Home

Manual

1. CGCCTAlggg ich 5 flanking Xhol and linker 19nt loop 3 flanking linker and SJ RNA CUCGAGUGAGCG_ _ _ _ CUGUAAAGCCACAGAUGGG __ CGCCURSIA Net 5 flanking Xhol and linker 19nt loop 3 flanking linker and Sell The backbone is engineered with flanking restriction enzyme sites for cloning purposes The 5 Xhol and 3 Spel sites were chosen since their respective GAG and ACT nucleotides correspond to natural miR 30 stem loop sequences The distal relative to the loop single nucleotide bulge pictured in Fig 14 1 is formed by the 5 and 3 flanks while the proximal bulge consists of the 3 end of the antisense strand thus the opposing nucleotide must be manipulated to maintain the bulge for proper Drosha DGCR8 processing see Step 3 below Step 2 Insert sense and antisense sequences Insert the sense sequence i e target site positions 1 22 immediately after the 5 flank sequence and the antisense sequence i e the reverse complement of the target site directly after the loop sequence CUCGAGUGAGCGGCAGCCAGGACUGCGCUAANNCUGUAAAGCCACAGAUGGGUUAGCGCAGUCCUGGCUGCAUCGCCURV UR EN Step 2 1 Delete N s and add a and matched u on either side of the 19nt loop 20nt 22nt CUCGAGUGAGCGGCAGCCAGGACUGCGCUAAACUGUAAAGCCACAGAUGGGUUUAGCGCAGUCCUGGCUGCAUCGCCUMKAIENENT Step 3 Add to 20nt to equal 22nt Match inside base pair on 20nt to complement corresponding bp in 22nt Manipulate the 5 bulge nucleot
2. 4 or more U s can serve as a termination signal for RNA Pol Ill Since many shRNA artificial miRNA expression vectors use Pol Ill promoters e g U6 H1 to drive expression these sequences should be avoided to prevent pre mature transcript termination e Run siSPOTR Browse additional off target information Highly Recommended Click Off Target Details to BLAST against transcript databases View the overall number of off targets and the distribution of more potent seed site types 7mer 1A 7mer M8 8mer e View download list of all predicted off targets with site type information e Additional considerations siRNA sequences with POTS numbers less than 50 generally show less toxic effects We suggest that you avoid sequences within 30 base pairs of a start or stop codon When possible you choose sequences with the lowest G C content Below is a step by step example incorporating the siSPOTR output and the steps listed in figure 14 3 above to create the miRNA primers Example of siSPOTR output Start siRNA_Seq passenger_strand_seq G C rank position POTS percentile_worse antisense sense 7Mer content 61 9 9 73 75 23 92 60 UUAGCGCAGUCCUGGCUGCAU GCAGCCAGGACUGCGCUAANN UAGCGCA Step 1 Start with the artificial miRNA backbone sequence The miR 30 based artificial miRNA backbone consists of constant regions that are partially derived from the human miR 30 pri miRNA DNA CTCGAGTGAGCG_ CTGTAAAGCCACAGATGGG__
3. siRNA Sequences 2 1 Retrieve sequences for your desired target transcript s Choose your target gene s of interest and retrieve the relevant mRNA sequence s from NCBI Ensembl UCSC Genome Browser or other available databases We leave it to the reader s responsibility to further investigate target transcripts for variants which may result from RNA processing events e g alternative splicing alternative polyadenylation and RNA editing among others that may influence the ability to target certain regions within the transcript In general we target the coding region however targeting the 5 and 3 UTR sequences is possible Careful consideration for the target sequence with regard to the project objectives is important before proceeding with design and screening of inhibitory RNA sequences For instance the reader should consider whether allele or splice isoform specific silencing is desirable or whether sequence conservation is important allowing the RNAi vectors to be tested in multiple species 2 2 Select 22 nt long target sites Identifying potent and highly specific siRNA sequences is not trivial Numerous empirical evaluations of large scale siRNA knockdown data have allowed researchers to establish several siRNA design guidelines Khvorova et al 2003 Matveeva et al 2007 For example one key consideration is that siRNA sequences be selected or manipulated to promote accurate loading of the antisense guide strand into RISC
4. CCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAG GTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCT ATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATT GGGAAGACAATAGCAGGCATGCTG GGGAAGCCGGTCGCAGGCGTAGGGTAGGTTTGAGCAGATAAACCATTAAGTGATTAACAACGACGGCA CGAGCGGCCGCTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCG TTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAA TGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTA AACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGT AAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACG TATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGA CTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGG GACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAG GTCTATATAAGCAGAGCTGGTTTAGTGAACCGTCAGATCCGCTAGCTACCGGTTTAATTAAGCCACCATG TCCAGACTGGACAAGAGCAAAGTCATAAACGGCGCTCTGGAATTACTCAATGGAGTCGGTATCGAAGGC CTGACGACAAGGAAACTCGCTCAAAAGCTGGGAGTTGAGCAGCCTACCCTGTACTGGCACGTGAAGAAC AAGCGGGCCCTGCTCGATGCCCTGCCAATCGAGATGCTGGACAGGCATCATACCCACTTCTGCCCCCTG GAAGGCGAGTCATGGCAAGACTTTCTGCGGAACAACGCCAAGTCATTCCGCTGTGCTCTCCTCTCACATC GCGACGGGGCTAAAGTGCATCTCGGCACCCGCCCAACAGAGAAACAGTACGAAACCCTGGAAAATCAG CTCGCGTTCCTGTGTCAGCAAGGCTTCTCCCTGGAGAACGCACTGTACGCTCTGTCCGCCGTGGGCCAC TTTACACTGGGCTGCGTATTGGAGGAACAGGAGCATCAAGTAGCAAAAGAGGAAAGAGAGACACCTAC CACCGATTCTATGCCCCCACTTCTGAGACAAGCAATTGAGCTGTTCGACCGGCAGGGAGCCGAACCTGC CTTCCTTTTCG
