Remote Portal User Manual
Contents
1. CSPG SURGEX energy intelligence Network Settings Network Server Network Mode Wired Only Apply Settings IP Configuration Obtain IP address automatically Auto Configuration Methods Apply Defaults BOOTP Enable O Disable DHCP Enable O Disable AutolP Enable O Disable DHCP Host Name Use the following IP configuration IP Address Subnet Mask Default Gateway DNS Server SNMP Enable O Disable SNMP Manager 0 0 0 0 Ethernet Configuration I Auto Negotiate Speed 100 Mbps 10 Mbps Duplex Full Half OK WebManager Version 2 0 0 5 User Manual a Select Obtain IP address automatically to automatically receive an IP address 1 BOOTP Select Enable to permit the Bootstrap Protocol BOOTP server to assign the IP address from a pool of addresses automatically Enable is the default 2 DHCP Select Enable to permit the Dynamic Host Configuration Protocol DHCP to assign a leased IP address to the RP IP automatically Enable is the default 3 AutolP Select Enable to permit the RP IP to generate an IP in the 169 254 x x address range with a Class B subnet Enable is the default 4 DHCP Host Name Enter the desired host name for the RP IP 2014 Electronic Systems Protection Inc Technical Support 1 800 645 9721 espei com Page 5 energy intelligence CSPG SURGEX C2 R2. CSPG SURGEX energy intelligence REMOTEPORTAL RP IP RP IP GNS User Manual 2014 Electronic Systems Protection Inc Technical Support 1 800 645 9721 espei com CSPG SURGEX C1 REMOTEPORTAL User Manual energy intelligence CSPG SURGEX energy intelligence energy intelligence ADVANCED SERIES MODE ECOMMANDCENTER FLATPAK MULTI STAGE SURGE DIAGNOSTIC AXESS ELIMINATOR SERIES ICE NEXT GEN SURGE PDU CERVELLA EMPOWER IMPEDANCE TOLERANT POS SURGE ELIMINATION COUVS ENERGY INTELLIGENCE INRUSH CURRENT POWERFRAME SURGEX DEFENDER SERIES ENVISION ELIMINATION REMOTE PORTAL DIGITAL QC ESP MULTIPAK SERIES MODE This product may be covered by one or more claims of the following patents or published patent application U S Patent Nos RE39 466 4 870 528 4 870 534 5 136 455 6 040 969 6 728 089 6 744 613 6 947 266 7 068 487 7 184 252 7 511 934 7 541 696 and 7 551 412 8 482 885 8 520 349 8 547 672 and 8 614 866 U S Patent Application Publication Nos 2012 0221161 2013 0073232 2012 0265361 2013 0073060 2013 0258538 and 2014 0005963 Canadian Patent No 1 332 439 1 333 191 2 461 332 and 2 511 695 2014 Electronic Systems Protection Inc Technical Support 1 800 645 9721 espei com Page 1 CSPG suRGEX C2 REMOTEPORTAL User Manual energy intelligenc I HARDWARE 3 A RRP IP u 20 0 1 a aaa 3 B RP IP GNS 2 0 0
3. 0 cc cece asaan 3 ll SETUP AND CONFIGURATION 4 A IP SETTINGS AND CONFIGURATION ccccccecccccccccacecccacacccaccecccecaeccecetecseetecetscececscecececeneness 4 B LAN OPERATION AND CONFIGURATION 2cccecececececececececcccccccccacacacacauauuctauataeeeatavavsteeeeeeas 4 C WAN CONFIGURATION cceccccccececececcccacececececcacacececeaeacacececeauesceneneaeacseeteneceaeseeeneanseenenes 8 lil OPERATION 9 A JAVA APPLET an 9 B MOBILE ccccecececececececececececececucecucececececececececececucececucucuauauauauauauauauauauaeavatatauavavavanananaeas 10 AA AA 10 D COM PORT REDIRECTION c cceccccccececececcccacecececcauacacececeaeaeaceceteauavacsteneauaeseeteneceanaeenenss 10 IV ADVANCED CONFIGURATION 11 V SPECIFICATIONS 13 2014 Electronic Systems Protection Inc Technical Support 1 800 645 9721 espei com Page 2 CSPG SURGEX FJ REMOTEPORTAL User Manual energy intelligen I HARDWARE A RP IP 5 LAN Connect to local network using Cat5e patch cable XG EV Data Port Connect to XG or EV product using 6p6c RJ25 patch cable with Standard pin out Power Input power connection USB Mini B 5VDC 500mA minimum LEDs LED State EV XG Toggle Establishing network connectivity EV solid XG off XG solid EV off Next Gen operating mode Buttons Action o O Press and hold for 5 seconds then release to reset the unit to AON tar GSTS NN TT defaults Will reset IP settings
