Home

MethylMagnet™ mCpG DNA Isolation Kit

1. D IXE NARA MethylMagnet mCpG DNA Isolation Kit User Manual Version B 06 11 09 Catalog 4 MM101 K D DAE NARA Table of Contents Kit Components and Storage rrrnnnnnnnnnnrnnvnvnnvnvvnvvnnnnvnnnnnnnsnsnnsnennennennennenene 2 MethylMagnet Work Flow rrnnarnannonnnnnnnnnnvnnvnvnnvnnvnnvnnvnvnnvennnsnnsnsnnssnsnene 3 About MethylMagnet ProteinsS m rmrrsrerrrrsrrsvesvevrrverververnrsvssessene 4 MethylMagnet DNA Isolation Kit OvervieW rrrrrrnnnnnarnrrnrrnsrnsrnennennnn 5 Advantages of MethylMagnet rrwnrnnnnnnannssvnnvnvnvnnnnnnsnennannnnvnvnnvnnesnnnnnnannne 6 Preparation of Genomic DNA mmmmsensnvsvrnrnsannansnosannnnsnrnsnnnnnnnenanennsnsnrnnnsnesan 7 MetnyiMagnet Protocol sueissgacseverssocsdianeardecctinecsadestatiandvaceanuaiansestinecndls 7 CONTOLRC IONS EE NE 9 Troubleshooting GU OE eeose e 11 Kit Components and Storage GST MBD magnetic beads One 1 5 ml tube blue cap Control HeLa DNA 55 ul 20 C 110 ng Msel cut 2ng u One 0 6 ml tube green dot Positive Control Primers 10 uM each One 0 6 ml tube red dot 16 5 ul Negative Control Primers 10 uM each One 0 6 ml tube blue dot 16 5 ul User Manual Kits are shipped on blue ice All components should be stored at 20 C Do not expose beads to temperatures below 20 C Store beads gt in an insulated cooler if the freezer has a defrost cycle IMPORTANT www ribomed com MethylMagnet mCpG DNA Isola
2. Thrombin digestion can release DNA containing the bound MBD domain While Bovine Thrombin does not interfere with PCR the samples should be treated to inactivate potential contaminating nuclease activities High salt elution High salt 1 2M can be used to elute bound DNA Following elution with high salt a cleanup step is required as the high salt may interfere with downstream applications Downstream Analysis Once the methylated DNA fraction has been eluted analysis can be carried out using several methods For PCR or qPCR follow the manufacturer s recommendations for amplification and detection We recommend using hot start PCR Control Reactions Overview A PCR primer pair is included for use as a positive control to confirm that the kit can discriminate between methylated and unmethylated DNAs The primer set is specific for the imprinted gene SNRPN Amplification of MethylMagnet processed samples with this primer pair will produce a 230 bp amplicon in both the supernatant fraction of the binding reaction the unbound unmethylated copy and the DNA fraction eluted from the GST MBD beads the methylated copy Figure 5A shows the results of control amplifications with this primer set for 20 ng of HeLa DNA processed with the MethylMagnet mCpG DNA Isolation Kit and eluted in 50 ul of glutathione buffer A second primer pair for the CDKN2A p16 CpG island is included as a negative control for use with HeLa DNA Amplification of
3. MBD fusion protein and glutathione magnetic beads for capture of methylated dsDNA It can be used to isolate mCpG DNA from 1 ng to 1 ug of genomic DNA per sample or it can be scaled up to isolate much larger quantities The MethylMagnet kit can capture DNA containing 6 or more methylated CpG sites DNA eluted with glutathione is ready for downstream applications without further processing How it Works Step 1 DNA Isolation and Fragmentation DNA isolation from cells or tissues may be done using a kit of choice Unlike some other methods MethylMagnet binds methylated double stranded DNA so it is not necessary to denature the DNA once it is isolated It is imperative that the DNA be fragmented so that the region of interest is physically separated from other regions of DNA that may be methylated Failure to adequately separate CpG islands could lead to co purification of unmethylated islands with neighboring methylated regions Fragmentation by restriction enzyme digestion is recommended CG Restriction Site i sil ind GC v CG ene GC An incomplete restriction digest can lead to isolation of unmethylated islands by association with adjacent methylated regions The island detection assays that utilize abscription for detection using the MethylMeter kits have been designed to work with DNA that has been cut with the restriction endonuclease Mse I Mse cuts at the sequence TTAA and therefore is not affected by C