5. G1060 pFBAAVTREmcsBgHpA CM VrtTAwtIRESeGFPS V40pA Inducible miRNA Plasmid Plasmid Features Coordinates 194 348 376 511 689 818 878 1193 1211 1274 1325 1538 1671 2193 2222 2974 2989 3575 1949 2668 2727 2863 2935 3053 3621 4154 4221 4445 5509 6369 3 Mscl 5887 gt Feature In7L SV40pA complementary outside ITRs AAV2 ITR 130bp TRE promoter Xhol and Xbal MCS BgHpA CMV Promoter rtTA Tet On Transactivator wtIRES EGFP SV40pA AAV2 ITR 119bp Gentamicin Tn7R B lactamase Ampicillin Complementary 8596bp BssHIl 4687 Xmal 4661 BssHIl 4344 BssHIl 4613 Mscl 4599 pFBAAVTREt mcs pA CMV rtTA wtIRESeGFP pA Mscl 3567 UNIVERSITY 0 IOWA CARVER COLLEGE OF MEDICINE VIRAL VECTOR CORE Antibiotic Resistance Ampicillin and Gentamicin Bacterial Backbone pFastBac Invitrogen Note To check the integrity of the AAV ITR s perform single restriction enzyme digestions with Xmal BssHil and Mscl This vector was designed with EGFP under the constitutive expression from the CMV promoter for tracking while the expression of the miRNA cassette can be inducibly driven by the tetracycline regulated TRE promoter for RNA interference RNAi analysis in mammalian cells BssHIl 691 Xmal 717 Xmal 728 BssHIl 776 Mscl 794 EcoRl 872 Xhol 1211 EcoRI 1244 Xmal 1256 Xbal 1274 Z lt Agel 2208 Pacl 2218 Red type indicates un
6. GCCTGGAACTAATCATATGTGGCCTGGAGAAACAGCTAAAGTGCGAAAGCGGCGGGCC GGCCGACGCCCTTGACGATTTTGACTTAGACATGCTCCCAGCCGATGCCCTTGACGACTTTGACCTTGAT ATGCTGCCTGCTGACGCTCTTGACGATTTTGACCTTGACATGCTCCCCGGGTAAGTCGACTTGAATTCGC CCCTCTCCCTCCCCCCCCCCTAACGTTACTGGCCGAAGCCGCTTGGAATAAGGCCGGTGTGCGTTTGTCT ATATGTTATTTTCCACCATATTGCCGTCTTTTGGCAATGTGAGGGCCCGGAAACCTGGCCCTGTCTTCTTG ACGAGCATTCCTAGGGGTCTTTCCCCTCTCGCCAAAGGAATGCAAGGTCTGTTGAATGTCGTGAAGGAA GCAGTTCCTCTGGAAGCTTCTTGAAGACAAACAACGTCTGTAGCGACCCTTTGCAGGCAGCGGAACCCC CCACCTGGCGACAGGTGCCTCTGCGGCCAAAAGCCACGTGTATAAGATACACCTGCAAAGGCGGCACA ACCCCAGTGCCACGTTGTGAGTTGGATAGTTGTGGAAAGAGTCAAATGGCTCTCCTCAAGCGTATTCAAC AAGGGGCTGAAGGATGCCCAGAAGGTACCCCATTGTATGGGATCTGATCTGGGGCCTCGGTACACATGC TTTACATGTGTTTAGTCGAGGTTAAAAAACGTCTAGGCCCCCCGAACCACGGGGACGTGGTTTTCCTTTG AAAAACACGATGATAATATGGCCACAACCATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTG CCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGG CGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCC CACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCA CGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGG CAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGG GCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAAC GTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAG 2 GACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCT GCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACA TGGTCCTGCTGGA
7. GTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAAATCG ATTTACGCGTGAGCTCCAATTCGCCCTATAGTGAGTCGTATTACGCGCGCAGCGGCCGACCATGGCCCA ACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTT TTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTGGATCTCCGGACAC GTGCGGACCGAACTAGAGCATGGCTACGTAGATAAGTAGCATGGCGGGTTAATCATTAACTACAAGGAA CCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAG GTCGCCCGACGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGCTGCCTGCAGGCATGCAAGCTGT AGCCAACCACTAGAACTATAGCTAGAGTCCTGGGCGAACAAACGATGCTCGCCTTCCAGAAAACCGAGG ATGCGAACCACTTCATCCGGGGTCAGCACCACCGGCAAGCGCCGCGACGGCCGAGGTCTTCCGATCTC CTGAAGCCAGGGCAGATCCGTGCACAGCACCTTGCCGTAGAAGAACAGCAAGGCCGCCAATGCCTGAC GATGCGTGGAGACCGAAACCTTGCGCTCGTTCGCCAGCCAGGACAGAAATGCCTCGACTTCGCTGCTGC CCAAGGTTGCCGGGTGACGCACACCGTGGAAACGGATGAAGGCACGAACCCAGTTGACATAAGCCTGT TCGGTTCGTAAACTGTAATGCAAGTAGCGTATGCGCTCACGCAACTGGTCCAGAACCTTGACCGAACGC AGCGGTGGTAACGGCGCAGTGGCGGTTTTCATGGCTTGTTATGACTGTTTTTTTGTACAGTCTATGCCTCG GGCATCCAAGCAGCAAGCGCGTTACGCCGTGGGTCGATGTTTGATGTTATGGAGCAGCAACGATGTTAC GCAGCAGCAACGATGTTACGCAGCAGGGCAGTCGCCCTAAAACAAAGTTAGGTGGCTCAAGTATGGGC ATCATTCGCACATGTAGGCTCGGCCCTGACCAAGTCAAATCCATGCGGGCTGCTCTTGATCTTTTCGGTC GTGAGTTCGGAGACGTAGCCACCTACTCCCAACATCAGCCGGACTCCGATTACCTCGGGAACTTGCTCC GTAGTAAGACATTCATCGCGCTTGCTGCCTTCGACCAAGAAGCGGTTGTTGGCGCTCTCGCGGCTTACGT TCTGCCCAAGTTTGAGCAGCCGCGTAGTGAGATCTATATCTATGATCTCGCAGTCTCCGGCGAGCACCG GAGGCAGGGCATTGCCACCGCGCTCATCAATCTCCTCAAGCATGAGGCCAACGCGCTTGGTGCTTATGT GATCTACGTGCAAGCAGA
8. Med as supplied by publisher siSPOTR siRNA Sequence Probability of Off Targeting Reduction https sispotr icts uiowa edu sispotr index html jsessionid E8EB7B91C5640FD84F7E72DC758505DD Rational design of therapeutic siRNAs minimizing off targeting potential to improve the safety of RNAi therapy for Huntington s disease Boudreau RL Spengler RM Davidson BL Mol Ther 2011 Dec 19 12 2169 77 doi 10 1038 mt 2011 185 Epub 2011 Sep 27 Plasmid based RNA interference Construction of small hairpin RNA ShRNA expression vectors Harper SQ Davidson BL Methods Mol Biol 309 219 235 2005 Translational efficiency of EMCV IRES in bicistronic vectors is dependent on IRES sequence and gene location Yury A Bochkov and Ann C Palmenberg BioTechniques 41 283 292 2006 Protocol Below are revised excerpts from Generation of hairpin based RNAi vectors for biological and therapeutic application for miRNA design and cloning Section numbers refer to the numbers in the original publication GENERATION OF HAIRPIN BASED RNAi VECTORS FOR BIOLOGICAL AND THERAPEUTIC APPLICATION Ryan L Boudreau and Beverly Davidson Contents 2 Selecting Candidate siRNA Sequences 2 1 Retrieve sequences for your desired target transcript s 2 2 Select 22 nt long target sites 4 Cloning Artificial miRNA Expression Vectors 4 1 Considerations for designing artificial miRNAs 4 2 Oligo design and cloning protocol for artificial miRNAs 2 Selecting Candidate
9. TTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGA CTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCG CGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAG AAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGT TCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTG GTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAA AGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTT ATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTC AACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAA TACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCA AGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTT TACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGG CGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTC TCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCG AAAAGTGCCACCTAAATTGTAAGCGTTAATATTTTGTTAAAATTCGCGTTAAATTTTTGTTAAATCAGCTCA TTTTTTAACCAATAGGCCGAAATCGGCAAAATCCCTTATAAATCAAAAGAATAGACCGAGATAGGGTTGA 3 GTGTTGTTCCAGTTTGGAACAAGAGTCCACTATTAAGAACGTGGACTCCAACGTCAAAGGGCGAAAAAC CGTCTATCAGGGCGATGGCCCACTACGTGAACCATCACCCTAATCAAGTTTTTTGGGGTCGAGGTGCCGT AAAGCACTAAATCGGAACCCTAAAGGGAGCCCCCGATTTAGAGCTTGACGGGGAAAGCCGGCGAACGT GGCGAGAAAGGAAGGGAAGAAAGCGAAAGGAGCGGGCGCTAGGGCGCTGGCAAGTGTAGCGGTCACG CTGCGCGTAACCACCACACCCGCCGCGCTTAATGCGCCGCTACAGGGCGCGTC Plasmid Qual
10. TTACGGTGACGATCCCGCAGTGGCTCTCTATACAAAGTTGGGCATACGGGA AGAAGTGATGCACTTTGATATCGACCCAAGTACCGCCACCTAACAATTCGTTCAAGCCGAGATCGGCTTC CCGGCCGCGGAGTTGTTCGGTAAATTGTCACAACGCCGCGAATATAGTCTTTACCATGCCCTTGGCCACG CCCCTCTTTAATACGACGGGCAATTTGCACTTCAGAAAATGAAGAGTTTGCTTTAGCCATAACAAAAGTC CAGTATGCTTTTTCACAGCATAACTGGACTGATTTCAGTTTACAACTATTCTGTCTAGTTTAAGACTTTATT GTCATAGTTTAGATCTATTTTGTTCAGTTTAAGACTTTATTGTCCGCCCACACCCGCTTACGCAGGGCATC CATTTATTACTCAACCGTAACCGATTTTGCCAGGTTACGCGGCTGGTCTATGCGGTGTGAAATACCGCAC AGATGCGTAAGGAGAAAATACCGCATCAGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCG GTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGG GATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTT GCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTG GCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGT TCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGC TCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCC GTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTAT CGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCT TGAAGTGGTGGCCTAACTACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGT TACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTT GTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGT CTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCAC CTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACA GTTACCAATGC
11. ase paring at the opposing terminus Khvorova et al 2003 Schwarz et al 2003 The RISC complex selects the strand with the weakest 5 end thermodynamic stability in this case the antisense strand Fig 14 1 Hence we select target sequences that have G or C nucleotides at positions 3 and 4 note positions 1 and 2 correspond to the dinucleotide 3 overhang of the antisense strand and A T or C nucleotides at positions 20 21 and 22 The C is allowed at the latter positions because we can destabilize the resulting G C base pairs by converting them to G U base pairs G and U weakly pair in RNA without altering the antisense strand sequence Next the GC content of the 22 nt site is calculated by dividing 6 the number of G or C nucleotides by 22 For instance the target site shown in Fig 14 1 has 12 G or C nucleotides resulting in a GC content of 55 which is within the acceptable range Finally we avoid stretches of A s and T s and relevant restriction enzyme sites for reasons mentioned above Note the user must also avoid creating these elements upon incorporating the siRNA into shRNA or artificial miRNA scaffolds 4 Cloning Artificial miRNA Expression Vectors 4 1 Considerations for designing artificial miRNAs Artificial miRNAs or miRNA shuttles are designed to mimic naturally occurring pri miRNAs for which the Drosha DGCR8 and Dicer cleavage sites have been mapped and experimentally validated With this information the identi
12. d clone directly into GXXX pFBAAV TREtight miRNAmcs BgHpA CMV rtTA wtIRESeGFP SV40pA Step 8 1 Purify the extended product using a PCR Purification kit QlAquick Qiagen or other as per the manufacturer s instructions and elute in 20 30 ul water Timesaving Tips for working with 15 20 candidates Anneal and extend the oligos pairs individually as above Run a sample on a gel to ensure that the extension worked for each pair and that they are the proper size and roughly the same molar ratio Pool 5ul of each confirmed double stranded hairpin pair and proceed to digest and ligate the product as if it is one sample This reduces the sample handling greatly for several steps Pick 30 48 minipreps from the resulting ligation Process minipreps and sequence At the University of lowa setting up sequencing reactions in a plate format with multiple samples greatly reduces the cost Screen sequences for all of the original intended miRNA hairpin sequences Typically the return is 95 100 Step 8 2 Digest the product with Xhol and Spel by adding the following to the 30 ul eluate 4 ul 10 x restriction enzyme buffer Cutsmart New England Biolabs 1 ul Spel 10 units ul 1 ul Xhol 20 units pl 4 ul H20 Incubate reaction at 37 C for 4 h to overnight Step 8 3 Digest 3 4 ug of the G1060 pFBAAV TREtight miRNAmcs BgHpA CMV rtTA wtIRESeGFP SV40pA expression plasmid with Xhol and Xbal This plasmid contains the mouse TRE promoter followed by a mul
