 26 1 6 99 129 FIV vector applications Alisky JM Hughes SM Sauter SL Jolly D Dubensky TW Jr Staber PD Chiorini JA Davidson BL Transduction of murine cerebellar neurons with recombinant FIV and AAV5 vectors Neuroreport 2000 Aug 21 11 12 2669 73 Brooks Al Stein CS Hughes SM Heth J McCray PM Jr Sauter SL Johnston JC Cory Slechta DA Federoff HJ Davidson BL Functional correction o
13. d enforcement by the laws of California Contact for WPRE Licensing The Salk Institute for Biological Studies 10010 North Torrey Pines Road La Jolla CA 92037 Attn Office for Technology Management Phone 858 435 4100 extension 1275 Fax 858 450 0509 CMV Promoter The CMV promoter is covered under U S Patents 5 168 062 and 5 385 839 and its use is permitted for research purposes only Any other use of the CMV promoter requires a license from the University of lowa Research Foundation 214 Technology Innovation Center lowa City IA 52242 CopGFP Marker The product pFIV H1 U6 copGFP siRNA Cloning and Expression Vector contains a proprietary nucleic acid coding for a proprietary fluorescent protein s intended to be used for research purposes only Any use of the proprietary nucleic acids other than for research use is strictly prohibited USE IN ANY Page 26 ver 2 041015 www systembio com Double Promoter pFIV H1 U6 siRNA Vectors Cat 4 SI110A 1 SH11A 1 OTHER APPLICATION REQUIRES A LICENSE FROM EVROGEN To obtain such a license please contact Evrogen at license evrogen com SBI has pending patent applications on various features and components of the Product For information concerning licenses for commercial use contact SBI Purchase of the product does not grant any rights or license for use other than those explicitly listed in this Licensing and Warranty Statement Use of the Product for any use other than described expressl
14. er Manual B Properties of the CopGFP Fluorescent Protein The pFIV H1 U6 copGFP Vector contains the full length copGFP gene with optimized human codons for high level of expression of the fluorescent protein from the CMV promoter in mammalian cells The copGFP marker is a novel natural green monomeric GFP like protein from copepod Pontellina sp The copGFP protein is a non toxic non aggregating protein with fast protein maturation high stability at a wide range of pH pH 4 12 and does not require any additional cofactors or substrates The copGFP protein has very bright fluorescence that exceeds at least 1 3 times the brightness of EGFP the widely used Aequorea victoria GFP mutant The copGFP protein emits green fluorescence with the following characteristics emission wavelength max 502 nm excitation wavelength max 482 nm quantum yield 0 6 extinction coefficient 70 000 M cm Due to its exceptional properties copGFP is an excellent fluorescent marker which can be used instead of EGFP for monitoring delivery of FIV constructs into cells C Related Products e Single Promoter pFIV H1 siRNA Cloning Vectors gt pFIV H1 Puro siRNA Cloning and Expression Vector Cat 4 SI100B 1 gt pFIV H1 copGFP siRNA Cloning and Expression Vector Cat 4 SI101A 1 These FIV based single promoter siRNA cloning vectors allow you to clone short hairpin siRNA shRNA templates under the H1 promoter and efficiently transduce
15. f established central nervous system deficits in an animal model of lysosomal storage disease with feline immunodeficiency virus based vectors Proc Natl Acad Sci U S A 2002 Apr 30 99 9 6216 21 Crystal RG Bad for cats good for humans Modified feline immunodeficiency virus for gene therapy J Clin Invest 1999 Dec 104 11 1491 3 Curran MA Kaiser SM Achacoso PL Nolan GP Efficient transduction of nondividing cells by optimized feline immunodeficiency virus vectors Mol Ther 2000 Jan 1 1 31 8 Curran MA Ochoa MS Molano RD Pileggi A Inverardi L Kenyon NS Nolan GP Ricordi C Fenjves ES Efficient transduction of pancreatic islets by feline immunodeficiency virus vectors 1 Transplantation 2002 Aug 15 74 3 299 306 DePolo NJ Reed JD Sheridan PL Townsend K Sauter SL Jolly DJ Dubensky TW Jr VSV G pseudotyped lentiviral vector particles produced in human cells are inactivated by human serum Mol Ther 2000 Sep 2 3 218 22 Derksen TA Sauter SL Davidson BL Feline immunodeficiency virus vectors Gene transfer to mouse retina following intravitreal injection J Gene Med 2002 Sep Oct 4 5 463 9 Haskell RE Hughes SM Chiorini JA Alisky JM Davidson BL Viral mediated delivery of the late infantile neuronal ceroid lipofuscinosis gene TPP I to the mouse central nervous system Gene Ther 2003 Jan 10 1 34 42 Hughes SM Moussavi Harami F Sauter SL Davidson BL Viral mediated gene transfer to mouse primary
