Home

user manul

1. 459 1459 jejueunjedx3 uonduioseg 6 v 2 L ON eqni 159 SNOILOVSY 39VH S dN 9NILL3S Il 318V L Protocol No PT1156 1 www clontech com Clontech Laboratories Inc 18 Version No PR15736 Marathon Ready cDNA User Manual inued VI Rapid Amplification of CDNA Ends RACE cont 8 peiseu ejyeudoudde eu uoneoi due 2 Aiepuooes B Jo pasu uonoeeJ JOVH elueuiiedxe eui ui PBAJOSQO SEM eUM OJ JEJILIIS spueq Jo Jeeuis B seonpoud sjonuoo eseuj Jo euo J spueg 10 eonpoid 39vH JNOA jnjosn Auejnonued 2460 pue LdV SUL v dg 006 B ejeJeue siu Hdd 5 2 pue G eui esn oj si UV sionpoud 2 dS5 JNOA eg Ajuo ued 5141 YNG 3y ui pesseudxe si JS9J9JUI JO eue y JEU oj njesn B si 2 459 94 sionpoJd DuiddejJe 0 FOVWH pue s Uiog Buiuuoped J q JonpoJd gy c 912 9086 Pinoys 2 eAnISOd SUL e JOVH Bunoouse qnojJ x uonoes ees SJOJJUO9 JO uoissnosip
2. e 104 SINSI pe oedxe ay jou op suonoeeu JOVH eiui ANOA ji uoneuuojur njesn epi oJd g g SJOJJUOQ S9 ON 06 09 06 1109 1109 JBLI4 XIN J9ISEW 1 d 4 ess ee us O H in INT OL 39VH 10002 INT 01 4euiud esuesnue 460 1 L WH 01 awyd esues 2459 WH 01 Ldv Apeoy uoujeJe o M19 M19 Ben q M19 SOd e HID SOd ejduies 2459 2 1459 uonduoseg 8 v c L ON eqni 1591 SNOILOV3H 39 dN 9 1135 I 318VL Clontech Laboratories Inc www clontech com Protocol No PT1156 1 Version No PR15736 19 Marathon Ready cDNA User Manual VI Rapid Amplification of CDNA Ends RACE continued 4 Commence thermal cycling using one of the following programs programs 1 and 2 work with the Control 5 G3PDH Primers and AP1 Program 1 preferred use if GSP Tm gt 70 C DNA Thermal Cycler 480 GeneAmp Systems 2400 9600 or hot lid thermal cycler 94 C for 1 min 94 C for 30 sec 5 cycles 5 cycles 94 30sec 94 S5sec 72 C 4min 72 C 4min 5 cycles 5 cycles 94 C 30 94 C 5sec 70 C 4min 70 C 4min 20 25 cycles 20 25 cycles 94 C 20sec 94 C 5 5 68 C 4
3. B eonpoud SUOIJOB91 JOVH G JNOA ji jnjesn Auejnonued Juo dS5 pue AJUO LdV 941 gt 06 006 B JJIM stu 39VH pue s eu esn SI uy sJoNPOJA JOVH pue G o eje Z 9 459 4noA ji aq Ajuo ued 5141 peeu uoujeJe u eui UI posseudxe si seuejul Jo eu JEU O JNJOSN si JOJJUOQ 2 1 459 941 sjionpoud 39VMH pue 5 q qx 60 B eneieueD Pinoys SUL e JOVH x uonoes ees JO uoissnosip ejejduioo e 104 SIJNSAJ pe oedxe eui Jou op JOVH noA JI epi oJd G S91ON 05 09 09 os 05 feul XIJN JSJSEJNI L in L m OH in L Nr 01 4eullid HQdED JOVH S Ionuoo INT 01 esues 2460 my In im L WH 01 esuesnue 1459 im L im L Nri 01 42eullid dV 2140 Ben 2140 Ben 4140 SOd e LID SOd ejdues
4. by 5 RACE l Region to amplified by 3 RACE lt gt NGSP1 a GSP1 3 GSP 3 adaptor ligated ds cDNA template 81 i 30 L EE API 3 5 GSP GSP2 NGSP2 AP2 5 Marathon cDNA Adaptor Gene specific primers GSPs Supplied by the 37 X NH blocking group user Nested GSPs NGSPs are optional and can be used for characterization of RACE products mI cDNA Synthesis Primer and for nested RACE PCR if necessary NNT30 plus second strand E Flanking 5 and 3 GSPs are optional for the Adaptor Primers AP1 and AP2 generation of the full length cDNA by end to end AP2 is optional for analysis of RACE PCR and are based on sequence products or nested RACE PCR data obtained from 5 and 3 RACE products Figure 4 The template and primers used in Marathon RACE reactions cDNA synthesis and adaptor ligation create a population of cDNAs with the structure depicted above This population is the Marathon Ready cDNA which is essentially a library of uncloned ds cDNA from which you can amplify many different cDNAs using different sets of GSPs If the GSPs create overlapping 5 and 3 RACE products the products can subsequently be joined by restriction digestion and ligation to create the full length cDNA providedthere are suitable restriction sites inthe region of overlap Also GSPs designed to give overlapping RACE products can be used together to generate a useful
5. Test Tube No 1 2 3 Component Full length 5 RACE 3 RACE Marathon Ready cDNA 5 ul 5 ul 5 ul 5 GSP primer 10 uM 1 ul 1 ul 3 GSP primer 10 uM 1 ul 1 ul GSPI primer 10 1 ul GSP2 primer 10 1 ul Master Mix 43 ul 43 ul 43 ul Total volume 50 ul 50 ul 50 ul The 5 and 3 RACE reactions are optional controls The 5 and 3 GSPs are critical for the success of full length amplification If the full length amplification does not work the most likely reason is the design of these primers These controls can help determine whether you have a problem with one of the primers 5 Overlay the contents of each tube with 2 drops of mineral oil and place caps firmly on each tube Note This is not necessary if you are using a hot lid thermal cycler 6 Commence thermal cycling using the following program DNA Thermal Cycler 480 GeneAmp Systems 2400 9600 or hot lid thermal cycler 949C for 1 min e 94 C for 30 sec 25 cycles 25 cycles 94 C 30 sec 94 C 5 sec 72 C 2 15 min 72 C 2 15 extension time in min should egual the expected length of the cDNA to the nearest kb plus 2 min e g if your expected product is 6 kb use 8 min 6 2 Note you may needto determine the optimal cycling parameters for your gene empirically If you see weak bands or no bands perform an additional five cycles For additional suggestions on optimizing RACE PCR conditions refer to Se
6. xt r 0N Nt r LV NN r LdV 10 915 oN ejejduia se 10 aq jouue9 pues Jaddn 2 2 99U9ululo e XII asesawAjog Z 5 LdV PU 2459 PPV UId JIVU 1459 tm 459 e XIJN SSEJOWIAJOq z dV 1459 PPV H9d 39Vu 5 suonoe91 39v 10 aJedaJd 1U 10 L4 10 N O JOL i uoidepy 1 PPV NOILV9IT HOLdVdV junjq 03 44 6040 MOL e YL PPV 147Z 10 9191 pue jod H eseNu 11814207 ouiAzug pueng puo28g e SISJHLNAS GNVULS GNOJIS JU 1 10 NZ i sisayjuAg vNq2 Dubj20p y90 ppy aseJdMISUBIJ ANY PPV SISIHLNAS GNVHLS 1SUH EINN ee A jeuondo Ss CELLLLINNI VVVVVNN QA C951 LL INN VVVVVNN VvVvvvvvvvvvvvvvvvvvvvvvvvvvvv 8 jo uoiBay YNG pepuens ejqnop 1 2 SpUQAU vNG VNH YNY Y Mod l 5 931 019 Lv JNOG Clontech Laboratories Inc www clontech com Protocol No PT1156 1 Version No PR15736 37 Marathon Ready cDNA User Manual inued Flow Chart of Marathon Procedu
7. Marathon cDNA amplification is a flexible tool Many researchers use this method and Marathon Ready cDNAs in place of conventional RACE kits to amplify just the 5 or 3 end of a particular cDNA Others perform both 5 and 3 RACE and many then go on to clone full length CDNAs using one of the two methods described in the latter part of the protocol In many cases researchers obtain full length CDNAs without ever constructing or screening a cDNA library Examples of 5 and 3 using the Control G3PDH Primers with different Marathon Ready cDNAs are givenin Figure 2A G3PDH Primers are provided with each Marathon Ready cDNA and are an important positive control in Marathon RACE experiments Figure 2B gives 5 and 3 Marathon RACE results for human actin and human transferrin receptor TFR genes while Figure 4 gives several examples of large 5 9 kb full length cDNAs generated by Marathon cDNA amplification Table I at the end of this introduction gives several other examples of Marathon amplified cDNAs The only requirement for Marathon cDNA amplification is that you use an LD PCR compatible polymerase mix and know at least 23 28 nucleotides nt of sequence information in order to design gene specific primers GSPs for the 5 and 3 RACE reactions Additional sequence information will facilitate analysis of vour RACE products This minimal requirement for sequence information means that Marathon cDNA amplification is well suit
8. 65 C best results are obtained if T 70 C enables the use of touchdown PCR Clontech Laboratories Inc www clontech com Protocol No PT1156 1 6 Version No PR15736 Marathon Ready cDNA User Manual Introduction amp Protocol Overview continued You will need to design gene specific primers for the 5 and or a RACE reactions GSP1 and GSP2 respectivelv Nested primers NGSP1 and NGSP2 will facilitate analysis of your RACE producis as described in Section VIII and can be used for nested RACE PCR if necessary Primer design is discussed in detail in Section V and Figure 4 shows the relationship of primers and template used in Marathon RACE reactions Construction of Marathon Ready cDNAs Construction of Marathon Ready cDNAs at Clontech begins with cDNA synthesis from high quality poly A RNA First strand synthesis uses a modified lock docking oligo dT primer with two degenerate nucleotide positions at the 3 end These nucleotides position the primer at the start of the poly A tail and thus eliminate the 3 heterogeneity inherent with conventional oligo dT priming Chenchik et al 1994 Borson et al 1994 The carefully optimized Marathon reaction conditions give consistently high yields and size distributions of first strand cDNA synthesis Second strand synthesis is performed according to the method of Gubler amp Hoffmann 1983 with a cocktail of E coli DNA polymerase I RNase H and E coli DNA ligase
9. 68 C 4 Program 2 if GSP T 60 65 C DNA Thermal Cycler 480 GeneAmp Systems 2400 9600 or hot lid thermal cycler 94 C for 1 min 94 C for 30 sec 25 30 cycles 25 30 cycles 94 C 30 sec 94 5sec 68 C 4 min 68 C 4 min Notes on cycling You may need to determine the optimal cycling parameters for your gene empirically If you see weak bands or no bands perform five additional cycles at 689C For more suggestions on optimizing RACE PCR conditions refer to Section X The optimal extension time depends on the length of the fragment being amplified We typically use 4 min for cDNA fragments of 2 5 kb For 0 2 2 kb targets we reduce the extension time to 2 3 min For 5 10 kb targets we increase the extension time up to 10 min 5 When cycling is completed analyze 5 ul from each tube along with appropriate DNA size markers on a 1 296 agarose EtBr gel Clontech Laboratories Inc www clontech com Protocol No PT1156 1 20 Version No PR15736 Marathon Ready cDNA User Manual VI Rapid Amplification of CDNA Ends RACE continued 6 Optional If the primary PCR reaction fails to give the distinct band s of interest or produces a smear you may wish to perform a Southern blot using a a cDNA probe b a nested primer as a probe Or you may wish to perform a secondary or nested PCR reaction using the AP2 primer supplied with Marathon Ready cDNA and a NGSP See the disc
