Home

TaqMan® SNP Genotyping Assays User Guide

1. 2 0 e eee ee eee 46 Gene on the X chromosome 2 ee cece eee ee eee eee eens 47 Gene on the Y chromosome 2 e eee ee eee ee eee eee eee 48 Sample preparation problems 00 200 e eee ee eee eee eee 48 Degraded DNA osc 5s ee ce hee eo de ea ee cee a ate We ee hee ae We 48 PCR inhibitors in sample 00 cece eee eee eee eee eee 51 Inaccurate DNA quantitation 000 cece eee eee 52 Assay problems g inded se eee Whe dee de NG ae ee gee emg ER ce eS 54 Reagents mishandled or expired 00 cece cece eee eee eee 54 Using a master mix without ROX AY Ce L 6iG tahoe gb Shea ae ge aed ae Dace 55 DNA or assay reagent not added to the reaction well 02 00000 55 Insufficient DNA added to the reaction well 00 e cece ee eee ee eee 55 Evaporation from the reaction well 00 0c cece eee eee eee 56 Pipetting errors jiccceeda see eae ee eke ag ce ioe pee E aaa 56 Inefficient mixing or centrifugation 0 c eee eee 57 Assay has high background fluorescence 0 0c cece eee eee eens 57 More than one sample in the well 000 cece eee eee eee 57 Instrument troubleshooting 0 0c e eee eee eee eee 58 TaqMan SNP Genotyping Assays User Guide Contents Routine instrument maintenance 20 e eee eee eee eee ees 58 Instrument calibration 0 2 eee eee eee eee 58 Types of calibration
2. If an assay performed poorly it was submitted to the assay design software for redesign Due to limitations in the technology and or the type of polymorphism an assay could not be developed for every polymorphism in the drug metabolism enzyme genes 221 genes were included in TaqMan Drug Metabolism Genotyping Assay set Genes that are not part of the TaqMan Drug Metabolism Genotyping Assay collection may be found in the Life Technologies TaqMan SNP Genotyping Assays product line The TaqMan Drug Metabolism Genotyping Assays include polymorphisms found in coding regions splice junctions or regulatory elements for the DME genes Additional intronic SNPs were included only if evidence from the public allele nomenclature web sites was identified If your SNP of interest is not available as a TaqMan Drug Metabolism Genotyping Assay it may be available as a Life Technologies TaqMan SNP Genotyping Assay This pre designed assay collection includes over four million assays Search for the gene of interest at the website http www lifetechnologies com taqmandme TaqMan DME Assays for genotyping triallelic SNPs Several important DME gene variants are triallelic SNPs wherein 3 bases occur at the same genomic location see Table 17 Triallelic SNP targets can be interrogated using a pair of TaqMan assays Each assay contains one probe for the major SNP allele which is labeled with the same reporter dye in both assays e g VIC
3. Assay QPCR Guarantee Visit www lifetechnologies com for full information on TaqMan Assays QPCR Guarantee or refer to Gene Expression Assay Performance Guaranteed With the TagMan Assays QPCR Guarantee Program Pub no CO13369 Note For additional documentation see Obtaining support on page 97 Safety Data Sheets SDSs are available from www lifetechnologies com support Note For the SDSs of chemicals not distributed by Life Technologies Corporation contact the chemical manufacturer TaqMan SNP Genotyping Assays User Guide Documentation and support Obtaining support Obtaining support For the latest services and support information for all locations go to www lifetechnologies com support At the website you can e Access worldwide telephone and fax numbers to contact Technical Support and Sales facilities e Search through frequently asked questions FAQs e Submit a question directly to Technical Support techsupport lifetech com e Search for user documents SDSs vector maps and sequences application notes formulations handbooks certificates of analysis citations and other product support documents e Obtain information about customer training e Download software updates and patches Limited product warranty Life Technologies Corporation and or its affiliate s warrant their products as set forth in the Life Technologies General Terms and Conditions of Sale found on Life Technologies webs
4. Snap On Optical Film Compression Pad for use with the automation accessory Cat no 4333292 MicroAmp Adhesive Film Applicator Cat no 4333183 ViiA 7 System or QuantStudio 6K 7K or 12K Flex System Fast 96 Well Block Module MicroAmp Fast Optical 96 Well Reaction Plate with Barcode 200 plates Cat no 4366932 20 plates Cat no 4346906 MicroAmp Optical Adhesive Film 100 films Cat no 4311971 MicroAmp Adhesive Film Applicator Cat no 4333183 StepOnePlus System MicroAmp Fast Optical 96 Well Reaction Plate with Barcode 200 plates Cat no 4366932 20 plates Cat no 4346906 MicroAmp Optical Adhesive Film 100 films Cat no 4311971 MicroAmp Adhesive Film Applicator Cat no 4333183 TaqMan SNP Genotyping Assays User Guide Appendix F User supplied materials and equipment Real Time PCR System Reaction Plates and Accessories 7900HT 7900HT Fast System 384 Well Block Module MicroAmp Optical 384 Well Reaction Plate with Barcode 1000 plates Cat no 4343814 500 plates Cat no 4326270 50 plates Cat no 4309849 icroAmp Optical 384 Well Reaction Plate 1000 plate Cat no 4343370 icroAmp Optical Adhesive Film 100 films Cat no 4311971 icroAmp Adhesive Film Applicator Cat no 4333183 lt lt 7900HT 7900HT Fast System e Standard 96 Well Block Module z icroA
5. 41 815 850 Xu C Goodz S Sellers E M Tyndale R F 2002 CYP2A6 genetic variation and potential consequences Adv Drug Deliv Rev 54 1245 56 TaqMan SNP Genotyping Assays User Guide 99 References Zanger U M Raimundo S and Eichelbaum M 2004 Cytochrome P450 2D6 overview and update on pharmacology genetics biochemistry Naunyn Schmiedebergs Arch Pharmacol 369 23 37 Haque K A Pfeiffer R M Beerman M B Struewing J P Chanock S J and Bergen A W 2003 Performance of high throughput DNA quantification methods BMC Biotechnol Oct 28 3 20 100 TaqMan SNP Genotyping Assays User Guide A Absolute quantitation 48 Allele Frequency 9 Nomenclature 9 Allelic discrimination Plate read 27 Plot 27 30 31 Assay database 14 Assay Information File AIF AssayID 81 Columns 81 Well Location 81 Autocalling 27 59 B biohazard safety 94 0 Chromosome Location 9 X 38 Y 38 Classification scheme 27 Cluster Diffuse 54 58 Trailing 54 58 Context sequence 9 Coriell cell line 8 Custom Assay Design Tool CADT 8 14 D DME Index 14 DNA Degradation 48 Quantitation 48 DNA delivery Dried down DNA 20 21 Wet DNA 20 21 documentation related 95 Drug Metabolism Enzyme DME TaqMan SNP Genotyping Assays User Guide Index Phase I Phase II Transmembrane transporters Drug Metabolism Index 9 F FAM dye 27 65 FAM dye labeled probe 9 Fluorometric analysis 48 G Genotyper Sof
6. dried down and stored before use Prepare the reaction plate with the wet DNA method 1 Dilute each DNA in nuclease free water in order to deliver 1 20 ng per well IMPORTANT All wells using the same assay must contain similar amounts of sample A final concentration of at least 0 2 ng uL is recommended 2 Pipette the reaction mix see Prepare the reaction mix on page 21 into each well of the reaction plate Use the appropriate volumes listed in Table 9 3 Cover the plate with MicroAmp Optical Adhesive Film 4 Centrifuge the plate briefly to spin down the contents and eliminate any air bubbles from the solutions 5 Dilute 1 20 ng of each purified gDNA sample into nuclease free water 6 Pipette samples into the plate a Remove the clear adhesive film from the plate b Into each well of the plate pipette one control or DNA sample using the volumes listed in the following table Be sure to include wells for use as no template controls TaqMan SNP Genotyping Assays User Guide Chapter 2 Genotyping experiment overview JE Set up the PCR reactions a Reaction Plate DNA Sample Volume MicroAmp Optical 384 Well Reaction Plate 2 25 uL MicroAmp Fast Optical 96 Well Reaction 4 50 pL Plate MicroAmp Optical 96 Well Reaction Plate 11 25 uL IMPORTANT Be sure that no cross contamination occurs from well to well 7 Cover the plate with MicroAmp O
7. dye and one probe for one of the minor alleles which is labeled with the second reporter dye e g FAM dye To generate accurate sample genotypes the two assays must be run independently on the same panel of samples and the resulting allelic discrimination plots must be analyzed in concert comparing the expected cluster positions from both assays to a map of the true sample genotypes Sample genotypes can be assigned with the help of a spreadsheet program and a chart of the expected genotypes see Example ABCB1 c 3095G gt T A triallelic SNP rs2032582 assays on page 74 or the AlleleTyper Software can be used to translate the results TaqMan SNP Genotyping Assays User Guide 73 74 Appendix C About the Drug Metabolism Enzyme genes TaqMan DME Assays for genotyping triallelic SNPs Refer to the TaqgMan Drug Metabolism Genotyping Assays for Triallelic SNPs Application Note Pub no 135AP01 01 for more details on manual analysis of triallelic SNPs using 2 DME SNP Assays or to the AlleleTyper Software User Guide Pub no 4469874 for information on having the genotypes assigned automatically by this software Table 17 TaqMan DME Assays for genotyping triallelic SNPs Gene rsSNP ID D dae Allele name tee ABCB1 rs2032582 C_11711720C_30 N A C A C_11711720D_40 N A C T CYP2C9 rs7900194 C__25625804_10 CYP2C9 8 c 449G gt A A G C_25625804D_20 CYP2C9 27 c 449G gt T T G CYP2D6 rs50308
8. instructions on avoiding false positive amplifications To ensure optimal analysis and troubleshooting of the TaqMan SNP Genotyping Assays it is recommended to prepare an optical reaction plate containing the following for each assay e DNA samples with unknown genotype at the polymorphism of interest e Strongly recommended Two no template controls NTCs Use DNase free water Life Technologies strongly recommends using at least two NTCs per assay to Orient the VIC dye and or FAM dye clusters to an origin Enable the detection of DNA contamination on a given set of plates e Optional DNA controls with known genotype at the polymorphism of interest e Keep all TaqMan Genotyping Assays protected from light in the freezer until ready to use Excessive exposure to light may affect the fluorescent probes e Minimize freeze thaw cycles e Dilute the 40X or 80X Predesigned SNP or Custom SNP Genotyping Assay to a 20X working stock solution see Perform the dilution of SNP Genotyping Assays on page 13 Note TaqMan DME Genotyping Assays are supplied at a 20X concentration e Prior to use Thoroughly mix TaqMan Genotyping Master Mix by swirling the bottle Resuspend SNP Genotyping Assay by vortexing then centrifuge the tube briefly For wet DNA only Resuspend the thawed frozen samples by vortexing then centrifuge the tubes briefly Prepare the reaction mix for each assay before transferring it to the opt
9. 0 1 to 0 999 which corresponds approximately to 4 ng uL to 50 ng uL of gDNA Values above or below are outside the linear range for concentration determination To ensure accurate quantitative results g DNA samples should be diluted so that the A260 reading is between 0 1 to 0 999 Remember to record the dilution factor and the diluents used Most plates and cuvettes have minimum working volumes and the g DNA sample used for the quantitative measurement will be discarded Ensure that you have enough gDNA to use this method Absolute Quantitation Absolute quantitation measures the total amount of amplifiable g DNA This technique requires the creation of a standard curve using g DNA samples of known quantities The standard samples must be pre quantitated and validated using an independent method such as spectrophotometry or fluorometry The unknown samples are compared to the known samples for quantitation Two well known techniques for absolute quantitation are e TaqMan assay chemistry RNase P e SYBR Green assay Absolute quantitation using TaqMan assay chemistry is a highly accurate technique for quantifying DNA TaqMan DNA Template Reagents Cat no 401970 and TaqMan RNase P Detection Reagents Cat no 4316831 allow for convenient means to quantify g DNA They includes pre diluted and validated standards at five concentrations 0 6 ng uL 1 2 ng uL 3 0 ng uL 6 0 ng uL and 12 0 ng uL Dilute or aliquot to the appro
10. 1 s No Template Control 0 3 0 1 0 3 0 5 07 0 9 1 1 13 41 5 Allele 1 VIC Ra Figure 1 Example of an allelic discrimination plot TaqMan Genotyper Software is a standalone software application that can be used to analyze raw data from genotyping experiments created on a Life Technologies real time PCR system The TaqMan Genotyper Software can be used to e Create a study Import multiple experiments into a single study Import assay information files txt or xml to update assay information Set the analysis settings Import Supplementary Sample Information SSI files to update sample information such as gender or population Import reference panel files to add reference samples to a study e Generate a study template then use the study template to create new studies The software analyzes the data according to the analysis settings that were defined in the study template e Analyze the study data using one of two call methods Autocalling The software algorithm is used to call the data points Classification Scheme You define the cluster boundaries that are used to call the data points e View the study results for example a summary of the Quality Control QC statistics at the study level assay level experiment level and sample level e Export the following data Analysis results Analysis settings Audit trails TaqMan SNP Genotyping Assays User Guide g Chapter 2 Genotyping ex
11. 3 Perform a literature search for documentation reporting the presence of null alleles for the gene 4 Perform analysis using a TaqMan Copy Number Assay Cat no 4400291 on all samples to confirm the sample has a null allele to rule out assay interference caused by a SNP present in the individual s DNA perform comparative sequencing on the subjects to identify any undocumented SNPs Note To locate the copy number assay of interest find them in the Assays search page at www lifetechnologies com A non target SNP under a primer or probe may result in off cluster data The location of the non target SNP under the primer or probe as well as the MAF influences the extent to which the cluster pattern is atypical The number of individuals exhibiting this pattern depends on the allele frequency of the non target SNP You may see additional clusters angle clusters or a lack of amplification of the sample when there is an additional polymorphism under the primer Figure 5 The presence of a polymorphism under a primer generally leads to lower PCR efficiency 0 40608 1012141618 2022242628303 2 34363840492 44496 4850525456 Figure 5 SNP under primer The points in pink between the back and green cluster constitute an angle cluster A SNP under a probe can result in an outlier that falls between the heterozygote and one of the homozygotes an angle cluster or an outlier that has the same angle as a cluster but trails behind the main cl
12. 5 years past their manufacturing date Perform the Life Technologies recommends that the SNP Genotyping Assays be diluted to a 20X dilution of SNP working stock then aliquoted for routine use to minimize freeze thaw cycles and the Genotyping Assays 1 Assays exposure to light Dilute 40X or 80X SNP Genotyping Assay to a 20X working stock with 1X TE buffer Note 1X TE buffer composition 10 mM Tris HCl 1 mM EDTA pH 8 0 in DNase free sterile filtered water Vortex then centrifuge the mixture Store multiple aliquots of the SNP Genotyping Assays at 15 to 25 C in the dark TaqMan SNP Genotyping Assays User Guide 13 E Chapter 1 Product Information A AL Workflow Workflow The following workflow illustrates an overview of a genotyping experiment using TaqMan SNP Genotyping Assays Prepare the Reaction Mix v Perform Pre PCR Plate Read optional v Perform the PCR h Set up Plate Document v Perform Post PCR Plate Read y Analyze the Plate Read Document amp Call Allele Types Ordering Assays TaqMan Predesigned SNP and DME Genotyping Assays 14 For the list of available TaqMan Predesigned SNP Assays and inventoried TaqMan DME Genotyping Assays visit www lifetechnologies com The database of over 4 5 million available assays can be searched by e Gene name e Gene symbol SNP ID e Assay ID e Allele nomenclature available for DME Assays for whi
13. AD plot What to do Rerun the assay mixing the samples well by pipetting up and down a few times and performing the centrifugation steps as described in the protocol Centrifuging the samples ensures that the contents of the sample well are pooled at the bottom of the well allowing for the most efficient PCR reaction and the most accurate endpoint read Some assays have higher levels of background fluorescence than others which can cause e The position of the NTCs moving away from the origin of the allelic discrimination plot e The position of the homozygous cluster moving towards the heterozygous clusters What to do If the clusters are well separated from each other the Real Time PCR Instrument Software can autocall the clusters You can also manually call the clusters Sometimes samples are inadvertently mixed together due to poor lab technique resulting in an outlier TaqMan SNP Genotyping Assays User Guide 57 Appendix A Troubleshooting Instrument troubleshooting Allelic Discrimination 1 60 0 80 0 00 0 00 0 20 0 40 0 60 0 80 1 00 Figure 15 Allelic discrimination plot with different samples in the same well outlier sample circled in red What to do Perform the assay again making sure that two samples are not combined in the same wells Instrument troubleshooting Routine instrument maintenance Instrument calibration 58 To eliminate poor thermal cycler performance ens
14. Blood e Blood cards e Cell culture suspension e Buccal swab e Rat or mouse tail e Tissue e Hair with follicle e Leaf punch or needle e Seed chip e FFPE tissue PCR amplification can be performed with any of the instruments in Table 5 and Table 6 However if a thermal cycler is used for PCR amplification the optional pre read and the post read must be performed separately on a Real Time PCR System in order to detect and record the fluorescent signals generated by TaqMan probe cleavage TaqMan SNP Genotyping Assays User Guide 17 a Chapter 1 Product Information E sUser supplied materials Table 5 Supported thermal cyclers Thermal Cycler Modules Veriti Thermal Cycler 96 well 96 well Fast and 384 well 9700 Thermal Cycler 96 well and 384 well 9800 Fast Thermal Cycler 96 well 96 well 2x96 well and ProFlex PCR system 2xFlat 1l Genotyping required post read using a Real Time PCR system listed in Table 6 Table 6 Supported Real Time PCR systems Real Time PCR Systems Block Modules 7500 System Standard 96 well 7500 Fast System 96 well 96 well 96 well Fast and 7900HT Fast System 384 well StepOne StepOnePlus System StepOne 96 well Fast 96 well 96 well Fast and VIIA 7 System 384 well 96 well 96 well Fast and QuantStudio 6 Flex Real Time PCR System 384 well 96 well 96 well Fast 384 QuantStudio 7 Flex Real Time PCR System wel