16. f the target gene of interest To rapidly screen the lentiviral siRNA constructs in plasmid form you can deliver and express them in HeLa or HEK 293 cells using chemical transfection For example with these cells the Lipofectamine Reagent Invitrogen Cat 18324 111 with Plus Reagent Invitrogen Cat 11514 015 system works well Alternatively you can use your target cells for this analysis If you have already established a transfection method for your target cells use your established conditions If you do not have an established transfection protocol we recommend you compare efficiencies of several transfection procedures e g Invitrogen s Lipofectamine 2000 Cat 4 11668 027 BDB Clontech s CLONfectin Cat 631301 For siRNA knockdown studies using transfection it is important to optimize the selected transfection protocol and then keep the parameters constant to ensure reproducible results Depending on what is appropriate for your target gene the silencing efficiency of different SiRNA constructs can be estimated by determining the concentration of target mRNA using RT PCR assessing the amount of target protein by Western blot or ELISA or assaying for activity of the target protein Usually siRNA constructs with 70 80 silencing efficiency are suitable for gene functional analysis studies Once you identify a functional siRNA construct you can package this construct into FIV pseudoviral particles and efficiently tra
17. fy the size of the oligonucleotides using a 12 native polyacrylamide gel Check quality of T4 polynucleotide kinase and T4 DNA ligase Test the activity of your ligase and reaction buffer using a different vector and insert Test the activity of T4 polynucleotide kinase by labeling annealed control Luciferase with 2P yATP Replace the reagents if they show poor activity 888 266 5066 Toll Free 650 968 2200 outside US Page 15 System Biosciences SBI User Manual Ensure there are no ligation inhibitors present EDTA and high salt can inhibit ligation reactions Make sure that your double strand oligonucleotide concentration is only 100 ng ul and that you dilute it at least 10 fold before adding it to the ligation reaction Check the quality of the competent cells Handle the competent cells gently Many cells can not be refrozen once thawed The quality of the competent cell can be tested by transforming with any circular plasmid Check antibiotic selection The plates used for cloning should contain 50 100 pg ml ampicillin in the media You can check the activity of the antibiotic by mixing wild type E coli with small numbers of E coli that have been successfully transformed with any plasmid containing the Amp gene 2 No product was amplified from selected clones Confirm activity of the Taq DNA polymerase Test the activity of the enzyme reaction by amplifying a known sequence from any plasmid DNA Replace the reagents if they demons
18. g Staal F 2003 Lentiviral nucleic acids and uses thereof US Patent NO 6 555 107 B2 Sauter SL Gasmi M Dubensky TW Jr A highly efficient gene delivery system derived from feline immunodeficiency virus FIV Methods Mol Med 2003 76 405 32 Song JJ Lee B Chang JW Kim JH Kwon YK Lee H Optimization of vesicular stomatitis virus G pseudotyped feline immunodeficiency virus vector for minimized cytotoxicity with efficient gene transfer Virus Res 2003 May 93 1 25 30 888 266 5066 Toll Free 650 968 2200 outside US Page 19 System Biosciences SBI User Manual V Appendix A Maps and Features for pFIV H1 U6 Vectors pFIV H1 U6 Puro Map CMV 5 LTR RRE cPPT pFIV HT1 U6 Puro 6345 bp d pUC ORI Puro SV40 ORI SV40 Poly A Bbs Bbsl Nr U6 Hl 3 ALTR Page 20 ver 2 041015 www systembio com Double Promoter pFIV H1 U6 siRNA Vectors Cat 4 SI110A 1 SH11A 1 pFIV H1 U6 Puro Features Feature Location Function CMV 5 LTR 1415 Hybrid CMV promoter sr R U5 lo long terminal repeat E rs for viral packaging and transcription E 762 1011 Packaging signal O O signal Rev response element binds gag and involved in 1012 1143 packaging of viral transcripts Central purine pyrimidine tract includes DNA Flap cPPT 1150 1391 region involved in nuclear translocation and integration of transduced viral genome CMV promoter 1394 1745 o promoter for transcription of Puro Puro 1753 2352 Puromyci