10. Marathon Ready cDNA User Manual VII Characterization of RACE Products At this point we recommend that you characterize your RACE fragments and confirm that you have amplified the desired product This can prevent confusion and wasted effort when you try to generate the full length CDNA even if you have single major products from both the 5 and 3 RACE reactions Characterization is especially important if you have multiple bands or if you suspect that you are working with a member of a multigene family For example the single RACE products generated using actin primers in Figure 2 Introduction contain cDNAs from three different members of the actin gene family Below we describe three methods for characterizing RACE products 1 Comparison of RACE products obtained with GSPs and NGSPs 2 Southern blotting and 3 Cloning and seguencing We recommend thatyou obtain atleastsome seguence confirmation before attempting to generate the full length cDNA For options 1 and 2 you will need nested GSPs for analyzing your 5 and 3 RACE products Section X also contains information that may help you interpret your results For more detailed protocols for blotting and cloning see Sambrook and Russell 2001 or other appropriate laboratory manuals A Comparison of RACE Products Obtained with GSPs amp NGSPs For the 5 RACE products compare the products of primary amplifications performed with AP1 and GSP1 to the products obtained
11. The conditions and enzyme concentrations for second strand cDNA synthesis have been optimized to produce high yields of ds cDNA Typically less than 15 of the second strand syntheses are primed by hairpin loop formation Following creation of blunt ends with T4 DNA polymerase the ds cDNA is ligated to the Marathon cDNA Adaptor See Appendix B for information on the design and the seguence of the Marathon cDNA Adaptor This adaptor is partially double stranded and is phosphorylated at the 5 end to facilitate blunt end ligation of the adaptor to both ends ofthe ds cDNA by T4 DNA ligase Blunt end ligation is more efficient than homopolymeric tailing or ligation of an adaptor to single stranded cDNA by T4 RNA ligase so a higher percentage of the resulting CDNA molecules contain the terminal structure reguired for RACE This is a primary reason why Marathon 5 RACE reactions are more efficient and reproducible than 5 RACE methods based on tailing or ss ligation Frohman et al 1988 Dumas et al 1991 Harvey amp Darlison 1991 Finally the adaptor ligated cDNA is diluted to the appropriate concentration and is packaged as Marathon Ready cDNA Marathon RACE Reactions Section VI Each tube of Marathon Ready cDNA is essentially an uncloned library of adaptor ligated ds cDNA Enough material is provided for you to perform 5 and 3 Marathon RACE for many different genes simply by using different gene specific primers Marathon RACE reaction
12. bands when used alone and that they give a single band when used together If either GSP alone gives persistent bands we recommend altering the cycling parameters or designing nested primers as discussed below If you have notalready done so repeat your RACE reactions using some form of hot start PCR antibody mediated wax beads or manual Clontech Laboratories Inc www clontech com Protocol No PT1156 1 32 Version No PR15736 Marathon Ready cDNA User Manual X Troubleshooting RACE Reactions continued f multiple bands persist try altering the PCR cycling parameters a Increase the stringency of your PCR by raising the annealing temperature in increments of 2 5 In many cases bands arising from nonspecific priming will disappear while real or incomplete products will persist b Reduce the cycle number Again bands arising from nonspecific priming may disappear while real or incomplete products will persist c Reduce the extension time d In the case of large RACE products increasing the extension time may help eliminate extra bands f multiple bands persist try designing a new set of primers a Redesign your primers so that they have a T gt 70 C and use the cycling parameters for touchdown PCR b We recommend that you design new primers that will give RACE products thatare slightly differentin sizethan those expected with the original primers These new primers can either be used by themsel
13. com Clontech Laboratories Inc Version No PR15736 41 Marathon Ready cDNA User Manual Notes Clontech Laboratories Inc www clontech com Protocol No PT1156 1 42 Version No PR15736 Marathon Ready cDNA User Manual Notes Notice to Purchaser Clontech products are to be used for research purposes only They may not be used for any other purpose including but not limited to use in drugs in vitro diagnostic purposes therapeutics or in humans Clontech products may not be transferred to third parties resold modified for resale or used to manufacture commercial products or to provide a service to third parties without written approval of Clontech Laboratories Inc Suppression PCR is covered by U S Patent No 5 565 340 Foreign patents pending A license under U S Patent Nos 4 683 202 4 683 195 and 4 965 188 and U S Patents Nos 5 407 800 5 322 770 5 310 652 or their foreign counterparts owned by Roche Molecular Systems Inc and F Hoffmann La Roche Ltd for use in research and development has an up front fee component and a running royalty component The purchase price of this product includes limited nontransferable rights under the running royalty component to use only this amount of the product to practice the Polymerase Chain Reaction PCR and related processes described in said patents where the processes are covered by patents solely for the research and development activities of the purchaser
14. contains TITANIUM Tag DNA Polymerase a nuclease deficient N terminal deletion of Tag DNA polymerase plus TaqStartTM Antibody to provide automatic hot start PCR Kellogg et al 1994 and a minor amount of a proofreading polymerase Advantage 2 Polymerase Mix is also available in the Advantage 2 PCR Kit Cat Nos 639206 639207 10X PCR reaction buffer Included with Advantage 2 Polymerase Mix and in the Advantage 2 PCR Kit Use the 10X reaction buffer supplied with your source of native or truncated Tag DNA polymerase in all reactions that call for 10X PCR buffer 50X dNTP Mix 10 mM each of dATP dCTP dGTP and dTTP 1X concentration 0 2 mM Included in the Advantage 2 PCR Kit 0 5 PCR reaction tubes We recommend Applied Biosystems GeneAmp 0 5 ml reaction tubes Cat Nos N801 0737 or N801 0180 Tricine EDTA buffer recommended instead of TE for dissolving and or diluting PCR templates 10 mM Tricine pH 9 2 0 1 mM EDTA Protocol No PT1156 1 www clontech com Clontech Laboratories Inc Version No PR15736 Marathon Ready cDNA User Manual General Considerations of Marathon cDNA Amplification The cycling parameters throughout this protocol have been optimized using a Applied Biosystems DNA Thermal Cycler 480 or GeneAmp PCR Systems 2400 9600 the Advantage 2 PCR Kit and Control G3PDH Primers The optimal cycling parameters may vary with different 50X polymerase mixes templates gene
15. control for PCR However itis not absolutely necessary to use primers that give overlapping fragments The specificity of Marathon RACE reactions is greatly enhanced by the absence of an AP1 binding site on the Marathon Ready cDNAs This site is created on the cDNA of interest by extension from the GSP during the first RACE cycle The amine group on the Marathon cDNA Adaptor blocks extension of the 3 end of the adaptor ligated ds cDNAs and thus prevents formation of anAP 1 binding site on the general population of cDNAs B Location of Primer Sequences within a Gene We have had good success using the Marathon Ready cDNA to amplify 5 and 3 cDNA fragments that extend up to 6 5 kb from the GSP sites If possible choose your primers so that the 5 and 3 RACE products will be 3 kb or less If designing primers that produce overlapping 5 and 3 RACE products it is helpful to design the gene specific PCR primers so that the overlap between GSP1 and GSP2 is at least 100 200 bases In this way a stretch of known sequence will be incorporated into the amplified 5 and 3 fragments and can be used to verify that the correct gene was amplified Clontech Laboratories Inc www clontech com Protocol No PT1156 1 14 Version No PR15736 Marathon Ready cDNA User Manual V Primer Design continued C Touchdown PCR We have found that touchdown PCR Don et al 1991 Roux 1995 significantly improves the specificity of Marathon RACE PC
16. repeat the RACE reaction gel purify the DNA in the band s of interest using your preferred method of DNA recovery from agarose gels resuspend in 30 ul of Tricine EDTA buffer and proceed with your experiments after confirming that you have cloned the correct RACE product C Cloning amp Seguencing RACE Products 1 Gel purify the RACE product s of interest using your preferred method of DNA recovery from agarose gels In our experience silica bead based methods work well for RACE products up to about 2 5 kb With longer fragments we have obtained the best results using eleciroelution or DNA purification cartridges If you choose another method of DNA purification resuspend your DNA in 30 ul of Tricine EDTA Buffer 2 Verify recovery of the desired DNA fragment by examining 5 ul on an agarose EtBr gel 3 Clone the purified PCR product directiv into a T A tvpe PCR cloning vector Alternativelv vou mav be able to clone into conventional vectors using the Not Srf I Xma l and EcoR I restriction sites in the Marathon Adaptor and or CDNA Synthesis Primer and restriction sites introduced in your GSP 4 Identifv clones containing gene specific inserts by colony hybridization using a 92P end labeled nested GSP as a probe or by sequencing from your GSP For 5 RACE products we recommend picking at least 8 10 different independent clones in order to obtain the maximal possible amount of seguence atthe 5 end Reverse transcriptio
