TOPO TA Manual - Buffalo State College Faculty and Staff Web Server
Contents
1. Item Amount Catalog no Taq DNA Polymerase Native 100 units 18038 018 500 units 18038 042 Tag DNA Polymerase Recombinant 100 units 10342 053 500 units 10342 020 Platinum Taq DNA Polymerase High Fidelity 100 units 11304 011 One Shot TOP10 Chemically Competent E coli 10 reactions C4040 10 20 reactions C4040 03 40 reactions C4040 06 One Shot TOP10 Electrocompetent E coli 10 reactions C4040 50 20 reactions C4040 52 One Shot Mach1 T1 Chemically Competent 20 reactions C8620 03 E coli One Shot MAX Efficiency DH5a T1 20 reactions 12297 016 Chemically Competent E coli PureLink Quick Plasmid Miniprep Kit 50 reactions K2100 10 PureLink Quick Gel Extraction Kit 50 reactions K2100 12 Ampicillin 200 mg 11593 019 Kanamycin 5g 11815 024 25g 11815 032 100 ml 18160 054 10 mg ml S O C Medium 10x 10 ml 15544 034 Overview Introduction How It Works Methods The TOPO TA Cloning Kits for Sequencing provide a highly efficient 5 minute one step cloning strategy TOPO Cloning for the direct insertion of Taq polymerase amplified PCR products into a plasmid vector for sequencing No ligase post PCR procedures or PCR primers containing specific sequences are required The plasmid vector pCR 4 TOPO is supplied linearized with e Single 3 thymidine T overhangs for TA Cloning e Topoisomerase covalently bound to the vector referred to as activated vector Taq polymerase has a nontempl2. e Additional product information and special offers Contact Us For more information or technical assistance call write fax or email Additional international offices are listed on our Web page www invitrogen com Corporate Headquarters Japanese Headquarters European Headquarters Invitrogen Corporation Invitrogen Japan Invitrogen Ltd 1600 Faraday Avenue LOOP X Bldg 6F Inchinnan Business Park Carlsbad CA 92008 USA 3 9 15 Kaigan 3 Fountain Drive Tel 1 760 603 7200 Minato ku Tokyo 108 0022 Paisley PA4 9RF UK Tel Toll Free 1 800 955 6288 Tel 81 3 5730 6509 Tel 44 0 141 814 6100 Fax 1 760 602 6500 Fax 81 3 5730 6519 Tech Fax 44 0 141 814 6117 E mail tech_support invitrogen com E mail jpinfo invitrogen com E mail eurotech invitrogen com MSDS MSDSs Material Safety Data Sheets are available on our website at www invitrogen com msds Limited Warranty Invitrogen is committed to providing our customers with high quality goods and services Our goal is to ensure that every customer is 100 satisfied with our products and our service If you should have any questions or concerns about an Invitrogen product or service please contact our Technical Service Representatives Invitrogen warrants that all of its products will perform according to the specifications stated on the certificate of analysis The company will replace free of charge any product that does not meet those specifications This warranty l
3. 329 pmoles 329 pmoles 658 pmoles T7 primer 0 1 ug ul in TE Buffer pH 8 20 pl 20 ul 2x20 ul 328 pmoles 328 pmoles 656 pmoles Control PCR 0 1 ug ul in TE Buffer pH 8 10 ul 10 ul 2x10 ul Template Control PCR Primers 0 1 ug ul each in TE Buffer pH 8 10 ul 10 ul 2x10 ul Sequence of Primers The table below lists the sequence of the sequencing primers included in the kit Primer Sequence M13 Forward 20 5 GTAAAACGACGGCCAG 3 M13 Reverse 5 CAGGAAACAGCTATGAC 3 T3 5 ATTAACCCTCACTAAAGGGA 3 T7 5 TAATACGACTCACTATAGGG 3 continued on next page Kit Contents and Storage continued One Shot The tables below describe the items included in each One Shot Kit Reagents Store at 80 C Item Composition Amount Amount Amount 10 Reactions 20 Reactions 40 Reactions S O C Medium 2 Tryptone 6 ml 6 ml 2x6 ml may be stored at 4 C or 0 5 Yeast Extract room temperature 10 mM NaCl 2 5 mM KCl 10 mM MgCl 10 mM MgSO 20 mM glucose Mach1 T1 TOP10 or Chemically Competent 11x50 pl 21 x 50 ul 41 x 50 pl DH5a T18 cells OR TOP10 cells Electrocomp pUC19 Control DNA 10 pg ul in 5 mM Tris HCl 50 ul 50 ul 2x50 pl 0 5 mM EDTA pH 8 Genotypes TOP10 Use this strain for general cloning and blue white screening without IPTG F mcrA A mrr hsdRMS mcrBC 80lacZAM15 AlacX74 recA1 araD139 A ara leu 7697 galU galK rpsL Str e
4. Electrocompetent continued on next page 17 Performing the Control Reactions continued Factors Affecting Cloning Efficiency 18 Note Note that lower cloning efficiencies will result from the following variables Most of these are easily correctable but if you are cloning large inserts you may not obtain the expected 95 or more cloning efficiency Variable Solution pH gt 9 Check the pH of the PCR amplification reaction and adjust with 1 M Tris HCl pH 8 Incomplete extension during PCR Be sure to include a final extension step of 7 to 30 minutes during PCR Longer PCR products will need a longer extension time Cloning large inserts gt 1 kb Increase amount of insert Or gel purify as described on page 19 Excess or overly dilute PCR product Reduce or concentrate the amount of PCR product Cloning blunt ended fragments Add 3 A overhangs by incubating with Taq polymerase page 21 or use the Zero Blunt TOPO PCR Cloning Kit for Sequencing Catalog no K2875 20 PCR cloning artifacts false positives TOPO Cloning is very efficient for small fragments lt 100 bp present in certain PCR reactions Gel purify your PCR product page 19 PCR product does not contain sufficient 3 A overhangs even though you used Tag polymerase Increase the final extension time to ensure all 3 ends are adenylated Taq polymerase is less efficient at
5. BioTechniques 20 1004 1010 Innis M A Gelfand D H Sninsky J J and White T S 1990 PCR Protocols A Guide to Methods and Applications Academic Press San Diego CA Sambrook J Fritsch E F and Maniatis T 1989 Molecular Cloning A Laboratory Manual Second Edition Plainview New York Cold Spring Harbor Laboratory Press Shuman S 1994 Novel Approach to Molecular Cloning and Polynucleotide Synthesis Using Vaccinia DNA Topoisomerase J Biol Chem 269 32678 32684 Shuman S 1991 Recombination Mediated by Vaccinia Virus DNA Topoisomerase I in Escherichia coli is Sequence Specific Proc Natl Acad Sci USA 88 10104 10108 2000 2006 Invitrogen Corporation All rights reserved For research use only Not intended for any animal or human therapeutic or diagnostic use 30 invitrogen Corporate Headquarters Invitrogen Corporation 1600 Faraday Avenue Carlsbad CA 92008 T 1 760 603 7200 F 1760 602 6500 E tech service invitrogen com For country specific contact information visit our web site at www invitrogen com
6. Cutthe area of the gel containing the desired DNA fragment using a clean sharp blade Minimize the amount of surrounding agarose excised with the fragment Weigh the gel slice 3 Add Gel Solubilization Buffer GS1 supplied in the kit as follows e For lt 2 agarose gels place up to 400 mg gel into a sterile 1 5 ml polypropylene tube Divide gel slices exceeding 400 mg among additional tubes Add 30 ul Gel Solubilization Buffer GS1 for every 10 mg of gel e For gt 2 agarose gels use sterile 5 ml polypropylene tubes and add 60 pl Gel Solubilization Buffer GS1 for every 10 mg of gel 4 Incubate the tube at 50 C for 15 minutes Mix every 3 minutes to ensure gel dissolution After gel slice appears dissolved incubate for an additional 5 minutes 5 Preheat an aliquot of TE Buffer TE to 65 70 C 6 Place a Quick Gel Extraction Column into a Wash Tube Pipette the mixture from Step 4 above onto the column Use 1 column per 400 mg agarose 7 Centrifuge at 212 000 x g for 1 minute Discard the flow through Place the column back into the Wash Tube 8 Optional Add 500 ul Gel Solubilization Buffer GS1 to the column Incubate at room temperature for 1 minute Centrifuge at gt 12 000 x g for 1 minute Discard the flow through Place the column back into the Wash Tube 9 Add 700 ul Wash Buffer W9 with ethanol add 96 100 ethanol to the Wash Buffer according to instructions on the label of the bottle to the column and incubat