19. g and transcription E 762 1011 Packaging signal Rev response element binds gag and involved in 1012 1143 packaging of viral transcripts Central purine pyrimidine tract includes DNA Flap cPPT 1150 1391 region involved in nuclear translocation and integration of transduced viral genome CMV promoter 1394 1745 ss promoter for transcription of copGFP eae green fluorescent protein similar to CopGFP 1753 2511 regular EGFP but with brighter color as a reporter for the transfected transduced cells WPRE 2518 3046 Posttranscriptional regulatory element which enhances the stability of the viral transcripts Required for viral reverse transcription self 3 ALTR AU3 3152 3700 inactivating 3 LTR with deletion in U3 region l prevents formation of replication competent viral particles after integration into genomic DNA H1 RNA promoter 3210 3300 RNA polymerase IIl promoter for expression of siRNA insert U6 RNA promoter 3353 3595 C RNA polymerase IIl promoter for expression of SiRNA insert SV40 Poly A 3788 3919 Transcription termination and polyadenylation SV40 Ori 3928 4074 Allows for episomal replication of plasmid in eukaryotic cells pUC Ori 4444 5117 C Allows for high copy replication in E coli AmpR 5262 6122 C Ampicillin resistant gene for selection of the plasmid in E coli The notation C refers to the complementary strand 888 266 5066 Toll Free 650 968 2200 outside US Page 23 System Biosciences SBI Us
20. h well of 96 well PCR plate or individual tubes c Add 1 ul of each bacterial culture from C 1 into each well or tube from C 2 b Mix d Proceed with PCR using the following program 94 C 4 min 1 cycle 94 C 0 5 min then 68 C 1 min 25 cycles 68 C 3 min 1 cycle Dilute BamHI enzyme to 5 U ul in 1X BamHI buffer Take 15 ul of PCR product from step d and add 1 ul of diluted BamHI from step e Mix Incubate at 37 C for 30 min Take 5 ul of the digestion reaction and run it on a 2 3 agarose EtBr gel in 1X TAE buffer zaro PCR product from clones without an insert will be digested resulting in two bands at 81 and 91 bp Product from positive clones will not be digested and the resulting band is 163 bp for 19 bp siRNA templates see Fig 2 Grow a positive clone in an appropriate amount of LB Amp Broth and purify the plasmid construct using an endotoxin free plasmid purification kit see Section F Page 12 ver 2 041015 www systembio com Double Promoter pFIV H1 U6 siRNA Vectors Cat 4 SI110A 1 SI111A 1 2A Screen for siRNA template inseris Alternative Protocol a Prepare a PCR master mix for each clone you would like to screen for the presence of an siRNA template insert as follows rxn 10 rxn Composition 0 5 ul 5 ul U6 PCR primer 10 uM 0 5 ul 5 ul Anti sense strand siRNA oligonucleotide 10 uM 0 5 ul 5 ul 50X dNTP mix 10 mM of each 2 5 ul 25 ul 10X PCR Reaction Buffer 19 5 ul 195 ul Deionized water
21. hould provide 2 10 times more colonies than ligation of the vector without an insert The control pFIV construct with the Luciferase siRNA template can also be used to monitor the efficiency of target Luciferase mRNA silencing A cell line with a constant expression level of Luciferase can easily be generated The level of Luciferase expression should be reduced at least 5 fold after transfection or transduction of the pFIV H1 Luciferase siRNA construct in the cell B Troubleshooting Specific Results 1 Getting Few or No Clones Check design of the siRNA template Check the sequence of the siRNA oligonucleotides to ensure that after sense anti sense annealing the ends present the 5 AAAG and 5 AAAA overhangs for proper annealing with the restricted ends of linear pFIV H1 U6 Vector Also confirm that the sense and anti sense strands sequences reverse complement each other Check sense anti sense annealing To ensure a high percentage 8096 of double stranded DNA after annealing check the concentration of siRNA oligonucleotides using a spectrophotometer and mix equal molar amounts of each strand For optimal annealing turn off the thermocycler after denaturation and let the tubes cool down to room temperature Evaluate 5 ul of annealed insert from step II B 1 e using a 12 polyacrylamide gel and compare the band s location with that of the original single stranded oligonucleotides Confirm oligonucleotides were correctly synthesized Veri
22. lls on LB plates with 50 ug ml ampicillin and grow overnight at 37 C C Identify clones with the target siRNA template 1 Prepare colony cultures a Randomly pick up 10 well separated colonies from each plate and grow each clone in 100 ul of LB Broth with 100 ug ml ampicillin at 37 C for 2 hours with shaking b Take 1 ul of each bacteria culture for PCR screening see C 2 and continue to grow the culture for another 6 hours c Store the bacterial culture at 4 C 888 266 5066 Toll Free 650 968 2200 outside US Page 11 System Biosciences SBI User Manual 2 Screen for siRNA template inserts There are two options for insert screening The first is screening using the H1 and U6 PCR primers provided in the kit followed by digestion of the PCR product by BamHI which is only present in negative clones Alternatively you can simply use your anti sense strand siRNA oligo and U6 PCR primer or sense strand siRNA oligo and H1 PCR primer to amplify only positive clones a Prepare a PCR master mix for each clone you would like to screen for the presence of an siRNA template insert as follows 1rxn 10 rxn Composition 0 5 ul 5 ul H1 PCR primer 10 uM 0 5 ul 5 ul U6 PCR primer 10 uM 0 5 ul 5 ul 50X dNTP mix 10 mM of each 2 5 ul 25 yl 10X PCR Reaction Buffer 19 5 ul 195 ul Deionized water 0 5 ul 5 ul Taq DNA polymerase approx 5 U ul 24 0 ul 240 ul Total volume b Mix the master mix very well and aliquot 24 ul into eac