17. using AP1 and NGSP1 and the same cycling conditions and Marathon Ready cDNA as a template For 3 RACE compare the products obtained from amplifications performed with AP1 and GSP2 to those obtained with AP1 and NGSP2 This is a good test of whether multiple bands are a result of correctly primed PCR or nonspecifically primed PCR If bands are real i e the result of correct priming they should be slightly smaller in the reaction using the NGSP The difference in mobility of the products should correspond to the positions of the GSPs and NGSPs in the cDNA structure Note Do not use AP2 in these reactions because it will cause a size decrease in all of the PCR products If you have multiple bands with AP1 and GSP1 or GSP2 some of these may disappear upon amplification with AP1 and NGSP1 or NGSP2 B Southern Blot Analysis Much stronger confirmation can be obtained by probing a Southern blot of your RACE products using an internal gene specific probe usually one of your other GSPs This method can be particularly useful for determining which bands are real when RACE produces multiple bands Multiple bands are more common with 5 RACE than with 3 RACE Figure 5 shows Southern analysis of the 5 RACE products from the insulin like growth factor receptor type 2 cDNA ILGFR2 The ILGFR2 mRNA which is large 9 kb and relatively rare is one of the most difficult targets we have analyzed using the Marathon cDNA amplification Clo
18. 1156 1 28 Version No PR15736 Marathon Ready cDNA User Manual X Troubleshooting RACE Reactions Tables and Ill in the User Manual include several controls that will help you troubleshoot the reaction if yields are suboptimal These include Tube No 2 5 or 3 RACE PCR using the Control G3PDH Primer and the AP1 Primer to amplify your Marathon Ready cDNA A smear of large molecular weight material may appear at the top of some lanes As discussed in Appendix B the upper limit of the suppression PCR effect is about 6 kb The large nonspecific amplification products that do appear in some Marathon generally do not interfere with interpretation of RACE results however care must be taken to avoid these products when cloning and otherwise using your RACE products for subseguent experiments Tube No 3 An additional positive control using both GSPs to amplify your Marathon Ready cDNA you do not have suitable 5 and 3 GSPs i e GSPs that create overlapping 5 and 3 RACE products use the control 5 and a RACE G3PDH Primers This should give a single band corresponding to the overlap between the primers This result confirms that vour cDNA or the G3PDH cDNA is present in and can be amplified from vour Marathon Readv cDNA Tube No 4 A negative control using AP1 by itself to amplify your Marathon Ready cDNA With less than 30 cycles this should produce no product may produce some la
19. Control G3PDH Primers The G3PDH Primers anneal to a portion of the G3PDH gene that is conserved among hu man rat and mouse Lanes 1 8 2 5 8 3 RACE from Human Heart Marathon Ready cDNA Lanes 3 amp 4 5 amp 3 RACE from Mouse Heart Marathon Ready cDNA Lanes 5 8 6 5 amp 3 RACE from Rat Heart Marathon Ready cDNA Lanes M DNA size markers Panel B Results using Actin and TFR primers Lane 1 Negative control reaction primed with AP1 alone Lane 1 1 2 kb 5 RACE product generated with actin primers Lane 2 1 3 kb 3 RACE product generated with actin primers Lane 3 2 6 kb 5 RACE product generated with primers Lane 4 2 9 kb 3 RACE product generated with TFR primers Lane M DNA size markers Overview of the Marathon cDNA amplification protocol An overview of Marathon cDNA amplification is presented in Figure 1 For Marathon Ready cDNAs cDNA synthesis and adaptor ligation are performed at Clontech 5 and or 3 RACE can be completed in one day The time required to characterize the RACE products and to generate the full length cDNA can vary greatly depending on the particular target As you read the following description and set up your experiments you may find it useful to refer to the detailed flow chart Figure 6 Appendix A and the diagram of the Marathon cDNA template and primers Figure 4 Section V Primer Design Section V Gene Specific Primers GSPs should be 23 28nt 50 70 GC Tin
20. Length CDNA by PCR In most cases you should see a single major product of the size predicted from Northern analysis or analysis of your 5 and 3 RACE products If you do not observe a single major band and if you cannot resolve your full length cDNA by optimizing the extension time and cycle number we suggest that you design additional nested 5 and 3 GSPs Most problems with the full length PCR reaction are due to poor primers and can be corrected simply by using better primers If one of the controls in Table V also does not work try that nested primer first Try additional primary PCR reactions with different combinations of flanking primers i e 5 GSP and 3 NGSP 5 NGSP and 3 GSP 5 NGSP and 3 NGSP If that doesn t work then try nested PCR See Section XI for additional suggestions on interpreting your results and optimizing your PCR reactions XII References Marathon cDNA amplification has been cited in more than 200 research articles For a complete list of citations see Clontech s web site http www clontech com Advantage GC 2 and Advantage HF 2 Systems January 1999 Clontechnigues XIV 1 7 Barnes W M 1994 PCR amplification of up to 35 kb DNA with high fidelity and high yield from bacteriophage templates Proc Natl Acad Sci USA 91 2216 2220 Belyavsky A T Vinogradova T and Rajewsky K 1989 PCR based cDNA library construction General cDNA libraries at the level of a few cells N
21. Marathon Readv CDNA User Manual Cat No 639300 PT1156 1 PR15736 Published 06 08 2001 Marathon Ready cDNA User Manual Table of Contents l Introduction amp Protocol Overview 4 ll List of Components 11 Additional Materials Required 11 IV General Considerations of Marathon cDNA Amplification 12 V Primer Design 13 VI Rapid Amplification of CDNA Ends RACE 17 VII Characterization of RACE Products 22 VIII Generation of Full Length cDNA by PCR 25 IX Generation of Full Length cDNA by Cloning 28 X Troubleshooting RACE Reactions 29 Troubleshooting Generation of Full Length cDNA by PCR 34 XII References 34 XIII Related Products 36 Appendix A Detailed Flow Chart of Marathon Procedure 37 Appendix B Marathon cDNA Adaptor amp Primers 39 2 Version No PR15736 Marathon Ready cDNA User Manual Table of Contents continued List of Figures Figure 1 Overview of the Marathon procedure 5 Figure 2 Typical Marathon 5 amp 3 RACE results 6 Figure 3 Examples of large full length CDNAs generated by end to end PCR of Marathon Ready cDNAs 9 Figure 4 The template and primers used in Marathon RACE reactions 14 Figure 5 Identifying the correct RACE products by Southern blotting 23 Figure 6 Detailed flow chart of Marathon cDNA amplification 37 Figure 7 The suppression PCR effect 40 Figure 8 Sequences of the Marathon cDNA Adaptor amp Primers 41 List of Tables Table Examples of cDNAs ampl
22. PCR reaction with GSPs from the 5 and 3 ends of your gene can be used to amplify the full length cDNA from the Marathon Ready cDNA The sequence of the 5 and 3 GSPs is usually obtained by seguencing the 5 end of the 5 RACE product and the 3 end of the 3 RACE product Figure 3 shows three examples of full length cDNAs generated by end to end 2 Generation of Full Length cDNA by Cloning Section IX Cloned overlapping 5 and 3 RACE fragments can be used to generate the full length cDNA using a restriction site in the overlapping region if one exists and sites in the Marathon Adaptor and or cDNA Synthesis Primer In general PCR using flanking GSPs is more direct and less subject to complications or artifacts With cloning there is a slight chance of joining 5 and 3 cDNA fragments derived from two different transcripts this could occur with two different forms of a polymorphic RNA or with transcripts from a multigene family In contrast with end to end PCR the 5 and 3 GSPs will amplify the full length of a single so there is no chance of generating a hybrid cDNA Virtually all cDNAs are within the range of LD PCR No method of cDNA synthesis can guarantee a full length cDNA particularly at the 5 end Determining the true 5 end reguires some combination of RNase protection assays primer extension assays and cDNA or genomic seguence information Many Marathon cDNAs include the complete 5 end of the cDNA ho
23. PT1156 1 www clontech com Clontech Laboratories Inc 38 Version No PR15736 Marathon Ready cDNA User Manual Appendix B Marathon cDNA Adaptor amp Primers The Marathon cDNA Adaptor has three design features that are critical to the success of Marathon cDNA amplification The use of a 5 extended adaptor that has no binding site for the AP1 Primer used in primary PCR An AP1 binding site can only be generated by extension of the gene specific primer GSP Blocking ofthe exposed 3 end of the adaptor with an amine group to prevent extension of the 3 end which would create an AP1 binding site and allow nonspecific amplification The use of an adaptor primer that is shorter than the adaptor itself suppression PCR As shown in Figure 7 the suppression PCR effect prevents amplification of templates where the 3 end has been extended to create an AP1 binding site Though rare such extension does occur presumably due to incomplete amine modification or incomplete adaptor ligation Given the exponential nature of PCR amplification such events would lead to nonspecific amplification and unacceptable backgrounds in the absence of suppression PCR Each of these features helps eliminate nonspecific amplification among the general population of cDNA fragments Together they allow amplification of a specific target from a very complex mixture of DNA fragments all of which have the same terminal structure using a sin
24. R Touchdown PCR involves using an annealing extension temperature during the initial PCR cycles that is several degrees higher than the of the AP1 Primer Although primer annealing and amplification is less efficient at this higher temperature it is also much more specific The higher temperature also enhances the suppression PCR effect with AP1 see Appendix B If the of your GSP gt 709C only gene specific synthesis occurs during these initial cycles and this allows a critical amount of gene specific product to accumulate The annealing extension temperature is then reduced to the AP1 Primer T forthe remaining PCR cycles permitting efficient exponential amplification of the gene specific template As noted above we recommend using primers with 5 gt 70 C to allow you tousethetouchdown cycling programs inthe protocol Nontouchdown cycling programs are also included for use with primers with T s lt 70 C D Nested Primers Do not use nested PCR in your initial experiments The AP1 Primer and a GSP will usually generate a good RACE product with a low level of nonspecific background However a Southern blot or nested GSPs NGSP1 and NGFP2 see Figure 4 are very useful for characterizing your RACE products Furthermore nested PCR may be necessary in some cases where the level of background or nonspecific amplification in the 5 or 3 RACE reaction is too high with a single GSP In nested PCR a primary amplificat