4. be chemically modified to add other reporters or affinity tags such as biotin fluorescein or other functional groups MethylMagnet has high affinity for fully methylated CpG sites MethylMagnet proteins have high affinity and pe specificity for binding to Biotin m m m m m DNA containing 5 Methyl a ow aoe CpG groups They have Biotin Figure 2 Streptavidin magnetic beads anti GST HRP gt p much higher affinity for gt DNA methylated on both SA Biotin J strands versus hemi KE de methylated not shown Methylated Unmethylated No DNA or unmethylated DNA Figure 2 Purified MethylMagnet protein Cat MM101 was incubated with a 550 bp p16 amplicon that was either fully methylated or unmethylated or with no DNA Figure 2A The biotinylated DNA target was immobilized to magnetic beads The MethylMagnet protein was incubated with the immobilized DNA for 1 hour After washing bound MethylMagnet was detected with an anti GST antibody horseradish peroxidase conjugate Figure 2B The HRP reaction was performed for 5 min The filled and unfilled bars represent duplicate measurements www ribomed com MethylMagnet mCpG DNA Isolation Kit User Manual V2 4 D TAG NIAAA MethylMagnet mCpG DNA Isolation Kit Overview The MethylMagnet mCpG DNA Isolation Kit is used to isolate methylated dsDNA from a genomic sample The MethylMagnet kit utilizes the MethylMagnet GST
5. DNA polymerase 104 Unbound supernatant fraction unmethylated or bound eluted fraction methylated Replace with 2 ul of ultrapure water for the no DNA control Phire Cycling Conditions 1 98 C 15 sec 5 Repeat steps 2 4 35 times 2 98 C 10 sec 6 72 C 1 min 3 65 7 C 10 sec 7 HOLD 4 4 72 C 10 sec A B S E1 E2 E3 S E1 S Unbound Supernatant E1 E3 Elutions 1 3 Figure 5 Amplification of fractionated fragmented HeLa DNA with the positive control primer pair MethylMagnet fractions 2 ul from an input of 20 ng of HeLa DNA were subjected to PCR with positive control primers that target the imprinted gene SNRPN A and the negative control primers that target the unmethylated p16 CpG island B S is the fraction containing the unmethylated DNA E1 E3 represent 3 serial elutions of the methylated DNA target from the beads Virtually all of the methylated DNA is recovered in the first elution www ribomed com MethylMagnet mCpG DNA Isolation Kit User Manual V2 10 D DAE NIAAA Interpretation of unexpected results for control reactions There are two situations in which unexpected results can arise when control primers are used with DNA from sources other than HeLa A single DNA sample might have an unexpected methylation pattern for the imprinted marker if that sample has altered imprinting functions For example the unmethylated copy might have become methylated to produce amplicon only in the eluted frac
6. MethylMagnet fractions should produce a 381 bp amplicon only in the supernatant fraction Figure 5B Positive Control Primer Sequences The positive control primer pair can be used as a universal internal control because the methylation pattern of the imprinted gene SNRPN is expected to be consistent over most human DNA samples The sequences of the positive control primers are shown below to allow users to order extra control primers The negative control should not be used on samples other than HeLa DNA because the methylation pattern for this marker is expected to vary among different DNA sources Positive Control SNRPN Forward Primer ACCTCCGCCTAAAATCCCTATG Reverse Primer GTATCCTGTCCGCTCGC www ribomed com MethylMagnet mCpG DNA Isolation Kit User Manual V2 9 D IXE NRS Protocol A total of 110 ng 2 ng ul of fragmented HeLa DNA is included in the kit together with primers for 5 control samples plus 1 no DNA control for each sample Control PCR reactions should be done after processing 20 ng of fragmented HeLa DNA with the MethylMagnet kit as described above and eluting in 50 ul of glutathione elution buffer PCR reactions should be done on both the supernatant fraction and the first elution fraction A protocol using Finnzyme s Phire Hot Start DNA polymerase is shown in Table 1 Table 1 Phire DNA hot start PCR volumes for a single reaction Ultrapurewater 10 0 MethylMagnet DNA fraction 2 0m ooo Phire
7. lure to release methylated DNA from the beads with glutathione buffer Incomplete washing Be sure that the region you want to amplify does not contain any restriction sites for the enzyme you are using Open a fresh tube of glutathione elution buffer or try eluting with 1X TE buffer at 80 C Be sure to follow all wash instructions so that all unmethylated DNA is removed before eluting methylated DNA Be sure to use less than or equal to 1 ug of DNA per 5 ul of beads If processing more DNA increase the volume of beads used Use methylated DNA to confirm decreased binding capacity Increase volume of beads Use only the reagents supplied with the MethylMagnet kit Reagents can be ordered at our website www ribomed com e Check kit expiration date e Ensure that the beads are thoroughly mixed during the binding reaction e Incubate the beads at 80C for 10 min in TE buffer and amplify the eluted fraction Ensure that the walls of the tubes are rinsed when applying Wash Buffer 2 Briefly spin the binding reactions at 500 rcf before washing to collect droplets from the tube walls MethylMagnet mCpG DNA Isolation Kit User Manual V2 11