23. merase reaction buffer and dNTP mix Recommended BDB Clontech Titanium Taq DNA polymerase Cat 639208 e PCR machine e BamHI enzyme New England BioLabs Cat RO136M e 2 396 AX TAE Agarose gel Page 6 ver 2 041015 www systembio com Double Promoter pFIV H1 U6 siRNA Vectors Cat 4 SI110A 1 SI111A 1 For Purifying siRNA Vectors after Cloning e Plasmid purification kit Recommended QIAGEN Endotoxin free Plasmid Kit The following kit combinations can be used for Midi scale preparation of endotoxin free DNA gt QIAfilter Plasmid Midi Kit Cat 4 12243 and EndoFree Plasmid Maxi Kit Cat 12362 gt QIAfilter Plasmid Midi Kit Cat 12243 and EndoFree Plasmid Buffer Set Cat 19048 Please visit the QIAGEN website to download the specialized protocol that is not contained in the user manual gt http www1 giagen com literature protocols pdf QP 15 pdf 888 266 5066 Toll Free 650 968 2200 outside US Page 7 System Biosciences SBI User Manual G Safety Guidelines The feline immunodeficiency virus FIV was originally isolated from cat blood Despite common close exposure of humans to FIV through contact with domestic cats including bites scratches etc no human infection or disease has ever been associated with FIV Poeschla 2003 Work with FIV based viruses falls within NIH Biosafety Level 2 criteria For a detailed description of laboratory biosafety level criteria consult the following pages on the Cen
24. n resistant marker for selection of the transfected transduced cells WPRE 2359 2887 Posttranscriptional regulatory element which enhances the stability of the viral transcripts Required for viral reverse transcription self 3 ALTR AU3 2993 3541 inactivating 3 LTR with deletion in U3 region prevents formation of replication competent viral particles after integration into genomic DNA H1 RNA promoter 3051 3141 RNA polymerase IIl promoter for expression of siRNA insert U6 RNA promoter 3194 3436 C RNA polymerase IIl promoter for expression of siRNA insert SV40 Poly A 3629 3760 Transcription termination and polyadenylation SV40 Ori 3769 3915 Allows for episomal replication of plasmid in eukaryotic cells pUC Ori 4285 4958 C Allows for high copy replication in E coli AmpR 5103 5963 C Ampicillin resistant gene for selection of the plasmid in E coli The notation C refers to the complementary strand 888 266 5066 Toll Free 650 968 2200 outside US Page 21 System Biosciences SBI User Manual pFIV H1 U6 copGFP Map CMV 5 LTR RRE cPPT pFIV HT U6 copGFP 6504 bp CMV pUC ORI copGFP SV40 ORI i pa U6 HI 3 ALTR Page 22 ver 2 041015 www systembio com Double Promoter pFIV H1 U6 siRNA Vectors Cat 4 SI110A 1 SI111A 1 pFIV H1 U6 copGFP Features Feature Location Function CMV 5 LTR 1 415 Hybrid CMV promoter sr R U5 lo long terminal repeat required for viral packagin
25. n with the Bbsl digested vector The annealed sequences should have a double stranded siRNA structure as shown in the following diagram See also Fig 1 Sense top 5 AAAGNNNNNNNNNNNNNNNNNNN 3 3 NNNNNNNNNNNNNNNNNNNAAAA 5 Anti sense bottom 888 266 5066 Toll Free 650 968 2200 outside US Page 9 System Biosciences SBI User Manual B Cloning of siRNA Template into pFIV H1 U6 Vector 1 Anneal siRNA Oligonucleotides a Dissolve the siRNA oligonucleotides in an appropriate amount of deionized water to a final concentration of 1 ug ul b Prepare the ds siRNA oligonucleotide as follows 2 5 ul Sense strand siRNA oligonucleotide 2 5 ul Anti sense strand siRNA oligonucleotide 25 0 ul 2X Annealing Buffer 20 0 ul Deionized water 50 0 ul Total volume c Heatthe mixture to 95 C for 5 min in a thermocycler or heating block Turn off the thermocycler or heating block and let it cool to room temperature The annealed oligonucleotide 100 ng ul is ready for phosphorylation and ligation steps Store the annealed oligonucleotides at 20 C until use 2 Phosphorylate the Template siRNA Note If your oligonucleotides are already phosphorylated dilute them to 10 ng ul in 1X Annealing Buffer skip this phosphorylation step and proceed to ligation in step 3 However you must phosphorylate the Luciferase Control Oligonucleotide before continuing with step 3 For the insert minus control you may either follow step 2 or use 1 ul