25. TagStartAntibody wax beads or manual hot start to minimize background in your RACE reactions 1 Prepare enough PCR master mix for all of the PCR reactions plus one additional tube The same master mix can be used for both 5 and 3 RACE reactions For each 50 reaction mix the following reagents 36 ul 5 ul 1 ul 1 ul HO 10X cDNA PCR Reaction Buffer dNTP mix 10 mM Advantage 2 Polymerase Mix 50X 43 ul Final volume Mix well bv vortexing without introducing bubbles and brieflv spin the tube in a microcentrifuge 2 For 5 RACE prepare PCR reactions as shown in Table II For 3 RACE prepare PCR reactions as shown in Table III Add the components in the order shown in 0 5 ml PCR tubes 3 Overlay the contents of each tube with 2 drops of mineral oil and place caps firmly on each tube Note This is not necessary if you are using a hot lid thermal cycler Protocol continues on page 20 Protocol No PT1156 1 Version No PR15736 www clontech com Clontech Laboratories Inc Marathon Ready cDNA User Manual inued VI Rapid Amplification of CDNA Ends RACE cont 5 ejyeudoudde eu Arepuooes Jo UOIJOB91 JOVH e ueuiiodxe eu ui PBAJOSQO SEM TEUM OJ Spueq Jo aws B seonpoud osje Jo euo J Spueq JO
26. athon RACE was used Clontech Laboratories Inc www clontech com 10 Protocol No PT1156 1 Version No PR15736 Marathon Ready cDNA User Manual ll List of Components Store all components at 20 C The following reagents are sufficient for 30 Marathon RACE reactions e 150 ul Marathon Ready cDNA 0 1 ng ul in Tricine EDTA buffer 50 ul Adaptor Primer 1 AP1 10 uM 50 ul Nested Adaptor Primer 2 AP2 10 uM 20 ul Control 5 RACE G3PDH Primer 10 20 ul Control a RACE G3PDH Primer 10 Note See Figure 8 Appendix for the seguences of the Marathon cDNA Adaptor and Primers Tms of AP1 and AP2 are 71 C and 77 C respectively However only 22 of the 27 nt in AP1 bind the adaptor during PCR so the effective T of AP1 is actually several degrees lower The lower effective Tm of AP1 is one reason touchdown PCR works well with Marathon RACE reactions lll Additional Materials Required The following reagents are required but not supplied Advantage 2 Polymerase Mix 50X You will need a Tag based 50X polymerase mix suitable for LD PCR A single polymerase will not give satisfactory results in most experiments The Marathon cDNA amplification protocol has been optimized with Clontech s Advantage 2 Polymerase Mix Cat Nos 639201 639202 This LD PCR enzyme mix has been specifically developed for amplification of cDNA templates of all sizes The Advantage 2 polymerase mix
27. cDNAAdaptor which is described in detailin Appendix B Both 5 and 3 RACE reactions are primed with an internal gene specific primer GSP and the Marathon Adaptor Primer AP1 The adaptor ligated cDNA does not contain a binding site for AP1 During the first round of thermal cycling the GSP is extended to the end of the adaptor creating an AP 1 binding site at the 5 or 3 terminus of the cDNA In subseguent cycles both AP1 and the GSP can bind allowing exponential amplification of the cDNA of interest Nonspecific products are greatly reduced because the AP 1 binding cannot be created on the general population of CDNA molecules which also lack binding sites for the GSPs Characterization of RACE Products Section VII Before generating the full length cDNA we strongly recommend that you characterize your RACE productsto confirm that you have amplified the desired target This can be done by one or more of the following 1 comparing PCR products obtained using GSP1 and AP1 to product generated with NGSP1 and AP1 2 probing a Southern blot of your PCR products with an internal gene specific probe e g labeled NGSP1 and 3 cloning and sequencing your RACE products In general we recommend that you obtain at least some sequence information Careful characterization of your RACE products at this point can prevent confusion and wasted effort in your subsequent experiments even when both RACE reactions produce single major produ
28. cDNAs it may be better to use primers that are closer to the ends of the cDNA and therefore do not create overlapping fragments Additionally the primers themselves can overlap i e be complementary GSPs should have GC content of 50 70 and a of at least 65 C whenever possible the T should be 70 C or higher as determined by nearest neighbor analysis Freier et al 1986 In our experience longer primers with annealing temperatures of at least 70 C give more robust amplification in RACE particularly from difficult samples T s of 70 C or higher allow you to use touchdown PCR Section C below 5 of GSP1 and GSP2 can be calculated or determined experimentally by doing PCR at different temperatures Avoid using self complementary primer sequences which can fold back and form intramolecular hydrogen bonds Similarly avoid using primers that have complementarity to the Marathon AP1 Primer particularly in the 3 ends For further assistance with primer design and T calculation consult the world wide web at http alces med umn edu VGC html Note Do not incorporate restriction sites into the 5 ends of the 5 and 3 GSPs In our experience the presence of these extra seguences can lead to increased background Protocol No PT1156 1 www clontech com Clontech Laboratories Inc Version No PR15736 13 Marathon Ready cDNA User Manual V Primer Design continued Region of overlap Region to be amplified
29. ction XVI 7 Analyze 5 ul of each sample on a 1 2 agarose EtBr gel Expected results In mostcases you should see a single major product If so proceed to steps 8 12 for gel purification of the full length cDNA Gel purification is recommended instead of cloning the PCR product directly even though the product of this reaction is often a single strong band If you do not see a single major product refer to Section X Clontech Laboratories Inc www clontech com Protocol No PT1156 1 26 Version No PR15736 Marathon Ready cDNA User Manual VIII Generation of Full Length cDNA by PCR continued 8 Pour a preparative 1 296 agarose gel in TAE buffer with EtBr 0 3 ug ml Note Do not use TBE buffer as we have had difficulty cloning full length cDNAs purified from TBE gels 9 Load the remaining 45 ul of the PCR amplification mixture on the gel along with appropriate DNA size markers 10 Using a medium to long wave length UV light gt 300 nm to visualize the DNA cut out the band corresponding to the fused full length cDNA Note Be careful to minimize exposure of your DNA to UV 11 Purify the DNA fragment Purify the band of interest using your preferred method of DNA recovery from agarose gels In our experience silica bead based methods work well for PCR products up to about 2 5 kb With longer fragments we have obtained the best results using electroelution or DNA purification cartridges If you choose ano
30. cts For example when we cloned and sequenced the single RACE product observed with actin primers in Figure 2 we found that this single band actually contained cDNAs from three different actin genes Characterization is essential at this point if you have multiple RACE products or suspect that you are working with a member of a multigene family Clontech Laboratories Inc www clontech com Protocol No PT1156 1 8 Version No PR15736 Marathon Ready cDNA User Manual Introduction amp Protocol Overview continued Figure 3 Examples of large full length cDNAs generated by end to end PCR of Marathon Ready cDNAs Full length cDNAs were generated using Advantage Poly merase Mix and 5 and 3 GSPs obtained by seguencing of 5 and 3 Marathon RACE products The template for Lanes 1 amp 2 was Human Skeletal Muscle Marathon Ready cDNA Cat No 639313 the template for Lane 3 was Human Placenta Marathon Ready cDNA Cat No 639311 Lane 1 Full length ILGFR1 cDNA 5 0 kb 32 cycles 7 min extension Lane 2 Full length ILGFR2 8 9 kb 28 cycles 10 min extension Lane 3 Full length cDNA 5 0 kb 25 cycles 7 min extension M 1 kb DNA ladder Options for Generating Full Length cDNA After RACE products have been characterized by partial or complete sequencing the full length CDNA can be generated by one of two methods 1 Generation of Full Length cDNA by PCR Section VIII A standard LD
31. ed for characterizing RNAs identified as expressed seguence tags ESTs Sikela amp Auffrav 1993 or by methods such as differential display Liang amp Pardee 1992 or RNAfingerprinting Welsh etal 1992 Welsh etal 1994 In particular Marathon cDNA amplification is an excellent tool for cloning full length CDNAs corresponding to differentially expressed mRNAs identified with the Clontech PCR Select M cDNA Subtraction Kit Cat No 637401 or the Delta Differential Display Kit Cat No 937405 Marathon Ready cDNAs can also be used to obtain full length clones of partial cDNAs obtained through library screening Clontech Laboratories Inc www clontech com Protocol No PT1156 1 4 Version No PR15736 Marathon Ready cDNA User Manual Introduction amp Protocol Overview continued Poly A RNA First amp second strand cDNA synthesis Y Done ds cDNA at CLONTECH Adaptor ligation Marathon Ready cDNA 5 RACE 5 fragment 3 RACE fragment Clone amp seguence RACE fragments to obtain 5 amp 3 seguence Cloned RACE fragments End to end PCR Conventional cloning gt Full length ds cDNA Figure 1 Overview of Marathon procedure A more detailed flow chart of the Marathon procedure can be found in Appendix A The cloned 5 amp 3 RACE fragments can be subcloned using a restric tion site in the overlapping regi