7. Dilute PCR Products 14 The information below will help you optimize the TOPO Cloning reaction for your particular needs The high efficiency of TOPO Cloning technology allows you to streamline the cloning process If you routinely clone PCR products and wish to speed up the process consider the following e Incubate the TOPO Cloning reaction for only 30 seconds instead of 5 minutes You may not obtain the highest number of colonies but with the high efficiency of TOPO Cloning most of the transformants will contain your insert e After adding 2 ul of the TOPO Cloning reaction to chemically competent cells incubate on ice for only 5 minutes Increasing the incubation time to 30 minutes does not significantly improve transformation efficiency If you are TOPO Cloning large PCR products toxic genes or cloning a pool of PCR products you may need more transformants to obtain the clones you want To increase the number of colonies e Incubate the salt supplemented TOPO Cloning reaction for 20 to 30 minutes instead of 5 minutes Increasing the incubation time of the salt supplemented TOPO Cloning reaction allows more molecules to ligate increasing the transformation efficiency Addition of salt appears to prevent topoisomerase from rebinding and nicking the DNA after it has ligated the PCR product and dissociated from the DNA To clone dilute PCR products you may e Increase the amount of the PCR pr
8. Pick 10 colonies for analysis see Analyzing Positive Clones page 12 continued on next page 10 Transforming One Shot TOP10 and DH5a T1 Competent Cells continued One Shot Electroporation Protocol Note Add 2 ul of the TOPO Cloning reaction from Performing the TOPO Cloning Reaction Step 2 page 5 into a vial of One Shot Electrocompetent E coli and mix gently Do not mix by pipetting up and down Carefully transfer solution to a 0 1 cm cuvette to avoid formation of bubbles Electroporate your samples using your own protocol and your electroporator Note If you have problems with arcing see below Immediately add 250 ul of room temperature S O C medium Transfer the solution to a 15 ml snap cap tube e g Falcon and shake for at least 1 hour at 37 C to allow expression of the antibiotic resistance genes Spread 10 50 ul from each transformation on a prewarmed selective plate and incubate overnight at 37 C To ensure even spreading of small volumes add 20 ul of S O C medium We recommend that you plate two different volumes to ensure that at least one plate will have well spaced colonies An efficient TOPO Cloning reaction should produce several hundred colonies Pick 10 colonies for analysis see Analyzing Positive Clones next page Addition of the Dilute Salt Solution in the TOPO Cloning Reaction brings the final concentration of NaCl and MgCl in the TOPO Cloning reaction to 5
9. adding a nontemplate 3 A next to another A Taq is most efficient at adding a nontemplate 3 A next to a C You may have to redesign your primers so that they contain a 5 G instead of a 5 T Brownstein et al 1996 Cloning small PCR products 100 bp Small PCR products may not completely disrupt the lacZ a ccdB gene fusion to allow growth of positive recombinants Try TOP10F cells which express the Lac repressor to repress expression of the fusion Pick transformants and characterize Note that cloning efficiency may decrease with gel purification of the PCR product because of nuclease contamination or dilution of the DNA You may wish to optimize your PCR to produce a single band Appendix Purifying PCR Products Introduction Smearing multiple banding primer dimer artifacts or large PCR products gt 3 kb may necessitate gel purification If you intend to purify your PCR product be extremely careful to remove all sources of nuclease contamination There are many protocols to isolate DNA fragments or remove oligonucleotides Refer to Current Protocols in Molecular Biology Unit 2 6 Ausubel et al 1994 for the most common protocols Two simple protocols are described below Using the The PureLink Quick Gel Extraction Kit page viii allows you to rapidly purify PureLink Quick PCR products from regular agarose gels Gel Extraction Kit 1 Equilibrate a water bath or heat block to 50 C 2
10. and is sold under license from the Universit Libre de Bruxelles for research purposes only The purchase of this product conveys to the buyer the non transferable right to use the purchased amount of the product and components of the product in research conducted by the buyer whether the buyer is an academic or for profit entity For licensing information please contact Licensing Department Invitrogen Corporation 1600 Faraday Avenue Carlsbad CA 92008 Tel 760 603 7200 Fax 760 602 6500 29 References Ausubel F M Brent R Kingston R E Moore D D Seidman J G Smith J A and Struhl K 1994 Current Protocols in Molecular Biology New York Greene Publishing Associates and Wiley Interscience Bernard P and Couturier M 1992 Cell Killing by the F Plasmid CcdB Protein Involves Poisoning of DNA Topoisomerase II Complexes J Mol Biol 226 735 745 Bernard P Gabant P Bahassi E M and Couturier M 1994 Positive Selection Vectors Using the F Plasmid ccdB Killer Gene Gene 148 71 74 Bernard P Kezdy K E Melderen L V Steyaert J Wyns L Pato M L Higgins P N and Couturier M 1993 The F Plasmid CcdB Protein Induces Efficient ATP dependent DNA Cleavage by Gyrase J Mol Biol 234 534 541 Brownstein M J Carpten J D and Smith J R 1996 Modulation of Non Templated Nucleotide Addition by Tag DNA Polymerase Primer Modifications that Facilitate Genotyping
11. completion If you used an enzyme that leaves a 5 overhang see the Important note on the next page Extract with phenol chloroform and ethanol precipitate Resuspend the DNA in 200 ul of TE pH 8 continued on next page Generating Nested Deletions continued If you find that you have to digest with an enzyme that leaves a 5 overhang e g Important Spe I you will have to fill in using a thio dNTPs and Klenow polymerase 1 Add 2 ul of a 1 mM stock of a thio dNTPs and 5 U of Klenow polymerase to the restriction digest previous page and incubate the reaction at room temperature for 10 minutes 2 Extract with phenol chloroform and ethanol precipitate Resuspend DNA in a volume of 200 tl 3 Incubate 1 ug of the filled in DNA with 20 U of exonuclease III for 15 minutes at 37 to check for protection against deletion Analyze by agarose gel electrophoresis Second Digest the DNA as described above with an enzyme that leaves a 5 overhang in Restriction Digest your insert or a blunt end e g Pme T Use 5 U of enzyme per ug DNA and digest the DNA to completion Remember to inactivate the restriction enzyme and check the digest 1 ul on an agarose gel to ensure that the reaction went to completion Extract with phenol chloroform and ethanol precipitate Resuspend the DNA at a concentration of 1 ug ul TE pH 8 Exonuclease For the exonuclease reaction set up a single digestion reaction and remove 25 ul II Mu
12. may also gel purify your PCR product after amplification with a Note proofreading polymerase After purification add Taq polymerase buffer dATP and 0 5 unit of Tag polymerase Incubate the reaction for 10 15 minutes at 72 C and use in the TOPO Cloning reaction 21 Generating Nested Deletions Introduction Background Strategy 22 For large inserts creating nested deletions is a method by which you can obtain additional sequence using the same sequencing primer You may use your own method or the one provided below The method below utilizes exonuclease III and mung bean nuclease to create nested deletions Commercial kits are available to generate nested deletions Exonuclease III will progressively digest only double stranded ds DNA containing a 5 overhang or blunt ends to create single stranded ss DNA It will not digest the 3 end of a ssDNA overhang or a 5 overhang that is filled in with a thio dNTPs This activity can be exploited to create unidirectional nested deletions in a DNA restriction fragment After digestion of the DNA with exonuclease III mung bean nuclease is used to remove all overhangs to produce blunt ends The DNA fragment is then ligated back into a vector with blunt ends and transformed into E coli competent cells Digestible by NOT Digestible by Exonuclease III z Exonuclease IH 5 3 5 i ses 3 5 ends filled in with a thio dNTPs 3 5 5 3 3 5 3 5 Most ne