15. Cards through the TaqMan Custom Plating Service For more information visit the TaqMan Custom Plating Service at http www lifetechnologies com customplating TaqMan OpenArray Genotyping Plates enable the highest sample throughput for mid density genotyping gt 110 000 genotypes in a single day with the QuantStudio 12K Flex Real Time PCR System For more information visit the TaqMan OpenArray Genotyping Technology web page at http www lifetechnologies com openarray User supplied materials For sample preparation 16 For genomic DNA extraction we recommend one of the following kits Table 4 Recommended kits for genomic DNA extraction Sample Type Name Cat no 4413021 96 well format and 4413020 50 single preps MagMAX DNA Multi Sample Kit DNAzol BD Reagent 10974 020 Blood amp Serum s ChargeSwitch gDNA 50 100 uL Blood Kit CS11000 GeneCatcher gDNA 3 10 mL Kit CS21110 K1820 01 K1820 02 nips PureLink Genomic DNA Purification Kit and K1821 04 4413021 96 well Buccal cells format MagMAX DNA Multi Sample Kit MagMAX DNA Multi Sample Kit 4413021 96 well Saliva R format and 4413020 using Oragene preserved saliva as input 50 single preps RecoverAll Total Nucleic Acid Isolation Kit for FFPE a FFPE tissue samples TaqMan SNP Genotyping Assays User Guide To perform the PCR Chapter 1 Pro
16. Cat no 4333183 z z z 7500 Fast System Fast 96 Well Block Module MicroAmp Fast Optical 96 Well Reaction Plate with Barcode 200 plates Cat no 4366932 20 plates Cat no 4346906 MicroAmp Optical Adhesive Film 100 films Cat no 4311971 MicroAmp Optical 8 Cap Strip 300 strips Cat no 4323032 MicroAmp Adhesive Film Applicator Cat no 4333183 TaqMan SNP Genotyping Assays User Guide 87 88 Appendix F User supplied materials and equipment Real Time PCR System Reaction Plates and Accessories ViiA 7 System or QuantStudio 6K 7K or 12K Flex System 384 Well Block Module MicroAmp Optical 384 Well Reaction Plate with Barcode 1000 plates Cat no 4343814 500 plates Cat no 4326270 50 plates Cat no 4309849 MicroAmp Optical 384 Well Reaction Plate 1000 plate Cat no 4343370 MicroAmp Optical Adhesive Film 100 films Cat no 4311971 MicroAmp Adhesive Film Applicator Cat no 4333183 ViiA 7 System or QuantStudio 6K 7K or 12K Flex System Standard 96 Well Block Module MicroAmp Optical 96 Well Reaction Plate with Barcode 500 plates Cat no 4326659 20 plates Cat no 4306737 MicroAmp Optical Adhesive Film 100 films Cat no 4311971 MicroAmp Optical Film Compression Pad 5 pads Cat no 4312639 MicroAmp Optical 8 Cap Strip 300 strips Cat no 4323032 MicroAmp
17. Figure 12 Allelic discrimination plot showing the effects of DNA degradation caused by heating Factors that affect DNA degradation include tissue preservation methods exposure to UV radiation temperature pH and salt concentration of the environment Dean 2001 There are many sources of gDNA including fresh capillary blood buccal scrapes solid organ biopsies and paraffin embedded tissue Table 14 Recommendations for sample storage conditions to minimize DNA degradation Tissue Type Storage Conditions Buccal tissue Store frozen between 15 C and 25 C Immediately place tissue in liquid nitrogen and store at 80 C Tissue or Freeze and store between 15 C and 25 C e Whole blood store frozen between 15 C and 25 C Blood e Buffy coat store frozen between 15 C and 25 C and thaw at room temperature before use TaqMan SNP Genotyping Assays User Guide PCR inhibitors in sample Appendix A Troubleshooting Sample preparation problems Potential PCR inhibitors can originate from the tissue source of the DNA sample or from the purification method Examples of inhibitors originating from the cell include heparin Holodniy 1991 proteins and heme Akane 1994 DeFranchis 1998 Examples of inhibitors originating from DNA preparation are phenol Katcher 1994 proteases detergents SDS and salts The presence of polymerase inhibitors can decrease PCR efficiency leading to e
18. Forward Primer AssaylD_F For custom assays only txt Name Forward Primer txt TGGAGAAGCACCGTGAACC For custom assays only Sequence html Forward Primer Concentration in uM of txt 36 Concentration uM the forward primer html Reverse Primer AssaylID_R For custom assays only txt Name Reverse Primer a CTCTCCCAGACCCACTTTT For custom assays only Sequence html Reverse Primer Concentration in uM of ae i 36 i Concentration uM the reverse primer html Reporter 1 Name Assay lD_V For custom assays only txt Reporter 1 ee CCCCCAAGGACCTC For custom assays only Sequence html 3 txt Reporter 1 Dye VIC Dye label for reporter 1 html Reporter 1 Concentration in uM of R 8 Concentration uM reporter 1 html Reporter 1 Quencher used for eae NFQ Quencher reporter 1 of the assay html Reporter 2 Name AssaylD_M For custom assays only txt Reporter 2 CHL CCCCCAAGGACCTC For custom assays only Sequence html txt Reporter 2 Dye FAM Dye label for reporter 2 html 83 TaqMan SNP Genotyping Assays User Guide 84 Appendix E About the Assay Information File AIF Explanation of the AIF Columns Columns Example Description ARERR Format Reporter 2 Concentration in uM of txt f 8 Concentration uM reporter 2 het Reporter 2 Quencher used for txt NFQ Quencher reporter 2 of the assay htm Nucleotide sequence surrounding the SNP site SNP alleles are bracketed The allele ord
19. Genotyping Assays User Guide 11 TaqMan Sample to SNP Kit contains all necessary reagents for sample preparation and amplification Good laboratory practices for PCR RT PCR When preparing samples for PCR RT PCR amplification Wear clean gloves and a clean lab coat not previously worn while handling amplified PCR RT PCR products or used during sample preparation Change gloves whenever you suspect that they are contaminated Maintain separate areas and dedicated equipment and supplies for Sample preparation and PCR RT PCR setup PCR RT PCR amplification and analysis of PCR RT PCR products Do not bring amplified PCR RT PCR products into the PCR RT PCR setup area Open and close all sample tubes carefully Avoid splashing or spraying PCR RT PCR samples Keep reactions and components capped as much as possible Use a positive displacement pipettor or aerosol resistant barrier pipette tips Clean lab benches and equipment periodically with 10 bleach solution or DNAZap Solutions Cat no AM9890 TaqMan SNP Genotyping Assays User Guide 91 Safety VAN WARNING GENERAL SAFETY Using this product in a manner not specified in the user documentation may result in personal injury or damage to the instrument or device Ensure that anyone using this product has received instructions in general safety practices for laboratories and the safety information provided in this document Before using an instrument or dev
20. Insufficient DNA added to the well See Insufficient DNA added to the reaction well on page 55 Pipetting errors See Pipetting errors on page 56 Inefficient mixing and or insufficient centrifugation See Inefficient mixing or centrifugation on page 57 TaqMan SNP Genotyping Assays User Guide 33 Appendix A Troubleshooting Troubleshooting the AD plot Observation Possible cause Recommended action All samples cluster with the NTC Allelic Discriminat tion Plot Sample Preparation Problems Samples are not in equal quantity due to degraded DNA See Degraded DNA on page 48 Samples are not in equal quantity due to inaccurate DNA quantitation See Inaccurate DNA quantitation on page 92 PCR inhibitors in sample See PCR inhibitors in sample on page 51 Assay Problems Reagents mishandled or expired See Reagents mishandled or expired on page 54 DNA or reagent not added to the well See DNA or assay reagent not added to the reaction well on page 55 Insufficient DNA added to the well See Insufficient DNA added to the reaction well on page 59 Pipetting errors See Pipetting errors on page 56 nstrument Problems Annealing temperatures on the thermal cycler were too high or too low for the primers or probes due to poor calibration See Instrument calibration on pa
21. Mix between 2 and 8 C e Make sure the Master Mix is thoroughly mixed prior to use The use of a PCR Master Mix that does not contain ROX dye or a similar passive reference can cause e Trailing clusters e Some or all data is undetermined There is an X instead of a called allele in the AD plot e Diffuse clusters What to do Use a TaqMan Genotyping Master Mix which includes ROX dye Discussion ROX dye is a passive reference dye that improves the precision of the results by compensating for small fluorescent fluctuations such as bubbles and small well to well variations Life Technologies analysis software for allele discrimination and genotyping experiments will not call the alleles when ROX dye or another passive reference is not present See also ROX dye not designated as reference on page 61 When gDNA or one of the assay reagents is not added to the reaction well no PCR amplification takes place and the sample clusters with the NTCs What to do Perform the assay again making sure to e Follow the TaqMan SNP Genotyping Assay protocol exactly e Pipette carefully e Mix thoroughly When insufficient gDNA is added to the reaction well no PCR amplification takes place and the sample clusters with the NTCs TaqMan SNP Genotyping Assays User Guide 55 Appendix A Troubleshooting Assay problems What to do Perform the assay again making sure to e Quantitate your DNA accurately see Quan
22. TaqMan Assays Design and Ordering Guide Pub no 4367671 for detailed instructions on designing your TaqMan Custom SNP Genotyping Assay After you select your target sequence verify that it meets criteria for e Biological Significance e Allele frequency e Length e Accuracy e Uniqueness Select an appropriate target site and review your sequence for polymorphisms and sequence repeats 1 Access the Custom TaqMan Assay Design Tool at www lifetechnologies com 2 Enter or edit sequence information within the Order Custom SNP Genotyping Assays link in the Custom TaqMan Assay Design Tool Multiple sequences may be entered e Sequences must be entered in the 5 to 3 direction e Sequence length must be between 61 and 5000 nucleotides e Sequences must only be composed of A C G T or N for masked neighboring SNPs e Targeted SNPs indels or MNPs up to 6 bases must entered between brackets in the format Allele1 Allele2 or by using IUPAC code letters for two SNP bases without brackets Deletions are denoted by an asterisk Note Ensure successful design and performance by reading TaqMan Custom Assays Design and Ordering Guide Pub no 4367671 3 Click on Check Format to ensure data input meets requirements 4 Select Submit for Assay Design TaqMan SNP Genotyping Assays User Guide Appendix D How to order TaqMan SNP Genotyping Assays How to order TaqMan Custom SNP Genotyping Assays Alternatively if
23. access the Custom TaqMan Assay Design Tool CADT on the Life Technologies website to enter target sequences import sequence information from a file or search the Life Technologies database for sequences Please note that target sequences must be prepared before submitting for design and that upfront bioinformatics work must be done before SNPs can be submitted to the CADT e Sequences must be accurate The CADT doesn t verify that a sequence can be found within a genome e Ensure that the allele frequency of the SNP is sufficiently high to provide useful data for the size of the study e Mask neighboring SNPs with Ns e Mask repeat sequences with Ns e BLAST or BLAT search sequences to ensure their uniqueness within the genome e The maximum size of an indel or MNP is 6 bases After selecting the target sequences submit the sequences to Life Technologies for custom designs Selection must specify whether the target is human functional testing performed or non human no functional testing Please note that under certain circumstances human targets should be submitted as non human targets Human SNP targets that should be ordered as non human assays include Y chromosome mitochondrial and cDNA sequences these assays often fail functional testing The selected assays can be ordered directly from the CADT Life Technologies will manufacture package and ship the TaqMan Assays Alternatively primer and probe sequences can be
24. are not in equal quantity due to inaccurate DNA quantitation See Inaccurate DNA quantitation on page 92 Assay Problems Contamination due to poor laboratory practices See Appendix G Good laboratory practices for PCR RT PCR Evaporation from the sample well See Evaporation from the reaction well on page 96 Pipetting errors See Pipetting errors on page 56 More than one sample in the well See More than one sample in the well on page 57 Inefficient mixing and or insufficient centrifugation See Inefficient mixing or centrifugation on page 97 nstrument Problems Block contaminated See Routine instrument maintenance on page 58 Samples not in Hardy Weinberg equilibrium expected ratios of each genotype not seen Allelic Discrimin ation Piot 13 18 23 28 Allele X C_11617922_10_FAM Genetic Reasons Copy number polymorphism See Gene has a copy number polymorphism on page 44 Gene is on X chromosome See Gene on the X chromosome on page 47 Software Problems Detectors and markers set up incorrectly See No marker assigned to the well on page 60 36 TaqMan SNP Genotyping Assays User Guide Appendix A Troubleshooting Troubleshooting the AD plot Observation Possible cause Recommended action Some or all data is missing no data point shown on AD
25. how large the sample population needs to be to detect a specific allele The lower the frequency of the minor allele the larger the sample size required to detect the allele The allele frequencies for validated TaqMan SNP and DME Genotyping Assays were calculated for four populations e African American e Caucasian e Chinese e Japanese Some of the assays are for polymorphisms that may e Not occur in some populations e Have very low minor allele frequencies An example is assay ID C__11703892_30 for gene ALDH2 rs671 In the Caucasian African American test populations the minor allele frequency was 0 but in the tested Chinese Japanese populations it was 20 30 TaqMan SNP Genotyping Assays User Guide Null alleles in an individual Appendix A Troubleshooting Genetic issues During development of TaqMan SNP and DME Genotyping Assays a sample size of 45 people was tested in each of the four populations This sample size provides 95 confidence that alleles with a minor allele frequency of 5 will be detected Therefore the sample sizes of the populations tested for the DMEs were too small to detect allele frequencies less than 5 When an individual does not have the gene or the portion of the gene that contains the SNP of interest the individual has a null allele The data point in the allelic discrimination plot from such an individual will either e Appear as a homozygote of the allele that is present where there i
26. nlm nih gov defines common patterns of human genetic variation and provides tools including haplotypes maps and tag SNPs to aid genetic association studies e 160 000 validated assays Highly tested assays to common SNPs having at least a 5 minor allele frequency in at least one of the test populations Validated assays were tested with 2 4 ethnic populations 90 Coriell cell line DNAs 45 from African American origins and 45 from Caucasian origins and 90 DNAs from Chinese and Japanese samples obtained from a collaborator The minor allele frequency MAF data is published on the product assay details page on our web site and in the order Assay Information Files AIF e Over 126 000 coding region assays Assays for the detection of informative and putative functional nonsynonymous cSNPs in gene coding regions The Life Technologies library also includes 10 000 predesigned mouse assays For targets of interest not covered by our predesigned assays collections TaqMan Custom SNP Genotyping Assays are available see TaqMan Custom SNP Genotyping Assays on page 9 Each TaqMan Predesigned SNP Genotyping Assay in the Life Technologies collection includes two allele specific TaqMan MGB probes containing distinct fluorescent dyes and a PCR primer pair to detect specific SNP targets Assays are made to order available in multiple scales and manufactured upon ordering Human assays undergo functional testing on a panel of 20 gen
27. pL reaction 25 pL reaction ms Master 2 50 pL 5 00 pL 12 50 uL 20X Assay Working Stock 0 25 uL 0 50 pL 1 25 uL Nuclease free _ _ _ water Total volume per well 2 75 uL 5 50 uL 5 00 uL Table 10 Preparation of the reaction mix for dried down DNA method component 384 Well pte 96 Well Fast plate 96 Well pute 5 pL reaction 10 pL reaction 25 pL reaction ea MARNE 2 50 uL 5 00 uL 12 50 uL v Werking 0 25 uL 0 50 pL 1 25 uL A 2 25 uL 4 50 pL 11 25 uL Li a aad 5 00 pL 10 00 pL 25 00 pL Note the following e When using TaqMan Genotyping Master Mix use fast reaction plates only on the QuantStudio 6K 7K or 12K Flex 96 well Fast block ViiA 7 96 well Fast Block 7500 Fast Real Time PCR System or 9800 Fast Thermal Cycler and only with Standard thermal cycling conditions e TaqMan SNP Genotyping Assays are also compatible with Universal Master Mix II and GTXpress Master Mix provided with the TaqMan Sample to SNP kit However TaqMan Genotyping Master Mix is preferable to Universal Master Mix II for purified DNA because it will overall provide better performance and stronger signal TaqMan SNP Genotyping Assays User Guide Prepare the DNA samples Chapter 2 Genotyping experiment overview 5 Set up the PCR reactions C8 e Due to the overall longer length of many TaqMan DME Assay amplicons Fast cycling conditions are not recommended if using GTXpress Mast
28. page 54 Using a master mix without ROX dye on page 55 DNA or assay reagent not added to the reaction well on page 55 Insufficient DNA added to the reaction well on page 55 Evaporation from the reaction well on page 56 Pipetting errors on page 56 Inefficient mixing or centrifugation on page 57 Assay has high background fluorescence on page 57 More than one sample in the well on page 57 The use of mishandled or expired reagents may result in Some or all samples clustering with the NTCs Trailing clusters TaqMan SNP Genotyping Assays User Guide Using a master mix without ROX dye DNA or assay reagent not added to the reaction well Insufficient DNA added to the reaction well Appendix A Troubleshooting Assay problems e Weak overall reaction weak signals What to do Perform the assay again with newly prepared reagents Follow the Assay and Master Mix Considerations for reagent storage and handling Assay consideration e Store TaqMan Assays between 15 to 25 C when they are not in use e Minimize freeze thaw cycles to no more than ten cycles Too many freeze thaw cycles can cause cleavage of the dye from the probe e Limit the assay exposure to light The fluorescent dyes are susceptible to photo bleaching Photo bleaching can result in a lower overall signal for the reaction TaqMan Genotyping Master Mix considerations e Store TaqMan Genotyping Master