32. es Inc Version No PR15736 29 Marathon Ready cDNA User Manual X Troubleshooting RACE Reactions continued High fidelity PCR If you are going to sequence or clone your RACE products for further analysis we recommend performing your RACE reactions using the Advantage HF 2 PCR Kit The Advantage HF 2 PCR Kit is designed to yield products of less than 3 5 kb with exceptionally high fidelity Based on sequence data derived from PCR products amplified for 25 cycles the Advantage HF 2 PCR Kit provides an accuracy rate that is more than 25X higher than Taq polymerase January 1999 Clontechniques This kit may not be ideal for cDNA templates that are greater than 3 5 kb but it is especially well suited for applications in which the RACE product will be sequenced or cloned for use in additional experiments Again the initial RACE reactions should be performed using the Advantage 2 Polymerase Mix to confirm the product is present and that the GSPs work well Troubleshooting touchdown PCR When troubleshooting touchdown PCR we recommend that you begin by modifying the final third set of cycle parameters i e the 20 25 cycles performed at 68 C in Program 1 If you do not observe an amplified product after 20 cycles at 68 C run five additional cycles If the product still does not appear add an additional 3 5 cycles at 68 C or try amplifying preforming a new PCR experiment with 25 cycles of 65 C 30 sec 68 C 4 min The last pro
33. gle set of GSPs Protocol No PT1156 1 www clontech com Clontech Laboratories Inc Version No PR15736 39 Marathon Ready cDNA User Manual Appendix B Marathon cDNA Adaptor amp Primers continued e On rare occasions 3 end of the adaptor ligated ds cDNA is extended creating a template with the full adaptor seguence on both ends Melt at 95YC Anneal at 68YC API Suppression PCR No primer binding panhandle structure suppresses PCR DNA synthesis V Even when the adaptor is extended very little full length amplification occurs Figure 7 The suppression PCR effect In rare cases the 3 end of the Marathon Adaptor gets extended Though rare such extension does occur presumably due to incomplete amine modification during oligonucleotide synthesis or incomplete adaptor ligation This creates a molecule that has the full length adaptor sequence on both ends and can serve as a template for end to end amplification Without suppression PCR these rare events would lead to unacceptable backgrounds in RACE reactions due to the exponential nature of PCR amplification However in suppression PCR the adaptor primer is much shorter than the adaptor itself Thus during subsequent thermal cycling nearly all the DNA strands will form the panhandle structure shown above which cannot be extended At the appropria
34. gram is especially useful if you suspect that your GSP has a close to or less than 70 C Adapting the Marathon protocol for thermal cyclers other than the Applied Biosystems DNA Thermal Cycler 480 or GeneAmp Systems 2400 9600 As noted elsewhere in this manual cycling parameters in this protocol must be optimized if you are using a thermal cycler other than the Applied Biosystems DNA Thermal Cycler 480 or GeneAmp Systems 2400 9600 If you have access to one of these thermal cycler we strongly recommend that you use it No bands are observed in your positive control GSP1 GSP2 The control PCR reaction using your sense and antisense GSPs and your Marathon Ready cDNA to amplify the internal fragment of your gene is very important If this reaction fails to produce the expected internal cDNA fragment there are at least four possible explanations There may be a problem with your 50X polymerase mix If you are not using Advantage 2 Polymerase Mix consider switching The Marathon protocol was optimized with Advantage 2 Polymerase Mix Your gene may be expressed weakly or not at all in your Marathon Ready cDNA may be necessary to try another Marathon Ready cDNA or make your own from the optimal tissue source using the Marathon cDNA Amplification Kit Cat No 634913 Clontech Laboratories Inc www clontech com Protocol No PT1156 1 30 Version No PR15736 Marathon Ready cDNA User Manual X Troubleshooting RACE Reactio
35. ified by Marathon RACE 10 Table Setting up 5 RACE reactions 18 Table Setting up 3 RACE reactions 19 Table IV Setting up PCR to amplify full length cDNA 26 Protocol No PT1156 1 www clontech com Clontech Laboratories Inc Version No PR15736 3 Marathon Ready cDNA User Manual I Introduction amp Protocol Overview Marathon Ready cDNAs are premade libraries of adaptor ligated ds cDNA ready for use as templates in Marathon cDNA amplification a method for performing both 5 and 3 RACE from the same template Chenchik et al 1995 1996 Figure 1 Marathon technology has been cited in more than 140 research articles For a complete list of citations please visit www clontech com The method is made possible by Clontech s patented suppression PCR technology Siebert et al 1995 and other innovations in the design of the Marathon Adaptor see Appendix B When compared to conventional kits used for 5 RACE Marathon RACE reactions are more efficient and reproducible with considerably less smearing and fewer false bands Because the protocol uses enzyme mixes designed for long distance PCR LD PCR Barnes 1994 Cheng et al 1994 Marathon RACE reactions are capable of amplifying much larger templates than can be amplified with conventional RACE methods Furthermore given the lower rate of misincorporation observed with LD PCR Marathon RACE products should have higher fidelity to the sequence of the original RNA
36. ion is performed with the outer primers and if a smear appears then an aliquot of the primary PCR product is reamplified using the inner primers The Marathon protocols include optional steps indicating where nested primers can be used The nested AP2 Primer provided with the kit can be used for both 5 and 3 RACE Nested primers should be designed according to the guidelines discussed above If possible nested primers should not overlap like AP1 and AP2 if they must overlap due to limited sequence information the 3 end of the inner primer should have as much unique sequence as possible Be sure that nested primers do not contain sequences that can hybridize to the outer gene specific primer particularly at their 3 ends Protocol No PT1156 1 www clontech com Clontech Laboratories Inc Version No PR15736 Marathon Ready cDNA User Manual V Primer Design continued E Controls to Test Gene Specific Primers GSPs When performing the RACE reactions we recommend that you perform the following controls to test your GSPs 1 Negative control with single primers Include a negative control containing only the appropriate GSP antisense primer for 5 RACE sense primer for 3 RACE and the adaptor ligated ds cDNA The GSPs should not give any bands in the absence of the AP1 Primer If significant amounts of product are seen with this control it may be necessary to alter the cycling parameters use nested primers or redesig
37. iple 5 products Use of different polyadenylation sites causes multiple 3 products Alternatively the gene may be a member of a multigene family in which case your gene specific primers may simultaneously amplify several highly homologous cDNAs Distinguishing true polymorphic forms of an RNA is a matter for scientific investigation Different RNA forms of the same gene may be most abundant in different Marathon Ready cDNAs Sources of artifacts Multiple bands often do not correspond to actual and complete transcripts These artifact RACE products can be divided into two classes incomplete and nonspecific There are several possible sources of incomplete fragments which are generated from correctly primed sites Premature termination offirst strand cDNA synthesis caused by pausing of RT generally causes multiple 5 RACE products This is a common problem with larger RNAs and it is a difficult problem to overcome since it is due to an intrinsic limitation of RT e Difficulty in amplifying certain difficult genes can cause multiple products in either 5 or 3 RACE often a result of high GC content Nonspecific RACE producis arise from nonspecific binding of the primer to multiple sites in the ds cDNA or primer dimer artifacts Suggestions f you have not already done so repeat your RACE reactions with all of the recommended controls In particular be sure that your GSPs do not give
38. khamedova Vlasik T Siebert P and Chenchik 1994 TagStart Antibody Hot start PCR facilitated by a neutralizing monoclonal antibody directed against Taq DNA polymerase BioTechniques 16 1134 1137 Liang P and Pardee A 1992 Differential display of eukaryotic messenger RNA by means of the polymerase chain reaction Science 257 967 970 Nelson K Brannan J and Kretz K 1995 The fidelity of TagPlus DNA polymerase in PCR Strategies Mol Biol 8 24 25 Roux K H 1995 Optimization and troubleshooting in PCR PCR Methods Applic 4 5185 5194 Sambrook J and Russell D W 2001 Molecular Cloning A Laboratory Manual Cold Spring Harbor Laboratory Press Cold Spring Harbor NY Siebert P D Chenchik A Kellogg D E Lukyanov K A and Lukyanov S A 1995 An improved method for walking in uncloned genomic DNA Nucleic Acids Res 23 6 1087 1088 Sikela J M and Auffray C 1993 Finding new genes faster than ever Nature Genet 3 189 191 Welsh J and McClelland A 1994 In Polymerase Chain Reaction Ed Mullis K B etal Birkhauser 295 303 Welsh J Chada Dala S Cheng R Ralph D and McClelland 1992 Arbitrarily primed PCR fingerprinting of RNA Nucleic Acids Res 20 4965 4970 Protocol No PT1156 1 www clontech com Clontech Laboratories Inc Version No PR15736 35 Marathon Ready cDNA User Manual XIII Related Products For the latest and
39. most complete listing of all Clontech products please visit www clontech com Cat No Marathon cDNA Amplification Kit 634913 e Advantage 2 PCR Kit 639206 639207 Advantage 2 Polymerase Mix 639201 639202 e Advantage GC 2 PCR Kit 639119 639120 Advantage GC 2 Polymerase Mix 639114 e Advantage HF 2 PCR Kit 639123 639124 e GUICK Clone M cDNAs many TagStart Antibody 639250 639251 Atlas cDNA Expression Arrays many e SMART cDNA Library Construction Kit 634901 e SMART PCR cDNA Synthesis Kit 634902 SMART RACE cDNA Amplification Kit 634914 Clontech PCR Select cDNA Subtraction Kit 637401 e Multiple Tissue cDNA MTC Panels many Delta Differential Display Kit 637405 GenomeWalker Kits many Total RNA Panels many Poly RNAs many Genomic and cDNA Libraries many e Multiple Tissue Northern MTN Blots many Clontech Laboratories Inc www clontech com Protocol No PT1156 1 36 Version No PR15736 Marathon Ready cDNA User Manual Detailed Flow Chart of Marathon Procedure Appendix A 81949 Hd 151 EINN S7 ays LdV 95 1 1 01 NN ejis xt YNNE se 10 papua xa aq JOUUB9 pues LdV 20 ais ON NN 459 1459 ix dv