13. e 5 end of each oligo thus Oligo 1 will begin with 5 AAAACTCGAG 3 and Oligo 2 with 5 AAAAACTAGT 3 These additional bases are required for 10 efficient restriction enzyme digestion near the ends of the DNA cassette following the polymerase extension The resulting DNA oligos can be ordered at reasonable cost from a variety of commercial vendors e g Integrated DNA Technologies Sigma Aldrich or Invitrogen using the smallest synthesis scale available and standard desalting purification Upon receipt the oligos can be reconstituted in purified water to make a 100 uM stock Hairpin 86mer CTCGAGTGAGCGIIGCAGCCAGGACTGCGCTAABCTGTAAAGCCACAGATGGGETTAGCGCAGTCCTGGCTGCRCGCCT IRN Hairpin broken into two primers to be annealed and extended Random A s added to the ends for digest Oligo 1 miRNA For 5 AAAACTCGAGT GAGCG JGCAGCCAGGACTGCGCTAA CTGTAAAGCCACAGATGGG 3 58mer miRNA Rev 3 CTGTAAAGCCACAGATGGGITTAGCGCAGTCCTGGCTGCM cacct 5 57mer Oligo 2 rev and comp 5 AAAAACTAGTAGGCGATGCAGCCAGGACTGCGCTAAaCCCATCTGTGGCTTTACAG 3 Step 7 Anneal and polymerase extend Oligo 1 and Oligo 2 Reaction conditions 5 ul 10 x reaction buffer with MgCl 1 ul Oligo 1 100 uM 1 ul Oligo 2 100 uM 1 ul dNTPs 10 mM 0 5 ul enzyme mix i e polymerase Incubate the reaction in a thermocycler 94 C for 2 min denaturation 54 C for 1 min annealing 72 C for 15 min extension Step 8 PCR purification digestion an
14. eam applications Step 5 Convert all T s to U s if not already complete and fold RNA using UNAfold available at http www idtdna com Scitools Applications unafold to confirm that the miRNA transcript forms the desired secondary structure Note select RNA as the input nucleotide type at the user interface and leave the remaining parameters set to Output of sir_graph C Created Tue Nov 20 07 38 18 2012 mfold_util 4 5 Crop A L A Predicted Dicer Cut Sites G 58 ues Instability Promotes AS in RISC Stability Promotes AS into RISC and keeps S out of RISC Predicted Drosha Cut sites dG 60 825 3b1f jnrdzlgnSebupdm5 i awOE634889938976240904 default UNAfold generally predicts several possible secondary structures for each input however the correct version of the miRNA should be at the top as the most stable structure In this case the fold should resemble the artificial miRNA depicted here Extra bulges indicate that revisions are needed Step 6 Convert all U s to T s Design and order DNA oligos The artificial miRNA DNA template is made by annealing two oligos that overlap in the loop region and performing a polymerase extension reaction to create the double stranded DNA cassette Oligo 1 consists of the Xhol site 5 flank sense sequence and loop in forward orientation while Oligo 2 is the reverse complement of the loop antisense 3 flank and Spel site We add four A nucleotides to th
15. est in 2014 and the University of lowa Viral Vector Core has limited experience with inducible miRNA For constituitively driven miRNA please see plasmids GO760 pFBAAVmU6mcsCMVeGFP or G0774 pFBAAVmU6mcsCMVmCherry Tet On Advanced Inducible Gene Expression Systems User Manual PT3898 1_102312 7 http www google com url sa t amp rct amp q amp esrc s amp Source web amp cd 7 amp ved 0C GcQFjAG amp url http 3A 2F 2Fwww clionte ch com 2Fxxclt_ibcGetAttachment jsp 3Fecltemld 3D17561 amp ei 3LupU6jCUsWfgAbksILoCA amp usg AFQj CNEQOJMoyr40 PqqXaaOPcwNbudctcA amp bvm bv 69620078 d b2k Mir XTM Inducible miRNA Systems User Manual PT5050 1 http www google com url sa t amp rct j amp q amp esrc s amp source web amp cd 1 amp ved 0CCIQFjAA amp url httP 3A 2F 2Fwww clontec h com 2Fxxclit_ibcGetAttachment jsp 3Fcltemld 3D17566 amp ei rMCpU8hB9KXqAb4mY GAAg amp usg AFQjCNGa flinWOPOihxXdi0QOVTfaHbdVw amp bvm bv 69620078 d b2k References Generation of hairpin based RNAi vectors for biological and therapeutic application Boudreau RL Davidson BL Methods Enzymol 2012 507 275 96 Review PMID 22365779 PubMed indexed for MEDLINE http www sciencedirect com science article pii B97801238650900001 44 siSPOTR a tool for designing highly specific and potent siRNAs for human and mouse Boudreau RL Spengler RM Hylock RH Kusenda BJ Davis HA Eichmann DA Davidson BL Nucleic Acids Res 2012 Aug 31 Epub ahead of print PMID 22941647 Pub
16. he University of lowa Sequencing Core Non Ul investigators should consult with their own sequencing facility for help if sequencing of the ITRs is desired We routinely request Extended Denaturation for all AAV plasmid sequencing There is no one set of primers that will always sequence through the ITRs The ITR primers listed below have been used with success in many cases Try sequencing in both directions from the plasmid in and from your insert out Suggested Sequencing Primers for a variety of prBAAV plasmids Below is a general list of commonly used primers at the University of lowa Viral Vector Core Please check to make sure the primers work for the shuttle plasmid you have received There are many free primer design programs available to design primers that will sequence your insert BgHpA For TGAGGAAATTGCATCGCATTGTCT BgHpA Rev AGGAAAGGACAGTGGGAGTG pFBAAV 119bp ITR GCCTTGCTGTTCTTCTACGG pFB587F 130bp ITR CTCTACAAATGTGGTATGGCTG pFB214F 130bp ITR GGGGTGGAAATGGAGTTT pFB158F 130bp ITR CATAACAGGAAGAAAAATGCCCCG 15 Please contact us with any questions Viral Vector Core vectors uiowa edu University of lowa 500 Newton Road 221 Eckstein Medical Research Building lowa City IA 52242 Tel 319 335 6726 http www medicine uiowa edu vectorcore Updated 1 14 15 SJS 16
