CLONTECH
Contents
1. 1 OO 11 Dilute the 10 ng ul stock of pUC18 DNA 1 1 000 in sterile H O to a final concentration of 10 pg ul Keep the 10 pg ul solution on ice and store the 10 ng ul stock at C20 C Discard the diluted solutions when you finished because the DNA will degrade over time Onice thaw one 50 ul tube of frozen TOP10F E colicompetent cells Pipet 1 ul of the diluted pUC18 10 pg ul directly into the competent cells and mix by tapping gently Do not mix by pipetting up and down Incubate the tube on ice for 30 min Heat shock for exactly 30 sec in the 42 C water bath Do not mix or shake Remove the tube from the 42 water bath and place on ice for 2 min Add 250 ul of SOC medium at room temperature to the tube Shake the tube horizontally at 37 C for 1 hr at 225 rpm in a rotary shaking incubator Place the tube with the transformed cells on ice Spread 50 ul from the transformation on a labeled LB X Gal IPTG plate containing 50 ug ml ampicillin Make sure the liquid is absorbed then invert the plate and place itin a 37 incubator overnight Expected Results The Transformation Control should yield about 100 colonies per 50 ul The transformation efficiency of the TOP10F E coli competent cells is at least 1 x 108 transformants per ug of supercoiled plasmid Protocol 4 PT3067 1 www clontech com CLONTECH Laboratories Inc Version PR01082 21 AdvanTAge PCR Cloning Kit2. A overhangs Even if your PCR application requires Ventor Pfu or you wish to clone blunt ended fragments you may add 3 A overhangs by incubating with Taq polymerase at the end of your cycling program see the Appendix Although CLONTECH s Advantage and Advantage 2 Polymerase Mixes contain a minor amount of proofreading enzyme PCR products will still have A overhangs and can be cloned into pT Adv The versatile pT Adv Vector Figure 2 is manufactured using methods that yield the highest reliability and recombination efficiency The vector includes priming sites for T7 RNA polymerase and flanking M13 forward and reverse primer sites for direct sequencing It also includes a T7 promoter for RNA transcription and translation A diverse multiple cloning site makes it easy to subclone your PCR product into the expression vector of your choice In addition the lacZa gene provides a simple blue white visual assay for rapid identification of positive clones Applications The AdvanTAge PCR Cloning Kit makes it easy to clone and characterize products generated using CLONTECH s PCR application kits For example after you obtain your full length cDNA using the Marathon cDNA Amplification Kit K1802 or SMART RACE cDNA Amplification Kit K1811 1 clone it into pT Adv for further analysis Similarly the AdvanTAge Kit can be used to clone differentially expressed genes identified using the CLONTECH PCR Select cDNA Subtraction Kit K1804 1
3. C 1991 Maximizing sensitivity and specificity of PCR by preamplification heating Nucleic Acids Res 19 3749 Faloona F Weiss S Ferre F amp Mullis 1990 Direct detection of HIV sequences in blood high gain polymerase chain reaction 6th Int l Conf AIDS San Francisco CA Abstr 1019 Innis M A Gelfand D H Sninsky J J amp White T J Eds 1990 PCR Protocols A Guide to Methods and Applications Academic Press Inc San Diego CA Mead D A Pey N K Herrnstadt C Marcil R A amp Smith L M 1991 A universal method for the direct cloning of PCR amplified nucleic acid Bio Technology 9 657 663 Sambrook J Fritsch E F amp Maniatis T 1989 Molecular Cloning A Laboratory Manual Second Edition Cold Spring Harbor Laboratory Press Plainview New York CLONTECH Laboratories Inc www clontech com Protocol 4 PT3067 1 Version PR01082 AdvanTAge PCR Cloning Kit User Manual IX Related Products Product Catalog GenomeWalker Kits many e Advantage 2 PCR Kit K1910 1 y Advantage 2 Polymerase Mix 8430 1 2 e AdvanTaq DNA Polymerase 8432 1 2 e AdvanTaq Plus DNA Polymerase 8431 1 2 e AdvanTaq PCR Kit K1912 1 y AdvanTaq Plus PCR Kit K1911 1 y Advantage GC 2 Polymerase Mix 8433 1 e Advantage GC 2 PCR Kit K1913 1 y Advantage HF 2 PCR Kit K1914 1 y e Advantage Genomic PCR Kit K1906 1 y e Advantage Genomic Polymerase Mix
4. to the solution prepared in Step 1 3 Adjust pH to 7 0 with 5 M NaOH then bring the volume to 980 ml with deionized 4 Prepare a 1 M solution of MgCl by dissolving 20 33 g of MgCl 6H O in deionized H O for a total volume of 100 ml 5 Autoclave both solutions on liquid cycle at 15 Ibs sq in for 20 min 6 Meanwhile make a 2M solution of glucose by dissolving 36 g of glucose in deionized H O for a total volume of 100 ml Filter sterilize this solution 7 Let the autoclaved solutions cool to about 55 C then add 10 ml of the filter sterilized 2 M glucose solution and 10 ml of 1 M MgCl Store at room temperature or 4 C Terrific Broth 1 2 tryptone 2 4 yeast extract 0 4 glycerol 17mM KH PO 72mM K HPO For 1 liter of Terrific Broth 1 Dissolve 2 31 g of KH PO and 12 54g of K HPO in 90 ml of deionized H O 2 Adjust the volume to 100 ml with deionized H O 3 Dissolve 12 g of tryptone 24 g of yeast extract and 4 ml of glycerol in 900 ml of deionized H O 4 Autoclave both solutions for 20 min on liquid cycle 5 Cool to 60 C or less and add the sterile 100 ml solution of KH PO and K HPO to the tryptone yeast extract glycerol solution Protocol 4 PT3067 1 www clontech com CLONTECH Laboratories Inc Version PR01082 9 AdvanTAge PCR Cloning Kit User Manual IV PCR Amplification A General Considerations If you are using the AdvanTAge PCR Cloning Kit for the first time we recommend that yo