26. ne transfer to airway epithelia using feline immunodeficiency virus based lentivirus vectors Methods Enzymol 2002 346 500 14 Wang G Slepushkin V Zabner J Keshavjee S Johnston JC Sauter SL Jolly DJ Dubensky TW Jr Davidson BL McCray PB Jr Feline immunodeficiency virus vectors persistently transduce nondividing airway epithelia and correct the cystic fibrosis defect J Clin Invest 1999 Dec 104 11 R55 62 FIV vector system development Browning MT Schmidt RD Lew KA Rizvi TA Primate and feline lentivirus vector RNA packaging and propagation by heterologous lentivirus virions J Virol 2001 Jun 75 11 5129 40 Curran MA Kaiser SM Achacoso PL Nolan GP Efficient transduction of nondividing cells by optimized feline immunodeficiency virus vectors Mol Ther 2000 Jan 1 1 31 8 Johnston JC Gasmi M Lim LE Elder JH Yee JK Jolly DJ Campbell KP Davidson BL Sauter SL Minimum requirements for efficient transduction of dividing and nondividing cells by feline immunodeficiency virus vectors J Virol 1999 Jun 73 6 4991 5000 Johnston J Power C Productive infection of human peripheral blood mononuclear cells by feline immunodeficiency virus implications for vector development J Virol 1999 Mar 73 3 2491 8 Poeschla EM Wong Staal F Looney DJ Efficient transduction of nondividing human cells by feline immunodeficiency virus lentiviral vectors Nat Med 1998 Mar 4 3 354 7 Poeschla E M Looney D J and Won
27. neural progenitor cells Mol Ther 2002 Jan 5 1 16 24 Page 18 ver 2 041015 www systembio com Double Promoter pFIV H1 U6 siRNA Vectors Cat 4 SI110A 1 SI111A 1 Kang Y Stein CS Heth JA Sinn PL Penisten AK Staber PD Ratliff KL Shen H Barker CK Martins Sharkey CM Sanders DA McCray PB Jr Davidson BL In vivo gene transfer using a nonprimate lentiviral vector pseudotyped with Ross River Virus glycoproteins J Virol 2002 Sep 76 18 9378 88 Lotery AJ Derksen TA Russell SR Mullins RF Sauter S Affatigato LM Stone EM Davidson BL Gene transfer to the nonhuman primate retina with recombinant feline immunodeficiency virus vectors Hum Gene Ther 2002 Apr 10 13 6 689 96 Price MA Case SS Carbonaro DA Yu XJ Petersen D Sabo KM Curran MA Engel BC Margarian H Abkowitz JL Nolan GP Kohn DB Crooks GM Expression from second generation feline immunodeficiency virus vectors is impaired in human hematopoietic cells Mol Ther 2002 Nov 6 5 645 52 Sinn PL Hickey MA Staber PD Dylla DE Jeffers SA Davidson BL Sanders DA McCray PB Jr Lentivirus vectors pseudotyped with filoviral envelope glycoproteins transduce airway epithelia from the apical surface independently of folate receptor alpha J Virol 2003 May 77 10 5902 10 Stein CS Davidson BL Gene transfer to the brain using feline immunodeficiency virus based lentivirus vectors Methods Enzymol 2002 346 433 54 Wang G Sinn PL Zabner J McCray PB Jr Ge
28. nsduce it into any target cells of choice For this purpose you will need to purchase the pFIV PACKTM Lentiviral Vector Packaging Kit from SBI Cat LV100A 1 and HEK 293T cells ATCC Cat CRL 11268 The pFIV PACK User Manual includes the procedural information for packaging the viral vector This user manual is also available on the SBI web site www systembio com Although you can create stable transfectants with the pFIV construct using standard transfection and selection protocols transduction of the lentiviral pFIV siRNA construct using packaged pseudoviral particles is the most efficient way to express siRNA in wide range of cells including dividing non dividing and hard to transfect varieties Page 14 ver 2 041015 www systembio com Double Promoter pFIV H1 U6 siRNA Vectors Cat 4 SI110A 1 SI111A 1 Ill Troubleshooting A Using the Positive Control The Luciferase Control siRNA Oligonucleotide is a double stranded DNA fragment with sticky ends 5 AAAG and 5 AAAA to match with the Bbsl digested ends on the linearized pFIV H1 U6 vector The 19 base siRNA template sequence targets the Luciferase gene When run in parallel with your experimental annealed double stranded siRNA oligonucleotides Luciferase Control siRNA Oligonucleotide serves as positive control to check if your phosphorylation and ligation reactions and transformation procedure work well Using the protocol described in II B ligation with this control insert s