8. ng to be used please refer to the manufacturer s recommendations If eluting with high salt Proteinase K or Thrombin a DNA clean up step is required before use Advantages of MethylMagnet High sensitivity without loss of specificity The MethylMagnet mCpG DNA Isolation Kits can be used with 1 ng of input DNA up to 1 ug of DNA not shown Shown below Figure 3 HeLa genomic DNA or artificially methylated HeLa DNA were purified with the MethylMagnet mCpG DNA Isolation Kit and eluted in 20 ul of glutathione Figure 3 p16 status Unmethylated Methylated ng genomic DNA 5 50 100 2 5 50 100 buffer 2 ul samples 1 10 of input were tested for p16 DNA by PCR 40 cycles and analyzed by gel electrophoresis and ethidium bromide staining 2 ng input corresponds to approximately 300 cells so methylated P16 from 200 pg of genomic DNA or 30 cells is detected here P16 was only detected with artificially methylated DNA p16 amplicon gt Shown in Figure 4 1 ng of HeLa DNA or artificially methylated HeLa DNA was purified with the MethylMagnet mCpG DNA Isolation Kit DNA was eluted in 50 ul and 2 ul samples were used for amplification of P16 This corresponds to detection from 6 cells or 40 pg of DNA and 12 copies of P16 The gel was stained with SYBR Green and imaged with a Typhoon fluorescence reader MethylMagnet mCpG DNA Isolation Kits are very specific for methylated DNA When unmethylated DNA is processed nothing is ca
9. oG methylation However MethylMagnet can be used with DNA that has been fragmented with other restriction enzymes Step 2 Capture of Methylated DNA The fragmented DNA is incubated with the MethylMagnet GST MBD protein which has already been attached to glutathione magnetic beads The DNA population will generally contain a mixture of methylated and unmethylated CpG sites Methylated CpG islands will bind to the beads via interaction of the mCpG sites and the MBD domain while unmethylated islands will remain in the supernatant fraction www ribomed com MethylMagnet mCpG DNA Isolation Kit User Manual V2 5 D DAE NARA Step 3 Elution of Methylated DNA Methylated DNA can be eluted from the glutathione beads several ways although the use of glutathione is recommended because the DNA is ready for downstream applications without further protease treatment or precipitation However several options are available A Elution of the GST MBD mCpG DNA complex with Glutathione recommended Elution of free DNA and denatured GST MBD with heat Elution of free DNA and digested GST MBD with Proteinase K Elution of the MBD mCpG DNA complex with Thrombin Elution of mCpG DNA with salt p DE Following elution with glutathione or heat the DNA is ready for downstream applications If PCR qPCR or abscription based assays are used for downstream analysis then no further clean up of the DNA is required If other methods are goi
10. ols for the study of CpG methylation in DNA These proteins contain the methyl binding domain MBD of the mouse MBD2 protein fused to the glutathione S transferase protein GST from S japonicum The two domains are separated by a linker containing a thrombin cleavage site Figure 1A The MBD from the MBD2b protein was chosen because MBD2b has the highest affinity among the known methyl CpG binding proteins for Me CpG sites and the lowest cross reactivity with unmethylated CpGs Additionally there are no sequence context effects on MBD2 CpG recognition as there are for MeCP2 which requires a run of A Ts near a CpG site therefore a greater number of mCpG sites will be recognized by MethylMagnet In addition to its high specificity for methylated DNA MethylMagnet proteins have several unique features that make them useful tools in the study of DNA methylation The GST allows the fusion protein or its complexes with methylated DNA to be isolated on glutathione agarose magnetic beads or plates and eluted intact with glutathione The GST group further allows the eluted protein DNA complexes to be immobilized to beads or microtiter plates with GST antibodies Alternatively the GST group can be used for visualization of the DNA protein complexes by using labeled GST antibodies or GST antibodies and labeled secondary antibodies or other detection methods for GST The GST group contains surface cysteine groups Figure 1B that can