5. 8418 1 TagStart Antibody 5400 1 2 TthStart Antibody 5401 1 e Marathon cDNA Amplification Kit K1802 1 e Marathon Ready cDNAs many SMART RACE cDNA Amplification Kit K1811 1 e CLONTECH PCR Select cDNA Subtraction Kit K1804 1 e Delta Differential Display Kit K1810 1 e ClonCapture cDNA Selection Kit K1056 1 Ligation Express Kit K1049 1 Protocol amp PT3067 1 www clontechcom CLONTECH Laboratories Inc Version PR01082 25 AdvanTAge PCR Cloning Kit User Manual Appendix Post PCR Addition of 3 A Overhangs It is often difficult to directly clone DNA amplified by Vent or Pfu polymerases into pT Adv Low cloning efficiencies are caused by the 3 to 5 exonuclease proof reading activities of Ventand Pfupolymerases which remove the 3 A overhangs necessary for T A cloning The following protocol for adding 3 A overhangs to blunt ended PCR products makes it possible to clone these products After amplification with Ventor Pfupolymerase place tubes on ice and add 0 7 1 unit of Taq polymerase to each tube Mix well It is not necessary to change the buffer Incubate at 72 for 8 10 min do not cycle Extract immediately with an equal volume of phenol chloroform Add 1 10 volume of 3 M sodium acetate and 2X volume of 10096 ethanol Centrifuge at maximum speed for 5 min at room temperature to precipitate the DNA Remove the ethanol rinse the pellet with 8096 ethan
6. CLONTECH s Advantage enzyme mixes be sure to use the Advantage 10X PCR Buffer T4 DNA ligase 4 0 Weiss units ul 10X Ligation buffer 60 mM Tris HCl pH 7 5 60 mM MgCl 50 mM NaCl 1 mg ml BSA 70 mM f mercaptoethanol 1mM ATP 20 mM Dithiothreitol 10 mM Spermidine Sterile H O CLONTECH Laboratories Inc www clontech com Protocol 4 PT3067 1 6 Version PR01082 AdvanTAge PCR Cloning Kit User Manual ll List of Components continued Box 2 Transformation reagents 6 ml 21 x50 ul 10 ul Protocol PT3067 1 Version PR01082 SOC Medium 2 Tryptone 0 5 Yeast extract 10mM NaCl 2 5mM_ KCI 10mM MgCl 10mM MgSO 20mM Glucose dextrose TOP10F E coli competent cells pUC18 supercoiled control DNA for transformation 10 ng ul in 5 mM Tris HCl 0 5 mM EDTA www clontech com CLONTECH Laboratories Inc AdvanTAge PCR Cloning Kit User Manual lll Additional Materials Required The following materials are required but not supplied Ampicillin 50 mg ml stock Kanamycin 50 mg ml stock LB Luria Bertani medium pH 7 0 for 1 L 1 0 Bacto tryptone 10 g 0 5 Yeast extract 5g 1 0 NaCI 10 g Dissolve ingredients in 950 ml of deionized H O Adjust the pH to 7 0 with 5 M NaOH and bring the volume up to 1 L Autoclave on liquid cycle for 20 min at 15 Ib in Store at room temperature or at 4 C LB antibiotic plates Prepare LB medium as above but add 15 g L agar before aut
7. cells are sensitive to temperature and mechanical lysis caused by pipetting Be extremely gentle Start transformation immediately after thawing the cells on ice Mix any additions by stirring gently with a pipette tip Keep the cells as cold as possible during all steps Use sterile technique when handling and plating your transformations TOP10F expresses the acZ repressor Lach which will repress transcription from the ac promoter To perform blue white screening for inserts you must add X Gal and IPTG to your plates to express LacZa Use kanamycin to select transformants when PCR products amplified from ampicillin resistant plasmids are cloned into pT Adv For example the Control DNA template included in the kit is from an ampicillin resistant plasmid Selecting with kanamycin will prevent contamination of the transformation reaction by the original ampicillin resistant plasmid B Preliminary Steps 1 2 3 Equilibrate a water bath to 42 Thaw one tube of SOC medium and bring to room temperature For each ligation transformation prepare two LB X Gal IPTG plates containing 50 ug ml of either ampicillin or kanamycin plates may be prepared ahead of time See Section III for recipes C Transformation 1 CLONTECH 14 Briefly centrifuge tubes containing the ligation reactions and place them on ice On thaw one 50 ul tube of frozen TOP10F E coli competent cells for each ligation transformatio