13. overnight in order to visualize colonies With the Mach1 T1 strain you may also prepare plasmid DNA 4 hours after inoculating a single overnight grown colony Note that you will get sufficient growth of transformed cells within 4 hours in either ampicillin or kanamycin selective media In addition to general microbiological supplies e g plates spreaders you will need the following reagents and equipment e TOPO Cloning reaction from Performing the TOPO Cloning Reaction Step 2 page 5 e SOC medium included with the kit e LB plates containing 50 ug ml ampicillin or 50 ug ml kanamycin e 42 C water bath e 37 C shaking and non shaking incubator For each transformation you will need one vial of competent cells and two selective plates e Equilibrate a water bath to 42 C e Warm the vial of S O C medium from Box 2 to room temperature e Warm selective plates at 37 C for 30 minutes see Important note below e Thaw on ice 1 vial of One Shot cells for each transformation If you are performing the rapid chemical transformation protocol or if you wish to visualize colonies within 8 hours of plating it is essential that you prewarm your LB plates containing 50 100 ug ml ampicillin prior to spreading continued on next page Transforming One Shot Mach1 T1 Competent Cells continued TM One Shot For optimal growth of Mach1 T1 E coli cells it is essential that selective plates Chemic
14. restriction sites of the enzymes you want to use The length of DNA to be sequenced will determine the number of time points taken during the exonuclease III digestion The amount of enzyme reaction temperature and the time of incubation can control the rate of exonuclease III digestion Use the table below as a guide to set up your digestion Reaction Temperature Exonuclease III Digestion number of bases per minute 37 C 400 34 C 375 30 C 230 23 C 125 For a 3000 bp fragment you might want to digest 600 bases per time point You will need to take 5 time points to progress through the fragment Using the table above you see that exonuclease III digests 400 bases minute at 37 C therefore your time points will be over 1 minute apart Assume 5 ug DNA per time point Note Exonuclease III digestion rates will vary Use the information above as a guideline You will need at least 30 ug of DNA for restriction digestion and subsequent exonuclease III mung bean nuclease digestion Isolate DNA using the PureLink HO Mini Plasmid Purification Kit Catalog no K2100 01 or CsCI gradient centrifugation Digest 30 ug DNA in a 500 ul reaction volume with an enzyme that leaves a 3 overhang e g 5se8387 I Use 5 U of enzyme per ug DNA and digest the DNA to completion Remember to inactivate the restriction enzyme and check the digest 1 ul on an agarose gel to ensure that the reaction went to
15. 0 mM and 2 5 mM respectively To prevent arcing of your samples during electroporation the volume of cells should be between 50 and 80 ul 0 1 cm cuvettes or 100 to 200 ul 0 2 cm cuvettes If you experience arcing try one of the following suggestions Reduce the voltage normally used to charge your electroporator by 1076 Reduce the pulse length by reducing the load resistance to 100 ohms Precipitate the TOPO Cloning reaction and resuspend in water prior to electroporation 11 Analyzing Transformants Analyzing Positive 1 Take 2 6 colonies and culture them overnight in LB or SOB medium Clones Sequencing 12 containing 50 100 ug ml ampicillin or 50 ug ml kanamycin Note If you transformed One Shot Mach1 T1 competent E coli you may inoculate overnight grown colonies and culture them for 4 hours in prewarmed LB medium containing 50 ug ml ampicillin or 50 ug ml kanamycin before isolating plasmid For optimal results we recommend inoculating as much of a single colony as possible 2 Isolate plasmid DNA using PureLink Quick Plasmid Miniprep Kit supplied with cat no K4575 02 or available separately page viii The plasmid isolation protocol is included in the manual supplied with the PureLink Quick Plasmid Miniprep Kit and is also available for downloading from www invitrogen com Other kits for plasmid DNA purification are also suitable for use 3 Analyze the plasmids for inserts by restriction anal
16. Invitrogen TOPO TA Cloning Kit for Sequencing Five minute cloning of Tag polymerase amplified PCR products for sequencing Catalog nos K4530 20 K4575 J10 K4575 01 K4575 40 K4580 01 K4580 40 K4595 01 K4595 40 K4575 02 Version O 10 April 2006 25 0276 Table of Contents Table of Contents ennnen ete tei Raster t eps tatters Der fu tei mete fo REIN cop ot et lees iii Kit Contents ANd Storage ise o ene eae eee esie eoe elsn iv Accessory Products tete tout ea MIS Ie Dr Mer Nofettid viii Merhods aaa ee ei 1 OVerVIe WW oeiiesofeniiueenene dare per eia Deni sto tubie dai hired E et T 1 Producing PER Products 2 2 2 22 deut m EU e e Hte 3 Performing the TOPO Cloning Reaction cn un ne Bl 4 General Guidelines for Transforming Competent Cells essere 6 Transforming One Shot Mach1 T18 Competent Cells nione dee editio op Sp REO PRidbeepd 7 Transforming One Shot TOP10 and DH5a T18 Competent Cells eee 9 Analyzing Transforman tss soisi iae a eiri E eea aenea deae E aS Ko nette te tenete aa a TEER Ea a eaea tenete nennen 12 Optimizing the TORO Cloning Reaction ne 14 Map or PERPA TOPOS Sce seo umane Nine 15 Performing the Control R actions iedit iia ien E e ier RE Ae EEr SETE ERSE RE SEEE ES EE EE 16 PRP GIN K occas P 19 Purifying PCR Products o Rer ted ipt pon Hare nd tiir eg esee bei Oa en aan ebb 19 Addition of 3 A Overhangs Po
17. al are prewarmed to 37 C prior to spreading Transformation 1 Protocol Sy Mr og Add 2 ul of the TOPO Cloning reaction from Performing the TOPO Cloning Reaction Step 2 page 5 into a vial of One Shot Chemically Competent E coli and mix gently Do not mix by pipetting up and down Incubate on ice for 5 to 30 minutes Note Longer incubations on ice do not seem to have any affect on transformation efficiency The length of the incubation is at the user s discretion Heat shock the cells for 30 seconds at 42 C without shaking Immediately transfer the tubes to ice Add 250 ul of room temperature S O C medium Cap the tube tightly and shake the tube horizontally 200 rpm at 37 C for 1 hour Spread 10 50 ul from each transformation on a prewarmed selective plate To ensure even spreading of small volumes add 20 ul of S O C medium We recommend that you plate two different volumes to ensure that at least one plate will have well spaced colonies Incubate plates at 37 C If you are using ampicillin selection visible colonies should appear within 8 hours For kanamycin selection incubate plates overnight An efficient TOPO Cloning reaction should produce several hundred colonies Pick 10 colonies for analysis see Analyzing Positive Clones page 12 Rapid One Shot An alternative protocol is provided below for rapid transformation of One Shot Chemical Mach1 T1 cells This protocol is only recommended for trans