29. plot Allelic Discriminat tion Plot Software Problems No marker assigned to sample See No marker assigned to the well on page 60 May have checked Omit for the missing wells See Omit option checked in Real Time PCR instrument software on page 60 Some or all alleles not called Xis shown on the AD plot Allelic Discrimination Plot Software Problems NTC task not assigned to NTC wells See NTCs not assigned on page 62 Autocall option not selected See Autocall is not selected on page 60 Sample only has two clusters but 2 cluster calling option not selected software cannot assign alleles See Two cluster calling not selected on page 60 Sample has only one cluster software cannot assign alleles See Single cluster assay on page 60 Outlier sample too far off scale for alleles to be called for other samples See Outlier too far off scale on page 61 TaqMan SNP Genotyping Assays User Guide 37 Appendix A Troubleshooting Genetic issues Observation Possible cause Recommended action More than 3 clusters Allelic Discrimination Plot xe xx 2 ee X OR E ga e wn Genetic Reasons Additional SNP under probe See Additional SNP present under the probe or primer on page 42 Copy number polymorphism See Gene has a copy number polymorphism on
30. sample blocks water inside consumables and from the consumables themselves This calibration enables the Real Time PCR Instrument Software to eliminate background signal from the fluorescent samples thus increasing the precision of the instrument Pure dye spectra calibration The pure dye spectra calibration enables the instrument to distinguish the fluorescent dyes being used in the system The Real Time PCR Instrument Software uses the spectral data from a set of pure dye standards to process the raw spectral data it receives after each run Instrument verification run The test verifies that the instrument can generate a standard curve and its ability to calculate the quantities of two unknowns This test requires an RNase P Verification Plate that contains pre loaded reagents that create a standard curve with known copy numbers and two unknowns also with known copy numbers Troubleshooting software problems Empty allelic discrimination plots Three conditions in allelic discrimination plots may be caused by problems that occurred during software analysis Most of these problems can be eliminated during software setup Allelic Discrimination plot problems due to software fall into four broad categories each of which is further discussed below e Empty allelic discrimination plots on page 59 e No alleles called in the AD plot on page 60 e Homozygous allele frequencies reversed on page 63 e Too many all
31. testing Assay development and testing Bioinformatics evaluation and design Development of the thermal cycler method 70 This section provides general information about how Life Technologies designed and tested the TaqMan Drug Metabolism Genotyping Assays Life Technologies performed extensive bioinformatics to ensure that all SNPs in the TaqMan Drug Metabolism Genotyping Assays were properly mapped to the human genome assembly The most current mapping information is available on the TaqMan Drug Metabolism Genotyping Assays page on the Life Technologies website http www lifetechnologies com taqmandme 1 221 genes were selected based on their roles in drug metabolism and transport A complete list of genes can be found in the TaqMan Drug Metabolism Genotyping Assay Index available on the Life Technologies web site 2 Polymorphisms associated with DME genes were identified from multiple sources including dbSNP HapMap collaborators public allele nomenclature sites and Life Technologies proprietary database 3 For each potential assay the polymorphism and 300 bases on either side of it were mapped to the human genome A polymorphism was considered to be successfully mapped when it was aligned to only one location in the genome 4 Polymorphisms were selected for inclusion into the TaqMan Drug Metabolism Genotyping Assays collection based on their location on the reference genome SNPs in coding regions misse
32. the nucleotide or base change Note The order of the alleles does not reflect frequency and or a wild type versus mutation designation because they can differ between populations The allele nomenclature can indicate one SNP or multiple SNPs associated with a haplotype The TaqMan Drug Metabolism Genotyping Assays are designed to identify a single polymorphism within an allele which is generally a haplotype To investigate an allele from the common allele nomenclature sites you may need several TaqMan Drug Metabolism Genotyping Assays Allele nomenclature was gathered from the following sites e The human cytochrome P450 CYP allele nomenclature committee web site http www cypalleles ki se e The arylamine N acetyltransferase NAT nomenclature web site http nat mbg duth gr e The home page of the committee mediating the naming of UDP glucuronosyltransferase http www pharmacogenomics pha ulaval ca cms ugt_alleles Note Because not all the genes or polymorphisms included in TaqMan Drug Metabolism Genotyping Assays have been curated on a nomenclature site not all of them are associated with public allele nomenclature For some very important variants in Very Important Pharmacogenes VIP this nomenclature can be found on the Pharmacogenomics Knowledge Base web site http www pharmgkb org TaqMan SNP Genotyping Assays User Guide 69 Appendix C About the Drug Metabolism Enzyme genes Assay development and
33. unexpected or atypical genetic results Only one or two clusters can occur in the AD plot as shown in Figure 3 when the minor allele occurs at a very low frequency in the population being studied Allelic Discrimination Plot Lee ee eee eee eee eee eee 0 4 0 9 1 4 1 9 2 4 29 3 4 3 9 Figure 3 Allelic discrimination plot showing a single cluster in addition to the NTCs What to do To determine if the size of your sample population is large enough to detect the minor allele of interest 1 Find the MAF for your assay on the TaqMan SNP Genotyping Assays page at www lifetechnologies com which is frequently updated Alternatively the MAF can be found in the Assay Information File distributed with the assays Allele frequency data can also be found using the public SNP identifier from public websites such as 1 dbSNP at http www ncbi nlm nih gov SNP index html 2 the HapMap project at http www hapmap org TaqMan SNP Genotyping Assays User Guide 39 40 Appendix A Troubleshooting Genetic issues 2 Using the Hardy Weinberg Equilibrium equation determine if the minor allele is detectable for a sample the size of your test population see Example calculation on page 40 In the Hardy Weinberg Equilibrium equation q 2qp p 1 the expected genotype frequencies are q 2qp and p where q and p represent the allele frequencies The values for q 2qp and p correspond to the fraction of a given
34. 0 8 0 The same markers and detectors are assigned to two The same markers and detectors are assigned to one of assays the two assays Figure 19 Allelic discrimination plots showing two assays assigned to one detector and marker What to do 1 Create markers and detectors for each assay on the plate Refer to the instructions in your instrument manual appropriate for your software 2 Assign each marker to the correct assays 3 Re analyze your data Multiple assays may be run ona single plate however it is essential that each assay is assigned its own marker Each assay has its own unique run characteristics Running two assays with the same marker name may result in genotyping miscalls and the appearance of assay failure TagMan SNP Genotyping Assays User Guide Overview of the TaqMan SNP Genotyping Assays Overview of the assay components TaqMan SNP Genotyping Assays allow for genotyping of nucleotide polymorphisms using the 5 nuclease assay for amplifying and detecting specific alleles in purified genomic DNA samples Each assay genotypes individuals for a specific polymorphism Each TaqMan Genotyping Assay contains two primers for amplifying the sequence of interest and two TaqMan MGB probes for allele detection The presence of two probes in each reaction allows for genotyping two possible variant alleles at the polymorphic site in a DNA target sequence The genotyping assay determines the presence or absence of a poly
35. 1 Product Information AU Product overview Product part numbers Product properties 10 For detailed information on how to order see Appendix D How to order TaqMan SNP Genotyping Assays Table 1 Ordering information for TaqMan Predesigned SNP Drug Metabolism Enzyme DME and Custom SNP Genotyping Assays Number of reactions l Cat no Assay mix Product Scale formulation 384 96 Non well well Human human 1 Small 1500 300 40X 4351379 4351384 a Medium 5000 1000 40X 4351376 4351382 Large 12 000 2400 80X 4351374 4351380 DME Small 750 150 20X 4362691 Small 1500 300 40X 4331349 4332077 Custom SNP Medium 5000 1000 40X 4332072 4332075 Large 12 000 2400 80X 4332073 4332076 11 Non human TaqMan Predesigned SNP Genotyping Assays are designed to amplify and detect specific polymorphisms in purified mouse genomic DNA samples For storage and handling of the TaqMan Genotyping assays see Storage and stability on page 13 All TaqMan Predesigned SNP DME and Custom SNP Genotyping Assays are optimized for use with TaqMan Genotyping Master Mix and require only three components for PCR e 1 20 ng purified genomic DNA per well final concentration gt 0 2 ng uL e 20X 40X or 80X TaqMan Genotyping Assay depending on product and assay scale e 2X TaqMan Genotyping Master Mix Note TaqMan Genotyping Assays are also compatible with Uni
36. 12 000 2400 80X 4332073 4332076 TaqMan SNP Genotyping Assays User Guide 77 Appendix D How to order TaqMan SNP Genotyping Assays How to order TaqMan Custom SNP Genotyping Assays Considerations for choosing human SNP Genotyping Assays Review of the target sequence Custom TaqMan Assay Design Tool 78 Life Technologies performs a functional test on all human SNP Genotyping Assays Genomic DNAs gDNAs from 20 unrelated individuals from 3 populations and both sexes are amplified under universal conditions with the SNP Genotyping Assay to test for amplification and clustering Human SNP Genotyping Assays that fail this test are not shipped Consequently if you expect SNP Genotyping Assays to human targets to fail the functional test order the nonhuman SNP Genotyping Assays Failures can occur for the following reasons e For human cDNA sequences the test fails because intronic sequences prevent primer or probe binding or separate assay component binding sites and prevent efficient amplification because of longer amplicon size e For human Y chromosome specific sequences the test fails because gt 90 of the samples in the test must amplify to pass and the female samples in the functional test will not amplify because they do not contain a Y chromosome The success of your TaqMan Custom SNP Assay depends largely on the quality of the sequence data that you submit for the design process Refer to the Custom
37. 20 Genotyping Assay overview 0 2 0 c cect eee ete 20 Assay setup guidelines 0 c cece eee ee eee eens 21 Reagents and samples preparation 20 eee e eee eee eee eens 21 Set up the PCR reactions 2 0 cece eee eens 21 Prepare the reaction Mix 00 00 cece eee eens 21 Prepare the DNA samples 0 000 eee e eee eee eens 23 Perform the PCR 220d cd ate eth ee di AG dr adele aE oda aie 26 Post PCR plate read and analysis 0 0 c cece eee eee 27 OVENVIEW i E sei Boda Ee ee eed de ee heey eee ee ceed 27 Analyze data using TaqMan Genotyper Software 0 cece 28 Resources for data analySis 0 0c cece sitie cece eee eee eens enaees 29 APPENDIXA Troubleshooting ciccccscccderssiecadieasseesewedenossenss 30 About the allelic discrimination plot 2 0 00 eee eee 30 Characteristics of a good allelic discrimination plot 2 2 00005 30 Troubleshooting the AD plot 0 2 cece eens 31 Unexpected patterns in AD plots 2 200 c eee eee 31 GeENelCISSUCS crag cc ede see a ok ad SE eed eae OE ed eee aaa 38 Low allele frequency 0c cece eet eens 39 Null alleles in an individual 2 e eee e eee eee eee 41 Additional SNP present under the probe or primer 0000e eee eeeeee 42 Gene has a copy number polymorphism 00 eee eee eee eee eee 44 SNP is triallelic or tetra allelic
38. 65 C_30634117C_20 CYP2D6 8 g 1758G gt T A C C_30634117D_30 CYP2D6 14 g 1758G gt A T C CYP1A1 rs41279188 C_30634152C_70 CYP1A1 5 g 2461C gt A G T C_30634152D_80 CYP1A1 9 g 2461C gt T G A CYP2C8 rs72558195 C_72650009C_10 CYP2C8 7 c 556C gt T G A C_72650009D_20 CYP2C8 8 c 556C gt G G C Note On the Life Technologies Assay Search results pages the annotation for the DME assays is tied to the SNP ID and not the SNP alleles Therefore both assays for a triallelic SNP will be assigned the same allele nomenclature Refer to the Important Information and or the context sequence to determine which alleles are interrogated by each assay Example ABCB1 c 3095G gt T A triallelic SNP 1s2032582 assays C_11711720C_30 ABCB1_c 3095 G gt T C_11711720D_40 ABCB1_c 3095 G gt A TCTTTC TCTTTC TATTTAGTTTGACTCACCTT C A ACCTTCTAGTTCTTT TATTTAGTTTGACTCACCTT C T ACCTTCTAGTTICTTT CCCAG CTTA CCCAG CTTA After running paired assays for triallelic SNPs in separate reactions on the same gDNA samples examine the cluster plots in you real time instrument software or TaqMan Genotyper Software 1 Heterozygotes Any sample called as a heterozygote is a true heterozygote for the reported alleles in a given assay 2 Homozygotes Samples running in or near a FAM or VIC homozygous cluster can be either a true homozygote for the reported allele or can be a heterozygote
39. Allelic discrimination plot for CYP2D6 showing samples with a copy number polymorphism circled in red for assay C__32407252_30 Allelic Discrimination Plot What to do 1 Evaluate overall assay performance e Do the assay results appear in tight clusters e Do clusters have good separation Appendix A Troubleshooting Genetic issues Repeat the experiment to confirm the presence of the off cluster sample Examine the sample s performance in other assays to rule out problems caused by this particular sample such as sample impurity or degradation Perform a literature search for documentation of copy number polymorphisms for the gene Perform comparative sequencing on the subjects to identify any undocumented SNPs present under the primer or probe extra SNPs may cause angle clusters Perform analysis using a TaqMan Copy Number Assay Cat no 4400291 on all samples to determine the copy number for the gene in which the polymorphism resides TaqMan SNP Genotyping Assays User Guide 45 Appendix A Troubleshooting Genetic issues SNP is triallelic or tetra allelic 46 Note the following e The Copy Number Assay of interest can be found on the Assays search page at www lifetechnologies com e A Custom TaqMan Copy Number Assay can be designed if a pre designed Copy Number Assay does not exist for a target of interest e Copy Number Assays must be run in duplex with a reference assay Reference
40. E a E a aa tae eee 72 Other assays for the DME genes 2 00 cece e eee eens 73 TaqMan DME Assays for genotyping triallelic SNPS annnnanannnnnnnnnnnnnnnnn 73 APPENDIXD How to order TaqMan SNP Genotyping Assays 76 How to order TaqMan Predesigned SNP and Drug Metabolism Genotyping Assays 76 Assay part numbers sa n a EEE AAA EES 76 Life Technologies website 0 cece ee eee eee eens 76 Quick Order hss besoin tesiibis iia iad a chose ehh es 77 How to order TaqMan Custom SNP Genotyping Assays 2000 2 eee eee ee 77 Assays part numbers reissen ee aa eee ees 77 Considerations for choosing human SNP Genotyping Assays 78 Review of the target Sequence cece eee 78 Custom TaqMan Assay Design Tool 0 0 2 e eee cece eee ees 78 APPENDIXE About the Assay Information File AIF 80 About the Assay Information File AIF 0000 cece cece cece cece eee eeeeee 80 TaqMan SNP Genotyping Assays User Guide 5 Contents FOr LIMS USOT S eia EEEa EEA EEE EEEE bee E ena g diy ean eee rere 81 AIF and tube contents ENTE EREE AANE AREIA AAEN a 81 Explanation of the AIF Columns 0c cece eee eee 81 APPENDIX F User supplied materials and equipment 87 APPENDIXG Good laboratory practices for PCR RT PCR 91 APPENDIXH Safety cece ec ee cece eee e eee eee eee eens 92 Chemicalisafetyins e
41. Man genotyping products Wet testing of these longer amplicons showed that the Rn values normalized signal were often lower for these longer amplicons affecting cluster separation To address this issue Life Technologies developed a new thermal cycler method The development of this new thermal cycler method is in the following sections TaqMan SNP Genotyping Assays User Guide Appendix C About the Drug Metabolism Enzyme genes Assay development and testing Determination of the optimal number of cycles A representative group of assays were subdivided by amplicon length into three groups short lt 100 bases medium 100 110 bases and long gt 110 bases The normalized signals for each set of assays performed at 40 and 50 cycles with a 60 second extension were compared At 50 cycles the average signal for both the VIC and FAM dyes increased dramatically for the long amplicons For these assays 50 cycles produced better genotyping data than the traditional 40 cycles Determination of the optimal extension time To further improve assay performance Life Technologies investigated longer extension times Three different extension times 60 90 and 120 seconds for 50 cycles were investigated The data produced by these experiments indicated that the 90 second extension showed significant increases in the normalized signal the average signal increased for both the VIC and FAM dyes No significant increases were observed with th
42. NA was then diluted with water to yield a 1 ng uL working stock 3 uL 3 ng total DNA of each DNA was delivered to the wells of a 384 well microtiter plate Each plate was dried overnight and the plates were sealed and stored for up to a year prior to use 72 TagMan SNP Genotyping Assays User Guide Other assays for the DME genes Appendix C About the Drug Metabolism Enzyme genes TaqMan DME Assays for genotyping triallelic SNPs Reaction mixes were prepared for 5 uL reactions PCR was performed using GeneAmp PCR System 9700 as described in Perform the PCR on page 26 with the only difference that the Universal Master Mix was used instead of the TaqMan Genotyping Master Mix Endpoint data were collected using the Life Technologies 7900HT Real Time PCR System All assays were wet tested on duplicate plates containing African American and Caucasian DNA samples Each plate contained DNA samples from e 45 African Americans e 45 Caucasians e 3 No template controls water Each assay was run twice to confirm performance Parameters used to analyze the assays included cluster signal tightness angle separation and Hardy Weinberg equilibrium If good performance was observed assays were run on a proprietary set of DNA samples from Chinese and Japanese populations to generate allele frequencies for those populations Each set containing 45 samples was provided as part of a collaboration These sets are not publicly available
43. P g Sup te 9 see packing slip for txt 4181727 f details SEXE Part Number 4351379 Product number used for ordering the assay html indi tX Product Type TaqMan SNP Genotyping Product type indicated by Assay Service the part number html i i ifi txt Assay ID C__123456789_10 Unique identifier for the assay html i i ifi txt t t Nurben 654321 Unique identifier for the manufacturing batch Remi Type of container in Plate Type 96 position tube rack v1_ which the assay is JEKE shipped Type of container in Rack or Array Type 96 position tube rack v1 which the assay is html shipped Bar Code ID of the box in Plate ID 1234567 which the assay is txt shipped Bar Code ID of the box in Rack or Array ID 1234567 which the assay is html shipped ini txt Vial Type 10 digit bar coded tube Pe of tube containing the assay html i z txt Vial ID 0004696076 Uniun bar cede the assay tube html TaqMan SNP Genotyping Assays User Guide Appendix E About the Assay Information File AIF Explanation of the AIF Columns Columns Example Description AEE Format Well location of the assay Well Location B02 in the associated bar txt coded plate Well location of the assay Tube Well Position B02 in the associated bar html coded plate Assay Mix Concentration of the SNP txt Concentration 40X Genotyping Assay mix primers and probels html