40. n does not always proceed all the way to the 5 end of the mRNA template especially for long templates Furthermore the action of T4 DNA polymerase removes 0 20 bases from the 5 end Once you have identified the clones containing the largest gene specificinserts obtain as much seguence data as you can Ideallv you will be able to seguence the entire open reading frame as well as 5 and 3 untranslated regions After RACE products have been characterized by partial or complete seguencing you have two options for generating the full length cDNA 1 Generation of Full Length cDNA by Section VIII 2 Generation of Full Length cDNA by Cloning Section IX Clontech Laboratories Inc www clontech com Protocol No PT1156 1 24 Version No PR15736 Marathon Ready cDNA User Manual VIII Generation of Full Length by We have used this method successfully with several transcripts in the 5 10 kb range and with several other smaller transcripts We have had success with both abundant and relatively rare mRNAs Please note that amplification of large cDNAs requires significantly longer extension times as described in Step 6 however ifthe extension time is too long some smearing may be observed Careful primer design is critical All Marathon PCR reactions have been optimized with Clontech s Advantage 2 Polymerase Mix which includes TaqStart Antibody for automatic hot start PCR If you choose not to use the Ad
41. n your original primer 2 Positive control with both GSPs only possible if using primers that produce overlapping 5 and 3 fragments To confirm that your gene is expressed in the Marathon Ready cDNA that you have chosen and that your GSPs work as intended set up a positive control containing both GSPs This should produce a band corresponding to the combined length of your GSPs and the overlap between the primers i e the region of overlap between the 5 and 3 RACE products If this band is missing then 1 your gene may not be expressed in the tissue from which the Marathon Ready cDNA was prepared 2 you made to optimize the cycling parameters for your GSPs or you may to design new Clontech Laboratories Inc www clontech com Protocol No PT1156 1 16 Version No PR15736 Marathon Ready cDNA User Manual VI Rapid Amplification of CDNA Ends RACE The procedure below describes how to set up the RACE PCR reactions We recommend that you also perform a positive control 5 using the positive control primer and AP 1 Although the Nested Adaptor Primer AP2 is provided nested PCR is generally not necessary in Marathon RACE reactions All Marathon RACE reactions have been optimized with Clontech s Advantage 2 Polymerase Mix which includes TaqStart Antibody for automatic hot start PCR If you choose not to use Advantage 2 Polymerase Mix you must use your polymerase mix with some form of hot start PCR i e
42. ns continued There is a problem with your primers This could be due either to poor primer design or poor primer preparation First try lowering your annealing extension temperature If this does not work you may need to design new primers or repurify your GSPs to remove impurities The AMV RT cannot effectively copy the full length CDNA due to strong secondary structure and or high GC content This is indicated if the 3 RACE works but the 5 RACE does not and the positive control GSP1 GSP2 does not produce the expected fragment You may be able to obtain more information by amplifying the internal fragment using GSP1 and GSP2 using genomic DNA as the template If this produces the expected band this indicates that your primers are usable and the problem is either a the target RNA is a poor template for AMV RT or b the RNA is not expressed in the tissue source you have chosen Note however that this is not a conclusive test since your primers may be separated by an intron in the genomic DNA If this is the case amplification of genomic DNA will give a larger fragment than expected or no fragment at all bands are observed with the experimental cDNA sample but the G3PDH positive control gives the expected product 1 Increase the cycle number 2 Lower the annealing temperature by increments of 2 5 C 3 Generate different GSPs 4 Try another Marathon Ready cDNA or make your own from the optimal tissue so
43. ntech Laboratories Inc www clontech com Protocol No PT1156 1 2 Version No PR15736 Marathon Ready cDNA User Manual VII Characterization of RACE Products continued Repeat the RACE reactions and examine the products on an agarose EtBr gel Photograph the gel then transfer the DNA to a nylon membrane using standard blotting procedures Prepare a hybridization probe that does not have sequences in common with GSP1 or 2 The probe can be end labeled NGSP1 or 2 Alternatively if your GSPs define overlapping 5 and 3 fragments GSP2 can be used as a probe to characterize your 5 RACE products and GSPI can be used as a probe to characterize your 3 RACE products Nick translated or random primed internal restriction fragments from a previously cloned partial cDNA can also be used Hybridize the probe to the Southern blot wash under moderate to high stringency conditions and expose x ray film Compare the hybridization pattern to the photograph of the agarose EtBr gel Generally you will want to isolate the RACE product s that correspond s to the largest band s on the Southern blot As seen in Figure 5 there may be larger RACE products that appear on the agarose gel but do not hybridize to the gene specific probe These bands are generally due to nonspecific priming Smaller bands that hybridize to your probe may be result of incomplete reverse transcription however you cannot exclude the possibilit
44. olecular Cloning A Laboratory Manual by Sambrook and Russell 2001 Clontech Laboratories Inc www clontech com Protocol No PT1156 1 12 Version No PR15736 Marathon Ready cDNA User Manual V Primer Design A Primer Sequence Gene Specific Primers GSPs should be 23 28nt 50 70 GC Tin 65 C best results are obtained if T 70 C enables the use of touchdown PCR The relationship of the primers used in the Marathon RACE reactions to the template and resulting RACE products is shown in detail in Figure 4 For the complete Marathon protocol you will need at least two GSPs an antisense primer for the 5 RACE PCR and a sense primer for the 3 RACE PCR If you are doing only 5 or 3 RACE you will only need one GSP All primers should be 23 28 nt long there is generally no advantage to using primers longer than 30 nt The primers shown in Figure 4 will create overlapping 5 and 3 RACE products which if a suitable restriction site is located in the region of overlap can subseguently be joined by restriction digestion and ligation to create the full length cDNA Using primers designed to give overlapping RACE products also means that these primers can be used together to generate the overlapping fragment if the overlap is at least 100 200 bp This provides a useful control for PCR However it is not absolutely necessary to use primers that give overlapping fragments In the case of large and or rare
45. on and a site in the cloning vector to obtain both parts of the complete cDNA to obtain a full length cDNA Or you can sequence the 5 end of the 5 product and the 3 end of the 3 product to obtain additional sequence information This additional sequence information can be used to design 5 and 3 gene specific primers to use in LD PCR with the Marathon Ready cDNA to obtain the full length cDNA Marathon Ready cDNAs also have several nonRACE applications For example you can use them to obtain full length copies of published cDNAs simply design flanking 5 and 3 GSPs from the published sequence and amplify the cDNA directly from an appropriate Marathon Ready cDNA Once you make the necessary primers you will have the cDNA you need in just a day and be ready for your next experiment Marathon Ready cDNAs can also be used instead of poly A RNAs and cDNA synthesis in many RT PCR experiments including characterization of tissue specific patterns of gene expression and characterization of polymorphic mRNAs and multigene families Chenchik amp Siebert 1996 Protocol No PT1156 1 www clontech com Clontech Laboratories Inc Version No PR15736 5 Marathon Ready cDNA User Manual Introduction amp Protocol Overview continued Human Mouse Heart Heart Heart Actin TFR 5 9 5 2 5 3 5 3 kb 12 34 5 6 kb M 12 3 4 Figure 2 Typical Marathon 5 amp 3 RACE results Panel A Results using the
46. re conti Appendix A sjuauiDeJj pauo o ay 5895 10 seouenbas au ui sais uon2ujsaJ Duisn 10 29 OJU 8101 4 quasaid aq jou Jo seouenbes sp nDuoj jnJ oe I INN ON mt CINNE Ud ienuauodxy NN peuisep eu pue 9 RJOSI e dej18A0 uoiBaJ y ui Ajanbiun sino zey eui Azue 0119111894 YUM sjueuiDeJj JIVH pue G peuo 2 ayy 1seBig 019 H19N31 T103 31V83N39 020104d 2 UOUJEJEJN JO Heya 9 10198A uiuo o H9d edAi y 81001 A seouenbes ou VNQ sp uiBuej nj VNQ sp pe1eBij 101depe 98 NN 6 DENN l g 459 6 XIN 5 04 pue 5459 28 6 YNG sp payebi sojdepe ym 5459 2 pue GUDISag e sJoNpOJd JIVH pue G au Jo spue ejsip ay e9uanbos 5459 ANY S 5 H9d QN3 01 QN3 A8 H19N31 T10d 31VH3N39 S19naoud 3IVU 371 312 dejJ9A0 Jo uolbay 19ndOHd 32VH 2 oe 1 AN 0N r NM ldY 459 Jo uoiBay N 19n00ud JIVU 5 i A Protocol No