18. an be varied from 30 seconds to 30 minutes For routine subcloning of PCR products 30 seconds may be sufficient For large PCR products gt 1 kb or if you are TOPO Cloning a pool of PCR products increasing the reaction time will yield more colonies 2 Place the reaction on ice and proceed to General Guidelines for Transforming Competent Cells next page Note You may store the TOPO Cloning reaction at 20 C overnight General Guidelines for Transforming Competent Cells Introduction Selecting a One Shot Chemical Transformation Protocol Important EN 7 ECO Nous N Once you have performed the TOPO Cloning reaction you will transform your pCR 4 TOPO construct into the competent E coli provided with your kit General guidelines for transformation are provided below For transformation protocols refer to the section entitled Transforming One Shot Mach1 T1 Competent Cells pages 7 8 or Transforming One Shot TOP10 and DH5a T1 Competent Cells pages 9 11 depending on the competent E coli you wish to transform Two protocols are provided to transform One Shot chemically competent E coli Consider the following factors when choosing the protocol that best suits your needs If you wish to Then use the maximize the number of transformants regular chemical transformation clone large PCR products 21000 bp protocol use kanamycin as the selective agent see Imp
19. any activity by a party for consideration and may include but is not limited to 1 use of the product or its components in manufacturing 2 use of the product or its components to provide a service information or data 3 use of the product or its components for therapeutic diagnostic or prophylactic purposes or 4 resale of the product or its components whether or not such product or its components are resold for use in research Invitrogen Corporation will not assert a claim against the buyer of infringement of patents owned or controlled by Invitrogen Corporation which cover this product based upon the manufacture use or sale of a therapeutic clinical diagnostic vaccine or prophylactic product developed in research by the buyer in which this product or its components was employed provided that neither this product nor any of its components was used in the manufacture of such product If the purchaser is not willing to accept the limitations of this limited use statement Invitrogen is willing to accept return of the product with a full refund For information on purchasing a license to this product for purposes other than research contact Licensing Department Invitrogen Corporation 1600 Faraday Avenue Carlsbad California 92008 Phone 760 603 7200 Fax 760 602 6500 Email outlicensing invitrogen com This product is the subject of one or more of U S Patent Numbers 5 910 438 and 6 180 407 and corresponding foreign patents
20. ases 508 810 T3 priming site bases 243 262 TOPO Cloning site bases 294 295 T7 priming site bases 328 347 M13 Forward 20 priming site bases 355 370 Kanamycin promoter bases 1021 1070 Kanamycin resistance gene bases 1159 1953 Ampicillin bla resistance gene bases 2203 3063 c Ampicillin b a promoter bases 3064 3160 c pUC origin bases 3161 3834 c complementary strand 15 Performing the Control Reactions Introduction Before Starting Producing Control PCR Product 16 We recommend performing the following control TOPO Cloning reactions the first time you use the kit to help you evaluate your results Performing the control reactions involves producing a control PCR product using the reagents included in the kit and using it directly in a TOPO Cloning reaction For each transformation prepare two LB plates containing 50 ug ml kanamycin Note Do not use plates containing ampicillin The control template is a plasmid that encodes ampicillin resistance This template is carried over into the TOPO Cloning and transformation reactions Transformants carrying this plasmid will also be ampicillin resistant resulting in an apparent increase in TOPO Cloning efficiency but upon analysis colonies do not contain the desired construct em Control DNA Template 100 ng 1ul 10X PCR Buffer 5 pl 50 mM dNTPs 0 5 ul Control PCR Primers 0 1 ug l each 1 ul Water 41 5 ul Tag Polymerase 1
21. ate dependent terminal transferase activity which adds a single deoxyadenosine A to the 3 ends of PCR products The linearized vector supplied in this kit has single overhanging 3 deoxythymidine T residues This allows PCR inserts to ligate efficiently with the vector Topoisomerase I from Vaccinia virus binds to duplex DNA at specific sites and cleaves the phosphodiester backbone after 5 CCCTT in one strand Shuman 1991 The energy from the broken phosphodiester backbone is conserved by formation of a covalent bond between the 3 phosphate of the cleaved strand and a tyrosyl residue Tyr 274 of topoisomerase I The phospho tyrosyl bond between the DNA and enzyme can subsequently be attacked by the 5 hydroxyl of the original cleaved strand reversing the reaction and releasing topoisomerase Shuman 1994 TOPO Cloning exploits this reaction to efficiently clone PCR products see below Topoisomerase ge CCCTT F oa zs LNAGGG GGG eas A PCR Product E GC HO S Topoisomerase continued on next page Overview continued Positive Selection Experimental Outline pCR 4 TOPO allows direct selection of recombinants via disruption of the lethal E coli gene ccdB Bernard and Couturier 1992 Bernard et al 1994 Bernard et al 1993 The vector contains the ccdB gene fused to the C terminus of the LacZa fragment Ligation of a PCR product disrupts expression of the lacZa ccdB gene fusion permit
22. ation into the One Shot TOP10 cells It is very important to proceed as soon as possible from the TOPO Cloning reaction to transformation to ensure the highest cloning and transformation efficiencies We have found that including salt 200 mM NaCl 10 mM MgCl in the TOPO Cloning reaction can increase the number of transformants 2 to 3 fold In addition incubating the reaction mixture for greater than 5 minutes in the presence of salt can also increase the number of transformants This is in contrast to earlier experiments without salt where the number of transformants decreases as the incubation time increases beyond 5 minutes Including salt in the TOPO Cloning reaction allows for longer incubation times because it prevents topoisomerase I from rebinding and potentially nicking the DNA after ligating the PCR product and dissociating from the DNA The result is more intact molecules leading to higher transformation efficiencies You will perform TOPO Cloning in a reaction buffer containing salt i e using the stock salt solution provided in the kit Note that the amount of salt added to the TOPO Cloning reaction varies depending on whether you plan to transform chemically competent cells or electrocompetent cells e If you are transforming chemically competent E coli use the stock Salt Solution as supplied and set up the TOPO Cloning reaction as directed on the next page e If you are transforming electrocompetent E col
23. containing 50 ug ml kanamycin Be sure to plate two different volumes to ensure well spaced colonies For plating small volumes 20 ul add 20 ul of S O C medium to allow even spreading Note Do not use ampicillin to select for transformants The PCR product was generated from a template containing the ampicillin resistance gene Carry over from the PCR will produce transformants that are ampicillin resistant but are not derived from pCR 4 TOPO 5 Incubate overnight at 37 C Hundreds of colonies from the vector PCR insert reaction should be produced Greater than 90 or more of these will contain the 750 bp insert when analyzed by EcoR I digestion and agarose gel electrophoresis Relatively few colonies will be produced in the vector only reaction These colonies usually result from frameshift events usually T T mismatches and results in disruption of the LacZa ccdB reading frame The pUC19 plasmid is included to check the transformation efficiency of the One Shot competent cells Transform with 10 pg per 50 ul of cells using the protocols on pages 7 11 Use LB plates containing 100 ug ml ampicillin Just before plating the transformation mix for electrocompetent cells dilute 10 ul of the mix with 90 ul of S O C medium Volume to Plate 10 ul 20 ul S O C 20 ul 1 10 dilution Type of Cells Transformation Efficiency 1x 10 cfu ug DNA gt 1x 10 cfu ug DNA Chemically Competent