17. he transposable elements or ITRs exists anytime you amplify the plasmid Recombination at the transposable elements may lead to amp resistant false positives that contain no gene of interest on ampicillin only plates Because the G1060 pFBAAV TREtight miRNAmcs BgHpA CMV rtTA wtIRESeGFP SV40pA vector is digested with two non cohesive enzymes Xhol and Xbal the likelihood of intramolecular vector ligation is minimal and few if any A G resistant colonies grow on vector only control plates However we recommend the vector be treated with alkaline phosphatase after restriction enzyme digestion to further minimize the potential for background colonies We typically pick four to six colonies per artificial miRNA construct and grow each of them overnight in 3 ml liquid LB cultures containing 100ug ml ampicillin and 7ug ml gentamicin The following day minipreps are performed using a miniprep kit which yields plasmid DNA of sufficient quality for cell culture applications Step 8 6 Screen for positive clones by EcoRI digestion and gel electrophoresis Note cloning an artificial miRNA into the Xhol and Xbal sites removes the internal EcoRI in the MCS and thus positive clones can be screened for by EcoRI digestion G1060 pFBAAV TREtight miRNAmcs BgHpA CMV rtTA wtIRESeGFP SV40pA vector only plasmid will yield 6485bp 1739bp and 372bp fragments indicating a negative clone The positive constructs with successful insertion of an artificial miRNA will y
18. ide to induce a mismatch The bulge is natural to the human miR 30 pri miRNA transcript and thus we aim to maintain this structure to promote proper downstream cleavage by Drosha DGCRE8 In the example the G nucleotide in the sense strand bulge position 5 is converted to an A nucleotide which will create a mismatch with the opposing C bulge nucleotide in the antisense region 3 In generating artificial miRNAs harboring different siRNA sequences the user should alter the 5 bulge nucleotide so that it does not pair with the opposing 3 bulge nucleotide This can be done following these simple guidelines A if the 3 bulge site is an A the 5 bulge nucleotide can be changed from T to either C G or A C if the 3 bulge site is a C the 5 bulge nucleotide can be changed from G to either A T or C G if the 3 bulge site is a G the 5 bulge nucleotide can be changed from C to either A or G T if the 3 bulge site is a T the 5 bulge nucleotide can be changed from A to either C or T 20nt 22nt CUCGAGUGAGCGIGCAGCCAGGACUGCGCUAA amp CUGUAAAGCCACAGAUGGGUUUAGCGCAGUCCUGGCUGCAUCGCCU ACUAGU Step 4 Convert C s to T s at the sense 3 end to impart duplex instability See Step 2 in shRNA cloning protocol Section 3 2 Note at this point it is good practice to ensure the hairpin sequence is void of stretches of four or more T s and any restriction enzyme sites e g internal Xhol Spel and EcoRI sites relevant to downstr
19. ield 6485bp and 2129bp bands Step 8 7 Sequence positive clones using either of the following primers BgHpA96R AGGAAAGGACAGTGGGAGTG BgHpA205R TGCCTGCTATTGTCTTCCC We highly recommend requesting extended denaturation from your Sequencing core to get a clean read through the hairpin secondary structure The TRE has multiple repeated sections making primer design for forward sequencing a challenge 4 3 Materials for artificial miRNA cloning G1060 pFBAAV TREtight miRNAmcs BgHpA CMV rtTA wtIRESeGFP SV40pA plasmid Overlapping DNA oligos for artificial miRNA Expand High Fidelity Polymerase and buffers Roche Restriction enzymes and buffers Xhol Spel Xbal EcoRI Notl Xmal BssHII and Mscl Gel electrophoresis equipment and reagents Gel extraction kit DNA ligase and buffer Chemical competent DH5a and Stbl3 bacterial cells Ampicillin and Gentamicin containing LB agar growth plates Miniprep kit 12 Information and Cloning Suggestions for Working with pFBAAV Plasmids Characteristics of AAV Adeno Associated virus AAV is a non pathogenic helper dependant parvovirus This is one of the most promising vehicles for gene delivery Recombinant AAV vectors have predominantly episomal gene expression AAV has long term expression in terminally differentiated cells It can infect a wide range of cells including non dividing cells Insert Size The major disadvantage of the AAV vectors is the small genome which limits the size of
20. ique restriction site Xmal 2966 Sall 2975 EcoRI 2983 gt G1060 pFBAAVTREmcsBgHpACMVrtTAwtIRESeGFPSV40pA CCATTCGCCATTCAGGCTGCAAATAAGCGTTGATATTCAGTCAATTACAAACATTAATAACGAAGAGATG ACAGAAAAATTTTCATTCTGTGACAGAGAAAAAGTAGCCGAAGATGACGGTTTGTCACATGGAGTTGGC AGGATGTTTGATTAAAAACATAACAGGAAGAAAAATGCCCCGCTGTGGGCGGACAAAATAGTT GGGAAC TGGGAGGGGTGGAAATGGAGTTTTTAAGGATTATTTAGGGAAGAGTGACAAAATAGATGGGAACTGGGT GTAGCGTCGTAAGCTAATACGAAAATTAAAAATGACAAAATAGTTTGGAACTAGATTTCACTTATCTGGTT CGGATCTCCTAGGCGATATCAGTGATCAGATCCAGACATGATAAGATACATTGATGAGTTTGGACAAACC ACAACTAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCATT ATAAGCTGCAATAAACAAGTTAACAACAACAATTGCATTCATTTTATGTTTCAGGTTCAGGGGGAGGTGT GGGAGGTTTTTTAAAGCAAGTAAAACCTCTACAAATGTGGTATGGCTGATTATGATCCTCTAGTACTTCTC GACAAGCTTACATTATTGAAGCATTTATCAGGGTTATTGTCTCAGACCTGCAGGCAGCT GCGCGCTCGCT CGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGC GAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCTTGTAGTTAATGATTAACCCG CCATGCTACTTATCTACGTAGCCATGCTCTAGTGAATTCCGAGTTTACTCCCTATCAGTGATAGAGAACGT ATGTCGAGTTTACTCCCTATCAGTGATAGAGAACGATGTCGAGTTTACTCCCTATCAGTGATAGAGAACG TATGTCGAGTTTACTCCCTATCAGTGATAGAGAACGTATGTCGAGTTTACTCCCTATCAGTGATAGAGAA CGTATGTCGAGTTTATCCCTATCAGTGATAGAGAACGTATGTCGAGTTTACTCCCTATCAGTGATAGAGA ACGTATGTCGAGGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGA TCGCCAGATGGTACCGTTTAAACTCGAGGTCCACGGTATCGATAAGCTTGATATCGAATTCCTGCAGCCC GGGGGATCCACTAGTTCTAGAGCGAGCGCCACCGCGGACAGCGGGGAGATCCAGACATGATAAGATCC TCGACTGTG