47. rge 5 8 kb smear product with higher cycle numbers RACE products can generally still be seen in the presence of these bands If this control produces a smear or ladder of extra bands you may need to alter the cycling parameters or perform a secondary amplification using the AP2 Primer Tube No 5 A negative control using each GSP by itself This control should produce no product If this control produces a smear or ladder of extra bands you may need to alter the cycling parameters perform a secondary amplification using nested primers or redesign your original primer A General Considerations Troubleshooting GC rich templates If your PCR productis notthe expected size especially your 5 RACE product it may be due to difficulty amplifying a GC rich template Clontech offers the Advantage GC 2 Polymerase Mix and PCR Kit for efficient amplification of GC rich templates However when using this polymerase mix or kit the master mix recipes will need to be modified to include GC Melt M and for the 5X Reaction Buffer instead of a 10 buffer supplied with most polymerases Additionally the PCR parameters may need to be optimized for these templates We recommend that you perform the initial RACE reactions with Advantage 2 Polymerase Mix then perform the RACE reactions using the Advantage GC 2 Polymerase Mix to confirm the product is the same size in both reactions Protocol No PT1156 1 www clontech com Clontech Laboratori
48. rsion No PR15736 Marathon Ready cDNA User Manual XII References continued A new tool for cloning 5 ends of mRNAs and for constructing cDNA libraries by in vitro amplification Nucleic Acids Res 19 5227 5232 Farrell Jr E 1993 RNA Methodologies ALab Guide for Isolation and Characterization Academic Press San Diego CA Freier S M Kierzek R Jaeger J A Sugimoto N Caruthers M H Neilson T and Tumer D H 1986 Improved free energy parameters for predictions of RNA duplex stability Proc Natl Acad Sci USA 83 9373 9377 Frey B and Suppmann B 1995 Demonstration of the Expand PCR system s greater fidelity and higher yields with a lacl based PCR fidelity assay Biochemica 2 8 9 Frohman M A 1993 Rapid amplification of complementary DNA ends for generation of full length complementary cDNAs Thermal RACE Methods Enzymol 218 340 358 Frohman M A Dush M K and Martin G R 1988 Rapid production of full length cDNA from rare transcripts Amplification using a single gene specific oligonucleotide primer Proc Natl Acad Sci USA 85 8998 9002 Gubler U and Hoffman B J 1983 Asimple and very efficient method for generating complimentary DNA libraries Gene 25 263 269 Harvey R J and Darlison M G 1991 Random primed cDNA synthesis facilitates the isolation of multiple 5 CDNA ends by RACE Nucleic Acids Res 19 4002 Kellogg D E Rybalkin Chen S Mu
49. s should be performed with a 50X polymerase mix containing a combination of DNA polymerases suitable for long distance PCR We recommend Clontech s Advantage 2 Polymerase Mix Cat Nos 639201 639202 which was specifically developed for LD Protocol No PT1156 1 www clontech com Clontech Laboratories Inc Version No PR15736 7 Marathon Ready cDNA User Manual Introduction amp Protocol Overview continued PCR using cDNA templates and is the polymerase mix used to optimize the protocols in this User Manual This 50X mix contains TITANIUM Tag DNA Polymerase a nuclease deficient N terminal deletion of Tag DNApolymerase plus TaqStart Antibody to provide automatic hot start PCR Kellogg et al 1994 and a minor amount of a proofreading polymerase The Advantage 2 Polymerase Mix is also available in the Advantage 2 PCR Kit Cat Nos 639206 639207 We recommend that you first perform Marathon RACE reactions using a LD PCR polymerase mix as stated above If your cDNA of interest has high GC content you can use the Advantage GC 2 Polymerase Mix Cat No 639114 or PCR Kit Cat Nos 639119 639120 for subsequent analysis For applications in which the highest fidelity product 3 5 kb is desired use the Advantage HF 2 PCR Kit Cat Nos 639123 639124 For more information see Section X Troubleshooting RACE Reactions Performing 5 and 3 RACE from the same template is made possible by the design of the Marathon
50. specific primers and thermal cyclers For example the efficiency of RACE PCR depends on the abundance of the mRNA of interest in the poly A RNA sample and different primers will have different optimal annealing extension temperatures You must use some form of hot start in the 5 RACE and 3 RACE The following protocols have been optimized using TaqStart Antibody Kellogg etal 1994 inthe 50X polymerase mix Hotstartcan also be performed manually D Aguila et al 1991 or using wax beads Chou et al 1992 We recommend the Tricine EDTA buffer for resuspending and diluting your DNA samples throughout this protocol Tricine buffers maintain their pH at high temperature better than Tris based buffers Tris based buffers can lead to low pH conditions that can degrade DNA When resuspending pellets or mixing reactions gently pipet the solution up and down or tap the bottom of the tube and then spin briefly to bring all contents to the bottom of the tube Perform all reactions on ice unless otherwise indicated Add enzymes to reaction mixtures last Make sure that the enzyme is thoroughly mixed with the reaction mixture by gently pipetting the mixture up and down Use the recommended amounts of enzyme These amounts have been carefully optimized for the Marathon amplification protocol and reagents Ethidium bromide is a carcinogen Use appropriate precautions in handling and disposing of this reagent For more information see M
51. te annealing extension temperature this intramolecular annealing event is strongly favored over and more stable than the intermolecular annealing of the much shorter adaptor primer to the adaptor Clontech Laboratories Inc www clontech com Protocol No PT1156 1 40 Version No PR15736 Marathon Ready cDNA User Manual Appendix B Marathon cDNA Adaptor amp Primers continued Marathon cDNA Adaptor T7 Promoter 5 OO UAD 3 DD 3 H N CCCGTCCA PO y L J Adaptor Primer 1 27 mer Nested Adaptor Primer 2 AP2 23 mer 5 CCATCCTAATACGACTCACTATAGGGC 3 5 ACTCACTATAGGGCTCGAGCGGC 3 EcoR 1 Marathon cDNA Synthesis Primer 52 5 TTCTAGAATTCAG CGGCCGC T gN N 3 F N j G A orC N G A or T Degenerate nucleotides anchor primer at base of poly A tail 5 RACE G3PDH Primer 24 mer 5 GGTCTTACTCCTTGGAGGCCATGT 3 3 RACE G3PDH Primer 25 mer 5 GACCCCTTCATTGACCTCAACTACA 3 Figure 8 Sequences of the Marathon cDNA Adaptor amp Primers The Tm s of AP1 and AP2 are 719C and 77 C as determined by nearest neighbor analysis Freier et al 1986 Note however that only 22 of the 27 nt in AP1 bind the Adaptor during the first cycle of PCR so the effective Tm of AP1 may be actually several degrees lower The lower effective Tm of AP1 is the reason touchdown PCR works well with Marathon RACE reactions Protocol No PT1156 1 www clontech
52. ther method of DNA purification resuspend your DNA in 30 ul of Tricine EDTA Buffer 12 Clone the full sized cDNA into a T A type PCR cloning vector In our experience large cDNAs can be damaged during purification by exposure to UV in the presence of EtBr If your full length cDNA is longer than 3 kb we suggest that you test the quality of the purified primary PCR product by repeating the reaction in Steps 4 6 using 5 ul of a 1 50 dilution of your PCR product as a template If the DNA is damaged reamplification will not give a single strong band If you cannot amplify a full length cDNA that can be readily reamplified we recommend that you clone the PCR product directly i e without gel purification and screen by hybridization with a gene specific probe for colonies that contain full length gene specific inserts To be certain of obtaining the correct product we recommend that you always pick several transformants and confirm the insertion of the full length cDNA of interest Again this is especially important with cDNAs larger than about 3 kb Protocol No PT1156 1 www clontech com Clontech Laboratories Inc Version No PR15736 21 Marathon Ready cDNA User Manual IX Generation of Full Length cDNA by Cloning Ifyou have cloned overlapping 5 and 3 RACE products andifthere is a restriction site in the overlapping portion of the cDNA sequence it is fairly easy to generate the full length cDNA by standard cloning techniq
53. ucleic Acids Res 17 2919 2932 Borson N D Sato W L and Drewes L R 1992 A lock docking oligo dT primer for 5 and 3 RACE PCR PCR Methods Applic 2 144 148 Chenchik A Moqadam F and Siebert P 1996 A new method for full length cDNA cloning by PCR In A Laboratory Guide to RNA Isolation Analysis and Synthesis Ed Krieg P A Wiley Liss Inc pp 273 321 Chenchik A and Siebert P April 1996 Studying tissue specific gene expression with Marathon Ready cDNAs Clontechniques XI 2 22 Cheng S Fockler C Barnes W M and Higuchi R 1994 Effective amplification of long targets from cloned inserts and human genomic DNA Proc Natl Acad Sci USA 91 5695 5699 Chou Q Russell M Birch D Raymond J and Bloch W 1992 Prevention of pre PCR mispriming and primer dimerization improves low copy number amplifications Nucleic Acids Res 20 1717 1723 D Aquila R T Bechtel L J Videler J A Eron J J Gorczyca P and Kaplan J C 1991 Maximizing sensitivity and specificity by preamplification heating Nucleic Acids Res 19 3749 Don R H Cox P T Wainwright B J Baker K and Mattick J S 1991 Touchdown PCR to circumvent spurious priming during gene amplification Nucleic Acids Res 19 4008 Dumas J B Edwards M Delort J and Mallet J 1991 Oligodoxynucleotide ligation to ss cDNAs Clontech Laboratories Inc www clontech com Protocol No PT1156 1 34 Ve
54. ues Note that restriction sites introduced with your GSP are not suitable for this purpose since using such a site to fuse your 5 and 3 fragments would in most cases introduce foreign sequence into the middle of your cDNA For the same reason do not fuse your 5 and 3 cDNA fragments using restriction sites in polylinkers adjacent to your cloned RACE products Simply digest each fragment with the enzyme and join them using T4 DNA ligase Clone the resulting full length cDNA into the vector of your choice using the restriction sites introduced by the Marathon Adaptor which is on both ends of full length cDNAs created in this manner and the Marathon cDNA synthesis primer on the 5 end The Marathon Adaptor contains sites for Not I and Xma I sticky ends and Srf I blunt ends while the cDNA Synthesis Primer contains Not and EcoR I sites See Appendix B This facilitates easy directional cloning of the Srf I Not I Srf I EcoR I Xma I Not I or Xma I EcoR I fragments or non directional cloning of Not I or Srf I Srf fragments into suitable vectors Srf and Not I are extremely rare in mammalian genomes occurring approximately once in 106 and hence are unlikely to be present most cDNAs Alternatively if you are working directly with the products of your 5 and 3 RACE reactions you can clone the full sized cDNA directly into any T A type PCR cloning vector Clontech Laboratories Inc www clontech com Protocol No PT