4. Runtime Environment JRE including MS Windows Apple OSX and various Linux distributions 2 Using a web browser navigate to the IP address of the RP IP Include the HTTP Server Port if set to a value other than 80 in this format hitp IP PORT x 10 1 2 78 PCS html i Z O 10 1 2 78 PCS html 0 004 A OVoff cow WG ove KG 0238 ING w E n nf oe o SS pia Outlets On Outlets On 0 0749 kWh i Turn Off Turn On Cycle Turn Off TurnOn Cycle Since 16 55 31 08 28 2014 T g g p H BHB User ID Next Gen PCS Ka H 2 User ID Rob s EV a PAA CSPG SURGEX CSPG SURGEX energy intelligence enVision PCS Mode Next Gen PCS Mode 3 Refer to the enVision Software User Manual for information regarding software operation http espei com products envision 2014 Electronic Systems Protection Inc Technical Support 1 800 645 9721 espei com Page 9 CSPG SURGEX energy intelligence B Mobile Cm REMOTEPORTAL User Manual 1 When using a browser which does not support Java a link to the mobile page will be provided The mobile page requires that JavaScript be enabled x Rob s EV Outlets On 112 09 Vin 0 Surge 0 004 A 2 Vos 0 00 W 4 OVRec 0 230 VNG 4 UVRec 59 97 Hz 3 UVog 0 813 PF 20 PO 1 406 CF 0 07 kWh Refresh Turn Off Turn O
5. parameters Hardware Ethernet TPI IP addr 0 0 0 0 DHCP BOOTP AutolP no gateway SNMP Manager not set DHCP device name not set Security SNMP is enabled SNMP Community Name public Telnet Setup is enabled TFTP Download is enabled Port 77FEh is enabled Web Server is enabled Web Setup is enabled ECHO is disabled Enhanced Password is disabled kkkkkkkkkkkkkkkkk Channel 1 kkkkkkkkkkkkkkkkk Connect Mode CO Source Port 10001 Destination Port 00000 Destination IP 0 0 0 0 CPU performance Standard Change Setup O Server configuration 1 Channel 1 configuration 5 Debug 6 Security 7 factory defaults 8 exit without save 9 save and exit Your choice 3 Select an option on the menu by entering the number of the option in the Your choice field and pressing Enter 4 To enter a value for a parameter type the value and press Enter or to confirm a current value just press Enter 5 Important When you are finished save the new configuration option 9 The unit reboots 2014 Electronic Systems Protection Inc Technical Support 1 800 645 9721 espei com Page 11 CSPG SURGEX energy intelligence fal REMOTEPORTAL User Manual 6 Server configuration Allows for the configuration of the following parameters a mog o 5 IP Address Gateway IP Address Netmask SNMP Manager IP Address Telnet configuration password DHCP device name DHCP FQDN option 7 Channel 1 configuration Allows fo
6. EMOTEPORTAL User Manual b Select Use the following IP configuration to manually specify the IP address 1 IP Address If DHCP is not used to assign IP addresses enter it manually in decimal dot notation The IP address must be set to a unique value in the network 2 Subnet Mask A subnet mask defines the number of bits taken from the IP address that are assigned for the host part 3 Default Gateway The gateway address or router allows communication to other LAN segments The gateway address should be the IP address of the router connected to the same LAN segment as the unit The gateway address must be within the local network 4 DNS Server The DNS server allows the name of a remote machine to be resolved automatically Enter the IP address of the DNS server If the device is DHCP enabled the DHCP server provides the DNS server IP address which will override this configured value Note This setting is applicable only in Manual Connection mode c SNMP 1 Select Enable or Disable to enable or disable the SNMP protocol 2 SNMP Manager Specify the IP address of the SNMP manager 3 The SNMP MIB may be downloaded on the Downloads tab on this page http www espel com products remote portal d Ethernet Configuration 1 Auto Negotiate With this option the Ethernet port auto negotiates the speed and duplex with the hardware endpoint to which it is connected This is the default 2 Speed The speed of data transm
7. RP IP 3 38 W x 2 2 D x 0 9 H Weight RP IP 0 2 Ibs Been dippers log Agency Listings RP IP ETL Certified to UL 60950 1 In Progress RP IP GNS 2014 Electronic Systems Protection Inc Technical Support 1 800 645 9721 espei com Page 13
8. is 80 6 Config Server Port Not applicable 7 MTU Size The Maximum Transmission Unit MTU is the largest physical packet size a network can transmit for TCP and UDP Enter between 512 and 1400 bytes The default is 1400 bytes 8 TCP Re transmission timeout The desired TCP re transmission timeout value If the ACK is not received for a packet sent from the RP IP device then the unit will retransmit the data The valid range is 500 4000 msec The default is 500 msec 4 Apply Settings Applies the currently specified settings 5 Apply Defaults Reset the unit to factory defaults Will not modify IP settings C WAN Configuration 1 To access the RP IP Java applet