21. ity Control Transfection Lipofectamine LTX Transfection in HT1080 Cells 7 16 14 24 hrs 0 7x10 c well in 6 well plate G1060 pFBAAVTREmIRNAmcsBgHpA G1061 prBAAVTREmiSafeBgHpA CMVrtTAwtiRESeGFP SV40pA CMVrtTAwtiIRESeGFP SV40pA 2ug well 2ug well Plasmid Quality Control ITR Digest G1060 pFBAAVTREmcsBgHpACMVrtTAwtIRESeGFPSV40pA Midi Prep date 7 9 14 Concentration 2 4ug ul Uncut BssHII Mscl Xmal Expected Fragments from digest of insertless plasmid re i Uncut supercoiled and relaxed 4000 w w 2000 1650 MA BssHil 4600 3568 269 85 74 Mscl 3503 2773 1288 1032 Xmal 4652 1710 1695 528 11 1000 500 Specific Information for cloning miRNA in the G1060 pFBAAVTREmcsBgHpACMVrtTAwtIRESeGFPSV40pA Plasmid Background This vector was designed with two independent cassettes 1 TRE miRNA BgHpA and 2 CMV rtTA wtIRESeGFP SV40pA The dox inducible tetracycline regulated TRE promoter drives the miRNA cassette Constitutive expression from the CMV promoter drives the rtTA transactivator and the expression of eGFP for tracking In the absence of induction according to the originator Clonetech the Tet On Advanced transactivator shows virtually no residual binding to the TRE in Pright Thus basal expression is extremely low Please refer to the original Clonetech guides for useful information on working with the Tet On Advanced System Please note that this plasmid was designed by customer requ
22. leaving the sense strand to be degraded Leuschner et al 2006 Matranga et al 2005 Furthermore GC content and positional nucleotide preferences also influence siRNA efficacy Given the multifaceted nature of designing optimal siRNAs we direct the reader to additional literature on the subject Birmingham et al 2007 Davidson and McCray 2011 Jackson and Linsley 2010 Also there are numerous publicly available siRNA design tools online It is important to note that siRNA design rules serve more as guidelines and that sequences adhering to them may not silence and vice versa NEW We have developed an online tool siSPOTR siRNA Seed Probability of Off Target Reduction to assist users with designing siRNAs with low off targeting potential https research icts uiowa edu sispotr_review201 1 siSPOTR searches user defined target sequences for siRNAs that pass strand biasing and GC filters and outputs the candidates with the lowest POTS values The output provides detailed off target information for each siRNA including i the number of 3 UTRs containing each seed site type ii the putative off target transcripts and iii counts of each seed site type on a per transcript basis SISPOTR also determines if the siRNA seed matches that of a known miRNA Recognizing the ease of purchasing pre validated siRNAs an additional tool allows users to input siRNA sequences to obtain relevant off targeting scores and information https sispotr icts ui
23. mid must be gentamicin resistant for the transposition to work e Growth and midi prep preparation of Bacmid DNA e Transfection of the Bacmid DNA with gene of interest into Sf9 cells Approximately 12mls of the P1 stage Baculovirus is harvested 5 days later 13 e Titer of the Baculovirus P1 stock We are able to make 1 3 preps of final AAV virus using the P1 stock depending on the titer of the stock and the desired MOI of infection for the final AAV prep e For multiple AAV virus preps the P1 stock is amplified to a larger volume P2 Baculovirus stock and titered e The final AAV virus is prepared in bioreactor bags on a rocker platform by dual infection with the package Baculovirus and the desired Rep Cap Baculovirus into Sf9 cells The Baculovirus provides pHelper function The culture is harvested 3 days later e The AAV vector is purified using either CsCl or an iodixanol gradient followed by ion exchange or affinity chromatography e A physical titer in viral genomes per ml vg ml is assessed by QPCR e Sample required 10ug of pFBAAV plasmid expressing the gene of interest at a concentration greater than 0 25ug ul Bacterial Backbone Invitrogen pFastBac For information on the pFastBac backbone and the Baculovirus System please review the Invitrogen manual http tools invitrogen com content sfs manuals bactobac_topo_exp_system_man pdf ITRs Inverted Terminal Repeats The ITRs for AAV were engineered into the I
24. milarly defined with these techniques since simply switching promoters restriction enzyme sites or expression contexts e g embedding the miRNA based stem loop in the 3 UTR or intron of a reporter gene can alter the pri miRNA structure and subsequent processing 4 2 Oligo design and cloning protocol for artificial miRNAs The following steps are outlined in Fig 14 3 Step 1 Start with artificial miRNA backbone sequence 5 Flank Sense Loop Antisense 3 Flank 5 CTOGAGTGAGCG N NNNNNNNNNNNNNNNNNNNN CTGTA AAGCCACAGATGGG NNNNNNNNNNNNNNNNNNINN N CGCCTACTAGT Yad Spel Mismatch bulge Step 2 Insert sense and antisense sequences Sense Antisense n n A 5 ENCGAGTGAGCG G GGCACAAGC TGGAG TACHACTICTGTAAAGCE MAGATGGG AGT IGTACTCCAGCTIGIGCE CGCCIMNAGE y Vaal Spa Step 3 Manipulate 5 bulge nucleotide to induce a mismatch 5 CTEGAGTCAGCG AIGGCACAAGCTGGAGTACAACT CIGTAAAGCCACAGATGGG A GTTGTACTCCAGCTTGTGCC C CGCCTACTAGT gt Yao Syn Mismatch bulge Step 4 Convert C s to Ps at sense 3 end to impart duplex instability 5 CTEGAGTGAGCG A GGCAC AAGCTGGAG TAC AATT CTGTAAAG CCACAGATGGG AGT TGTAC TCC AGCTTGTGCC CGCCTACTAGT 3 YA Spel Change C s to T s Step 5 Convert all T s to U s and fold RNA using UNA fold CUEGAGUGAGCG A GGC AC AAGCUGGAGUAC AAUU CUGUAAAGCC AC AGAUGGG AGUUG UAC UC CAGCUUGUGCC C CGCCUACUAGO 3 Yaa Spel UNAfold Structure resmbling artificial miRNA in Fig 2 Step 6 Design and order DNA