55. urce using the Marathon cDNA Amplification Kit Cat No 634913 D cDNA product consists of multiple bands In many cases your initial experiments will produce multiple 5 and or 3 RACE products As mentioned above you will have to determine which are real and which are artifacts While the following guidelines will help you eliminate artifacts confirmation of real and complete bands will reguire additional studies such as mapping of transcription start sites intron exon structure and polyadenylation sites and genomic seguencing Multiple fragments do not mean you cannot proceed with generating the full length cDNA however you may save time in the long run if you try to eliminate nonspecific fragments by troubleshooting the reactions If multiple fragments persist and you want to proceed you generally will want to start with the largest fragment from each RACE reaction since it is most likely to be a true complete RACE product Protocol No PT1156 1 www clontech com Clontech Laboratories Inc Version No PR15736 31 Marathon Ready cDNA User Manual X Troubleshooting RACE Reactions continued Sources of real multiple RACE products Individual genes can give rise to multiple sizes of transcripts and hence to multiple RACE fragments via at least three mechanisms Alternative splicing can cause multiple products in either 5 or 3 RACE Use of different transcription initiation sites causes mult
56. ussion in Section V Primer Design a Dilute 5 ul of the primary product into 245 ul of Tricine EDTA buffer b Repeat steps 1 5 above using 5 ulof the diluted primary product in place of the Marathon Ready cDNA 1 ul of the AP2 primer and 1 ul of your nested antisense GSP Fewer cycles 15 20 instead of 25 30 At Clontech we have successfully used Marathon Ready cDNAs to amplify the 5 and 3 RACE fragments of several different genes from poly RNA Typically only one major band is generated although in some cases minor bands are also visible Although a nested AP2 Primer is provided nested primers generally are not needed for successful Marathon amplification particularly if you use primers with Ta s gt 70 C and the preferred cycling programs for touchdown PCR If you do not know the complete structure of your gene you may be able to predict the size of the correctly amplified product via Northern blot analysis Certain genes will give multiple bands due to the presence of a multigene family or multiple RNAs If there are multiple products you may need to determine which are real e g the products of alternative transcription start sites alternative splicing sites or related genes and which are artifacts e g the result of pausing by RT high GC content nonspecific priming during RACE PCR etc Protocol No PT1156 1 www clontech com Clontech Laboratories Inc Version No PR15736 21
57. vantage 2 Polymerase Mix you must use some form of hot start with your polymerase mix 1 Design 5 5 and 3 GSP primers based on the seguence obtained from your 5 and 3 RACE producis These primers should be derived from the 5 and 3 ends of the cDNA as shown in Figure 4 and should be 23 28 nt long We do not recommend adding restriction sites to the ends of your primers as we have observed higher background in some cases Consult the guidelines in Section V for more information on the design of the primers In some cases it may be necessary to design nested 5 and 3 primers however we recommend you first try to amplify the full length cDNA with a single pair of primers 2 Prepare enough master mix for all PCR reactions and one extra reaction to ensure sufficient volume For each 50 PCR reaction mix the following reagents 36 ul 5 ul 10X cDNA POR Reaction Buffer 1 ul dNTP Mix 10 mM _ 1 ul Advantage 2 Polymerase Mix 50X 43 ul Final volume 3 Mix well by vortexing without introducing bubbles then briefly spin the tube in a microcentrifuge 4 Prepare reactions as shown in Table IV Add the components in the order shown in 0 5 ml PCR tubes and mix gently Protocol No PT1156 1 www clontech com Clontech Laboratories Inc Version No PR15736 25 Marathon Ready cDNA User Manual VIII Generation of Full Length cDNA by PCR continued TABLE IV SETTING UP PCR TO AMPLIFY FULL LENGTH cDNA
58. ves or in combination with the original primers in nested PCR In nested PCR the product of a PCR reaction is reamplified using a second set of primers that is internal to the original primers This often greatly reduces the background and nonspecific amplification seen with either set of primers alone The design of nested primers is discussed in Section V Prior to performing nested RACE PCR we recommend that you perform separate primary amplifications with AP1 and either the GSP or NGSP This is a good test of whether multiple bands are a result of correctly primed PCR or nonspecifically primed PCR If the multiple bands are real i e the result of correct priming they should be present in both reactions but slightly smaller in the reaction using the nested primers The difference in mobility of the products should correspond to the positions of the GSP and NGSP in the cDNA structure E RACE cDNA product is smeared Note Some Marathon reactions produce very complex patterns of bands that appear almost as smears See Figure 5 for an example Section VIII gives some guidelines for interpreting these complex patterns and isolating the band s of interest You can try optimizing your RACE reactions using the troubleshooting tips described above for multiple bands Protocol No PT1156 1 www clontech com Clontech Laboratories Inc Version No PR15736 33 Marathon Ready cDNA User Manual XI Troubleshooting Generation of Full
59. wever the action of T4 DNA polymerase may remove some nucleotides typically 1 20 from the 5 end of the CDNA Severe secondary structure may also block the action of RT and or Tag DNA polymerase in some instances In our experience Marathon RACE products and full length CDNAs compare favorably in this regard with CDNAs obtained by conventional RACE Protocol No PT1156 1 www clontech com Clontech Laboratories Inc Version No PR15736 9 Marathon Ready cDNA User Manual I Introduction amp Protocol Overview continued or from libraries To obtain the maximum possible amount of 5 sequence we recommend that you sequence the 5 ends of 5 10 separate clones of the 5 RACE product TABLE I EXAMPLES OF cDNAs AMPLIFIED BY MARATHON RACE Size of Abundanceamplified Gene Poly A RNA of mRNA cDNA kb Transferrin receptor Placental Low med 5 1 Actin Placental High 1 9 Rat lung specific protein Lung High 2 1 Inducible nitric oxide synthase Placental Low med 4 1 GCSF receptor Thymus Low med 2 9 Insulin like growth factor Thymus Low med 5 1 receptor type 1 Insulin like growth factor Thymus Low med 8 9 receptor type 2 HIV induced genes 1 amp 2 HIV infected Med 0 7 1 75 identified by differential display macrophage Interferon a Placental Low 27 G3PDH Placental High 1 5 fo microglobulin Placental High 0 6 a Human unless otherwise indicated b When conventional RACE failed to produce the 5 ends of these two genes Mar
60. when this product is used in conjunction with a thermal cycler whose use is covered by the up front fee component Rights to the up front fee component must be obtained by the end user in order to have a complete license to use this product in the PCR process where the process is covered by patents These rights under the up front fee component may be purchased from Applied Biosystems or obtained by purchasing an Authorized Thermal Cycler No right to perform or offer commercial services of any kind using PCR where the process is covered by patents including without limitation reporting the results of purchaser s activities for a fee or other commercial consideration is hereby granted by implication or estoppel Further information on purchasing licenses to practice the PCR Process where the process is covered by patents may be obtained by contacting the Director of Licensing at Applied Biosystems 850 Lincoln Centre Drive Foster City California 94404 or the Licensing Department at Roche Molecular Systems Inc 1145 Atlantic Avenue Alameda California 94501 Clontech Clontech logo and all other trademarks are the property of Clontech Laboratories Inc Clontech is Takara Bio Company 02006 Protocol No PT1156 1 www clontech com Clontech Laboratories Inc Version No PR15736 43
61. y that some of these shorter bands are real and correspond to alternatively spliced transcripts transcripts derived from multiple promoters or other members of a multigene family A B C Figure 5 Identifying the correct RACE products by Southern blotting Panel A Agarose EtBr gel showing the products of 5 Marathon RACE using a GSP derived from the ILGFR2 cDNA Lane 2 expected product 3 kb Lane 1 1 kb DNA ladder Panel B Southern blot of the gel seen in Panel A probed with a NGSP for ILGFR2 Note that the hybridization signal at the top of the blot is considerably lower than the top of the DNA smear seen in Panel A To obtain the full length CDNA a second gel was run and the portion of the gel corresponding to just below the 3 kb size marker was excised The DNAwas eluted and cloned and multiple independent clones were tested as described in the protocol to identify the largest insert derived from the ILGFR2 gene Panel C The same blot was reprobed with an internal gene specific probe derived from the 5 end of the cDNA This confirms that the band at the top of Panel B is the correct 5 RACE product Most researchers will not have the necessary probe to confirm their 5 RACE product in this manner Protocol No PT1156 1 www clontech com Version No PR15736 Clontech Laboratories Inc Marathon Ready cDNA User Manual VII Characterization of RACE Products continued 6 Once you have determined the band s of interest

user manul

Contents

Download Pdf Manuals

Related Search

Related Contents