8. the remainder of the ligation reaction mixture at 20 C Heat shock for exactly 30 sec in the 42 C water bath Do not mix or shake Remove the tube from the 42 water bath and place on ice for 2 min Add 250 ul of SOC medium at room temperature to the tube Shake the tube horizontally at 37 for 1 hr at 225 rpm in a rotary shaking incubator Place the tube with the transformed cells on ice Spread 50 ul from the tube on a labeled LB X Gal IPTG plate contain ing 50 ug ml of either kanamycin or ampicillin Make sure the liquid is absorbed then invert the plate and place in a 37 incubator overnight Expected Results You should expect about 5 25 colonies from the 50 ul plated Most of these colonies should be blue there should be 5 white colonies The blue colonies contain supercoiled pT Adv Vector Over time the 3 T overhangs on the pT Adv Vector will degrade causing a blunt end self ligation of the vector This can cause a frameshift of the lacZa gene resulting in a false white or light blue colony with no insert CLONTECH Laboratories Inc www clontech com Protocol 4 PT3067 1 20 Version PR01082 AdvanTAge PCR Cloning Kit User Manual Vill Control Reactions continued B Transformation Efficiency Control A tube of supercoiled pUC18 is included in the kit as a control for transformation Before you begin prepare LB X Gal IPTG plates containing 50 ug ml ampicillin see Section III
9. CLONTECH Innovative Tools to Accelerate Discovery AdvanTAge PCR Cloning Kit User Manual PT3067 1 PR01082 Published 24 March 2000 Catalog K1901 1 See List of Components for storage conditions FOR RESEARCH USE ONLY AdvanTAge PCR Cloning Kit User Manual Table of Contents I Introduction 3 ll List of Components 6 Additional Materials Required 8 IV PCR Amplification 10 V Cloning into pT Adv 12 VI Transformation 14 Vil Troubleshooting Guide 16 VIII Control Reactions 19 IX References 24 X Related Products 25 Appendix Post PCR Addition of 3 A Overhangs 26 List of Figures Figure 1 Flow chart of the AdvanTAge PCR cloning method 4 Figure 2 Restriction map and multiple cloning site of the pT Adv Vector 5 Notice to Purchaser This product is intended to be used for research purposes only It is not to be used for drug or diagnostic purposes nor is it intended for human use CLONTECH products may not be resold modified for resale or used to manufacture commercial products without written approval of CLONTECH The PCR process is covered by patents owned by Hoffmann La Roche Inc and F Hoffmann La Roche A G Products covered by U S Patents 5 487 993 amp 5 827 657 and European Patent 40550693 CLONTECH Laboratories Inc www clontech com Protocol PT3067 1 2 Version PR01082 AdvanTAge PCR Cloning Kit User Manual I Introduction The AdvanTAge PCR Cloning Kit provides
10. Control Section VIII C above should be sufficient Alternatively you may use the formula given in Section V to estimate the amount of PCR product to ligate with 50 ng of pT Adv CLONTECH Laboratories Inc www clontech com 22 Protocol 4 PT3067 1 Version PR01082 AdvanTAge PCR Cloning Kit User Manual Vill Control Reactions continued 1 8 9 10 11 12 13 14 Combine the following reagents in a sterile 0 5 ml tube Sterile H O 5 ul 10X ligation buffer Tul pT Adv Vector 25 ng ul 2 ul Control PCR product 1 ul T4 DNA ligase 1 ul Total volume 10 ul Incubate the Ligation Control at 14 C for a minimum of 4 hr preferably overnight Prepare LB X Gal IPTG plates with 50 ug ml kanamycin for plating the transformation mix from the Ligation Control See Section Ill for recipes Briefly centrifuge the Ligation Control reactions and place them on ice Onice thaw one 50 ul tube of frozen TOP10F E colicompetent cells Pipet 1 ul of the Ligation Control directly into the competent cells and mix by tapping gently Do not mix by pipetting up and down Incubate the tube on ice for 30 min Store the remaining ligation mixture at 20 C Heat shock for exactly 30 sec in the 42 C water bath Do not mix or shake Remove the tube from the 42 C water bath and place on ice for 2 min Add 250 ul of SOC medium at room temperature to each tube Shake the tubes horizontally at 37 C for 1 hr a
11. User Manual Vill Control Reactions continued C PCR Control To test the components of the kit a control DNA template and primers are included to generate a control PCR product that can be ligated into the pT Adv Vector The Control Primers amplify a 700 bp fragment which when cloned into pT Adv will produce about 8096 white colonies on LB X Gal IPTG plates containing 50 ug ml kanamycin Because the Control DNA template is from an ampicillin resistant plasmid be sure to use kanamycin instead of ampicillin to select transformants 1 Combine the following reagents in a 0 5 ml PCR tube Control DNA template 100 ng 10X PCR buffer 50 mM dNTPs Control Primer 1 Control Primer 2 Sterile H O Thermostable DNA polymerase Total volume 2 Overlay with 70 ul of mineral oil 3 Commence cycling using the following parameters 25 cycles 94 C 1 min 55 1min 72C 1min e 72 C for an additional 7 min after the final cycle 4 Remove 10 ul from the PCR sample and electrophorese on a 0 8 1 5 agarose EtBr gel 5 A 700 bp band should be visible Quantify the amount of DNA by measuring against a known standard run on the same gel You should get a concentration of about 20 ng ul for your PCR Control Proceed to the Ligation Transformation Control Section VIII D D Ligation Transformation Control To test the efficiency of the vector ligate fresh PCR product into the pT Adv Vector In general 1 ul of the PCR