44. SDS Handle chemical wastes in a fume hood Ensure use of primary and secondary waste containers A primary waste container holds the immediate waste A secondary container contains spills or leaks from the primary container Both containers must be compatible with the waste material and meet federal state and local requirements for container storage After emptying a waste container seal it with the cap provided Characterize by analysis if necessary the waste generated by the particular applications reagents and substrates used in your laboratory Ensure that the waste is stored transferred transported and disposed of according to all local state provincial and or national regulations IMPORTANT Radioactive or biohazardous materials may require special handling and disposal limitations may apply TaqMan SNP Genotyping Assays User Guide 93 Appendix H Safety Biological hazard safety Biological hazard safety 94 AX WARNING BIOHAZARD Biological samples such as tissues body fluids infectious agents and blood of humans and other animals have the potential to transmit infectious diseases All work should be conducted in properly equipped facilities using the appropriate safety equipment for example physical containment devices Safety equipment also may include items for personal protection such as gloves coats gowns shoe covers boots respirators face shields safety glasses or goggles Ind
45. SNP Assays are expressly excluded from the TaqMan Assay QPCR Guarantee Life Technologies makes the following guarantee to the customer on each assay delivered to the customer e Quality Each assay is manufactured with high quality to enable customer to obtain reproducible results from lot to lot e Performance Each assay is designed with a robust algorithm enabling superior sensitivity specificity and accuracy Assay s performance specifications are set based on purified high quality samples Assay s performance may vary depending on the type and quality of sample e Content Each assay is part of the largest collection of qPCR primer and probe sets e Results Each Assay will enable you to obtain data you can trust If any Assay does not meet the above guarantee Life Technologies at its option will either replace it at no cost or credit your account with the purchase price of such assay For assay purchased in a multi assay arrayed format for example TaqMan Array Cards or Plates Life Technologies reserves the right to replace or provide credit for each assay individually and is not obliged to replace or provide credit for the entire card or plate Customer may use such credit to purchase other assay products from Life Technologies Replacement or credit of the purchase price as set forth above is Life Technologies sole obligation and customer s sole and exclusive remedy with respect to failure of the assays to meet the TaqMan
46. Scharf S Faloona F A et al 1985 Enzymatic amplification of beta globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia Science 230 1350 1354 Shastry B S 2006 Pharmacogenetics and the concept of personalized medicine Pharmacogenomics Journal 6 16 21 Smits K M Gaspari L Weijenberg M P et al 2003 Interaction between smoking GSTM1 deletion and colorectal cancer results from the GSEC study Biomarkers 8 299 310 Szakacs G Annereau J P Lababidi S et al 2004 Predicting drug sensitivity and resistance Profiling ABC transporter genes in cancer cells Cancer Cell 6 129 137 Thier R Br ning T Roos P H et al 2006 Markers of genetic susceptibility in human environmental hygiene and toxicology The role of selected CYP NAT and GST genes International Journal of Hygiene and Environmental Health 206 149 171 Topcul Z Chiba 1 Fujiedal M et al 2002 CYP2A6 gene deletion reduces oral cancer risk in betel quid chewers in Sri Lanka Carcinogenesis 23 595 598 Wilkinson G R 2005 Drug metabolism and variability among patients in drug response N Engl J Med 352 2211 21 Wong G K Yang Z Passey D A et al 2003 A population threshold for functional polymorphisms letter Genome Research 13 1873 1879 Xie H G Kim R B Wood AJ J Stein C M 2002 Molecular basis of ethnic differences in drug disposition and response Ann Rev Pharmocologic Toxicity
47. Trailing clusters e Nonamplification such that some or all samples cluster with the NTCs What to do 1 Dilute the sample and run the assay with the diluted sample If the inhibition decreases then it is likely there are PCR inhibitors in the sample 2 Re purify the sample and run the assay again Discussion Inhibition of PCR is always possible when DNA is extracted from tissue and or blood samples Life Technologies examined the effects of hematin on the TaqMan SNP and DME Genotyping Assays Hematin was added to each well of the assay at one of three concentrations 0 25 uM 0 50 uM and 1 00 uM except for the wells containing the control samples The results are shown in Figure 13 Effect of Inhibitor On Drug Metabolism Genotyping Assay Control 0 25uM Hematin a 0 50uM Hernatin 1 00uM Hematin i ap J gt 3 e siet Ws SE a 5 et P u 1 et ak w Ow j 0 T T 0 0 5 1 15 2 Ai 3 35 4 vic Figure 13 PCR inhibition as a function of hematin concentration PCR inhibition effects begin at 0 25 uM hematin Assay performance is severely compromised at 0 50 uM hematin and although signal strength is significantly lowered it is still possible to call genotypes Assay performance is entirely inhibited at 1 00 uM where cleaving of the probes is nonexistent resulting in no fluorescence The DNA purification method used to prepare gDNA can affect the success of PCR Maaroufi 2004 The selec
48. USER GUIDE applied biosystems by Kafe technologies TaqMan SNP Genotyping Assays TaqMan Predesigned SNP Genotyping Assays TaqMan Custom SNP Genotyping Assays and TaqMan Drug Metabolism Enzyme Genotyping Assays Catalog Number 4351379 4351384 4351376 4351382 4351374 4351380 4362691 4331349 4332077 4332072 4332075 4332073 and 4332076 Publication Number MANO009593 Revision A 0 o For Research Use Only Not for use in diagnostic procedures technologies For Research Use Only Not for use in diagnostic procedures The information in this guide is subject to change without notice DISCLAIMER LIFE TECHNOLOGIES CORPORATION AND OR ITS AFFILIATE S DISCLAIM ALL WARRANTIES WITH RESPECT TO THIS DOCUMENT EXPRESSED OR IMPLIED INCLUDING BUT NOT LIMITED TO THOSE OF MERCHANTABILITY FITNESS FOR A PARTICULAR PURPOSE OR NON INFRINGEMENT TO THE EXTENT ALLOWED BY LAW IN NO EVENT SHALL LIFE TECHNOLOGIES AND OR ITS AFFILIATE S BE LIABLE WHETHER IN CONTRACT TORT WARRANTY OR UNDER ANY STATUTE OR ON ANY OTHER BASIS FOR SPECIAL INCIDENTAL INDIRECT PUNITIVE MULTIPLE OR CONSEQUENTIAL DAMAGES IN CONNECTION WITH OR ARISING FROM THIS DOCUMENT INCLUDING BUT NOT LIMITED TO THE USE THEREOF Important Licensing Information These products may be covered by one or more Limited Use Label Licenses By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses TRADEMARKS The tr
49. aaa Sows hese toe hwiea aaa a chan a len aa eae bs 93 Biological hazard safety 0 c eee eee eee 94 Documentation and support ccc cece eee e teen ee ee eee eeeeeenees 95 Obtaining documentation 0c c eee eee eee 95 TaqMan Assays QPCR Guarantee 0 cece eee 96 Obtaining SDSS n sete ime soe See Seca bois Boiss Hage on Mena a a ane head 96 Obtaining SuppOrt s rerien e ani a Rik cated e a a A aae E a E a E a S E ariaa EEA T 97 Limited product warranty 000 eee eet eee 97 References GX Secs nnn vary wend anos een ae EEE D ERTE dues 101 TaqMan SNP Genotyping Assays User Guide About This Guide IMPORTANT Before using this product read and understand the information in the Safety appendix in this document Revision history Revision Date Description A 0 January 2014 New document Purpose of the guide The TaqMan SNP Genotyping Assays User Guide provides e overview of the TaqMan Predesigned Custom SNP and Drug Metabolism Enzyme Genotyping Assays e general guidelines for ordering assays e procedures for using TaqMan Predesigned Custom SNP and Drug Metabolism Enzyme Genotyping Assays e data analysis guidelines for interpreting results e troubleshooting information User attention words Two user attention words may appear in this document Each word implies a particular level of observation or actions as described b
50. ademarks mentioned herein are the property of Life Technologies Corporation and or its affiliate s or their respective owners TaqMan and AmpliTaq Gold are registered trademarks of Roche Molecular Systems Inc TaqMan used under permission and license DNAzol is a registered trademark of Molecular Research Center Inc Oragene is a trademark of DNA Genotek Inc NanoDrop is a registered trademark of NanoDrop Technologies LLC Microsoft Excel is a registered trademark of Microsoft Corporation 2014 Life Technologies Corporation All rights reserved Contents ADOUE This GUIS cic av cen edeenus sk edecnwaeswiond x E Ea ES 7 Revision history ec 6ceds see ca ee ta bebe aw eda Eanna Ea a ew eee taeda bbe eae de ae 7 Purpose Of the guide cechrrerirrerrirenkki ehi EEE EE EA Ea aia dete aN 7 User attention Words oserei iri i tee e tea Seen oud eee ener edule oe ra a aS 7 m CHAPTER1 Product Information cccceeee eee e eee e eee ees 8 Product information ss2 cecnnd eed agie dean od e aae E E ouMnass odes 8 TaqMan Predesigned SNP Genotyping Assays 000 eee eee eee eee 8 TaqMan Drug Metabolism Enzyme Genotyping Assays 02 02 000 ee 9 TaqMan Custom SNP Genotyping Assays 0 2c e eee eee 9 Product OVERVIEW 3 aie we dita tne bia ie ee RN EEEE EEN 9 Product part numbers 2 c scc0 0cc00ecs cae Ree cee eee eae eee 10 Product properties 2 c cece eee eens 10 ASSAY content
51. alt Lake City Utah TaqMan SNP Genotyping Assays User Guide References Luo H R Gaedigk A Aloumanis V Wan Y J 2005 Identification of CYP2D6 impaired functional alleles in Mexican Americans Eur J Clin Pharmacol 61 797 802 Maaroufi Y Ahariz N Husson M and Crokaert F 2004 Comparison of different methods of isolation of dna of commonly encountered candida species and its quantitation by using a real time PCR based assay J Clin Microbiology 42 3159 3163 Mullis K B and Faloona F A 1987 Specific synthesis of DNA in vitro via a polymerase catalyzed chain reaction Methods Enzymol 155 335 350 Ouahchi K Lindeman N and Lee C 2006 Copy number variants and pharmacogenomics Pharmacogenomics 7 25 29 Oscarson M 2001 Genetic polymorphisms in the cytochrome P450 2A6 CYP2A6 gene implications for interindividual differences in nicotine metabolism Drug Metabolism and Disposition 29 91 95 Rao Y Hoffmann E Zia M Bodin L et al 2000 Duplications and defects in the CYP2A6 gene identification genotyping and in vivo effects on smoking Mol Pharmacol 58 4 747 55 Rebbeck T R 1997 Molecular epidemiology of the human glutathione S transferase genotypes GSTM1 and GSTT1 in cancer susceptibility Cancer Epidemiol Biomarkers Prev 6 733 43 Roses A D 2004 Pharmacogenetics and Drug Development The Path to Safer and More Effective Drugs Nature Reviews Genetics 5 645 56 Saiki R K
52. asie a aie e e Rea eed ee tee en eterno Sein 59 Troubleshooting software problems 0000 e eee eee eee eee eee 59 Empty allelic discrimination plots 0c eee eee eee eee 59 No alleles called inthe AD plot 2 e eee eee ee 60 Homozygous allele frequencies reversed 0 2 0 e eee eee eee ee eee 63 Too many alleles called in AD plot 0 c cece ees 63 APPENDIX B Overview of the TaqMan SNP Genotyping Assays 65 Overview of the assay components 0c eee eee eee eens 65 About the probes asr and aoa weed dais Shs eats Bee he de Re OE Ee ke 65 Basics of 5 nuclease aSSay cece cee ccc cee e eee eee E D ia 66 PCR principles 2 2 25 ck ec eee nie hte esd Rieti a ee 66 Mismatches between probes and target sequences 0eeee eee eee 67 Data analysis 66 ccd Gewese ah ee bee Se Be Se ee ele ok ee ela ee 67 APPENDIXC About the Drug Metabolism Enzyme genes 68 Introduction to the Drug Metabolism Enzyme genes 2 020eeeeee eerie 68 Drug Metabolism Enzyme classifications 000 cece eee eee eee 68 Allele nomenclature 2 c cece cece eee ee eee eens 69 Assay development and testing 00 cee eee eee eee eee 70 Bioinformatics evaluation and design 2 cece cece eee eee 70 Development of the thermal cycler method 000 cece eee eee eee 70 Wet testing 0f assays onian bce E e E E A
53. assays are commercially available for human and mouse analysis If working with other species you need to identify and use your own reference assay target Discussion Data points for samples from homozygous individuals with extra copies of a gene will generally cluster with the homozygous cluster Data points for heterozygous individuals with copy number polymorphisms may appear as outliers such as a fourth or fifth cluster between the heterozygote cluster and one of the homozygous clusters Since copy number variation may not present itself in all individuals a gene dosage assay should be performed on all samples to determine which individuals carry extra copies of the gene When a SNP is triallelic or tetra allelic you may see outlier samples in the allelic discrimination plot although the samples may not be well separated from the main clusters You may also see more than three clusters These situations are best confirmed by running replicate plates Life Technologies did not include known triallelic SNPs in the predesigned TaqMan SNP Genotyping Assays collection However Life Technologies provides pairs of assays to several important DME gene variants that are triallelic SNPs see TaqMan DME Assays for genotyping triallelic SNPs on page 73 for more information 40t 16T 107 t 9 00 02 04 08 08 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40 Figure 8 Allelic discrimination p
54. before using any genomic DNA gDNA even commercially prepared DNA e Use the recommended amount of gDNA 3 to 20 ng per sample per assay e Always use the same quantity of gDNA for all samples of an assay on a plate Discussion The amount of gDNA is critical to the success of the assays Within an assay and or study gDNA concentration uniformity leads to accurate robust and reproducible results and ensures efficient use of valuable samples Variability in gDNA concentrations can lead to experimental anomalies that may affect interpretation of genotyping results as shown in Figure 14 Precise handling and quantitative measurements before running an assay can prevent possible errors without waste of reagents and samples 3ng DNA Concentration Plate Mixed DNA Concentration Plate 64 6 ll dH 127 ng j v ae ZA 10 ng E a E La 135 ng s 5ng X A i s 1 NTC 0 5 ng vee 0 0 1 r r r Q 05 1 15 2 25 3 35 o Os 1 15 2 25 3 35 vic vic All samples have 3 ng gJDNA Samples with gDNA ranging from 0 5 to 127 ng Figure 14 Allelic discrimination plots for TaqMan DME Genotyping Assay C__1204092_20 Commercially purchased DNA comes with concentration information but it is good practice to confirm DNA concentrations Life Technologies has found that DNA concentrations listed for commercially available g DNA can be quite different from in house measurements There are numerous methods for quantitati
55. ch this information has been mapped e Genomic location TaqMan DME Genotyping Assays can also be ordered by selecting assays from the DME Index available at http www lifetechnologies com taqmandme Selected list of assays can be ordered by batch query on the TaqMan SNP Genotyping Assay search page or by entering the assay IDs and the product part number into the Quick Order tool TaqMan SNP Genotyping Assays User Guide TaqMan Custom SNP Genotyping Assays Chapter 1 Product Information Ordering Assays aoe Note All assays are predesigned and optimized and sold with the TaqMan Assays QPCR guarantee see TaqMan Assays QPCR Guarantee on page 96 for details For more information on ordering TaqMan Predesigned SNP and DME Genotyping Assays consult How to order TaqMan Predesigned SNP and Drug Metabolism Genotyping Assays on page 76 Note For detailed instructions on how to design and order TaqMan Custom SNP Genotyping Assays consult the Custom TaqMan Assays Design and Ordering Guide Pub no 4367671 Custom SNP Assays are designed using the Custom Assay Design Tool CADT This tool may also be used to upload assays that have already been designed outside the system Life Technologies designs synthesizes and performs analytical quality control on Custom TaqMan SNP Assays based on sequence information supplied All information supplied is secure and confidential After selecting the sequences to study
56. ciated protein MRP1 ABCC1 ATP dependent transporters like MDR1 ABCB1 P glycoprotein organic anion transporters such as hOAT1 SLC22A6 Bleasby 2005 and multidrug resistance protein MRP2 ABCC2 Szakacs 2004 Allele nomenclature for the polymorphisms in the DME genes follows an international system created to describe polymorphisms in DNA and protein sequences den Dunnen 2001 When available Life Technologies provides the allele nomenclature for the SNP being interrogated by a particular TaqMan Drug Metabolism Genotyping Assay The allele nomenclature indicates the gene name the allele designation and the base changes associated with the polymorphism Because this nomenclature is used in the Life Technologies website for categorizing the TaqMan Drug Metabolism Genotyping Assays you can search for an assay using the allele nomenclature for the SNP of interest An example of this nomenclature is CYP1A1 1C g 3229G gt A which describes a polymorphism in a cytochrome P450 gene where e CYP1A1 indicates the HUGO gene name e 1C indicates the allele from the Human Cytochrome P450 Nomenclature Committee http www cypalleles ki se Mt e g indicates that the mapping position comes from the genomic DNA reference sequence c indicates cDNA e 3229 indicates the nucleotide position relative to the first base of the start codon on the genomic DNA reference sequence e G gt A indicates
57. duct Information User supplied materials aa ee Sample Type Name Cat no MagMAX FFPE DNA Isolation Kit 4463578 PureLink FFPE RNA Isolation Kit K156002 K1820 01 K1820 02 mips PureLink Genomic DNA Purification Kit and K1821 04 Fresh frozen tissue samples DNAzol Reagent 10503 027 4413021 96 well MagMAX DNA Multi Sample Kit format and 4413020 50 single preps Cell lines K1820 01 K1820 02 ape PureLink Genomic DNA Purification Kit and K1821 04 10503 027 DNAzol Reagent Alternatively sample preparation and amplification reagents compatible with TaqMan SNP Custom SNP and DME Genotyping Assays are included in TaqMan Sample to SNP Kits for ordering information see Appendix F User supplied materials and equipment However Life Technologies recommends pre amplifying all samples prepared with TaqMan Sample to SNP Kits when using OpenArray for subsequent genotyping Contact Life Technologies for more information on how to order TaqMan Pre Amplification Pools and reagents Note Due to the longer length of the amplicons in DME assays it is not recommended to run samples processed with TaqMan Sample to SNP Kits using Fast PCR conditions Use instead the DME Assay thermal cycling conditions described in Perform the PCR on page 26 TaqMan Sample to SNP Kits can be used to extract genomic DNA from the following samples e