11. om temperature For 1 ng to lt 20 ng input DNA use 10 ul elution buffer For 20 ng to lt 50 ng input DNA use 50 ul elution buffer For 50 ng to 1 ug input DNA use 100 ul elution buffer b Pull down the beads with the magnet and remove the supernatant fraction containing the eluted methylated DNA c Although most of the DNA will be recovered in the first elution a second elution can be performed to maximize methylated DNA recovery For DNA input above 500 ng two elutions are recommended DNA can be used in PCR without further purification Alternative methods to recover methylated DNA Although we recommend elution with glutathione other elution methods may be used Heat treatment a Suspend the beads in 50 ul 1X TE pH 8 100 ul when using gt 50 ng input DNA Incubate 10 minutes at 80 C with mixing b Pull down the beads and save the supernatant fraction containing the eluted DNA c Asecond elution can be performed to maximize methylated DNA recovery DNA can be used in PCR without further purification www ribomed com MethylMagnet mCpG DNA Isolation Kit User Manual V2 8 D IXE NARA Thrombin digestion The MethylMagnet GST MBD protein has a Thrombin cleavage site linking the GST and MBD domains This site can be cleaved with Bovine Thrombin in a buffer containing 10 mM TrisCl pH 8 150 mM NaCl Calcium chloride can be omitted from the cleavage buffer to avoid possible interference with downstream processing
12. or a few seconds Do not go above 500 rcf 2700 rpm This is a good time to thaw the elution buffer at room temperature www ribomed com MethylMagnet mCpG DNA Isolation Kit User Manual V2 7 D IXE NAAS 4 Removal of unbound unmethylated DNA fragments a Spin the samples in a microcentrifuge for a few seconds if droplets have collected on the walls of the tubes Do not go above 500 rcf The beads will settle to the bottom of the tubes but will rapidly form pellets on the sides of the tubes in response to the magnet b Place the tubes in the magnetic separation rack and remove the supernatant fraction containing the unbound unmethylated DNA c Wash the beads with 0 4 ml of Wash Buffer 2 Rinse the tube walls while initially adding the buffer and completely suspend the beads d Incubate the beads for 5 min with mixing at room temperature and 1000 rpm Perform one additional wash and incubation with Wash Buffer 2 e Wash the beads one time with 0 4 ml of TE buffer No incubation is needed for this step 5 Elution of methylated DNA with glutathione Note Elution buffer can lose potency with extended storage due to oxidation of the glutathione Buffer is provided in 5 tubes Once a tube is opened the glutathione should be used within 2 months Invert the elution buffer several times prior to use to be sure it is homogeneous a Suspend the beads in elution buffer and incubate 10 min with mixing e g Thermomixer 1000 rom ro
13. ptured and detected in the eluted bound fraction even with 40 cycles of PCR When methylated DNA is captured nothing is detected in the supernatant unbound fraction Unmethylated Methylated Figure 4 Input DNA DNA DNA S Supernatant fraction E Eluted fraction P16 Amplicon C Minus DNA www ribomed com MethylMagnet mCpG DNA Isolation Kit User Manual V2 6 D WE NARA Preparation of Fragmented Genomic DNA Isolation and purification of DNA from cells or tissues may be done using any of several commercially available kits Fragmentation of small amounts of DNA can be most easily accomplished with the use of 4 base recognition restriction endonucleases that are biased to A T rich sequences e g Msel TTAA and Tsp5091 AATT The completeness of digestion can be tested by performing PCR with a primer pair flanking the restriction site verses a primer pair that does not have an intervening site A positive control with undigested DNA should also be performed Upon completion of the restriction digestion and heat inactivation of the enzyme the DNA can be added directly to the binding buffer for capture There is no need to ethanol precipitate the DNA MethylMagnet mCpG DNA Isolation Kit Protocol Approximate time 2 hours 1 Preparation of DNA samples in Binding Buffer Mix the following for a single DNA sample 40 ul Binding Buffer 10 ul fragmented DNA For controls add 10 ul of HeLa DNA If less than 10 ul of DNA is