29. nty Statement anaa 26 888 266 5066 Toll Free 650 968 2200 outside US Page 1 System Biosciences SBI User Manual I Introduction and Background A Overview This manual provides details and information necessary to clone an siRNA template into the double promoter pFIV H1 U6 siRNA Cloning and Expression Vectors pFIV H1 U6 PuroTM and pFIV H1 U6 copGFP Vectors Specifically it provides critical instructions on designing and synthesizing siRNA templates cloning the siRNA templates into the pFIV H1 U6 Vectors and confirming successful cloning This manual does not include information on packaging pFIV H1 U6 Vector constructs into pseudoviral particles or transducing your target cells of choice with these particles This information is available in the user manual provided with the pFIV Lentiviral Vector Packaging Kit from SBI Cat LV100A 1 which is available on the SBI web site www systembio com Before using the reagents and material supplied with this system please read the entire manual B siRNA Technology Short double stranded RNAs with sizes 19 29 bp can efficiently mediate gene silencing in mammalian cells by guiding sequence specific degradation of target mRNA sequences Bernstein 2001 Hammond 2000 Synthetic double stranded siRNA molecules can be introduced into cells to suppress gene expression transiently Alternatively siRNA templates can be cloned into an siRNA expression vector such as SBl s pFIV Serie
30. o produce and are easier to clone These advantages make the double promoter pFIV H1 U6 siRNA Vectors highly suitable for siRNA library construction as well as convenient for cloning and expressing single siRNA sequences The pFIV H1 U6 Cloning Vectors are provided in a ready to ligate linearized form that has been digested with Bbsl and purified to remove the stuffer fragment The linearized vector contains two unique 5 overhangs to facilitate directional cloning with minimal self ligation background Fig 1 Two PCR primers that flank the H1 and U6 promoter regions are included to provide a simple way to screen plasmid clones for the presence of siRNA inserts Fig 2 1 Bbsl pBamHi Bbsl ri l l U6 promoter T d T H1 promoter Bbsl 1 GACGAARA s ms ue Rey eue SEO vus tttttagagtg CUGCUECECOECUC cms sis wv gana Wes d vs atctcac t Ligation sense 5 aaagGACTCCAGTGGTAATCTAC 3 3 CTGAGGTCACCATTAGATGaaaa 5 antisense p53 annealed siRNA oligos Fig 1 Design of double promoter siRNA cassette and siRNA template oligos The dotted lines in the middle of the figure indicate the position of the stuffer fragment that was removed by digesting the vector with Bbsl A BamHl site which is useful in screening see Fig 2 is located in the stuffer fragment The transcriptional start site is indicated by the arrows denoted 1 The Ts transcription terminators are also indicated On the bottom of the figure an example of the
31. ort For more information about SBI products to download manuals in PDF format and to get vector map and sequence information please visit our web site http www systembio com For additional information or technical assistance please call or e mail us at System Biosciences SBI 211 South Whisman Road Mountain View CA 94041 Phone 650 968 2200 888 266 5066 Toll Free Fax 650 968 2277 E mail info systembio com 888 266 5066 Toll Free 650 968 2200 outside US Page 25 System Biosciences SBI User Manual VI Licensing and Warranty Statement Limited Use License Use of the pFIV H1 U6 siRNA Cloning and Expression Vector i e the Product is subject to the following terms and conditions If the terms and conditions are not acceptable return all components of the Product to System Biosciences SBI within 7 calendar days Purchase and use of any part of the Product constitutes acceptance of the above terms FIV Vector System This Product is for non clinical research use only Use of this Product to produce products for sale or for any diagnostic therapeutic clinical including pre clinical veterinary or high throughput drug discovery purpose the screening of more than 10 000 compounds per day is prohibited In order to obtain a license to use this product for these commercial purposes contact The Regents of the University of California This Product or the use of this Product is covered by U S Patent No 6