24. contamination Purchaser Notification Information for European Customers Limited Use Label License No 5 Invitrogen Technology Limited Use Label License No 54 ccdB Fusion Vectors The Mach1 T1 E coli strain is genetically modified to carry the lacZAM15 hsdR lacX74 recA endA tonA genotype As a condition of sale use of this product must be in accordance with all applicable local legislation and guidelines including EC Directive 90 219 EEC on the contained use of genetically modified organisms The purchase of this product conveys to the buyer the non transferable right to use the purchased amount of the product and components of the product in research conducted by the buyer whether the buyer is an academic or for profit entity The buyer cannot sell or otherwise transfer a this product b its components or c materials made using this product or its components to a third party or otherwise use this product or its components or materials made using this product or its components for Commercial Purposes The buyer may transfer information or materials made through the use of this product to a scientific collaborator provided that such transfer is not for any Commercial Purpose and that such collaborator agrees in writing a not to transfer such materials to any third party and b to use such transferred materials and or information solely for research and not for Commercial Purposes Commercial Purposes means
25. e at room temperature for 5 minutes Centrifuge at 212 000 x g for 1 minute Discard flow through 10 Centrifuge the column at 712 000 x g for 1 minute to remove any residual buffer Place the column into a 1 5 ml Recovery Tube 11 Add 50 ul warm 65 70 C TE Buffer TE to the center of the cartridge Incubate at room temperature for 1 minute 12 Centrifuge at 212 000 x g for 2 minutes The Recovery Tube contains the purified DNA Store DNA at 20 C Discard the column 13 Use 4 pl of the purified DNA for the TOPO Cloning reaction continued on next page 19 Purifying PCR Products continued Low Melt Agarose Note that gel purification will result in a dilution of your PCR product Use only Method chemically competent cells for transformation 1 Electrophorese as much as possible of your PCR reaction on a low melt agarose gel 0 8 to 1 2 in TAE buffer Visualize the band of interest and excise the band Place the gel slice in a microcentrifuge tube and incubate the tube at 65 C until the gel slice melts Place the tube at 37 C to keep the agarose melted Use 4 ul of the melted agarose containing your PCR product in the TOPO Cloning reaction page 5 Incubate the TOPO Cloning reaction at 37 C for 5 to 10 minutes This is to keep the agarose melted Transform 2 to 4 ul directly into TOP10 One Shot cells using the method on pages 7 11 Note Cloning efficiency may decrease with purification of
26. e should be few other bands Use the DNA from Step 8 previous page to set up ligation reactions for each time point Note Some ligase buffers already contain ATP Be sure to check the composition of your ligase buffer before adding additional ATP 1 Set up the following 20 ul ligation reaction Digested DNA lul 10X Ligase Buffer 2 ul 10 mM ATP pH 7 7 5 ribonucleotide form 1 pl T4 DNA Ligase 1 U l 2 ul Deionized Water 14 ul Total Volume 20 ul Incubate at room temperature for 4 hours or at 4 C overnight Transform 1 ul of the ligation reaction into competent E coli and select on LB plates containing 50 100 ug ml ampicillin Choose 5 colonies per time point and isolate DNA using the PureLink HQ Mini Plasmid Purification Kit Catalog no 2100 01 or similar kit Analyze for deleted inserts Order the deletions by descending size and proceed to sequencing Clones can be sequenced using the M13 Reverse or the 13 primer Refer to Current Protocols in Molecular Biology pages 7 2 1 to 7 2 20 for more information on exonuclease III digestions Ausubel et al 1994 Technical Service World Wide Web Visit the Invitrogen website at www invitrogen com for e Technical resources including manuals vector maps and sequences application notes MSDSs FAOs formulations citations handbooks etc e Complete technical service contact information e Access to the Invitrogen Online Catalog
27. e tubes to ice Add 250 ul of room temperature S O C medium Cap the tube tightly and shake the tube horizontally 200 rpm at 37 C for 1 hour Qv Qu mese 7 Spread 10 50 ul from each transformation on a prewarmed selective plate and incubate overnight at 37 C To ensure even spreading of small volumes add 20 ul of S O C medium We recommend that you plate two different volumes to ensure that at least one plate will have well spaced colonies 8 An efficient TOPO Cloning reaction should produce several hundred colonies Pick 10 colonies for analysis see Analyzing Positive Clones page 12 Rapid One Shot An alternative protocol is provided below for rapid transformation of One Shot Chemical chemically competent E coli This protocol is only recommended for Transformation transformations using ampicillin selection For more information on selecting a Protocol transformation protocol refer to page 6 Note It is essential that LB plates containing ampicillin are prewarmed prior to spreading 1 Add 4 ul of the TOPO Cloning reaction from Performing the TOPO Cloning Reaction Step 2 page 5 into a vial of One Shot Chemically Competent E coli and mix gently Do not mix by pipetting up and down 2 Incubate on ice for 5 minutes Spread 50 ul of cells on a prewarmed LB plate containing 50 100 ng ml ampicillin and incubate overnight at 37 C 4 Anefficient TOPO Cloning reaction should produce several hundred colonies
28. er time point to create an appropriate set of nested deletions Exonuclease III deletion grade 100 U l Klenow polymerase 5 U l optional Mung bean nuclease 100 U ul T4 DNA ligase 4 U l a Thio phosphate dNTPs 1 mM optional 2X Exonuclease III Buffer 100 mM Tris HCl pH 8 10 mM MgCl 10X Mung Bean Nuclease Buffer 300 mM sodium acetate pH 5 500 mM NaCl 10 mM ZnCb 50 v v glycerol 1X Mung Bean Dilution Buffer 10 mM sodium acetate pH 5 0 1 mM zinc acetate 0 1 Triton X 100 50 v v glycerol 10X Ligase Buffer 500 mM Tris HCl pH 7 5 70 mM MgCh 10 mM dithiothreitol DTT B mercaptoethanol 10 mM ATP ribonucleotide form pH 7 to 7 5 Heat block with variable temperature settings Microcentrifuge tubes Dry Ice Agarose gel electrophoresis equipment and reagents continued on next page 23 Generating Nested Deletions continued Important Other Considerations Example Plasmid Preparation First Restriction Digest 24 We recommend that you first digest with Sse8387 I to linearize the vector and create ends that have 3 overhangs Then digest with Pme I to create a blunt end Exonuclease III will digest from the Pme I site into the insert After treating with mung bean nuclease to create blunt ends simply ligate the vector back together You can use either the M13 Reverse or the T3 primer to sequence into your insert Be sure to check your insert for the presence of
29. formations using Transformation ampicillin selection For more information on selecting a transformation Protocol protocol refer to page 6 Note It is essential that LB plates containing ampicillin are prewarmed to 37 C prior to spreading 1 Add 4 ul of the TOPO Cloning reaction from Performing the TOPO Cloning Reaction Step 2 page 5 into a vial of One Shot Chemically Competent E coli and mix gently Do not mix by pipetting up and down 2 Incubate on ice for 5 minutes Spread 50 ul of cells on a prewarmed LB plate containing 50 100 ng ml ampicillin and incubate overnight at 37 C 4 An efficient TOPO Cloning reaction should produce several hundred colonies Pick 10 colonies for analysis see Analyzing Positive Clones page 12 Transforming One Shot TOP10 and DH5a T1 Competent Cells Introduction Materials Supplied by the User Preparing for Transformation Important Protocols to transform One Shot TOP10 and DH5a T1 competent E coli are provided below Both chemical transformation and electroporation protocols are provided If you are transforming Mach1 T1 cells refer to the section entitled Transforming One Shot Mach1 T1 Competent Cells pages 7 8 In addition to general microbiological supplies e g plates spreaders you will need the following reagents and equipment e TOPO Cloning reaction from Performing the TOPO Cloning Reaction Step 2 page 5 e SOC medium included with t