58. e 120 second extension Clustering was also analyzed and the group of assays with the longest amplicons showed the most improvement in tightness and angle separation of the genotype clusters Tightness and angle separation are determined algorithmically tightness is the distance of individual points from each other and angle separation measures the distance between clusters Figure 21 demonstrates the effects of increased number of cycles and longer extension time on the assays based on amplicon length TaqMan SNP Genotyping Assays User Guide 71 Appendix C About the Drug Metabolism Enzyme genes Assay development and testing 50 cycles Z254 za L sil be Amplicon lt 100 bp AR LE 1 e 054 0 T T T T T g i 0 05 1 15 2 25 3 3 5 VIC Rn 50 cycles 64 54 4 a 4 wt a e a 3 qt 7 Amplicon 100 110 b 2 a P 4 o 14 ss G 04 T T T d i i 7 0 0 5 1 15 2 25 3 3 5 4 VIC Rn 50 cycles 54 454 Fe 44 ar 354 53 nr fe z sa r a L 2 n Amplicon gt 150 bp 2 A T mn i ata e tee eornp aam 5 054 0 T T T f y 0 0 5 1 15 2 25 3 3 5 VIC Rn Figure 21 Allelic distribution plots for short medium and long amplicon assays for 60 dark blue and 90 second pink extension times Wet testing of Stock DNA samples were obtained from Coriell Cell Repositories http assays ccr coriell org Dilutions of the stock DNA were quantitated by the RNase P method Each stock D
59. e combinations a single cluster assay is the correct result For example a single cluster assay can be correct for a SNP with a very low MAF such as TaqMan SNP Genotyping Assays User Guide Appendix A Troubleshooting Troubleshooting software problems many of the TaqMan DME Genotyping Assays see Low allele frequency on page 39 If you believe the single cluster is correct manually call the alleles You may need to rescale the plot before you can call the alleles accurately For complete instructions for plot rescaling refer to the user manual of your instrument or software Figure 16 shows an example of a single cluster plot before and after rescaling Allelic Discrimination Plot 50 Allelic Discrimination Plot ve 89 Pa Ie 37 2 gt 40 i s ty 2 x h 27 3 0 22 25 17 20 15 1 2 1 0 07 05 02 gt m e me a e ma 09 i 01 03 05 07 09 141 13 15 0 0 05 1 0 15 20 25 3 0 35 40 45 5 0 Allele X C__27861810_10_FAM Allele X C__27861810_10_FAM Single cluster before rescaling Single cluster after rescaling Figure 16 Allelic discrimination plot before and after rescaling ROX dye not designated as reference When ROX dye is not designated as a reference some of the Real Time PCR Instruments will not autocall the a
60. eles called in AD plot on page 63 This section highlights common data analysis issues that can lead to undetermined ambiguous or incorrect genotypes For complete instructions for setting up running and analyzing TaqMan Genotyping Assay experiments refer to the user manual for your instrument or software and follow the steps provided Incorrectly creating and or selecting the detector and marker can result in an empty allelic discrimination plot even when the assay chemistry is successful When the allelic discrimination plot is empty causes include e No marker assigned to the well on page 60 TaqMan SNP Genotyping Assays User Guide 59 Appendix A Troubleshooting Troubleshooting software problems No alleles called in the AD plot 60 e Omit option checked in Real Time PCR instrument software on page 60 e ROX dye not designated as reference on page 61 No marker assigned to the well A marker must be assigned to each well before the Real Time PCR Instrument Software can analyze the plate and obtain results What to do If you have a post read plate that appears to have no data 1 Check to see if a marker is assigned 2 Ifno marker is assigned assign one and reanalyze the data Omit option checked in Real Time PCR instrument software If there is a red X in the plate document for a well the Omit Well option may have been checked for this well The Omit Well option removes the selected well fr
61. elow Note Provides information that may be of interest or help but is not critical to the use of the product IMPORTANT Provides information that is necessary for proper instrument operation or accurate chemistry kit use TaqMan SNP Genotyping Assays User Guide 7 Product Information Product information TaqMan Predesigned SNP Genotyping Assays The TaqMan SNP Genotyping Assays use TaqMan 5 nuclease chemistry for amplifying and detecting specific polymorphisms in purified genomic DNA samples Each assay allows genotyping of individuals for a single nucleotide polymorphism SNP All assays are developed using Life Technologies robust bioinformatics assay design process relying on a pipeline using heuristic rules deduced from both manufacturing and assay performance data These assays use TaqMan minor groove binding MGB probes for superior allelic discrimination improved signal to noise ratios and design flexibility TaqMan Assays QPCR Guarantee see TaqMan Assays QPCR Guarantee on page 96 ensures performance and satisfaction with the results obtained with all predesigned TaqMan SNP and Drug Metabolism Enzyme DME Genotyping Assays The TaqMan Predesigned SNP Genotyping Assays in the Life Technologies collection include over 4 5 million genome wide human assays e 3 5 million HapMap SNPs SNPs genotyped by the HapMap Project across several populations This project http hapmap ncbi
62. er Software Quick Reference Card 4448638 TaqMan Assays Shipped at Ambient Temperature Reduce 090071 Environment Impact and Retain Their Quality and Stability Table 25 Instrumentation documentation Document Publication number Applied Biosystems 7300 7500 7500 Fast Real Time PCR 4347822 System Allelic Discrimination Getting Started Guide Applied Biosystems ViiA 7 Real Time PCR System 4441434 Getting Started Guide Applied Biosystems ViiA 7 Real Time PCR System User 4442661 Guide Applied Biosystems StepOne and StepOnePlus Real Time PCR Systems Getting Started Guide for Genotyping 4376786 Experiments Applied Biosystems QuantStudio 12K Flex Real Time 4470935 PCR System Getting Started Guide TaqMan SNP Genotyping Assays User Guide 95 Documentation and support Obtaining SDSs TaqMan Assays QPCR Guarantee Obtaining SDSs 96 Document Publication number Applied Biosystems QuantStudio 12K Flex Real Time 4470542 PCR System User Guide QuantStudio 6 and 7 Flex Real Time PCR System MAN0007993 Software Getting Started Guide Applied Biosystems 7900HT Fast Real Time PCR System 4364015 Allelic Discrimination Getting Started Guide Only the following assays are covered by the TaqMan Assay QPCR Guarantee predesigned SNP Genotyping Assays and Drug Metabolism Enzyme Genotyping Assays Without limiting the foregoing custom
63. er lt AGCTA T corresponds to the TXE Context Sequence eos A CAGTC association with reporter html dyes where Allele1 VIC Allele2 FAM For Predesigned SNP and Drug Metabolism Enzyme assays only F Strand used to design the i Design Strand Forward TaqMan probe tx Chromosome on which NSN Category Chromosome 12 the SNP is found txt Chromosome on which SEIS Category ID Chr12 the SNP is found Ext Microsatellite markers i Group D12S345 D12S1663 associated with the SNP txt Microsatellite markers i Sroup I Bie associated with the SNP ad Entrez Gene database ID Entrez Gene ID 45241185 of the gene in which the html SNP is found Transcript Accession number of the MIP NM_005957 4 transcript in which the html Accession SNP is found eee Location of the SNP in the s 3583 gene or transcript in html Transcript or Gene WE which it is found Entrez Gene database txt Gene Symbol IRAK4 symbol for associated gene html UX Gene Name Interleukin 1 receptor Ete a Gene gatabase gene name html TaqMan SNP Genotyping Assays User Guide Appendix E About the Assay Information File AIF Explanation of the AIF Columns Columns Example Description AF EILG Format Gi romosome 12 Chromosome on which 2 LAG the SNP is found html Organism for which the JERE Species Home sapiens 5 assay was designed aa Target Exons N A N A tx NCBI Gene NCBI transcr
64. er Mix 3 Swirl the bottle of 2X TaqMan Genotyping Master Mix gently to mix the contents 4 Vortex and centrifuge the 20X Assay Working Stock then mix briefly 5 Pipette the required volumes of 2X TaqMan Genotyping Master Mix 20X Genotyping Assay mix and for the dry down method only nuclease free water into a sterile tube 6 Cap the tube 7 Vortex the tube briefly to mix the components 8 Centrifuge the tube briefly to spin down the contents and to eliminate air bubbles from the solution Extract and purify genomic DNA The genomic DNA gDNA should be extracted and purified according to standard practices We recommend the gDNA extraction and purification kits listed in Table 4 Alternatively the TaqMan Sample to SNP Kit can also be used refer to the kit protocol for assay setup see Table 23 for ordering information Quantitate the gDNA We recommend quantifying the amount of gDNA in samples before using TaqMan SNP Genotyping Assays Use a reliable method such as e UV Vis spectrophotometry A260 A280 measurement Haque 2003 e NanoDrop spectrophotometry e Qubit 2 0 Fluorometer Cat no Q32866 with Qubit Assay Tubes Cat no Q32856 and Qubit dsDNA HS Assay Kit Cat no Q32854 e RNase P method see Absolute Quantitation on page 53 Methods for adding DNA TaqMan SNP Genotyping assays can be used with either wet or dried down DNA If the experiment requires multiple plates
65. es N S and Cox T M 1998 A potent inhibitor of Taq DNA polymerase copurifies with human genomic DNA Nucleic Acids Res 16 10355 den Dunnen J Antonarakis S 2001 Nomenclature for the description of human sequence variations Human Genetics 109 121 124 Eichelbaum M Ingelmann Sundberg M and Evans W E 2006 Pharmacogenomics and Individualized Drug Therapy Annual Review of Medicine 57 119 137 Gallagher S R 1994 Quantitation of DNA and RNA with Absorption and Fluorescence Spectroscopy Current Protocols In Molecular Biology Vol 3 John Wiley amp Sons pp A3 D 1 A3 D3 Holodniy M Kim S Katzenstein D Konrad M Groves E and Merigan T C 1991 Inhibition of human immunodeficiency virus gene amplification by heparin J Clin Microbiol 29 676 679 Katcher H L and Schwartz I 1994 A distinctive property of Tth DNA polymerase Enzymatic amplification in the presence of phenol Biotechniques 16 84 92 Kutyavin I V Lukhtanov E A Gamper H B and Meyer R B 1997 Oligonucleotides with conjugated dihydropyrroloindole tripeptides base composition and backbone effects on hybridization Nucleic Acids Res 25 3718 3723 Kwok S and Higuchi R 1989 Avoiding false positives with PCR Nature 339 237 238 Liew S N Lazaruk K Wong L Stevens J et al 2005 Determining the Copy Number of Genes Using Real Time Quantitative PCR poster At American Society for Human Genetics Annual Meeting Oct 25 29 S
66. esigned so their hybridization to off target template is highly reduced by even single nucleotide mismatches between a probe and the target sequence Poor probe hybridization reduces the amount of reporter dye cleaved from the quenched probe Furthermore AmpliTaq Gold DNA polymerase is more likely to displace a mismatched probe without cleaving it Each of these factors minimizes the production of nonspecific fluorescence signals from off target templates After generating an endpoint read on a real time PCR instrument the data is plotted by the instrument software conventionally VIC dye allele 1 on the X axis and FAM dye allele 2 on the Y axis The instrument analysis software allows for auto calling genotypes minimizing manual intervention In addition Life Technologies real time instrument eds files can be loaded into TagMan Genotyper Software for data analysis For instructions on how to use TaqMan Genotyper Software consult the TaqMan Genotyper Software Getting Started Guide Pub no 4448637 Note TaqMan Genotyper Software is available for free download at www lifetechnologies com TaqMan SNP Genotyping Assays User Guide 67 About the Drug Metabolism Enzyme genes Introduction to the Drug Metabolism Enzyme genes Drug Metabolism Enzyme classifications 68 Drug metabolizing enzymes DMEs are proteins involved in the biotransformation metabolism and or detoxification of endogenous and fo
67. for the FAM TM or VIC reported allele and for the unreported SNP allele in a given assay Samples carrying just one reported allele may or may not run together with those carrying two reported alleles i e cluster splitting may or TaqMan SNP Genotyping Assays User Guide Appendix C About the Drug Metabolism Enzyme genes TaqMan DME Assays for genotyping triallelic SNPs may not be notable If samples close to a homozygote cluster are called as undetermined manually call these as homozygotes 3 Noamp Weak or No amplification Samples that are homozygous for the unreported allele can exhibit weak amplification relative to other samples carrying reported alleles due to nonspecific activity of the assay probes Table 18 Example of a translation table ABCB1 c 3095G gt T A triallelic SNP rs2032582 assays C A Assay C T Assay Genotype c 3095G gt T A893T c 3095G gt A A893S ABCB1 c 3095G gt T A C_11711720C_30 C_11711720D_40 G G C C C C G A C C C T A A noamp T T G T C A C C T A A A T T T T A A noamp Note The alleles reported by the ABCB1 SNP assays are given in the plus strand genome orientation whereas the ABCB1 gene maps to the minus genome strand Thus the reported SNP assay alleles and the SNP cDNA annotations are the reverse complement of one another TaqMan SNP Genotyping Assays User Guide 75 How to order TaqMan SNP Genotyping Assays How to order TaqMan Predes
68. ge 58 AmpliTag Gold polymerase was not efficiently activated due to incorrect thermal cycler method See Perform the PCR on page 26 AmpliTag Gold polymerase was not efficiently activated due to poor calibration of the thermal cycler See Instrument calibration on page 58 34 TaqMan SNP Genotyping Assays User Guide Appendix A Troubleshooting Troubleshooting the AD plot Observation Possible cause Recommended action Cloudy or diffuse clusters Allelic Discrimination Plot Sample Preparation Problems Samples are not in equal quantity due to degraded DNA See Degraded DNA on page 48 Samples are not in equal quantity due to inaccurate DNA quantitation See Inaccurate DNA quantitation on page 92 PCR inhibitors in sample See PCR inhibitors in sample on page 51 Assay Problems ROX dye not present in PCR Master Mix See Using a master mix without ROX dye on page 99 Evaporation from the reaction well See Evaporation from the reaction well on page 96 Pipetting errors See Pipetting errors on page 56 nstrument Problems ROX dye not designated as the reference dye See ROX dye not designated as reference on page 61 If only one cluster is present allelic discrimination plot incorrectly scaled See Single cluster assay on page 60 NTCs generate high fluo
69. gure 2 Ideally an AD plot shows one a good allelic two or three clusters and near the origin the no template controls NTCs described discrimination in Table 12 The points in each cluster are grouped closely together and each cluster is plot located well away from the other clusters Allelic Discrimination Plot Homozygote cluster Heterozygote cluster He AE ng Homozygote cluster i No template controls NTC 0 0 Figure 2 Typical 3 cluster allelic discrimination plot 30 TaqMan SNP Genotyping Assays User Guide Appendix A Troubleshooting Troubleshooting the AD plot Table 12 Assignment of clusters in an allelic discrimination plot Content of samples Location in AD plot Allele X homozygote labeled with VIC dye Lower right corner Allele Y homozygote labeled with FAM dye Upper left corner Approximately midway between Alleles X and Y heterozygote Allele X and Allele Y clusters No Template Control NTC Bottom left corner Anywhere outside the regions Undetermined described above ae With NTC cluster in the bottom left No amplification corner Troubleshooting the AD plot Unexpected AD plots do not always present a three cluster pattern for various reasons including patterns in AD genetic reasons However other issues such as sample preparation and or assay plots issues may also cause unexpected patterns The following table sum
70. hem individually Click Order Now to proceed to checkout You will have the option to review your order before finalizing it In the Review Order section you can e Delete an Assay e Change the size of a selected Assay e Change the quantity of a selected Assay e Add more items in your shopping cart e Select the conditioning of the Assays Individual tubes Other plating options see Plated formats on page 16 Note Once a TaqMan SNP Custom Assay has been designed it can be re ordered using Quick Order with its part number and Assay ID see Quick order on page 77 TaqMan SNP Genotyping Assays User Guide 79 About the Assay Information File AIF This appendix describes the assay information included in each shipment of TaqMan SNP Genotyping Assays About the Assay Information File AIF The CD ROM received with each TaqMan SNP Genotyping Assay order contains an Assay Information File The Assay Information File AIF e Is identical to AIFs of other TaqMan Genotyping Assay products e Includes the number of the bar code of the plate in which the assays are shipped e Is provided in three convenient formats atab delimited txt format that can be opened in Excel or similar spreadsheet programs abrowser readable hmt1 format not available for TaqMan DME Genotyping Assays a xml file that can be opened with a xml viewer e Includes up to 57 data fields depending on the type of assay a
71. ical reaction plate for thermal cycling Mix thoroughly after adding the reagents to the DNA samples to avoid stratification of the reagents and or air bubbles in the well which can lead to stringy clusters see Appendix A Troubleshooting Set up the PCR reactions Prepare the reaction mix The reaction mix is composed of 20X 40X or 80X TaqMan Genotyping Assay TaqMan Genotyping Master Mix and nuclease free water The recommended final reaction volume per well is 5 uL for a 384 well plate 10 uL for a 96 well Fast plate and 25 uL for a 96 well plate see Table 9 and Table 10 1 Calculate the number of reactions to be performed for each assay including recommended controls see Reagents and samples preparation on page 21 TaqMan SNP Genotyping Assays User Guide 22 Chapter 2 Genotyping experiment overview Set up the PCR reactions Note Multiple genotyping assays can be run on one reaction plate Controls for each assay must be included on the same plate 2 Calculate the total volume of each component needed for each assay using the following table Note Prepare excess volume to account for pipetting errors IMPORTANT Be sure to choose the appropriate DNA delivery method wet or dry according to the experiment type you wish to perform Table 9 Preparation of the reaction mix for wet DNA method E T 384 Well Plate 96 Well Fast Plate 96 Well Plate P 5 pL reaction 10