12. VII Troubleshooting Guide If you do not obtain the results you expect use the following guide to troubleshoot your experiment To confirm that your kit is working properly perform the control reactions Section VIII Observation No colonies obtained from transformation White colonies do not have insert Only white colonies obtained Majority of colonies are blue or light blue with very few white colonies CLONTECH Laboratories Inc 16 Reason Bacteria were not competent Plates were too old or contained the wrong concentration of antibiotic The single 3 T overhangs on the pT Adv vector may have degraded Plates lacked X Gal and or IPTG The insert did not interrupt the reading frame of the lacZ gene A polymerase which does not add 3 A overhangs such as Vent or Pfu was used www clontech com Solution Use the pUC18 vector included with the kit to check transformation efficiency Use 50 ug ml of either ampicillin or kanamycin Be sure ampicillin plates are fresh 1 month old Use another tube of pT Adv Avoid storing vector for 6 months or repeatedly freezing and thawing it Perform the Self Ligation Control Section VIII A to check vector Be sure to include X Gal and IPTG If your insert is 500 bp colonies may be light blue Check some light blue colonies for insert Use Taq polymerase If you must use Vent or Pfu follow the protocol in the Appe
13. a quick simple strategy for directly cloning PCR products Based on the T A cloning method Clark 1988 Mead et al 1991 the AdvanTAge kit is optimized to produce gt 80 recombinants nine out of 10 of which contain the desired PCR product The technique requires no special primers e g with added restriction sites no post PCR purification and no enzymatic treatment such as restriction enzyme digestion or polishing to create blunt ends The AdvanTAge PCR cloning method The AdvanTAge method consists of three main steps Figure 1 First ligate your just amplified PCR product into the pT Adv Vector Then transform the TOP10F E coli competent cells provided in the kit and plate onto LB medium containing antibiotic X Gal and IPTG Finally select white colonies for further analysis T A cloning exploits the terminal transferase activity of thermostable DNA polymerases such as AdvanTaq or Tth During PCR the enzyme adds a single deoxyadenosine A to the 3 ends of many reaction products Clark 1988 The pT Adv Vector with its 3 T overhangs enables you to directly clone these products Because the enzyme s terminal transferase activity does not depend on the template sequence essentially any PCR product can be cloned by this method without prior sequence information or other design constraints Thermostable polymerases with extensive 3 to 5 exonuclease proofreading activity such as Venf and Pfu do not leave 3
14. agarose and the DNA size markers you choose will depend on the expected range of insert sizes These are general guidelines Expected size 96 agarose DNA size markers 0 3 1 5 kb 1 5 174 Ill 0 5 10 kb 1 2 1 kb DNA ladder gt 5 kb 0 8 Hind lll C Optimization of PCR If you observe smearing or multiple bands on the agarose EtBr gel you must somehow isolate your fragment of interest Because gel purification may decrease ligation efficiency we suggest that you attemptto optimize your PCR before resorting to purification A hot start may help prevent amplification of nonspecific products For other suggestions see Innis et a 1990 If gel purification is necessary be extremely careful of nuclease contam ination All solutions that come in contact with the gel and fragment should be free of nucleases Avoid communal EtBr baths and use only high quality agarose We have found that either electroelution or silica based DNA purification systems such as the NucleoTrap Gel Extraction Kit 4K3070 1 or the NucleoSpin Extraction Kit K3051 1 2 work well Protocol 4 PT3067 1 www clontech com CLONTECH Laboratories Inc Version PR01082 11 AdvanTAge PCR Cloning Kit User Manual Cloning into pT Adv V A General Considerations For optimal ligation efficiencies we recommend that you use PCR products immediately 1 day after amplification The single 3 A over hangs on the PCR products will degrad