30. he kit e LB plates containing 50 ug ml ampicillin or 50 ug ml kanamycin e 15 mlsnap cap plastic culture tubes sterile electroporation only e 42 C water bath or an electroporator and 0 1 or 0 2 cm cuvettes e 37 C shaking and non shaking incubator For each transformation you will need one vial of competent cells and two selective plates e Equilibrate a water bath to 42 C for chemical transformation or set up your electroporator e Warm the vial of S O C medium from Box 2 to room temperature e Warm selective plates at 37 C for 30 minutes see Important note below e Thaw on ice 1 vial of One Shot cells for each transformation If you are performing the rapid chemical transformation protocol it is essential that you prewarm your LB plates containing 50 100 ug ml ampicillin prior to spreading continued on next page Transforming One Shot TOP10 and DH5a T1 Competent Cells continued One Shot 1 Add2 ul of the TOPO Cloning reaction from Performing the TOPO Cloning Chemical Reaction Step 2 page 5 into a vial of One Shot Chemically Competent E coli Transformation and mix gently Do not mix by pipetting up and down Protocol 2 Incubate on ice for 5 to 30 minutes Note Longer incubations on ice do not seem to have any affect on transformation efficiency The length of the incubation is at the user s discretion Heat shock the cells for 30 seconds at 42 C without shaking Immediately transfer th
31. i the amount of salt in the TOPO Cloning reaction must be reduced to 50 mM NaCl 2 5 mM MgCl to prevent arcing during electroporation Dilute the stock Salt Solution 4 fold with water to prepare a 300 mM NaCl 15 mM MgCl Dilute Salt Solution Use the Dilute Salt Solution to set up the TOPO Cloning reaction as directed on the next page continued on next page Performing the TOPO Cloning Reaction continued Performing the Use the procedure below to perform the TOPO Cloning reaction Set up the TOPO Cloning TOPO Cloning reaction using the reagents in the order shown and depending on Reaction whether you plan to transform chemically competent E coli or electrocompetent E coli Note The red or yellow color of the TOPO vector solution is normal and is used to visualize the solution Reagent Chemically Competent E coli Electrocompetent E coli Fresh PCR product 0 5to4 ul 0 5 to4 ul Salt Solution 1 ul Dilute Salt Solution lul Water add to a final volume of 5 ul add to a final volume of 5 ul TOPO vector lu 1ul Final Volume 6 ul 6 ul Store all reagents at 20 C when finished Salt solutions and water can be stored at room temperature or 4 C 1 Mix reaction gently and incubate for 5 minutes at room temperature 22 23 C Note For most applications 5 minutes will yield plenty of colonies for analysis Depending on your needs the length of the TOPO Cloning reaction c
32. ically Competent 40 K4580 01 TOP10 Electrocomp 20 K4580 40 TOP10 Electrocomp 40 K4575 02 TOP10 Chemically Competent 20 Includes PureLink Quick Plasmid Miniprep Kit TOPO TA Cloning TOPO TA Cloning reagents Box 1 are listed below Note that the user must Reagents supply Taq polymerase Store Box 1 at 20 C Item Concentration Amount Amount Amount 10 Reactions 20 Reactions 40 Reactions pCR 4 TOPO 10 ng ul plasmid DNA in 15 ul 25 ul 2x25 ul 50 glycerol 50 mM Tris HCI pH 7 4 at 25 C 1 mM EDTA 2mM DTT 0 1 Triton X 100 100 ug ml BSA 30 uM phenol red continued on next page Kit Contents and Storage continued TOPO TA Cloning Reagents continued Item Concentration Amount Amount Amount 10 Reactions 20 Reactions 40 Reactions 10X PCR Buffer 100 mM Tris HCI pH 8 3 at 100 ul 100 ul 2x100 ul 42 C 500 mM KCI 25 mM MgCb 0 0176 gelatin dNTP Mix 12 5 mM dATP 12 5 mM dCTP 10 ul 10 ul 2x10 ul 12 5 mM dGTP 12 5 mM dTTP neutralized at pH 8 0 in water Salt Solution 1 2 M NaCl 50 ul 50 ul 2x50 ul 0 06 M MgCb Water 1ml 1ml 2x1ml M13 Forward 20 0 1 ug ul in TE Buffer pH 8 20 ul 20 ul 2x20 ul Primer 407 pmoles 407 pmoles 814 pmoles M13 Reverse Primer 0 1ug ulin TE Buffer pH 8 20 pl 20 ul 2x 20 ul 385 pmoles 385 pmoles 770 pmoles T3 primer 0 1 ug ul in TE Buffer pH 8 20 pl 20 ul 2x 20 ul
33. imits Invitrogen Corporation s liability only to the cost of the product No warranty is granted for products beyond their listed expiration date No warranty is applicable unless all product components are stored in accordance with instructions Invitrogen reserves the right to select the method s used to analyze a product unless Invitrogen agrees to a specified method in writing prior to acceptance of the order Invitrogen makes every effort to ensure the accuracy of its publications but realizes that the occasional typographical or other error is inevitable Therefore Invitrogen makes no warranty of any kind regarding the contents of any publications or documentation If you discover an error in any of our publications please report it to our Technical Service Representatives Invitrogen assumes no responsibility or liability for any special incidental indirect or consequential loss or damage whatsoever The above limited warranty is sole and exclusive No other warranty is made whether expressed or implied including any warranty of merchantability or fitness for a particular purpose 27 Product Qualification Introduction TOPO Vector TOPO Cloning Efficiency Primers One Shot Competent E coli 28 Invitrogen qualifies the TOPO TA Cloning Kits for Sequencing as described below The parental supercoiled pCR 4 vector is qualified by restriction digest prior to adaptation with topoisomerase I Restricti
34. nd A1 nupG Mach1 T1 Use this strain for general cloning and blue white screening without IPTG Strain is resistant to T1 bacteriophage F 80lacZAM15 AlacX74 hsdR rx m ArecA1398 end A1 tonA confers resistance to phage T1 DH5a T1 Use this strain for general cloning and blue white screening without IPTG Strain is resistant to T1 bacteriophage F 680lacZAM15 A lacZY A argF U169 recA1 end A1 hsdR17 rx m phoA supE44 thi 1 gyrA96 rel A1 tonA confers resistance to phage T1 Information for Non U S Customers Using Mach1 T1 Cells The parental strain of Mach1 T1 E coli is the non K 12 wild type W strain ATCC 9637 S A Waksman Although the parental strain is generally classified as Biosafety Level 1 BL 1 we recommend that you consult the safety department of your institution to verify the Biosafety Level vi continued on next page Kit Contents and Storage continued PureLink Quick For kit components of the PureLink Quick Plasmid Miniprep Kit Box 3 Plasmid Miniprep supplied with cat no K4575 02 refer to the manual supplied with the miniprep Kit kit vii Accessory Products Additional Products viii The table below lists additional products that may be used with TOPO TA Cloning Kits for Sequencing For more information refer to our Web site www invitrogen com or contact Technical Service page 27
35. ng Bean aliquots at various time points Use 5 ug DNA time point p 1 Set up 5 microcentrifuge tubes with the exonuclease III stop solution 155 ul Igesuon water 20 ul 10X mung bean nuclease buffer for each tube Hold at room temperature 2 Setup the following 125 ul exonuclease III digestion reaction Double digested DNA 1 ug ul 25 ul 2X Exonuclease III buffer 62 5 ul 100 mM fresh B mercaptoethanol 12 5 ul Water 25 ul Total Volume 125 ul 3 Add 5 ul of exonuclease III 100 U ul and incubate at the desired temperature see page 24 4 Remove 25 ul from the reaction for each time point 1 2 minutes per time point and add to one of the tubes containing the stop solution Place tubes on dry ice 5 When all time points have been collected heat the tubes at 68 C for 15 minutes to inactivate exonuclease III Place the tubes on ice 6 Dilute mung bean nuclease to 15 U ul in 1X Mung Bean Nuclease buffer 7 Add 1 ul of diluted mung bean nuclease to each time point tube Incubate at 30 C for 30 minutes 8 Extract each time point with phenol chloroform and precipitate with ethanol Resuspend each DNA pellet in 15 ul TE pH 8 continued on next page 25 Generating Nested Deletions continued What You Should See Ligation and Transformation For More Information 26 Analyze 7 ul of each sample on an agarose gel For each increasing time point you should see a single band that progressively decreases in size Ther