from outside of the local network the following 2 ports must be forwarded through the firewall to the internal IP address of the RP IP a HTTP Server Port Default 80 b TCP Server Port Default 10001 2 To access the RP IP mobile page from outside of the local network the following port must be forwarded through the firewall to the internal IP address of the RP IP a HTTP Server Port Default 80 2014 Electronic Systems Protection Inc Technical Support 1 800 645 9721 espei com Page 8 energy intelligence CSPG SURGEX EX REMOTEPORTAL User Manual HI OPERATION A Java Applet 1 Download and install the current JRE from www java com Java applet operation requires a computer with an operating system which supports the installation of a Java
9. ission The default is 100 Mbps This option is only available when Auto Negotiate is not enabled 3 Duplex The direction of data transmission The default is Full This option is only available when Auto Negotiate is not enabled 2014 Electronic Systems Protection Inc Technical Support 1 800 645 9721 espei com Page 6 CSPG SURGEX C7 REMOTEPORTAL User Manual energy intelligence 3 Server View and change the embedded Server settings ESP PCS x amp C ff DO 10 1 2 78 secure Itx conf htm CSPG SURGEX energy intelligence Server Settings Network Server aa a B Apply Settings Mode enVision EV TCP Server Port 110001 Server Configuration Enhanced Password O Enable Disable Telnet Web Manager Password PCS Communication Apply Defaults Retype Password Advanced ARP Cache Timeout secs 600 45 TCP Keepalive secs 4 Monitor Mode Bootup Enable O Disable CPU Performance Mode O Low Regular High HTTP Server Port 80 Config Server Port 30718 MTU Size 1400 TCP Re transmission 50 timeout ms 500 WebManager Version 2 0 0 5 a PCS Communication 1 Mode Select enVision EV or NextGen XG operational mode 2 TCP Server Port Specify the port for serial data b Server Configuration 1 Enhanced Password Selecting this option enables advanced password creation allowing y
10. n Cycle Wed Sep 03 2014 16 42 44 GMT 0400 Eastern Daylight Time Full Site Electronic Systems Protection Inc z gt fi D 10 1 2 78 mobileEV h X7 Next Gen PCS a amp C fi 10 1 2 78 mobilexG hyy Next Gen PCS Outlets On 108 VIN 40 Surge 2 OVRec 5 UVRec 3 PO Refresh Turn Off Turn On Cycle Wed Sep 03 2014 16 41 27 GMT 0400 Eastern Daylight Time Full Site Electronic Svstems Protection Inc enVision PCS Mode C SNMP Next Gen PCS Mode 1 The RP IP and RP IP GNS provide monitoring and control via SNMP The SNMP MIB may be downloaded here http www espel com products remote portal D COM Port Redirection 1 The RP IP and RP IP GNS may also be used with COM Port Redirection software and the standard Next Gen PCS and enVision PCS desktop software applications 2014 Electronic Systems Protection Inc Technical Support 1 800 645 9721 espei com Page 10 energy intelligence CSPG sURGEX fF REMOTEPORTAL User Manual IV ADVANCED CONFIGURATION A Advanced settings may be adjusted via Telnet on port 9999 1 Upon establishing a connection the following information is displayed ESP PCS MAC address 0080A39C878F Software version V6 9 0 3 140902 CPK6903_XPT05 Press Enter for Setup Mode 2 To enter Setup Mode press Enter within 5 seconds The configuration settings display followed by the Change Setup menu enVision EV Mode basic
11. ou to create passwords up to 16 bytes in length Disabling this option disables advanced password creation allowing you to create basic passwords up to 4 bytes in length 2 Telnet Web Manager Password Enter the password required for Telnet configuration and Web Manager access 2014 Electronic Systems Protection Inc Technical Support 1 800 645 9721 espei com Page 7 energy intelligence CSPG SURGEX REMOTEPORTAL User Manual c Advanced 1 ARP Cache Timeout When the unit communicates with another device on the network it adds an entry into its ARP table ARP Cache timeout defines the number of seconds 1 600 before it refreshes this table 2 TCP Keepalive TCP Keepalive time defines how many seconds the unit waits during an inactive connection before checking its status If the unit does not receive a response it drops that connection Enter a value between 0 and 60 seconds 0 disables keepalive The default setting is 45 Monitor Mode Bootup Select Disable to disable entry into the monitor mode using the yyy or xx1 key sequence at startup This field prevents the unit from entering monitor mode by interpreting the stream of characters that are received during the device server s initialization at startup C 4 CPU Performance Mode Do not adjust Default is Regular 5 HTTP Server Port This option allows the configuration of the web server port number The valid range is 1 65535 The default port