15. alyze DNA by restriction digestion 1 Pick at least 10 white colonies for plasmid isolation and restriction analysis 2 Grow colonies overnight in 2 5 ml LB broth containing 50 ug ml of either ampicillin or kanamycin 3 Isolate plasmid and analyze by restriction mapping or sequencing for orientation of the insert For protocols for plasmid isolation and restric tion enzyme digestion please refer to Ausubel et al 1990 or Sambrook et al 1989 Note If you find that putative ampicillin resistant colonies do not grow in liquid culture containing antibiotic replate the transformation s on plates containing 100 ug ml ampicillin To increase plasmid yield use Terrific Broth or SOC medium containing antibiotic see Section III for recipes E Sequencing Use an M13 reverse primer to sequence into your insert from the ac promoter To sequence into the insert from the lacZa fragment you can use either a T7 promoter primer an M13 40 forward primer or an M13 20 forward primer Please note that commercially available T7 primers do not all have the same sequence Be sure to check the sequence of your T7 primer carefully see Figure 2 In addition if your PCR product was generated using CLONTECH s Marathon cDNA Amplification Kit 1802 1 you cannot use a T7 primer to sequence the insert Protocol 4 PT3067 1 www clontech com CLONTECH Laboratories Inc Version PR01082 15 AdvanTAge PCR Cloning Kit User Manual
16. e over time reducingthe efficiency The pT Adv Vector is supplied in five aliquots It is stable for six months from date of purchase if not subjected to repeated freeze thaw cycles Vector that has been stored for longer periods or has been repeatedly frozen and thawed will lose the 3 T overhangs resulting in false white positives i e background colonies To confirm that the pT Adv Vector still has 3 T overhangs perform the Self Ligation Control Section VIII A Use kanamycin to select transformants when PCR products amplified from ampicillin resistant plasmids are cloned into pT Adv For example the Control DNA template included in the kit is from an ampicillin resistant plasmid Selecting with kanamycin will prevent contamination of the transformation reaction by the original ampicillin resistant plasmid Cloning Procedure 1 Briefly centrifuge one tube of pT Adv to collect all the liquid in the bottom 2 Mark the date of first use on the tube If there is any vector remaining after the experiment store at 20 C or 70 C 3 Use the formula below to estimate the amount of PCR product needed to ligate with 50 ng 20 fmol of pT Adv x ng PCR product y bp PCR product 50 ng pT Adv size of pT Adv 3 900 bp where x ng is the amount of PCR product of y base pairs to be ligated for a 1 1 vector insert molar ratio Notes Ingeneral 0 5to 1 0 ul of atypical PCR sample with an average insert length of 400 700 bp
17. ent only in the multiple cloning site MCS and can be used to excise the inserted PCR product The 3 T overhang preceding the insert is added to the linearized vector during modification Note that the MCS shown represents the vector sequence affer it has been linearized and modified During preparation the pT Adv Vector is modified such that the inserted PCR product is flanked on each side by EcoR sites Protocol PT3067 1 www clontech com CLONTECH Laboratories Inc Version PR01082 5 AdvanTAge PCR Cloning Kit User Manual Il List of Components Store Box 1 at 20 Store Box 2 at 70 Avoid repeated freeze thaw cycles Note Thermostable DNA polymerase must be supplied by the user Box 1 AdvanTAge PCR Cloning Reagents 5x10ul 10 ul 10 ul 10 ul 10 ul 100 ul 25 ul 100 ul 1 000 ul pT Adv Vector linearized 25 ng ul in 10 mM Tris HCl pH 7 5 1 mM EDTA Control DNA template 0 1 ug ul in 10 mM Tris HCl pH 7 5 1 mM EDTA Control Primer 1 0 1 ug ul in 10 mM Tris HCl pH 7 5 1 mM EDTA Control Primer 2 0 1 ug ul in 10 mM Tris HCl pH 7 5 1 mM EDTA Note The Control Primers are provided for the PCR Control Section VIII C They are not suitable for sequencing 50 mM dNTPs neutralized to pH 8 0 12 5 mM dATP 12 5 mM dCTP 12 5 mM dGTP 12 5 mM dTTP 10X PCR buffer 100 mM Tris HCl pH 8 3 at 42 500 mM KCI 25 mM MgCl 0 01 Gelatin tNote When using
18. f your cycling program see the Appendix No modification of your PCR primers e g by phosphorylation or addition of a restriction site is necessary B PCR Amplification In general 10 100 ng of DNA is sufficient to use as a template for PCR However if you are amplifying a pool of cDNA the amount of template DNA depends on the relative abundance of the message of interest in your mRNA population For optimal ligation efficiencies we recommend that you perform no more than 30 PCR cycles For the PCR Control use the Control DNA template and Control Primers 1 and 2 provided in the kit For specific parameters for the PCR Control please see Section VIII C CLONTECH Laboratories Inc www clontech com Protocol 4 PT3067 1 10 Version PR01082 AdvanTAge PCR Cloning Kit User Manual IV PCR Amplification continued 1 Prepare a PCR mix for your reactions and controls per rxn DNA template 10 100 ng 10X PCR buffer 5 ul 50 mM dNTPs 0 5 ul Control Primers 1 amp 2 each 1 ul Sterile H O x pl Thermostable DNA polymerase 1 unit Total volume 50 ul 2 Commence cycling in a Perkin Elmer GeneAmp System 9600 or equivalent thermal cycler 3 Analyze your PCR product by electrophoresis on an agarose EtBr gelto confirm that you have obtained a single DNA fragment and to estimate the concentration of your PCR product Quantify the amount of DNA by measuring against a known standard run on the same gel The percentage of