25. nents of the pathways that catalyze the rearrangement and deletion of nonstandard secondary and tertiary structures including cruciforms caused by inverted repeats and Z DNA that occur frequently in eukaryotic cells Cloning however can be difficult in these strains We recommend DH5a competent cells for sub cloning Quality Control ITR Digest We require a quality control digest of the plasmid upon submission to ensure that there is no recombination before vector production is started The ITRs in the pFBAAV plasmids have several convenient restriction sites to determine whether the ITRs are intact without sequencing Sequencing the ITRs can be difficult due to their hairpin secondary structure We suggest a single digest each of BSsHII Mscl and Xmal It is a good idea to also run un cut and linearized plasmid next to these digests Determine your fragment sizes for each digest and check carefully to see that you get what you expect and no extraneous bands Be sure to check your final midi or maxi product not just your miniprep as recombination is possible during any amplification process 14 Sequencing pFBAAV plasmids and ITRs The majority of the plasmid and insert can be sequenced normally Sequencing of the ITRs is difficult but possible Sequencing of the ITRs or other difficult secondary structures may be aided by requesting Extended Denaturation or by requesting Betaine Chemistry for AAV ITRs in the comments section at t
26. nvitrogen pFastBac backbone by Dr Robert Kotin Orientation and Updates The MCS and BgHpA were inserted in the antisense direction relative to the Invitrogen backbone and ITRs Please note that the backbone and ITRs were re sequenced and updated in 2012 and there are several changes Please discard any older sequences The nomenclature of 5 ITR 119bp and 3 ITR 130bp have been retained on some maps to identify the sequences The orientation of the ITRs makes no difference to the formation of the viral vector Recombination Recombination is a possibility at both the transposable elements Tn7L and Tn7R and the Inverted Terminal Repeats ITRs in the pFBAAV plasmid In order to check for and reduce the chance of recombination we have the following recommendations Antibiotic Resistance The gentamicin resistant gene lies within the transposable elements and may be lost if the transposable elements recombine We suggest using both ampicillin and gentamicin selection on plates and in your liquid media throughout the cloning process and during amplification to midi or maxi preps Ampicillin concentration 100ug ml final Gentamicin Sulfate concentration 7ug ml final E Coli Competent Cell Recommendations We recommend using a stable E coli strain such as SURE2 Stable2 or Stable3 for transformation of your final plasmid product These competent cell strains have been engineered to stop unwanted rearrangement events and lack the compo
27. oligos Oligo forward Step 7 Anneal and polymerase extend oligos Obgo 1 forward MAA ACTCGAGTGAGCGAGGCAC AAGCTGGAGTACAAT TCTGTAMAGCCACAGATOG G 1 lt AEREA RR ERRE REE A I GACATTTCGGTGTCTACCCTC AACATGAGGIC GAAC ACG GGGCGGATGATCAARAA 5 Oligo 2 reverse complement Step 8 PCR purification digestion and cloning to prOPObluntll U6 EcoRI EwRI Figure 14 3 Artificial miRNA cloning scheme The details for designing artificial miRNAs and cloning them into the mU6 expression vector are described in the text Section 4 2 Steps 1 8 Shown here is the example of incorporating the eGFP targeted siRNA into an artificial miRNA scaffold How to use the siSPOTR tool e Input sequence s for siRNA design at https sispotr icts uiowa edu sispotr tools sispotr design html Click the appropriate button to paste or upload the sequence s Single sequences can be in plain or FASTA format Multiple sequences require FASTA formatting e Select the number of candidates desired in the output e Advanced Modify input parameters e GC Content Min Max Filters candidate sequences based on specified GC content range e 5 Passenger G C Number Forces the passenger strand to have high 5 end stability This decreases likelihood of loading the unintended passenger strand Additional parameters to promote guide strand loading are automatically included in the design e Pol Ill Expression Removes sequences with 4 T U s Stretches of
28. owa edu sispotr index html ijsessionid E8EB7B91C5640FD84F7E72DC758505DD To date no algorithm guarantees silencing efficacy and it is most recommend that the user pick three to four candidates for screening Some investigators screen 10 20 candidates at a time Tips and short cuts for working with multiple candidates are outlined in the cloning information below Here we will describe a basic strategy for siRNA target site selection which incorporates the most important criteria for promoting efficacy in addition to certain rules that are specific to the design of hairpin based RNAi expression vectors We identify 22 nt target sites within the target transcript that adhere to four criteria 1 high propensity to primarily load the antisense guide strand into RISC 2 GC content between 20 and 70 3 void of restriction enzyme sites relevant to downstream applications e g cloning RNAi expression cassettes into viral vector systems 4 lacking a stretch of four continuous A or T nucleotides i e AAAA or TTTT The latter prevents premature transcription termination from Pol Ill promoters which typically terminate at stretches of four to six T s Strand biasing is determined by the thermodynamic stabilities present at the ends of the siRNA duplex To achieve faithful loading of the antisense strand the duplex must be designed such that there is strong G C base pairing present at the 5 end of the sense passenger strand and weak A G U b