72. ice read and understand the safety information provided in the user documentation provided by the manufacturer of the instrument or device Before handling chemicals read and understand all applicable Safety Data Sheets SDSs and use appropriate personal protective equipment gloves gowns eye protection etc To obtain SDSs see the Documentation and Support section in this document 92 TaqMan SNP Genotyping Assays User Guide Appendix H Safety Chemical safety Chemical safety WARNING GENERAL CHEMICAL HANDLING To minimize hazards ensure laboratory personnel read and practice the general safety guidelines for chemical usage storage and waste provided below and consult the relevant SDS for specific precautions and instructions Read and understand the Safety Data Sheets SDSs provided by the chemical manufacturer before you store handle or work with any chemicals or hazardous materials To obtain SDSs see the Documentation and Support section in this document e Minimize contact with chemicals Wear appropriate personal protective equipment when handling chemicals for example safety glasses gloves or protective clothing Minimize the inhalation of chemicals Do not leave chemical containers open Use only with adequate ventilation for example fume hood Check regularly for chemical leaks or spills If a leak or spill occurs follow the manufacturer s cleanup procedures as recommended in the
73. ient mixing or centrifugation on page 97 nstrument Problems Thermal cycler poorly calibrated See Instrument calibration on page 58 Software Problems ROX dye not designated as the reference dye See ROX dye not designated as reference on page 61 32 TaqMan SNP Genotyping Assays User Guide Appendix A Troubleshooting Troubleshooting the AD plot Observation Possible cause Recommended action Some samples cluster with the NTCs Allelic Discrimination Plot SA aa 44 ela LS d Genetic Reasons Individual sample has two null alleles See Null alleles in an individual on page 41 SNP is triallelic See SNP is triallelic or tetra allelic on page 46 SNP is on the Y chromosome and some samples are female See Gene on the Y chromosome on page 48 Sample Preparation Problems Samples are not in equal quantity due to degraded DNA See Degraded DNA on page 48 Samples are not in equal quantity due to inaccurate DNA quantitation See Inaccurate DNA quantitation on page 52 PCR inhibitors in sample See PCR inhibitors in sample on page 51 Assay Problems Evaporation from the reaction well See Evaporation from the reaction well on page 56 DNA or reagent not added to the well See DNA or assay reagent not added to the reaction well on page 55
74. igned SNP and Drug Metabolism Genotyping Assays Assay part numbers Life Technologies website 76 Use the TaqMan Predesigned SNP Genotyping Assay part numbers that correspond to the type of assay and the number of reactions needed Table 19 Ordering information for TaqMan Predesigned SNP and Drug Metabolism Enzyme DME Genotyping Assays pene T Number of reactions Paru Cat no 384 well 96 well Human Mouse Pras Small 1500 300 40X 4351379 4351384 designed Medium 5000 1000 40X 4351376 4351382 a Large 12 000 2400 80X 4351374 4351380 DME Small 750 150 20X 4362691 To order one of the 4 5 million available assays from the Life Technologies website 1 Go to the Assay Search Tool at www lifetechnologies com to view the available TaqMan Predesigned SNP and Drug Metabolism Enzymes Genotyping Assays 2 Select SNP Genotyping for the type of experiment and All SNP Genotyping for the type of assay DME assays can be found by selecting either All SNP Genotyping or Drug Metabolism Assays 3 Choose the Species of interest 4 Enter your Target Information You can search by e Gene name e Gene symbol e RefSeq accession numbers TaqMan SNP Genotyping Assays User Guide Quick order 7 Appendix D How to order TaqMan SNP Genotyping Assays How to order TaqMan Custom SNP Genotyping Assays e SNP ID e Assay ID e Allele nomenclature available for Drug Metabolism As
75. ipt ID Sap Reference ANM 001733 detected by the assay ai NCBI SNP rs17611 Reference ID from NCBI CZ Reference dbSNP html Medline Reference N A N A txt Celera Discovery System S Celera ID hCV11720402 CDS unique SNP ID tx Celera Discovery System Celera SNP ID hCV11720402 CDS unique SNP ID html i CXT Cytogenic Band 9934 Cytoband location of the target sequence html SNP mutation type Acceptor splice site donor splice site txt SNP Type Missense intergenic unknown intron missense html mutation nonsense mutation silent mutation UTR 3 or UTR 5 Minor Allele Freq e ae aaa pas txt Ca c sian 0 48 genotyping at Life Technologies Caucasian html As calculated by SNP Minor Allele Freq genotyping at Life txt 4 0 14 African American Technologies African html American Minor Allele Freq Pee ele SE Sie txt Japanese 0 24 genotyping at Life P Technologies Japanese html Minor Allele Freq pete culstee by SNS txt Chinese 0 36 genotyping at Life Technologies Chinese html Celera Assembly i Build Number WA MA i 85 TaqMan SNP Genotyping Assays User Guide 86 Appendix E About the Assay Information File AIF Explanation of the AIF Columns Columns Example Description A EERS Format Location on Celera N A N A Poe Assembly NCBI assembly version NCBI Assembly from which the tx 37 Set ci Build Number coordinate position is html obtained Location on
76. ite at www lifetechnologies com termsandconditions If you have any questions please contact Life Technologies at www lifetechnologies com support TaqMan SNP Genotyping Assays User Guide 97 98 References Afonina I Zivarts M Kutyavin 1 et al 1997 Efficient priming of PCR with short oligonucleotides conjugated to a minor groove binder Nucleic Acids Res 25 2657 2660 Akane A Matsubara K Nakamura H Takahashi S and Kimura K 1994 Identification of the heme compound copurified with deoxyribonucleic acid DNA from bloodstains a major inhibitor of polymerase chain reaction PCR amplification J Forensic Sci 39 362 372 Bleasby K Hall L A Perry J L Mohrenweiser H W and Pritchard J B 2005 Functional Consequences of Single Nucleotide Polymorphisms in the Human Organic Anion Transporter hOAT1 SLC22A6 J Pharmacol and Exp Therapeutics 314 923 931 Bolt H M and Thier R 2006 Relevance of the deletion polymorphisms of the glutathione S transferases GSTT1 and GSTM1 in pharmacology and toxicology Current Drug Metabolism 7 613 628 Cho HJJ Lee S Y Ki C S and Kim J W 2005 GSTM1 GSTT1 and GSTP1 polymorphisms in the Korean population J Korean Med Sci 2005 20 1089 92 Dean M and Ballard J W O 2001 Factors affecting mitochondrial DNA quality from museum preserved Drolosphila simulans Entomologia Experimentalis et Applicata 98 279 283 DeFranchis R Cross N C P Foulk
77. ividuals should be trained according to applicable regulatory and company institution requirements before working with potentially biohazardous materials Follow all applicable local state provincial and or national regulations The following references provide general guidelines when handling biological samples in laboratory environment U S Department of Health and Human Services Biosafety in Microbiological and Biomedical Laboratories BMBL 5th Edition HHS Publication No CDC 21 1112 Revised December 2009 found at www cdc gov biosafety publications bmb15 BMBL pdf World Health Organization Laboratory Biosafety Manual 3rd Edition WHO CDS CSR LYO 2004 11 found at www who int csr resources publications biosafety Biosafety7 pdf TaqMan SNP Genotyping Assays User Guide Documentation and support Obtaining documentation Portable document format PDF versions of this guide and the documents listed in this section are available on the Life Technologies website at www lifetechnologies com suppotrt Note To open the user documentation use the Adobe Reader software available from www adobe com Table 24 Product documentation Document Publication number TaqMan Genotyping Master Mix Protocol 4371131 TaqMan Genotyping Master Mix Quick Reference Card 4371130 Custom TaqMan Assays Design and Ordering Guide 4367671 TaqMan Genotyper Software Getting Started Guide 4448637 TaqMan Genotyp
78. l and Array Card 96 well 96 well Fast 384 QuantStudio 12K Flex Real Time PCR System well Array Card and OpenArray Table 7 Consumables Item Cat no 1 5 mL Microcentrifuge tubes AM12400 For ordering information Reaction plates and accessories for Real Time PCR see Appendix F User system supplied materials and equipment 18 TaqMan SNP Genotyping Assays User Guide Chapter 1 Product Information User supplied materials aa ee Table 8 Reagents Reagent Volume Cat no 1 mL 4371353 10 mL 4371355 3 ener neu 10 mL 4381656 50 mL 4371357 2 x 50 mL 4381657 Nuclease free water 100 mL AM9938 11 2X TaqMan Genotyping Master Mix is the recommended master mix for use with DNA samples not prepared with TaqMan Sample to SNP Alternatively TaqMan SNP Custom SNP and DME Genotyping Assays are also compatible with e GTXpress Master Mix a component of the TaqMan Sample to SNP kit for ordering information see Appendix F User supplied materials and equipment e Universal Master Mix II Note It is not recommended to use Fast thermal cycling conditions for TaqMan DME Genotyping assays Use instead the DME Assay thermal cycling conditions described in Perform the PCR on page 26 TaqMan SNP Genotyping Assays User Guide 19 a y A 4 JF ay M me Genotyping experiment overview Z E Workflo
79. leles are present Table 13 Possible genotypes in a triallelic SNP Bases in DNA Possible Homozygotes Possible Heterozygotes Original SNP G T GG and TT GT Triallelic SNP G T A GG TT and AA AT GT and GA 75 fom Gy ot 50T 3 ai f A al Pica GAT REE 4 sil GOWA ati NTC ki TAG 250 yT T 0 ea Te Figure 9 Allelic discrimination plot for a triallelic SNP with genotype for each cluster shown When a gene is on the X chromosome and the population being studied is made up of both males and females the genotype frequencies of the samples do not correspond to the predicted autosomal Hardy Weinberg frequencies For a sample population composed of a mixture of males and females the number of heterozygotes will be noticeably lower than predicted by the Hardy Weinberg equilibrium equation None of the males should be heterozygous because males have only one X chromosome 47 Appendix A Troubleshooting Sample preparation problems Gene on the Y chromosome 20 18 s 1 6 1 4 12 12 10 1 0 l os 2 os m i i i i i 02 04 05 08 10 12 14 15 18 20 22 24 28 28 30 32 34 36 02 04 06 08 10 12 14 15 18 20 22 24 25 28 30 32 34 38 Figure 10 Allelic discrimination plot with a small number of heterozygotes for assay C__11617922_10 for SNO rs6324 in the MAOB gene colored by gender on the right panel blue female brown male What to do 1 Check the AIF included
80. lleles while others may exhibit trailing clusters in the allelic discrimination plots ROX dye is a passive reference that improves the precision of the results by compensating for small fluorescent fluctuations such as bubbles and small well to well variations that occur in the plate Life Technologies recommends using TaqMan Genotyping Master Mix that contains ROX as a passive reference dye Consult your specific instrument manual for more information on ROX designation for genotyping applications Outlier too far off scale If you have an assay that shows clustering around the NTCs you may want to look for data from an outlier sample In some cases the software scales to include the outlier giving the other samples the appearance of clustering around the NTC If you TaqMan SNP Genotyping Assays User Guide 61 62 Appendix A Troubleshooting Troubleshooting software problems remove the outlier from the analysis the software rescales the data and the analysis can proceed For more details on how to remove outlier refer to the user manual of your instrument or software Allelic Discrimination Plot Allelic Discrimination Plot Outlier circled in red Data reanalyzed with outlier omitted Figure 17 Data analyzed with and without outlier included What to do Remove the outlier s using the omit well function in your Real Time PCR Instrument software and re analyze The program will adjust the scaling NTCs no
81. lot for a triallelic gene additional clusters shown in pink What to do 1 Evaluate overall assay performance Are there consistent outlier samples 2 Examine the sample s performance in other assays to rule out problems caused by this particular sample such as sample impurity or degradation 3 Perform comparative sequencing on the subjects to verify the presence of more than two alleles 4 Repeat the experiment If the same samples are consistently located in the same outlier space away from the NTCs the heterozygotes and the homozygotes your gene may be triallelic TaqMan SNP Genotyping Assays User Guide Gene on the X chromosome TaqMan SNP Genotyping Assays User Guide Appendix A Troubleshooting Genetic issues 5 Check the literature for the SNP in question There may be newly reported polymorphisms described in the literature Calculate the allele frequencies for your plate and compare them to the literature to confirm your results agree with the literature Discussion If a SNP is triallelic you might see six clusters three homozygotes and three heterozygotes rather than the typical pattern of three clusters two homozygotes and one heterozygote If a SNP is tetra allelic the possible cluster pattern can be more complicated Figure 9 shows an assay created for the SNP rs2032582 in the ABCB1 gene which is known to have three alleles in several populations In the triallelic example in Figure 9 the following al
82. marizes unexpected patterns observed in AD plots and indicates the pages in this manual where a discussion of these patterns and their causes can be found Observation Possible cause Recommended action Only one or two clusters Genetic Reasons present MAF is too low for sample size See Low allele frequency on page 39 Alec Discrimination Pt from the tested population t 15 2002538 Allele X C_27861010_10_FAM TaqMan SNP Genotyping Assays User Guide 31 Appendix A Troubleshooting Troubleshooting the AD plot Observation Possible cause Recommended action Trailing clusters Allelic Discrimination Plot ve Sample Preparation Problems Samples are not in equal quantity due to degraded DNA See Degraded DNA on page 48 Samples are not in equal quantity due to inaccurate DNA quantitation See Inaccurate DNA quantitation on page 92 PCR inhibitors in sample See PCR inhibitors in sample on page 51 Assay Problems Reagents mishandled or expired See Reagents mishandled or expired on page 54 ROX dye not present in PCR master mix See Using a master mix without ROX dye on page 99 Evaporation from the reaction well See Evaporation from the reaction well on page 96 Pipetting errors See Pipetting errors on page 56 Inefficient mixing and or insufficient centrifugation See Ineffic
83. morphism based on the change in fluorescence of the dyes associated with the probes see Table 16 About the probes The TaqMan MGB Probes consist of target specific oligonucleotides with e A reporter dye is linked to the 5 end of each probe VIC dye for Allele 1 probe FAM dye for Allele 2 probe e A minor groove binder MGB which increases the melting temperature Tmn without increasing probe length Afonina 1997 Kutyavin 1997 thus allowing the design of shorter probes Shorter probes result in greater differences in Tm values between matched and mismatched probes e A non fluorescent quencher NFQ at the 3 end of the probe Table 16 Correlation between fluorescence signals and sample sequence Fluorescence Signals Sample Genotype VIC signal Homozygosity for Allele 1 FAM signal Homozygosity for Allele 2 VIC and FAM signals Heterozygosity Allele 1 Allele 2 TaqMan SNP Genotyping Assays User Guide 65 Appendix B Overview of the TaqMan SNP Genotyping Assays Basics of 5 nuclease assay Basics of 5 nuclease assay PCR principles e Genomic DNA is introduced into a reaction mixture consisting of TaqMan Genotyping Master Mix forward and reverse primers and two TaqMan MGB Probes e Each TaqMan MGB Probe anneals specifically to a complementary sequence if present between the forward and reverse primer sites When the probe is intact the proximity of the quencher dye to the
84. mp Optical 96 Well Reaction Plate with Barcode 500 plates Cat no 4326659 20 plates Cat no 4306737 icroAmp Optical Adhesive Film 100 films Cat no 4311971 MicroAmp Optical Film Compression Pad 5 pads Cat no 4312639 icroAmp Optical 8 Cap Strip 300 strips Cat no 4323032 MicroAmp Snap On Optical Film Compression Pad for use with the automation accessory Cat no 4333292 icroAmp Adhesive Film Applicator Cat no 4333183 z z z 7900HT 7900HT Fast System Fast 96 Well Block Module z MicroAmp Fast Optical 96 Well Reaction Plate with Barcode 200 plates Cat no 4366932 20 plates Cat no 4346906 MicroAmp Optical Adhesive Film 100 films Cat no 4311971 MicroAmp Adhesive Film Applicator Cat no 4333183 Table 23 Optional Master Mix reagents Product Volume Cat no 5 mL Sample prep 1 mL PCR 4403313 7 200 mL Sample prep 10 mL PCR 4403081 TaqMan Sample to SNP Kit 20 mL Sample prep 10 mL PCR 4403083 20 mL Sample prep 50 mL PCR 440387 TaqMan SNP Genotyping Assays User Guide 89 90 Appendix F User supplied materials and equipment Product Volume Cat no m 400 reactions 4403311 TaqMan GTXpress Master Mix 4000 reactions 4401892 7 20 000 reactions 4401890 TaqMan GTXpress Master Mix 40 000 reactions 4401857 using GTXpress Master Mix TaqMan SNP
85. n For example for a SNP with a MAF of 5 0 05 the predicted frequencies are 0 0025 q q 0 095 q p and 0 9025 p p If the allele frequencies are reversed you see 0 9025 q q 0 095 q p and 0 0025 p p Reporter dye assigned incorrectly to the allele in the detector In the software you must set up two detectors and one marker in order for the alleles to be called The detector defines which dye is assigned to the allele If you inadvertently assigned the dyes to the wrong alleles when you created the detectors the observed frequencies will be the reverse of those predicted from the Hardy Weinberg equation Note The AIF included with your order contains the correct allele dye assignments In the software you must set up one marker for each assay run on the plate Running more than one assay per marker can result in more than three clusters in the allelic discrimination plot TaqMan SNP Genotyping Assays User Guide 63 64 Appendix A Troubleshooting Troubleshooting software problems Allelic Discrimination Plot Allelic Discrimination Plot 42 42 rd if ae b wrt 37 37 iq RZ e pi HEI Te vhe ia ae oe ent prt 2 Fi ER T 32 PE ET fe tet 4 Weer 7 27 Eh x 27 id x 22 22 17 17 gt ve 12 2 te Fa eet Ladeser ls PET be 7 is eee PH e k 07 a ve d e a J fat ee x 02 02 Q aoo Fy 1 0 3 0 60 7 0 90 0 0 1 0 20 3 0 40 5 0 6 0 7