19. is Set up the ligation with a 1 1 or 1 3 vector insert molar ratio If your insert is 500 bp check these light blue colonies for insert Use more ampicillin up to 100 ug ml or use kanamycin Be sure your ampicillin stock solution and plates are fresh CLONTECH Laboratories Inc 17 AdvanTAge PCR Cloning Kit User Manual VII Troubleshooting Guide continued Observation White colonies do not grow in liquid culture No results from sequencing No PCR product Low plasmid yield CLONTECH Laboratories Inc 18 Reason These colonies may be ampicillin sensitive satellites You accidentally used the Control Primers in the kit for sequencing These are only suitable for generating the control PCR product The sequence of your T7 primer may not have been correct You used an SP6 primer for sequencing Either the thermostable DNA polymerase was inactive or the conditions for your PCR were not optimal Cells did not grow well in LB www clontech com Solution Be sure to pick large white colonies Use more ampicillin up to 100 ug ml or use kanamycin to eliminate this problem Be sure ampicillin is fresh Use the M13 forward 20 or 40 and reverse primers or use the T7 promoter primer to sequence into the insert Check the sequence of your T7 promoter primer and make sure it matches with the priming site on pT Adv see Figure 2 Do not use an SP6 primer to
20. n Pipet2 ul of each ligation reaction directly into the competent cells and mix by tapping gently Do not mix by pipetting up and down Incubate the tubes on ice for 30 min Store the remaining ligation mixtures at 20 C Heat shock for exactly 30 sec in the 42 water bath Do not mix or shake Remove the tubes from the 42 water bath and place on ice for 2 min Add 250 ul of SOC medium at room temperature to each tube Shake the tubes horizontally at 37 for 1 hr at 225 rpm in a rotary shaking incubator Place the tubes containing the transformed cells on ice Laboratories Inc www clontech com Protocol 4 PT3067 1 Version PR01082 AdvanTAge PCR Cloning Kit User Manual VI Transformation continued 10 Spread 50 ul and 200 ul from each transformation on separate labeled LB X Gal IPTG plates containing 50 ug ml of either kanamycin or ampicillin 11 Make sure the liquid is absorbed then invert the plates and place them in a 37 C incubator for at least 18 hr 12 Shift plates to 4 C for 2 3 hr to allow proper color development D Analysis of Transformation For an insert size of 400 700 bp you should obtain 50 200 colonies per plate depending on the volume plated Approximately 80 of these colonies should be white Note that ligation efficiency depends on insert size as insert size increases the efficiency will decrease To determine the presence and orientation of insert an
21. ndix to add 3 A overhangs Protocol 4 PT3067 1 Version PR01082 AdvanTAge PCR Cloning Kit User Manual Vil Troubleshooting Guide continued Observation Majority of colonies are blue or light blue with very few white colonies continued Some colonies have a light blue color or appear white with blue centers White colonies or blue colonies of normal size are surrounded by smaller white colonies Protocol PT3067 1 Version PR01082 Reason PCR products were gel purified before ligation Gel purification can remove the single 3 A overhangs Too much of the amplification reaction was added to the ligation The high salt content of PCR can inhibit ligation The PCR products were stored for too long before ligation The molar ratio of vector insert in the ligation reaction was incorrect There may be leaky expression of the acZ fragment or only partial disruption of acZ The smaller colonies are ampicillin sensitive satellites which do not contain plasmid Do not pick small colonies www clontech com Solution Optimize your PCR to avoid gel purification If gel purification is necessary use electroelution or a silica matrix based system Use no more than 2 3 ul of the PCR mixture in the ligation reaction Use PCR products immediately Efficiencies are reduced after only 1 day of storage Estimate the concentration of the PCR product by agarose gel electrophores