32. plicating HIV virus SBI s novel pFIV siRNA Vectors address these issues since they are derived from feline immunodeficiency virus FIV Poeschla 2003 for Safety Guidelines when working with these vectors see section G In addition the pFIV Vectors developed at SBI are self inactivating as a result of a deletion in the U3 region of 3 ALTR see Appendix for Vector Features Upon integration into the genome the 5 LTR promoter is inactivated which prevents formation of replication competent viral particles When expressed the hybrid CMV FIV 5 LTR drives high level transcription of the viral construct and produces a transcript that contains all the necessary functional elements e Psi RRE and cPPT for efficient packaging When this construct is expressed in HEK 293 cells that also express viral coat proteins e a packaging cell line the pFIV transcripts are efficiently packaged into pseudoviral particles After isolation these pseudoviral particles containing the RNA version of the pFIV expression cassette can be efficiently transduced into any mammalian target cells Following transduction into the target cells this expression cassette is reverse transcribed and integrated into the genome of the target cell The pFIV H1 U6 Vectors also contain a bacterial origin of replication and ampicillin resistance Amp gene for propagation and selection in E coli The pFIV H1 U6 Puro Vector Cat SI110A 1 contains a puromycin resistance
33. s of siRNA Cloning and Expression Vectors and expressed in the cells of choice Endogenously expressed siRNA effectors provide long term silencing of the target gene and allow the researcher to generate cell lines and transgenic organisms with a stable knockdown phenotype for functional studies Two approaches have been developed for in vivo expression of siRNAs from plasmid and viral vectors In one approach the sense and anti sense strands are transcribed separately from two independent promoters and form the siRNA duplex Lee 2002 Miyagishi 2002 With the second approach a single stranded siRNA sequence with a fold back stem loop structure also known as a hairpin is expressed from a single promoter This sequence is then converted into double stranded siRNA after intracellular processing cleaves the loop Brummelkamp 2002 Paddison 2002 In both approaches the siRNA molecules are transcribed from constitutive RNA polymerase III promoters e U6 and or H1 and terminated with TTTTT Ts sequences Tuschl 2002 The U6 and H1 promoters are different in size but contain the same conserved sequence elements Myslinski 2001 C FIV Lentiviral siRNA Expression System Lentiviral expression vectors are the most effective vehicles for delivering genetic material to almost any mammalian cell including non dividing cells and whole model organisms As with standard plasmid vectors it is possible to introduce lentiviral siRNA constructs in
34. sequence for the p53 siRNA template oligonucleotides is shown Page 4 ver 2 041015 www systembio com Double Promoter pFIV H1 U6 siRNA Vectors Cat 4 SI110A 1 SI111A 1 163 bp H1 promoter U6 promoter T 1 siRNA template insert gacgaaaaaaagGACTCCAGTGGTAATCTACtttttagagtg ctgctttttttcCTGAGGTCACCATTAGATGaaaaatctcac di Transcription 1 sense 5 gGACUCCAGUGGUAAUCUACuu 3 3 uucCUGAGGUCACCAUUAGAUG 5 antisense ds p53 siRNA Transcript Fig 2 Transcription of the p53 example construct from a double promoter pFIV H1 U6 Vector Transcription of the p53 siRNA template starts at the indicated arrows and occurs simultaneously from both the H1 and U6 promoters The structure of the p53 siRNA molecule is shown Also shown is the location of the H1 and U6 PCR primers Amplification with these primers spans the cloning site and produces a 163 bp PCR product for the p53 siRNA sequence shown The size of the product is similar for both positive and negative clones because of the similarity in sizes of the insert and the stuffer fragment When screening for inserts the absence of the BamHI site see Fig 1 indicates a positive clone 888 266 5066 Toll Free 650 968 2200 outside US Page 5 System Biosciences SBI User Manual E List of Components Each pFIV H1 Vector Kit provides enough plasmid for 20 ligation reactions e pFIV H1 U6 Puro siRNA Cloning and Expression Vector Cat 4 SI110A 1 5
35. ters for Disease Control Office of Health and Safety Web site http www cdc gov od ohs biosfty bmbl4 bmbl4s3 htm http www cdc gov od ohs biosfty bmbl4 bmbl4toc htm Also you should consult the health and safety guidelines and officers at your institution regarding use and handling of the FIV lentiviral system In addition although the system itself has been designed to minimize possible risk specific recombinant FIV vector constructs may be potentially hazardous depending on the nature of introduced insert such as oncogenes toxins siRNA to tumor suppressor genes etc For these reasons it is critical to exercise due caution while working with recombinant lentiviruses To ensure safe laboratory handling you should thoroughly understand the biology of the lentiviral vectors and the specific modifications and design features of the SBI system with which you are working The original FIV viral vector was developed by Eric M Poeschla David J Looney and Flossie Wong Staal in UCSD Poeschla 2003 Based on this original FIV vector the pFIV H1 U6 Vectors for cloning and expressing siRNA were developed at SBI These vectors have been modified to remove sequences that overlap with the packaging plasmid to minimize the possibility for homologous recombination and generation of self replicating viral sequences when co transfecting these constructs into packaging cells SBI s pFIV H1 U6 vectors also have a deletion in the enhancer of the U3 region