29. the transgene from ITR to ITR to about 4 7 Kb Please consider the size of the promoter polyA any reporters and your gene of interest when planning the cloning into an AAV shuttle vector When the length of inserted DNA between the 2 ITRs is close the maximal allowed i e 4 7Kb the packaging efficiency decreases significantly AAV Production The University of lowa Viral Vector Core uses two systems for AAV production A Triple Transfection System and the Baculovirus System The Triple Transfection System may be used with any pAAV plasmid including the pFBAAV plasmids A pHelper plasmid isolated from adenovirus a Rep Cap plasmid and the AAV ITR plasmid package containing the gene of interest are transfected into 40 x 150mm plates of adherent 293FT cells per prep This system is more labor intensive for production and purification but can be completed within three to four weeks of receiving the plasmid The services provided for production are e Transfection e Large scale amplification of AAV vectors e The AAV vector is purified using either CsCl or an iodixanol gradient followed by ion exchange or affinity chromatography e A physical titer in viral genomes per ml vg ml is assessed by QPCR e Sample required 550ug of AAV plasmid expressing the gene of interest at a concentration greater than 0 25ug ul per prep One disadvantage to the investigator in the triple transfection system is having to provide 500ug of DNA for each subseq
30. tiple cloning site MCS and a BgHpA termination signal Xbal vector and Spel artificial miRNA cleaved sites produce compatible sticky ends for ligation Although there is a Spel site in the G1060 pFBAAV TREtight miRNAmcs BgHpA CMV rtTA wtIRESeGFP SV40pA multiple cloning sites we have found in prior studies that ligation to the Xbal site produces a stem loop which is more efficiently processed yielding higher antisense RNA levels and more potent gene silencing Boudreau et al 2008 Step 8 4 Gel purify the digested fragments We typically run the digested artificial miRNA inserts on a 2 agarose gel and excise the 100 bp band The digested G1060 pFBAAV TREtight miRNAmcs BgHpA CMV rtTA wtIRESeGFP SV40pA is run on a 1 11 agarose gel and the 8 6 kb fragment is excised Gel extraction can be performed by various means Step 8 5 Perform ligation and bacterial transformation using standard protocols We ligate 6 ng of insert to 50 ng of vector and incubate at room temperature for 1 h before transformation The pFBAAV plasmid backbone is both ampicillin and gentamicin resistant and thus transformed bacteria should be grown on LB agar plates containing a final concentration of 100ug ml ampicillin and 7ug ml gentamicin We highly recommend the use of both antibiotics The gentamicin resistance is contained within the transposable elements The ampicillin resistance is outside the transposable elements The possibility for recombination at t
31. ty of the small RNA duplex which is processed from the initial stem loop transcript is known For artificial miRNAs this region is replaced by siRNA duplexes thus creating a miRNA based hairpin which serves to shuttle siRNA sequences into the RNAi pathway An important consideration for designing artificial miRNAs is to maintain the structural and sequence recognition motifs required for appropriate processing Drosha DGCR8 binds to regions of single stranded nature located at the base of the pri miRNA stem loop Han et al 2004 Zeng and Cullen 2005 Thus including 50 100 nts of the flanking sequences 5 and 3 native to the pri miRNA will help to ensure that the stem loop base folds properly to promote cleavage at the intended site Artificial miRNAs have been generated using a number of naturally occurring pri miRNAs as scaffolds for siRNA sequences Chung et al 2006 Tsou et al 2011 Zeng et al 2002 Here we will describe a method to generate artificial miRNAs based on the natural human miR 30 pri miRNA transcript For ease of cloning we only include a minimal amount of natural miR 30 flanking sequences while additional 5 and 3 sequences are derived from the mouse U6 expression vector We have characterized these vectors for appropriate expression and processing using small transcript northern blot small RNA RT PCR and RACE analyses Boudreau et al 2008 Chen et al 2005 We recommend that newly designed miRNA shuttles be si
32. uent prep and the possibility of recombination during the maxi prep process Each maxi prep should be digested and evaluated for integrity The Baculovirus System can only be used with pFBAAV plasmids with transposable elements to incorporate the ITRs and gene of interest into the Bacmid DNA This system also relies on the gentamicin selection marker within the transposable elements The system was developed by Dr Robert Kotin at the National Institute of Health The system is described in the following publication Insect Cells as a Factory to Produce Adeno Associated Virus Type 2 Vectors Human Gene Therapy 13 1935 1943 November 1 2002 The Baculovirus System takes 5 6 weeks for production but has many advantages The Baculovirus System can tolerate more toxic proteins driven by mammalian promoters as these promoters will not be active in the insect cells This system is also generally more robust with higher titers cost effective and less labor intensive for production Once we have a Baculovirus stock of the investigator package we can make additional preps readily and we have tested the Baculovirus stock to be stable for years The services provided for production are e Transposition of the gene interest into the DH10Bac bacmid DNA Everything in the pFBAAV plasmid between the transposable elements Tn7 ITR Promoter gene of interest pA ITR gentamicin resistance Tn7 is incorporated into the large 135 000kb bacmid DNA Your plas

Manual

Contents

Download Pdf Manuals

Related Search

Related Contents