22. oclaving Autoclave on liquid cycle for 20 min at 15 Ib in Let cool to 55 add antibiotic 50 ug ml of either ampicillin or kanamycin and pour into 10 cm plates Let harden then invert and store at 4 C X Gal stock solution 5 bromo 4 chloro 3 indolyl 8 D galactoside 40 mg ml in DMF Dissolve 400 mg of X Galin 10 ml of dimethylformamide Protect from light by storing in a brown bottle at 20 C IPTG stock solution isopropyl B D thiogalactoside 100 mM Dissolve 238 mg of IPTG in 10 ml of deionized H O Filter sterilize and store in 1 ml aliquots at 20 C LB X Gal IPTG plates 1 Warm an LB plate containing the appropriate antibiotic at 37 C for 10 min 2 Pipet 40 ul of the X Gal stock solution and 40 ul of the IPTG stock solution onto the center of the plate and spread evenly with a sterile spreader 3 Allow the solution to diffuse into the plate by incubating at 37 C for 20 30 min CLONTECH Laboratories Inc www clontech com Protocol 4 PT3067 1 8 Version PR01082 AdvanTAge PCR Cloning Kit User Manual lll Additional Materials Required continued SOC medium 296 Tryptone 0 5 Yeast Extract 10 mM NaCl 2 5mM KCl 10 mM MgCl 6H O 20 mM glucose 1 For 1 liter dissolve 20 g of tryptone 5 g of yeast extract and 0 5 g of NaCl in 950 ml of deionized H O 2 Prepare a250 mM KCl solution by dissolving 1 86 g of KCl in deionized H O for a total volume of 100 ml Add 10 ml of this stock KCI solution
23. ol and allow to air dry 7 Resuspend the pellet in TE buffer to the starting volume of the DNA amplification reaction The DNA amplification product is now ready for ligation into the pT Adv Vector oR 0 o CLONTECH Laboratories Inc www clontech com Protocol 4 PT3067 1 26 Version PR01082 AdvanTAge PCR Cloning Kit User Manual Notes AdvanTAge AdvanTaq AdvanTaq Plus ClonCapture CLONTECH PCR Select Delta GenomeWalker Marathon Marathon Ready SMART TaqStart and TthStart are trademarks of CLONTECH Laboratories Inc Advantage is a registered trademark of CLONTECH Laboratories Inc GeneAmp is a registered trademark of Roche Molecular Systems Inc licensed to the Perkin Elmer Corporation Vent is a registered trademark of New England Biolabs The PCR process is covered by patents owned by Hoffmann La Roche Inc and F Hoffmann La Roche Ltd 1999 CLONTECH Laboratories Inc Protocol PT3067 1 www clontech com CLONTECH Laboratories Inc Version PR01082 27
24. or ClonCapture cDNA Selection Kit K1056 1 and amplified using AdvanTaq AdvanTag Plus or any Advantage Kit Protocol PT3067 1 www clontech com CLONTECH Laboratories Inc Version PR01082 3 AdvanTAge PCR Cloning Kit User Manual I Introduction continued Unpurified PCR product Ligate into pT Adv SE Transform TOP10F cells amp plate on LB X gal IPTG with amp or kan Select white colonies for analysis Figure 1 Flow chart of the AdvanTAge PCR cloning method CLONTECH Laboratories Inc www clontech com Protocol PT3067 1 4 Version PR01082 AdvanTAge PCR Cloning Kit User Manual I Introduction continued MCS 234 355 1259 Scal 2413 Apal 2222 208 M13 Reverse Primer GAAACAGCTATGACCATGATTACGCCAAGCTTGGTACCGAGCTCGGATCCACTAGT lacZa START Hind Sac Spel 264 AACGGCCGCCAGTGTGCTGGAATTCGGCT T ELTE AAGCCGAATICTGCA BsXl EcoRI N 3 T overhang EcoR 309 GATATCCATCACACTGGCGGCCGCTCGAGCATGCATCTAGAGGGCCCAATTCG 32 EcoRV 51 Not gl Nsil Xbal Apal in CCCTATAGTGAGTCGTATTACAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAAC T7 Promoter M13 Sequencing Primer M13 40 forward primer Figure 2 Restriction map and multiple cloning site of the pT Adv vector Unique restriction sites are in bold Restriction sites with asterisks are pres
25. reeze thaw cycles Vector that has been stored for longer periods or has been repeatedly frozen and thawed will lose the 3 T overhangs resulting in false white positives i e background colonies To confirm that the pT Adv Vector still has the 3 T overhangs perform the Self Ligation Control a ligation reaction of the pT Adv Vector alone followed by transformation into TOP10F E colicompetent cells To confirm thatthe cells are indeed competent perform the Transformation Efficiency Control Section VIII B alongside the Self Ligation Control 1 Combine the following reagents in a sterile 0 5 ml tube Sterile HO 6 ul 10X Ligation buffer 1 ul pT Adv Vector 25 ng ul 2 ul T4 DNA ligase 4 Weiss units 1 ul Total volume 10 ul Protocol 4 PT3067 1 Version PR01082 www clontech com CLONTECH Laboratories Inc 19 AdvanTAge PCR Cloning Kit User Manual Vill Control Reactions continued 2 3 8 9 10 11 12 13 14 Incubate overnight at 14 15 Prepare LB X Gal IPTG plates containing 50 ug ml of either kanamycin or ampicillin Section III Briefly centrifuge the tubes containing the ligation reactions and place them on ice Onice thaw one 50 ul tube of frozen TOP10F E colicompetent cells Pipet 1 ul of the mixture from Step 1 directly into the competent cells and mix by mix by tapping gently Do not mix by pipetting up and down Incubate the tube on ice for 30 min Store