36. oduct If you use polymerase mixtures that do not have enough Tag polymerase or a proofreading polymerase only you can add 3 A overhangs using the method on page 21 1 Set up the following 50 ul PCR reaction Use the cycling parameters suitable for your primers and template and be sure to end with a 7 to 30 minute extension at 72 C to ensure that all PCR products are full length and 3 adenylated Use less for plasmid template DNA and more DNA for genomic template DNA DNA Template 10 100 ng 10X PCR Buffer 5 ul 50 mM dNTPs 0 5 pl Primers 200 ng each 1 uM each Water add to a final volume of 49 ul Tag Polymerase 1 unit ul 1 unit Total Volume 50 ul 2 Check the PCR product by agarose gel electrophoresis You should see a single discrete band If you do not see a single band refer to the Note below If you do not obtain a single discrete band from your PCR you may gel purify your fragment before TOPO Cloning see page 19 Take special care to avoid sources of nuclease contamination Alternatively you may elect to optimize your PCR to eliminate multiple bands and smearing Innis et al 1990 The PCR Optimizer Kit Catalog no K1220 01 incorporates many of the recommendations found in this reference Performing the TOPO Cloning Reaction Introduction Note Using Salt Solution in the TOPO Cloning Reaction At this point you should have your PCR product ready for TOPO Cloning and transform
37. oduct e Incubate the TOPO Cloning reaction for 20 to 30 minutes e Concentrate the PCR product Map of pCR 4 TOPO pCR 4 TOPO Map The map below shows the features of pCR 4 TOPO and the sequence surrounding the TOPO Cloning site Restriction sites are labeled to indicate the actual cleavage site The complete sequence of pCR 4 TOPO is available for downloading from our Web site www invitrogen com or by contacting Technical Service page 27 LacZa initiation codon M13 Reverse priming site T3 priming site 201 CACACAGGAA ACAGCTATGA CCATGATTAC GCCAAGCTCA GAATTAACCC TCACTAAAGG GTGTGTCCTT TGTCGATACT GGTACTAATG CGGTTCGAGT CTTAATTGGG AGTGATTTCC Spe Pst Pmel EcoRI EcoR Not r l l l l l 261 GACTAGTCCT GCAGGTTTAA ACGAATTCGC CCTT PCR INAGGGC GAATTCGCGG CTGATCAGGA CGTCCAAATT TGCTTAAGCG GGAENMELUSM TTCCCG CTTAAGCGCC T7 priming site M13 Forward 20 priming site CCGCTAAATT CAATTCGCCC TATAGTGAGT CGTATTACAA TTCACTGGCC GTCGTTTTAC GGCGATTTAA GTTAAGCGGG ATATCACTCA GCATAATGTT AAGTGACCGG CAGCAAAATG 311 Comments for pCR 4 TOPO 3956 nucleotides lac promoter region bases 2 216 CAP binding site bases 95 132 RNA polymerase binding site bases 133 178 Lac repressor binding site bases 179 199 Start of transcription base 179 M13 Reverse priming site bases 205 221 LacZa ccdB gene fusion bases 217 810 LacZa portion of fusion bases 217 497 ccdB portion of fusion b
38. on digests must demonstrate the correct banding pattern when electrophoresed on an agarose gel Once the pCR 4 TOPO vector has been adapted with topoisomerase I it is lot qualified using the control reagents included in this kit Under conditions described on pages 16 17 a 750 bp control PCR product was TOPO Cloned into the vector and subsequently transformed into the One Shot competent F coli included with the kit Each lot of vector should yield greater than 95 cloning efficiency The primers included in this kit have been lot qualified by DNA sequencing experiments using the dideoxy chain termination technique All competent cells are qualified as follows e Cells are tested for transformation efficiency using the control plasmid included in the kit Transformed cultures are plated on LB plates containing 100 ug ml ampicillin and the transformation efficiency is calculated Test transformations are performed in duplicate Transformation efficiency should be 1 x 10 cfu ug DNA for chemically competent cells and gt 1 x 10 for electrocompetent cells e To verify the absence of phage contamination 0 5 1 ml of competent cells are added to LB top agar and poured onto LB plates After overnight incubation no plaques should be detected e Untransformed cells are plated on LB plates 100 ug ml ampicillin 25 ug ml streptomycin 50 ug ml kanamycin or 15 ug ml chloramphenicol to verify the absence of antibiotic resistant
39. ortant note below obtain transformants as quickly as possible rapid chemical transformation protocol If you will be using kanamycin as the selective agent for chemical transformation use the regular chemical transformation protocol The rapid chemical transformation protocol is only suitable for transformations using ampicillin selection If you use a plasmid template for your PCR that carries either the ampicillin or kanamycin resistance marker we recommend that you use the other selection agent to select for transformants For example if the plasmid template contains the ampicillin resistance marker then use kanamycin to select for transformants The template is carried over into the TOPO Cloning and transformation reactions resulting in transformants that are ampicillin resistant and white but are not the desired construct Transforming One Shot Mach1 T1 Competent Cells Introduction Note Materials Supplied by the User Preparing for Transformation Important Protocols to transform One Shot Mach1 T1 chemically competent E coli are provided below If are transforming cells other than Mach1 T1 cells refer to the section entitled Transforming One Shot TOP10 and DH5a T1 Competent Cells pages 9 11 The Mach1 T1 strain allows you to visualize colonies 8 hours after plating on ampicillin selective plates If you are using kanamycin selection you will need to incubate plates
40. rotocol is provided below for your convenience Other protocols are suitable Materials Needed PCR SuperMix High Fidelity Invitrogen Catalog no 10790 020 Appropriate forward and reverse PCR primers 20 uM each Procedure 1 For each sample aliquot 48 ul of PCR SuperMix High Fidelity into a 0 5 ml microcentrifuge tube Add 1 ul each of the forward and reverse PCR primer 2 Pick 10 colonies and resuspend them individually in 50 ul of the PCR cocktail from Step 1 above Don t forget to make a patch plate to preserve the colonies for further analysis 3 Incubate the reaction for 10 minutes at 94 C to lyse the cells and inactivate nucleases Amplify for 20 to 30 cycles For the final extension incubate at 72 C for 10 minutes Store at 4 C Visualize by agarose gel electrophoresis Once you have identified the correct clone be sure to purify the colony and make a glycerol stock for long term storage It is also a good idea to store a stock of purified DNA at 20 C 1 Streak the original colony out for single colony on LB plates containing 100 ug ml ampicillin 2 Isolate a single colony and inoculate into 1 2 ml of LB containing 100 ug ml ampicillin Grow overnight until culture is saturated Mix 0 85 ml of culture with 0 15 ml of sterile glycerol and transfer to a cryovial 5 Store at 80 C 13 Optimizing the TOPO Cloning Reaction Introduction Faster Subcloning More Transformants Cloning