86. nd the file format see Table 21 AIF can be used to e Identify the assay included in each tube e Locate each tube in the assay rack e Provide the 2 D bar code for each tube e Determine assay IDs e Identify the chromosome location of the SNP e View the minor allele frequencies in Caucasian African American Japanese and Chinese populations when available for Predesigned SNP and Drug Metabolism Enzyme Genotyping Assays only e View the context sequence for Predesigned SNP and Drug Metabolism Enzyme Genotyping Assays only e View the assay sequence for Custom SNP Genotyping Assays only 80 TaqMan SNP Genotyping Assays User Guide Appendix E About the Assay Information File AIF For LIMS users For LIMS users The AIF on the CD ROM is named so a LIMS system can automatically upload it The AIF name has the following format Assay Type xx yy txt where e Assay Type refers to TaqMan Predesigned SNP Drug Metabolism or Custom SNP Genotyping Assay e xx is the order number up to 10 characters e yy is the plate ID number up to 10 characters AIF and tube contents To determine the contents of each assay tube match the Assay ID on the tube label with the values of the Assay ID and Well Location columns in the AIF The Well Location column indicates the plate rack position for the assay in the corresponding row of the AIF Explanation of the AIF Columns The table below describes the AIF columns Note Because the i
87. nformation in the AIF varies by product line not all the fields are populated for all assay types Refer to the Understanding your shipment document included in your order for a description of the AIF columns pertinent to your assay The format of the AIF where the fields can be found is indicated in the following table in the rightmost column Table 21 Description of the AIF columns Columns Example Description Alr rile Format TXT Customer Name University of X Name af ime customers organization or institution html Customer sales order Order Number 185185185 number unique to an txt order Sales Order Customer sales order 185185185 number unique to an html Number order Contact Name John Doe Name of the customer html XML Template Version of the template in Version 2 0 which the AIF is created cee TaqMan SNP Genotyping Assays User Guide 81 Appendix E About the Assay Information File AIF Explanation of the AIF Columns Columns Example Description AIE FIS Format txt Assay Name MyAssay For custom assays only provided by the customer tmi Date when the product Expiration Date 28 AUG 2018 expired and should no html longer be used Databases used to _ Annotation Sources NCBI annotate the AIF html Date when the product Jext Ship Date 15 JAN 13 was packaged for shipment html Seepackinaslple Shipment unique number Delivery Number
88. ng genomic DNA including e UV spectroscopy TaqMan SNP Genotyping Assays User Guide Appendix A Troubleshooting Sample preparation problems e Absolute quantitation e Fluorometric analysis Life Technologies recommends quantitating g DNA using UV spectroscopy or absolute quantitation using the TaqMan RNase P method UV spectroscopy UV Spectroscopy is the most widely used method for quantifying all types of DNA however the consumable reagents used in the process vary greatly A spectrophotometer must be set up correctly for the reagents and equipment used Optical plastic cuvettes and plates have different background constants than quartz cuvettes and plates consult the instrument s manual for ways to determine the background constant Also be cautious of the diluents used with the g DNA samples They too can have differing properties and may affect the final results UV spectroscopy can be used to quantitate gDNA by reading sample absorbance at 260 nm A260 The A260 is most accurate when using pure nucleic acid and is most useful for DNA in microgram quantities Gallagher 1994 Proteins particles in the solution and aromatic chemicals can affect the reading Samples are usually concurrently read at 280 nm to determine the concentration of contaminating proteins The A260 A2g0 ratio is used to determine purity of a DNA sample see PCR inhibitors in sample on page 51 The effective read range of UV spectroscopy is
89. nome The SNP alleles are included in brackets where the order of the alleles corresponds to the association with probe reporter dyes where Allele 1 VIC dye Allele 2 FAM dye If the context sequence is XXXXX A B XXXXX e A allele always represents the VIC dye TM e B allele always represents the FAM dye For example the sequence clip in Table 2 would result in the following allele to dye association e Line 1 VIC dye associated with the G allele FAM dye associated with the A allele e Line 2 VIC T FAM C e Line 3 VIC G FAM A e Line 4 VIC T FAM C Table 2 Sequence clips from an Assay Information File showing the targeted SNP in square brackets Context Sequence Line 1 GAGGGGAGGCGGCTGCCCACCCTTC G A ACACTATTACCCATCGGTCA CTTGT Line 2 GATACTGCTTTTCCTATTAACCCAT T C AGTGATGGGGTCAGAAGGCT GAGGC Line 3 TTCCACAAGTTCTCAAAGCAACTAT G A TTCATAACTTAATCTCTCTT Line 4 ATTGACATCTGTATAAACCGTGTGA T C GGCAGTGATTTAGTAACTTT TTGTC Each TaqMan SNP Genotyping Assay shipment consists of e One tube for each TaqMan assay ordered Each tube is identified with a label on the side and a 2 D bar code on the bottom e A copy of the Safety Data Sheet SDS TaqMan SNP Genotyping Assays User Guide 11 z9 2 E fat E las A Product overview Chapter 1 Product Information e A CD ROM containing documen
90. nse nonsense silent polymorphisms as well as SNPs in splice site acceptor regions splice site donor regions and the 5 UTR were chosen Additional intronic polymorphisms were included only when these were available from the public allele nomenclature web sites 5 For all polymorphisms repetitive regions non target polymorphisms and putative polymorphisms within 300 bases on either side of the SNP of interest were masked to avoid assays with potential polymorphisms under probes and primers 6 The masked sequence was sent to the Life Technologies proprietary TaqMan Assay Design Software 7 The resulting assay design was mapped to the genome again using the BLAST database search algorithm to ensure the primers and probes are specific for the target polymorphism 8 Ifthe assay design mapped with sufficient specificity it was synthesized and submitted for wet lab testing see Wet testing of assays on page 72 Assays that failed wet lab testing were resubmitted to the assay design software to generate alternative assay designs To address the homology issues within the DME genes and to ensure specificity of these assays Life Technologies created assay designs that resulted in amplicon lengths greater in general than those for other TaqMan Genomic Assay product lines The average amplicon length for the TaqMan Drug Metabolism Genotyping Assays is 160 base pairs compared to 100 base pairs for other Life Technologies Taq
91. om the analysis Consult your instrument user manual for information on how to check and uncheck Omit well options To assist with cluster calling the Real Time PCR Instrument Software can autocall the data When autocalling fails you will see X on the plot rather than the symbol for called alleles There are some instances where the software will not autocall the data e Autocall is not selected on page 60 e Two cluster calling not selected on page 60 e Single cluster assay on page 60 e ROX dye not designated as reference on page 61 e Outlier too far off scale on page 61 e NTCs not assigned on page 62 Autocall is not selected The software will not autocall unless the autocall option is selected If autocall is not selected the allelic discrimination plot shows all the calls as X Refer to your instrument manual for instructions on how to use autocall options Two cluster calling not selected The 2 cluster calling option in the Real Time PCR Instrument Software must be selected if the software is to successfully autocall plates when only two clusters are detected Detection of only two clusters can happen if the MAF is low and or you ran too few samples to detect all three genotypes If this is the case you must select the two cluster calling option and re analyze the plate Single cluster assay The Real Time PCR Instrument Software cannot autocall single cluster assays For many assay sampl
92. omic DNA samples from TagMan SNP Genotyping Assays User Guide TaqMan Drug Metabolism Enzyme Genotyping Assays TaqMan Custom SNP Genotyping Assays Chapter 1 Product Information TE Product overview Rage Coriell cell lines before shipment upon first order Within the panel there are 8 female and 12 male samples Of this set of 20 DNAs there are 7 Caucasian 7 African American and 6 Asian descent samples Quality of repeat orders are verified by mass spectrometry and concentration measurement TaqMan Drug Metabolism Enzyme DME Genotyping Assays offer a comprehensive collection of assays optimized for genotyping SNPs insertions and deletions indels and multi nucleotide polymorphisms MNPs in drug metabolism related genes The TaqMan DME Genotyping Assays collection of 2 700 assays detect potentially causative polymorphisms in 221 drug metabolism enzyme and associated transporter genes For more information on DME genes and assay development see Appendix C About the Drug Metabolism Enzyme genes TaqMan DME Genotyping Assays are inventoried for fast availability Create your own assays by submitting confidential target sequences to our secure assay design pipeline using the TaqMan Custom Assay Design Tool CADT All human SNP genotyping assays are functionally tested on 20 unique DNA samples to ensure assay amplification and sample clustering These custom assays are designed synthesized formulated o
93. page 44 SNP is triallelic or tetra allelic See SNP is triallelic or tetra allelic on page 46 Software Problems Several assays were run but only one marker was assigned See Too many alleles called in AD plot on page 63 Vector clusters sample data has two clusters at the same angle Allelic Discriminat tion Plot Genetic Reasons Additional SNP under probe See Additional SNP present under the probe or primer on page 42 een yooh Copy number polymorphism See Gene has a copy number polymorphism on page 44 Sample Preparation Problems Samples not in equal quantity due to degraded DNA See Degraded DNA on page 48 Samples not in equal quantity due to inaccurate DNA quantitation See Inaccurate DNA quantitation on page 92 Genetic issues Genetic issues may cause atypical or unexpected assay results including e Low allele frequency on page 39 e Null alleles in an individual on page 41 e Additional SNP present under the probe or primer on page 42 e Gene has a copy number polymorphism on page 44 e SNP is triallelic or tetra allelic on page 46 38 TaqMan SNP Genotyping Assays User Guide Low allele frequency Appendix A Troubleshooting Genetic issues e Gene on the X chromosome on page 47 e Gene on the Y chromosome on page 48 Use this section to determine the reasons for
94. periment overview 5 Post PCR plate read and analysis N a e Transfer studies from one TaqMan Genotyper Software application to another e Ensure data security The security feature allows you to Set security parameters to manage users set up user accounts and assign user roles Track changes to the data For more information on using TaqMan Genotyper Software consult TaqMan Genotyper Software Getting Started Guide Pub no 4448637 Resources for Data analysis varies depending on the instrument Refer to the following documents data analysis for more information about analyzing your data e The appropriate instrument user guide see Obtaining documentation on page 95 TaqMan Genotyper Software Getting Started Guide Pub no 4448637 e Life Technologies website for a variety of tutorials on how to analyze data from TaqMan Genotyping Assays see Obtaining support on page 97 TaqMan SNP Genotyping Assays User Guide 29 Troubleshooting About the allelic discrimination plot Problems with sample preparation running the assay the instrument and or software can give rise to atypical results in the allelic discrimination plot also known as a cluster plot a scatter plot or an AD plot The genetic characteristics of the assay and or the sample can also lead to unexpected results in the allelic discrimination plot Characteristics of An allelic discrimination plot is shown in Fi
95. population that would be homozygous for the minor allele qq heterozygous qp and homozygous for the major allele pp respectively 3 Multiply your sample size by the fraction for each allele to determine the number of individuals with each genotype that you should expect to see If your sample size is small you may not be able to detect rare alleles Example calculation For a SNP with a MAF of 5 0 05 the predicted frequencies are 0 0025 q q 0 095 q p and 0 9025 p p If you test of 20 genomic DNA samples from this population you might expect e Homozygotes for the minor allele 0 0025 x 20 0 05 no individuals e Heterozygotes 0 095 x 20 1 9 about 2 individuals e Homozygotes for the major allele 0 9025 x 20 18 05 about 18 individuals To detect one homozygote for the minor allele it would take a sample size of approximately 400 individuals Sample Size 1 MAF Discussion Several of the assays in TaqMan SNP and DME Assays collection show low or 0 for the minor allele frequency Many of these SNPs are believed to be functional polymorphisms which may occur at very low frequencies depending on the population you are studying Many functional polymorphisms occur at low frequencies Wong 2003 The MAF indicates the frequency of the less frequent allele in a population Traditionally only the minor allele frequency is reported The major allele frequency is calculated as 1 MAF From the MAF you can calculate
96. priate range for your samples SYBR Green is a dye which binds only to double stranded DNA dsDNA Quantitation with SYBR Green assay chemistry is less specific than TaqMan assay TaqMan SNP Genotyping Assays User Guide 53 Appendix A Troubleshooting Assay problems chemistry because the dye binds to any dsDNA whereas TaqMan reagent chemistry targets a specific DNA sequence The SYBR Green method requires melt curve analysis to verify the specificity of the assay For either technique be sure to run the standard curve and unknown samples on the same plates in the Real Time PCR instrument Fluorometric analysis You can quantitate DNA by fluorometric analysis using various intercalating dyes These are summarized in Table 15 Table 15 Dyes used for fluorometric DNA quantitation Dye Features Hoechst 33285 e More sensitive than spectrophotometric measurements due to low affinity for RNA e Base composition of DNA can affect readings because the dye binds preferentially to 5 AT 3 rich DNA Ethidium bromide e Capable of detecting ng levels of DNA e Not base composition sensitive e Binds to RNA e Ideal for relatively pure DNA with a high 5 Gc 3 content PicoGreen 1000 ng mL of dsRNA e Can quantitate as little as 25 pg mL to Assay problems Reagents mishandled or expired 54 Problems with preparing the assay may include Reagents mishandled or expired on
97. ptical Adhesive Film or MicroAmp Optical Caps if you are using a MicroAmp Optical 96 well plate Seal the plate with a MicroAmp Adhesive Film Applicator IMPORTANT Use a MicroAmp Optical Film Compression Pad when using MicroAmp Optical Adhesive Film with a MicroAmp Optical 96 well plate on the 7900HT Real Time PCR System or 9800 thermal cycler MicroAmp Optical 96 or 384 well plate on the GeneAmp PCR System 9700 8 Centrifuge the plate briefly to spin down the contents and eliminate air bubbles from the solutions Prepare the reaction plate with the DNA dry down method 1 Pipette and dry the sample a Pipette one control or sample 1 20 ng of purified gDNA or no template control consisting of nuclease free water in each well of a MicroAmp Optical 96 or 384 Well Reaction Plate Use a calibrated positive displacement pipettor to minimize contamination and error IMPORTANT Use sample volumes of 2 5 uL to minimize drying time b Dry down the samples completely by evaporation at room temperature in a dark amplicon free location Cover the plate with a lint free tissue while drying IMPORTANT In the case of gDNA do not accelerate drying by heating the plate Heating the plate may cause poor gDNA recovery 2 Pipette the reaction mix see Prepare the reaction mix on page 21 into each well of the reaction plate Use the appropriate volumes listed in Table 10 TaqMan SNP Genotyping As
98. ptimized and quality control tested TaqMan Custom SNP Genotyping Assays allow you to e Perform genotyping studies with any possible SNP in any organism For example AGTTCATCCATGGTCA AGTTCATACATGGTCA annotated as AGTTCAT C A CATGGTCA e Detect indels of up to six bases for genotyping studies For example AGTTCATCCATGGTCA P AGTTCATGGTCA annotated as AGTTCAT CCAT GGTCA e Detect MNPs of up to six bases for genotyping studies For example AGTTCATCCATGGTCA P AGTTCATATATGGTCA annotated as AGTTCAT CC AT ATGGTCA SNP assay sequences can also be submitted directly into the CADT to manufacture a specific known assay sequence Product overview TaqMan SNP Genotyping Assays User Guide SNP Genotyping Assays contain VIC dye labeled probe FAM dye labeled probe and two target specific primers TaqMan probes incorporate MGB technology at the 3 end to deliver superior allelic discrimination The MGB molecule binds to the DNA helix minor groove improving hybridization based assays by stabilizing the MGB probe template complex This increased binding stability permits the use of probes as short as 13 bases for improved mismatch discrimination and greater flexibility when designing assays for difficult or variable sequences All MGB probes also include a non fluorescent quencher NFQ that virtually eliminates the background fluorescence and provides excellent signal to noise ratio for superior assay sensitivity Chapter
99. rboxyl group on the target small molecule Examples of Phase I enzymes are the cytochrome P450 gene super family and the alcohol dehydrogenase gene family Four members of the P450 super family CYP3A CYP2D6 CYP2C19 and CYP2C9 account for almost 50 of metabolism of commonly used drugs Wilkinson 2005 e Phase II enzymes Involve the conjugation of various cofactors to functional groups on small molecules that are often exposed or created by a Phase I reaction Phase II reactions include glucuronidation acetylation and sulfation Phase II reactions often increase the hydrophilicity of a compound thereby enhancing its excretion from the body This class includes the UDPglucuronosy transferase UGT family that metabolizes morphine and thiopurine S methyltransferase TMPT that metabolizes Captropril Shastry 2006 e Drug transporters Expressed in liver kidney and the intestines involved in the elimination of xenobiotics from the body This class of protein includes organic TaqMan SNP Genotyping Assays User Guide Allele nomenclature Appendix C About the Drug Metabolism Enzyme genes ntroduction to the Drug Metabolism Enzyme genes anion transporters organic cation transporters peptide transporters and nucleoside transporters Many of these proteins exhibit broad substrate specificity which can lead to significant drug drug interactions at the transporter level Examples of transporters are the multidrug resistance asso