12. r the configuration of the following parameters a mog gp 5 Connect Mode Do not modify Default is CO Source Port Destination Port Currently Unused Destination IP Currently Unused Enable Pack Control Do not modify Default is No Disconnect Time 8 Debug Not intended for general use Enables EV XG data communication debug 9 Security Allows for the configuration of the following parameters a mog a 5 gt j Disable SNMP SNMP Community Name Disable Telnet Setup Disable TFTP Firmware Update Disable Port 77FEh configuration port Disable Web Server Disable Web Setup Disable ECHO ports Enable Enhanced Password Use Encryption Currently Unused 10 Factory defaults Reset the unit to factory defaults Will not modify IP settings 11 Exit without save Exits and terminates telnet session without modifying parameters 12 Save and exit Stores parameters and reboots with new parameters in place 2014 Electronic Systems Protection Inc Technical Support 1 800 645 9721 espei com Page 12 energy intelligence CSPG SURGEX C1 REMOTEPORTAL User Manual V SPECIFICATIONS Power Requirement RP IP 5VDC 2W RP IP GNS 12VDC 2W Network Interface RJ45 Ethernet 10BASE T or 100BASE TX auto sensing Protocols Supported ARP TCP IP Telnet SNMP DHCP BOOTP TFTP Auto IP and HTTP LEDs 10BASE T amp 100BASE TX Link Activity Full half duplex EV XG mode indicators Dimensions
13. stall Lantronix Devicelnstaller http www lantronix com device networking utilities tools device installer html B LAN Operation and Configuration 1 Using a web browser with JavaScript enabled navigate to http IPAddress config where the IPAddress is the IP Address of the RP IP a When prompted for a User Name and Password leave both fields blank and press Log In b Important For any changes to be applied press the OK button at the bottom of the section then press Apply Settings in the left hand menu and finally wait for the RP IP to reboot with new settings in place c Home Page View firmware and configuration information currently in use gt e x J F m uy 1 x C ft D 10 1 2 78 secure ltx_conf htm IG CSPG SURGEX energy intelligence Device Status Network Server Apply Settings Product Information Firmware Version V6 9 0 3 Apply Defaults Build Date 02 Sep 2014 Network Settings MAC Address 00 80 A3 9C 87 8F Network Mode Wired DHCP HostName lt None gt IP Address 10 1 2 78 Default Gateway 10 1 2 1 DNS Server 10 1 2 11 MTU 1400 Device Type PCS envision WebManager Version 2 0 0 5 2014 Electronic Systems Protection Inc Technical Support 1 800 645 9721 espei com Page 4 CSPG SURGEX energy intelligence ial REMOTEPORTAL 2 Network Settings View and change IP Configuration 4 EsP Pcs x oH C ff DO 10 1 2 78 secure Itx conf htm
14. to factory default Press and hold for 5 seconds then release to toggle between EV and XG operating modes B RP IP GNS 1 2 LAN Connect to local network using Cat5e patch cable galingan XG EV Data Port Connect to XG or EV product using 6p6c RJ25 patch cable with Standard pin out Bos LECE Busa Powe LED Frich siss LEDit Power Input power connection Barrel 12VDC 1A minimum Switch Ports Power LAN XG EV LEDs LED State Meaning EV XG Toggle Establishing network connectivity EV solid XG off enVision operating mode XG solid EV off Next Gen operating mode Switch Status Link Activity LEDs for each switch port RP IP GNS Power Indicator 5 Buttons Ke ee Press and hold for 5 seconds then release to reset the unit to A ee defaults Will reset IP settings to factory default Press and hold for 5 seconds then release to toggle between EV and XG operating modes 2014 Electronic Systems Protection Inc Technical Support 1 800 645 9721 espei com Page 3 energy intelligence CSPG SURGEX KC REMOTEPORTAL User Manual ll SETUP AND CONFIGURATION A IP Settings and Configuration 1 Factory Default Acquires IP address automatically via DHCP 2 Determine assigned IP address by one of the following methods a Access router table b Download and run ESP RP IP Discover Utility available on the Downloads tab here http www espel com products remote portal c Download and in
Download Pdf Manuals
Related Search