14. tion Alternatively the positive control might show signal only in the supernatant If these results are associated with only a single sample then they likely reflect an abnormal methylation Status of SNRPN in that sample An unexpected result that includes all of the samples in an experiment indicates a failure of the kit A systematic failure of the kit will most likely manifest itself in the positive control when the signal is all found in the supernatant fraction This could be due to a failure of the beads to bind methylated DNA or a failure of the bound DNA to be released in the presence of elution buffer Possible aberrant results and possible solutions are listed in the Troubleshooting table Table 2 Troubleshooting No PCR product in any of the fractions No PCR product from the eluted fraction Unmethylated DNA in the elution fraction Methylated DNA in the supernatant Signal appears only in the supernatant fractions of all samples High background in the eluted fraction of the negative control www ribomed com Primers flank a restriction site DNA was not eluted because the glutathione in the elution buffer has oxidized Beads not washed thoroughly Binding capacity of the beads has been exceeded Binding capacity of the beads is reduced because of improper storage or handling Binding capacity of the beads is reduced because of non optimal buffer conditions Failure of the beads to bind methylated DNA Fai
15. tion Kit User Manual V2 2 D JXE NAARHAU Please read entire manual before starting Reagents are included for 30 samples This can be 30 samples of the user s DNA or 25 samples of the user s DNA and 5 controls with HeLa DNA User supplied Materials Equipment e Microcentrifuge tubes 1 7 ml polypropylene and microcentrifuge e Filter pipette tips e Sample mixing equipment e g Eppendorf Thermomixer shaker or tube rotator e Thermocycler and PCR components for control reactions e DNAse free ultrapure water e Rare earth Magnet or magnetic rack e g RiboMed Cat MR22 01 Caution Rare earth magnets can be extremely powerful Care should be taken when handling them Keep magnetized parts away from instruments that may be damaged by high magnetic fields MethylMagnet Work Flow Isolate and Fragment Prepare Genomic DNA DNA sample Prepare GST MBD magnetic beads Resuspend beads in DNA sample Bind DNA to GST MBD magnetic beads Pull down beads and remove supernatant fraction Unmethylated DNA remains in the supernatant fraction Wash beads Elute methylated DNA Analyze Methylation Status www ribomed com MethylMagnet mCpG DNA Isolation Kit User Manual V2 3 D IZENEAN About MethylMagnet Proteins The MethylMagnet mCpG DNA isolation Figure 1 Thrombin Cleavage Site kit utilizes RiboMed s GST MBD protein A GST Domain LYPRLGSPGISGGGGGIR MBD MethylMagnet MethylMagnet proteins are versatile to
16. used add the volume difference in ultrapure DNAse free water to the Binding Buffer before adding the DNA If a DNA volume greater than 10 ul is used add 4 volumes of Binding Buffer per volume of DNA 2 Preparation of GST MBD beads a Uniformly suspend the bead stock by gently flicking the tube The viscosity of the bead suspension is great enough that protein denaturation by foaming is not a concern DO NOT VORTEX THE BEADS IMPORTANT To prevent loss of beads and protein we do not recommend pipetting to resuspend the beads when they are in storage buffer b Transfer beads to a 1 7 ml microcentrifuge tube A 5 ul bead volume is sufficient for sample sizes ranging from 1 ng to 1 ug c Resuspend the beads in 100 ul of Wash Buffer 1 Resuspend by gentle pipetting d Pull down the beads with the magnet and discard the wash buffer e Resuspend the beads in the DNA samples usually 50 ul Resuspend by gentle pipetting 3 DNA binding reaction Incubate the beads at room temperature 18 23 C for 1 hour The beads should be mixed during the incubation e g with an Eppendorf Thermomixer set at 1 000 rom A 1 7 ml microcentrifuge tube is optimal if the samples are mixed with a horizontal rotary motion Smaller tubes can be used if the samples are mixed end over end 8 rom Be aware that with end over end mixing some of the beads may get caught in the seal of the tube and the lid If this happens spin the samples in a microcentrifuge f

MethylMagnet™ mCpG DNA Isolation Kit

Contents

Download Pdf Manuals

Related Search

Related Contents

MethylMagnet&trade; mCpG DNA Isolation Kit

Contents

Download Pdf Manuals

Related Search

Related Contents

MethylMagnet™ mCpG DNA Isolation Kit