36. trate poor activity Confirm pairing of the oligo sequence and PCR primer If you used the alternative insert screening protocol confirm that the sense strand oligonucleotide is paired with the H1 PCR primer and the anti sense strand sequence with the U6 PCR primer 3 None of the PCR products were digested with BamHI enzyme Confirm activity of the BamHI enzyme Test the activity of the enzyme reaction by digesting a DNA sequence known to have a BamHI restriction site Replace the reagents if they demonstrate poor activity Alternatively use the alternative insert screening protocol on page 13 Page 16 ver 2 041015 www systembio com Double Promoter pFIV H1 U6 siRNA Vectors Cat 4 SI110A 1 SI111A 1 IV References General references Abbas Terki Blanco Bose N Deglon Pralong W and Aebischer P 2002 Lentiviral mediated RNA interference Hum Gene Ther 13 2197 2201 Buchschacher G L and Wong Staal F 2000 Development of lentiviral vectors for gene theraphy for human diseases Blood 95 2499 2504 Burns J C Friedmann T Driever W Burrascano M and Yee J K 1993 Vesicular stomatitis virus G glycoprotein pseudotyped retroviral vectors concentration to a very high titer and efficient gene transfer into mammalian and non mammalian cells Proc Natl Acad Sci USA 90 8033 8034 Cann A J ed 2000 RNA Viruses A Practical Approach Oxford Univ Press Dull T Zufferey R Kelly M Mandel R J Ngu
37. y herein may be covered by patents or subject to rights other than those mentioned SBI disclaims any and all responsibility for injury or damage which may be caused by the failure of the buyer or any other person to use the Product in accordance with the terms and conditions outlined herein Limited Warranty SBI warrants that the Product meets the specifications described in the accompanying Product Analysis Certificate If it is proven to the satisfaction of SBI that the Product fails to meet these specifications SBI will replace the Product or provide the purchaser with a refund This limited warranty shall not extend to anyone other than the original purchaser of the Product Notice of nonconforming products must be made to SBI within 30 days of receipt of the Product SBI s liability is expressly limited to replacement of Product or a refund limited to the actual purchase price SBI s liability does not extend to any damages arising from use or improper use of the Product or losses associated with the use of additional materials or reagents This limited warranty is the sole and exclusive warranty SBI does not provide any other warranties of any kind expressed or implied including the merchantability or fitness of the Product for a particular purpose SBI is committed to providing our customers with high quality products If you should have any questions or concerns about any SBI products please contact us at 888 266 5066 O 2004 System
38. yen M Trono D and Naldini L 1998 A third generation lentivirus vector with a conditional packaging system J Virol 72 8463 8471 Gould D J and Favorov P 2003 Vectors for the treatment of autoimmune diseases Gene Therapy 10 912 927 Lee N S Dohjima T Bauer G Li H Li M J Ehsani A Salvaterra P and Rossi J 2002 Expression of small interfering RNAs targeted against HIV 1 rev transcripts in human cells Nature Biotechnol 20 500 505 Morgan R A Cornetta K and Anderson W F 1990 Application of the polymerase chain reaction in retroviral mediated gene transfer and the analysis of gene marked human TIL cells Hum Gene Ther 1 135 149 Pfeifer A Kessler T Yang M Baranov E Kootstra N Cheresh D A Hoffman R M and Verma I M 2001 Transduction of liver cells by lentiviral vectors Analysis in living animals by fluorescence imaging Mol Ther 3 319 322 Qin X F An D S Chen I S and Baltimore D 2003 Inhibiting HIV 1 infection in human T cells by lentiviral mediated delivery of small interfering RNA against CCR5 Proc Natl Acad Sci USA 100 183 188 Quinn T P and Trevor K T 1997 Rapid quantitation of recombinant retrovirus produced by packaging cell clones Biotechniques 23 1038 1044 Sui G Soohoo C Affar E B Gay F Forrester W C and Shi Y 2002 A DNA vector based RNAi technology to suppress gene expression in mammalian cells Proc Natl Acad S
Download Pdf Manuals
Related Search