26. sequence pT Adv There is no SP6 binding site Perform the PCR Control Section VIII C If it works then your polymerase is probably active and you need to optimize your PCR If it does not work try new enzyme Try using SOC medium Remember to include antibiotic See Section Ill for recipe Protocol PT3067 1 Version PR01082 Vill Control Reactions AdvanTAge PCR Cloning Kit User Manual Here is a brief overview of the control reactions for troubleshooting AdvanTAge PCR Cloning Control Reaction Self Ligation Control Section VIII A Transformation Efficiency Control Section VIII B PCR Control Section VIII C Ligation Transformation Control Section VIII D A Self Ligation Control Explanation This control reaction reveals whether pT Adv has lost the 3 T overhangs Loss of the T overhangs results in blunt end ligation and disruption of the lacZa reading frame Many false white colonies will result normally 596 of the colonies should be white Tests the competency of the TOP10F E coli competent cells There should be 1 x 108 transformants per ug of supercoiled plasmid Tests the PCR reagents except for the thermostable DNA polymerase Tests the ligation reagents and pT Adv This reaction should produce 8096 white colonies which should contain vector with insert The pT Adv Vector is stable for six months from date of purchase if not subjected to repeated f
27. t 225 rpm in a rotary shaking incubator Place the transformed cells on ice Plate 50 ul from the Ligation Transformation Control on LB X Gal IPTG plates containing 50 ug ml kanamycin Incubate for at least 18 hr at 37 C Expected Results The Ligation Transformation Control should produce gt 80 white colonies Over time the 3 T overhangs of the pT Adv Vector will degrade causing an increase in the number of false white colonies i e background colonies without inserts The background should not exceed 10 see the Self Ligation Control Section VIII A If this happens use another tube of pT Adv and try to avoid repeated freeze thaw cycles Protocol PT3067 1 www clontech com CLONTECH Laboratories Inc Version PR01082 23 AdvanTAge PCR Cloning Kit User Manual Vill References Ausubel F M Brent R Kingdom E Moore D M Seidman J G Smith J A amp Struhl K eds 1995 Current Protocols in Molecular Biology John Wiley amp Sons NY Chou Q Russell M Birch D Raymond J amp Block W 1992 Prevention of pre PCR mispriming and primer dimerization improves low copy number amplifications Nucleic Acids Res 20 1717 1723 Clark J M 1988 Novel non templated nucleotide addition reactions catalyzed by procaryotic and eucaryotic DNA polymerases Nucleic Acids Res 16 9677 9686 D aquila R T Bechtel L J Videler J A Eron J J Gorczyca P amp Kaplan J
28. u perform the PCR Control in parallel with your experiment For the PCR Control use the Control DNA template and Control Primers 1 and 2 provided in the kit For specific parameters please see Section VIII C The Control Primers 1 and 2 provided in the kit are intended for use in the PCR Control Section VIII C They are notsuitable for sequencing You may wish to use a hot start for PCR Hot start PCR is commonly used to enhance the specificity and sensitivity of PCR amplification D Aquila et al 1991 Chou et al 1992 Faloona et al 1990 CLONTECH offers TagStart 5400 1 2 and TthStart 5401 1 Antibodies for automatic hot start PCR Our AdvanTaq Plus DNA Polymerase and all Advantage products provide automatic hot start The T A cloning method works for PCR products generated using any thermostable DNA polymerase that adds 3 A overhangs Enzymes with extensive 3 to 5 exonuclease activity such as Vent and Pfu do not leave 3 A overhangs Although CLONTECH s Advantage and Advan tage 2 Polymerase Mixes contain a minor amount of proofreading enzyme PCR products will still have A overhangs and can be cloned into pT Adv However to maximize your cloning efficiency you may incubate with Tag polymerase at the end of your cycling program see the Appendix If your PCR application requires Ventor Pfu or you wish to clone blunt ended fragments you may add 3 A overhangs by incubating with Taq polymerase at the end o
29. will give the proper vector insert ratio of 1 1 This 1 1 ratio gives the best ligation efficiencies If you are concerned about the accuracy of your DNA concen trations try a second ligation reaction at a vector insert ratio of 1 3 For a 1 3 vector insert ratio multiply x by 3 to get the amount of PCR product for ligation Donotuse more than 2 3 ul of the PCR sample in the ligation reaction because salts in the PCR sample may inhibit the T4 DNA ligase 4 Calculate the volume of PCR product needed for x ng determined in step 3 Dilute your PCR sample with sterile H O if necessary 5 Set up the ligation reaction as follows PCR product 1 day old x ul 10X Ligation buffer 1 ul pT Adv Vector 25 ng ul 2 yl Sterile H O x pl T4 DNA ligase 4 0 Weiss units 1 wl Total volume 10 CLONTECH Laboratories Inc www clontech com Protocol 4 PT3067 1 12 Version PR01082 AdvanTAge PCR Cloning Kit User Manual V Cloning into pT Adv continued 6 Incubate the ligation reaction at 14 C for a minimum of 4 hr preferably overnight Higher or lower temperatures may reduce ligation efficiency 7 Proceed to Transformation Section VI If you cannot transform immediately store your ligation reaction at 20 C until you are ready Protocol PT3067 1 www clontech com CLONTECH Laboratories Inc Version PR01082 13 AdvanTAge PCR Cloning Kit User Manual VI Transformation A General Considerations Competent
Download Pdf Manuals
Related Search