41. st Amplification ueeennnnnensnnnnssenenennnnnn 21 Generating Nested Deletions cinese oae oats eA binant di dede been oe heels 22 Technical Service i 2 22 22 2222 et EEE RIED 27 Product Qualification 2 tet e a ee n e ete d eot a tds 28 Purchaser Notification s ce Rt e emet es nde eir rdiet up ae 29 IN C 30 Kit Contents and Storage Shipping and Storage Types of Kits The TOPO TA Cloning Kits for Sequencing are shipped on dry ice Each kit contains a box with TOPO TA Cloning reagents Box 1 and a box with One Shot Competent E coli Box 2 TOPO TA Cloning Kit for Sequencing supplied with the PureLink Quick Plasmid Miniprep cat no K4575 02 is shipped with an additional box containing reagents for plasmid purification Box 3 Store Box 1 at 20 C Box 2 at 80 C and Box 3 at room temperature TOPO TA Cloning Kits for Sequencing are available with either Mach1 T18 TOP10 or DH5a T1 One Shot Chemically Competent cells or TO10 One Shot Electrocomp cells see page vi for the genotypes of the strains Catalog no K4575 02 also includes PureLink Quick Plasmid Miniprep Kit Catalog no One Shot Cells Reactions K4530 20 Mach1 T1 Chemically Competent 20 K4575 J10 TOP10 Chemically Competent 10 K4575 01 TOP10 Chemically Competent 20 K4575 40 TOP10 Chemically Competent 40 K4595 01 DH5a T1 Chemically Competent 20 K4595 40 DH5a T1 Chem
42. sted deletion strategies involve digestion of the target DNA with two restriction enzymes One enzyme should leave a 3 overhang which prevents digestion by exonuclease III The other enzyme should leave a 5 overhang or a blunt end for digestion of the DNA by exonuclease III Note that the multiple cloning site in this vector contains an 5508387 I site a rare site that leaves a 3 overhang after digestion In addition there is also a Pme I site that leaves a blunt end when digested continued on next page Generating Nested Deletions continued General Outline Materials Needed The table below outlines the general steps necessary to prepare nested deletions Step Action 1 Prepare pure plasmid DNA 2 Digest DNA with the first restriction enzyme 3 Fill in 5 overhangs with a thio dNTP mix and Klenow optional 4 Extract DNA with phenol chloroform 1 1 v v and ethanol precipitate 5 Check fill in by digestion with exonuclease III and agarose gel electrophoresis optional 6 Digest DNA with the second restriction enzyme 7 Extract DNA with phenol chloroform 1 1 v v and ethanol precipitate 8 Digest DNA with exonuclease III and collect time points 9 Digest DNA with mung bean nuclease to remove ssDNA and create blunt ends 10 Ligate the ends to recircularize vector 11 Transform ligation into competent E coli and select transformants 12 Analyze at least 5 transformants p
43. the PCR product You may wish to optimize your PCR to produce a single band 20 Addition of 3 A Overhangs Post Amplification Introduction Direct cloning of DNA amplified by proofreading polymerases into TOPO TA Cloning vectors is often difficult because of very low cloning efficiencies This is because proofreading polymerases remove the 3 A overhangs necessary for TA Cloning Invitrogen has developed a simple method to clone these blunt ended fragments Materials Needed You will need the following items e Taq polymerase e A heat block equilibrated to 72 C e Phenol chloroform optional e 3Msodium acetate optional e 100 ethanol optional e 80 ethanol optional e TE buffer optional Procedure This is just one method for adding 3 adenines Other protocols may be suitable 1 After amplification with the proofreading polymerase place vials on ice and add 0 7 1 unit of Taq polymerase per tube Mix well It is not necessary to change the buffer A sufficient number of PCR products will retain the 3 A overhangs 2 Incubate at 72 C for 8 10 minutes do not cycle 3 Place onice and use immediately in the TOPO Cloning reaction Note If you plan to store your sample overnight before proceeding with TOPO Cloning extract your sample with an equal volume of phenol chloroform to remove the polymerases Ethanol precipitate the DNA and resuspend in TE buffer using the starting volume of the PCR You
44. ting growth of only positive recombinants upon transformation in TOP10 cells Cells that contain non recombinant vector are killed upon plating Therefore blue white screening is not required The flow chart below outlines the experimental steps necessary to clone your PCR product Produce PCR product TOPO Cloning Reaction Mix together PCR product and pCR 4 TOPO Incubate 5 minutes at room temperature Transform into TOP10 E coli cells Select and analyze colonies Isolate plasmid DNA and sequence Producing PCR Products Introduction Note Materials Supplied by the User Polymerase Mixtures Producing PCR Products Note The TOPO TA Cloning Kits for Sequencing are specifically designed to clone Taq polymerase generated PCR products for sequencing The first time you use the kit we recommend performing the control TOPO Cloning reaction on page 16 to evaluate your results Do not add 5 phosphates to your primers for PCR The PCR product synthesized will not ligate into pCR 4 TOPO In addition to general microbiological supplies e g plates spreaders you will need the following reagents and equipment e Tag polymerase e Thermocycler e DNA template and primers for PCR product If you wish to use a mixture containing Taq polymerase and a proofreading polymerase Taq must be used in excess of a 10 1 ratio to ensure the presence of 3 A overhangs on the PCR pr
45. unit ul 1 ul Total Volume 50 ul Overlay with 70 ul 1 drop of mineral oil if required Amplify using the following cycling parameters To produce the 750 bp control PCR product set up the following 50 ul PCR Step Time Temperature Cycles Initial Denaturation 2 minute 94 C 1X Denaturation 1 minute 94 C Annealing 1 minute 55 C 25X Extension 1 minute 72 C Final Extension 7 minutes 72 C 1X 4 Remove 10 ul from the reaction and analyze by agarose gel electrophoresis A discrete 750 bp band should be visible Proceed to the Control TOPO Cloning Reactions next page continued on next page Performing the Control Reactions continued Control TOPO Cloning Reactions Using the control PCR product produced on the previous page and pCR 4 TOPO set up two 6 ul TOPO Cloning reactions as described below 1 Set up control TOPO Cloning reactions If transforming by electroporation use a 4 fold dilution of the Salt Solution to prevent arcing see page 11 Analyzing Results Transformation Control Reagent Vector Only Vector PCR Insert Control PCR Product 1ul Water 4 ul 3ul Salt Solution Tul Tul pCR 4 TOPO 1 ul lu 2 Incubate at room temperature for 5 minutes and place on ice 3 Transform 2 ul of each reaction into separate vials of One Shot TOP10 cells pages 7 11 4 Spread 10 100 ul of each transformation mix onto LB plates
46. ysis digest with EcoR I or refer to the vector map on page 15 or by PCR screening see next page You may also proceed directly to sequencing You may sequence your construct to confirm that your gene is cloned in the correct orientation Four primers M13 Forward 20 M13 Reverse T3 and T7 are included to help you sequence your insert Refer to the map on page 15 for the sequence surrounding the TOPO Cloning site For the full sequence of the vector refer to our Web site www invitrogen com or contact Technical Service page 27 If you discover that the primers included in the kit do not allow you to completely sequence your insert you may try one or both of the following e Synthesize additional primers to sequence into the insert e Prepare a set of nested deletions refer to the protocol on page 22 If you need help with sequencing refer to general texts Ausubel et al 1994 Sambrook et al 1989 or the manufacturer of your sequencing enzyme continued on next page Analyzing Transformants continued Analyzing Transformants by PCR Long Term Storage You may wish to use PCR to directly analyze positive transformants For PCR primers use one of the four primers in the kit and a primer that hybridizes within your insert If you are using this technique for the first time we recommend performing restriction analysis in parallel Artifacts may be obtained because of mispriming or contaminating template The p
Download Pdf Manuals
Related Search