100. reign compounds for example naturally occurring compounds like prostaglandins drugs and environmental agents Genes that code for these enzymes are often referred to as DME genes Polymorphisms in the DME genes may influence the rate of foreign compound metabolism and or excretion among individuals thereby potentially affecting foreign compound efficacy and or toxicity Several of these polymorphisms may affect drug efficacy and toxicity Eichelbaum 2006 Roses 2004 For example there are over 100 known variants of the CYP2D6 gene Some of these variations result in a complete loss of enzymatic activity while some of the variants only reduce catalytic activity http http www cypalleles ki se cyp2d6 htm TaqMan Drug Metabolism Genotyping Assays are designed to detect polymorphisms such as SNPs indels and MNPs in the genes that code for the drug metabolism enzymes and drug transporters The terms SNP and polymorphism will be used interchangeably throughout the rest of this appendix and refer to all of these polymorphisms The products of DME genes are Phase I and Phase II drug metabolism enzymes transmembrane transporters and other gene products thought to be involved in the metabolism of endogenous compounds and xenobiotics in humans e Phase I enzymes Involve the hydrolysis oxidation or reduction of xenobiotic compounds These enzymes either create or expose a functional group such as a hydroxyl group or ca
101. reporter dye suppresses the reporter fluorescence e As shown in Figure 20 the exonuclease activity of AmpliTaq Gold DNA Polymerase cleaves only probes hybridized to the target Cleavage separates the reporter dye from the quencher dye increasing fluorescence by the reporter 1 Assay Components and DNA Template Se Probe ys Probe Forward primer Ve j Re A verse primer G Wy 5 F DNA template G A C T 5 2 Denatured Template and Annealing Assay Components Bg g LEGEND PE VIC dye Probe AS Probe Reverse primer sae Vip FAM dye G A Forward primer G DN AC i ETT l Quencher Minor Groove Binder AmpliTaq Gold 3 Polymerization and Signal Generation Cece TUL D hi DNA Polymerase Reverse primer Probe Probe wie a g U lt Primer Forward primer 3 fuca Template A A CL Extended Primer Figure 20 TaqMan Reagents detection process The increase in fluorescence occurs only if the amplified target sequence is complementary to the probe Thus the fluorescence signal generated by PCR amplification indicates which alleles are in the sample 66 TaqMan SNP Genotyping Assays User Guide g Mismatches between probes and target sequences Data analysis Appendix B Overview of the TaqMan SNP Genotyping Assays Basics of 5 nuclease assay The probes in SNP Genotyping Assays are d
102. rescence signals that cluster with samples rather than close to the origin Allelic Discrimination Plot Assay Problems Reagents mishandled or expired See Reagents mishandled or expired on page 54 x x xe x x Contamination due to poor laboratory practices See Appendix G Good laboratory practices for PCR RT PCR nstrument Problems Block contaminated See Routine instrument maintenance on page 58 Software Problems Reporter dye assigned incorrectly See ROX dye not designated as reference on page 61 TaqMan SNP Genotyping Assays User Guide 35 Appendix A Troubleshooting Troubleshooting the AD plot Observation Possible cause Recommended action Sample or samples did not cluster with specific allele Genetic Reasons Additional SNP under primer See Additional SNP present under the probe or primer on page 42 SNP is triallelic or tetra allelic See SNP is triallelic or tetra allelic on page 46 Copy number polymorphism See Gene has a copy number polymorphism on page 44 Note In this plot Homozygotes are blue and green Heterozygotes are black e NTCs are light blue Outliers are pink Sample Preparation Problems 2 24 26 28 30 32 34 36 38 40 Samples are not in equal quantity due to degraded DNA See Degraded DNA on page 48 Samples
103. rmation about the AIF see Appendix E About the Assay Information File AIF 12 TaqMan SNP Genotyping Assays User Guide Chapter 1 Product Information TE Storage and handling recommendations F About the Drug The TaqMan Drug Metabolism Index contains a comprehensive list of the DME Metabolism assays with annotations that include Enzyme Assay e The gene to which the polymorphism location is mapped Index Allele nomenclature from public allele nomenclature sites when available Polymorphism for example A G Context sequence Amino acid change if applicable Phenotype from PharmGKB Life Technologies MAF data To download the TaqMan Drug Metabolism Index go to http www lifetechnologies com taqmandme Storage and handling recommendations Storage and stability Store the SNP Genotyping Assays at 15 to 25 C in the dark IMPORTANT Protect TaqMan Assays from direct exposure to light Excessive exposure to light may affect the fluorescent probes Do not perform more than 10 freeze thaw cycles If you expect to freeze thaw TaqMan Assays more than three times consider aliquoting the Assays to minimize the number of freeze thaw cycles Life Technologies recommends diluting the 40X and 80X TaqMan Predesigned and Custom SNP Genotyping Assays to a 20X working stock see Perform the dilution of SNP Genotyping Assays on page 13 TaqMan SNP Assay products are stable for up to
104. s one null allele e Cluster with the NTCs when there are two null alleles If an individual sample consistently clusters with the NTCs for a particular assay it may indicate the individual has a null allele There are documented occurrences of null alleles in the genes CYP2A6 Topcul 2002 GSTM1 Smits 2003 GSTT1 Bolt 2006 Thier 2006 Cho 2005 Rebbeck 1997 and CYP2D6 Luo 2005 Zanger 2004 in TaqMan Drug Metabolism Genotyping Assays collection Allelic Discrimination Plot Uncalled samples 70 indicated by Xs x x x x x s t TR NTCs indicated by squares Area of plot around NTC zoomed in Allele Y C__8717770_20_FAM A Sh te 02 07 12 17 22 27 32 37 42 Allele X C__874777_20_vIC Figure 4 Allelic discrimination plot showing a null allele for the assay C__8717770_20 What to do 1 Evaluate the overall assay performance e Do the assay results appear in tight clusters e Do the clusters have good separation 1 Repeat the experiment If the same sample s consistently cluster with the NTC while other samples show fluorescence a null allele may be present TaqMan SNP Genotyping Assays User Guide 41 Appendix A Troubleshooting Genetic issues Additional SNP present under the probe or primer 42 2 Examine the sample s performance in other assays to rule out problems caused by this particular sample such as sample impurity or degradation
105. s sie testidoeea ee evdwadu dees nee ae nhnoe een ee eae bes dees 11 Context sequence representation cee eee eee eee eee 11 Shipment contents 0 a eee eee eee 11 About the Assay Information File 0000s cece eee eee eee eeeees 12 About the Drug Metabolism Enzyme Assay Index 02 02 e eee eee eee 13 Storage and handling recommendations 000c eee eee eee eee 13 Storage and stability 0 00 c eee eee 13 Perform the dilution of SNP Genotyping Assays 002 0c eee eee eee 13 Work low cctatccwte kee the cee dre tare ean deed werent ected Seale 14 Ordering ASSAYS cimeri nity etic ae nog Hp e E Gennes ioa iE ee E Aa tuners ied 14 TaqMan Predesigned SNP and DME Genotyping Assays 2 2 005 14 TaqMan Custom SNP Genotyping Assays 00 e eee eee eee 15 Plated formats lt 5 0 0 skies cnet Rae sate he Se SG ga Ee eel de edad 16 96 or 384 well plates 0 0 c ee eee eee 16 OpenArray Plats cecal a AE TAr teeta ceaanton ates mam ee eae aie eat ane ENE ae sees nes 16 User supplied materials 0 00 c cee ee nents 16 For sample preparation 0 000 e eee teens 16 To penton the PER soep irora ose ch nce anie duce signe E a ede E A a a 17 TaqMan SNP Genotyping Assays User Guide 3 Contents m CHAPTER2 Genotyping experiment overview 0 cceeeeeeees 20 WorkiloW nu sirens ceeds ieee and saranda EEE a i E EE E
106. says User Guide 25 ai Chapter 2 Genotyping experiment overview E lt Perform the PCR 3 Perform the PCR Cover the plate with MicroAmp Optical Adhesive Film Seal the plate with a MicroAmp Adhesive Film Applicator IMPORTANT Use a MicroAmp Optical Film Compression Pad when using MicroAmp Optical Adhesive Film with a MicroAmp Optical 96 well plate on the 7900HT Real Time PCR System or 9800 thermal cycler MicroAmp Optical 96 or 384 well plate on the GeneAmp PCR System 9700 Centrifuge the plate briefly to spin down the contents and eliminate any air bubbles from the solutions Refer to the appropriate instrument user guide for help with programming the thermal cycling conditions or with running the plate 1 26 Use the thermal cycling conditions specified in the following table Predesigned SNP and Custom S DME Step NP Temp Duration Cycles Temp Duration Cycles AmpliTaq Gold UP 95 C 10 minutes HOLD 95 C 10 minutes HOLD Enzyme Activation Denaturation 95 C 15 seconds 95 C 15 seconds 40 50 gee 60 C 1minute 60 C 90 seconds Extension Note TaqMan DME Genotyping Assays use a 90 second extension time and 50 cycles These conditions are for optimal performance due to the longer average amplicon size of TaqMan DME Assays compared to that of TaqMan SNP Genotyping Assays IMPORTANT These conditions are optimized for use onl
107. says for which this information has been mapped e Genomic location Select Search From the search result page you will be supplied with a list of assays that match your search criteria including information on annotation for assays and SNPs Select the assays to add to your shopping cart Note You must be logged on to add assays to your shopping cart View your shopping cart to select assay scales and complete your order If you have already chosen the TaqMan Predesigned SNP or Drug Metabolism Enzyme Genotyping Assay needed or you have selected TaqMan Drug Metabolism genotyping Assays from the DME Index available at http lwww ifetechnologies com snpandme you can order using the Quick Order tool 1 2 Go to www lifetechnologies com Ensure you are signed in to your account Select Quick Order from the top Menu bar Enter the part number Assay ID s and the quantity Click Add to Cart and proceed to checkout How to order TaqMan Custom SNP Genotyping Assays Assays part numbers Use the TaqMan Custom SNP Genotyping Assay part numbers that correspond to the type of assay and the number of reactions needed Table 20 Ordering information for TaqMan Custom SNP Genotyping Assays Number of reactions Cat no Assay mix Product Scale formulation Non 384 well 96 well Human Auman Small 1500 300 40X 4331349 4332077 a Medium 5000 1000 40X 4332072 4332075 Large
108. show a trailing cluster e Extreme evaporation occurring early in the reaction The PCR reaction fails and the samples cluster with the NTC Pipetting errors Pipetting errors can cause inconsistent delivery of reagents or sample to the wells which can cause e Trailing clusters e Some or all samples clustering with the NTCs e Cloudy or diffuse clusters e One or samples that do not cluster with a specific allele i e an outlier What to do e Improve pipetting precision as follows Calibrate and clean the pipettors regularly Pipette larger volumes no less than 5 uL for greater accuracy and precision 56 TaqMan SNP Genotyping Assays User Guide Inefficient mixing or centrifugation Assay has high background fluorescence More than one sample in the well Appendix A Troubleshooting Assay problems Reduce the number of pipetting steps whenever possible Increase the consistency of the pipetting method such as using robotic pipetting Consult the manufacturer about the correct method of dispensing liquid volumes accurately from the pipettor For example some pipettors are designed to deliver the designated volume at the first plunger stop so blowing out the residual volume may cause errors e Validate your pipetting process by preparing a replicate plate same assay and sample over a plate to be sure results are reproducible Insufficient mixing or centrifugation can cause trailing clusters in the
109. submitted directly to CADT for synthesis Assays are shipped only if they pass the following analytical quality control criteria e Each primer and probe is individually tested by mass spectroscopy to verify the accuracy and the yield of the resulting synthesized oligonucleotide e Assays must meet probe and primer yield specifications as performed by mass spectroscopy e Human SNP Genotyping Assays are tested using 20 human genomic DNA samples for 3 populations To pass this functional test amplification must occur and at least one allelic discrimination cluster heterozygous or homozygous compared to no template controls must be generated Non human SNP Genotyping Assays are not functionally tested TaqMan SNP Genotyping Assays User Guide 15 Bick D E ES E K Y A Plated formats Plated formats 96 or 384 well plates OpenArray Plates Chapter 1 Product Information Note Custom SNP Assays are not covered by the TaqMan Assays QPCR guarantee see TaqMan Assays QPCR Guarantee on page 96 for details For more information on ordering TaqMan Custom SNP Genotyping Assays consult How to order TaqMan Custom SNP Genotyping Assays on page 77 For projects that require analyzing a large number of samples or for evaluating samples for a large number of SNPs assays may be ordered in plated formats TaqMan SNP Assays can be ordered pre plated into Fast or standard 96 or 384 well plates or TaqMan Array
110. t assigned If the wells containing the NTCs are not assigned with the NTC task in the software the software may not call the alleles TagMan SNP Genotyping Assays User Guide Homozygous allele frequencies reversed Too many alleles called in AD plot Allelic Discrimination Plot 6 0 6 0 Tro Appendix A Troubleshooting ubleshooting software problems Allelic Discrimination Plot x x re x x 6 0 50 x i x x x La x xx x y re aR x ea X a 40 Xx X Mx 4 0 oe gt a p x x os Xx tr x A 2 x x x EAA pir 2 KH x pol gie ef er x Wo X torre 3 0 Xx A led Bee kak 45 d x x x gt Fls x A x H E 2 0 as ER a EB x x P x 2 0 le gt x Xxx 0 0 0 0 BUI OOF EN SS SE D EG SS GG 3 L 03 08 13 18 03 08 13 18 Without NTCs labeled With NTCs assigned Figure 18 Data analyzed with and without the NTCs assigned What to do In some instances where the data is diffuse and software does not autocall labeling the NTC wells with the NTC task provides a point of reference for the software improving clustering and autocalling Assign the NTC task to the NTC wells in the plate and re analyze the data Refer to the instruction manual appropriate for your software Note NTCs are not required for autocalling Your observed major and minor allele frequencies for homozygotes are reversed from those predicted by the Hardy Weinberg Equilibrium equatio
111. ted method must minimize degradation and remove inhibitors One method for assessing DNA purity is to calculate the A260 A280 ratio In addition absorbance at 230 nm can indicate the presence of phenol Gallagher 1994 In Life Technologies laboratories A260 A2g0 ratios between 1 8 and lt 2 0 indicate that the gDNA samples are pure enough to use for TaqMan SNP and DME Genotyping Assays The effective read range of UV spectroscopy is 0 1 to 0 999 which corresponds approximately to 4 ng uL to 50 ng uL of gDNA Values above or below that range are invalid absorbance readings To ensure accurate quantitative results TaqMan SNP Genotyping Assays User Guide 51 Appendix A Troubleshooting Sample preparation problems Inaccurate DNA quantitation 52 gDNA samples should be diluted so that the A269 reading is between 0 1 and 0 999 Dilution factor and the diluents used must be recorded Most plates and cuvettes have minimum working volumes and the g DNA sample used for the quantitative measurement will be discarded It is therefore necessary to ensure having enough gDNA to use this method and still leave sufficient DNA for the study Problems with DNA quantitation manifest themselves as Trailing clusters Some or all samples clustering with the NTCs Cloudy or diffuse clusters A sample or samples does not cluster with a specific allele i e is an outlier What to do e Always perform your own concentration measurements
112. the i UX Location on NCBI 59971795 chromosome on the NCBI Assembly genome assembly as html referenced Change in amino acid i Amino Acid Change H1146Q sequence due to the SNP html HapMap Minor As calculated by HapMap i 0 09 Project Yoruba in html Allele Freq YRI Pa Ibadan Nigeria As calculated by HapMap Project Utah residents HapMap Minor with Northern and Allele Freq CEU eel Western European sarmi ancestry from the CEPH collection HapMap Minor As calculated by HapMap 0 49 Project Han Chinese in html Allele Freq CHB ie Beijing China HapMap Minor As calculated by HapMap 0 36 Project Japanese in html Allele Freq JPT Tokyo Japan Amplicon Size N A N A html TaqMan SNP Genotyping Assays User Guide User supplied materials and equipment The tables below list the reaction plates and accessories available for Life Technologies real time PCR systems Table 22 Recommended consumables to used with Life Technologies real time PCR systems Real Time PCR System Reaction Plates and Accessories 7500 System Standard 96 Well Block Module MicroAmp Optical 96 Well Reaction Plate with Barcode 500 plates Cat no 4326659 20 plates Cat no 4306737 icroAmp Optical Adhesive Film 100 films Cat no 4311971 MicroAmp Optical Film Compression Pad 5 pads Cat no 4312639 icroAmp Optical 8 Cap Strip 300 strips Cat no 4323032 icroAmp Adhesive Film Applicator
113. the assay sequences are already known the primer and probe sequences for manufacturing can directly be entered 1 Click on the Enter Custom Primer Probe pairs button 2 Enter or edit the sequence information 3 Select the Species of interest 4 Check format and submit After the sequences are submitted for assay design you can either wait for the TaqMan Custom Assay Design Tool to complete your design or you can close your browser and return to your order at a later time After receiving your sequence Life Technologies sends you an e mail to confirm that your sequences have been submitted The email contains a link to your design job in the TaqMan Custom Assay Design Tool that you can use to check the status of your job Select the row that corresponds to your design job in the Design Details section of the Select Assays tab to check on the status of your submission For each design job the Design Details table displays e Batch ID The ID assigned to the submission by Life Technologies e Submitted The date that you submitted the sequence information e Status The status of the design Completed or Pending e Details The assays in each batch that passed failed or were not designed Select the assay size or scale and the quantity in the drop down lists in the Size and the Quantity columns for each assay to order Click Add All to add all assays to the order or alternatively click Add next to each assay to select t
114. titate the g DNA on page 23 e Follow the TaqMan SNP Assays protocol as recommended adding between 1 to 20 ng of purified genomic DNA ensuring final concentration no less than 0 2ng uL e Pipette carefully e Mix thoroughly Evaporation from Evaporation of your reaction can occur if the reaction plates are not properly sealed the reaction well leading to e Outliers mild moderate evaporation e Trailing clusters moderate evaporation e Samples clustering at the NTC extreme evaporation What to do 1 Check the location of the wells for the problem calls Evaporation can most often occur around the edges of the plate 2 Check the seals of the optical adhesive cover for leaks 3 If there are leaks perform the assay again Use an adhesive seal applicator Cat no 4333183 to thoroughly seal the cover Make sure to run the applicator over the edges of the seal Discussion Evaporation can occur if your plate is not properly sealed As evaporation occurs the water in the reaction decreases causing the signals from the reporter and ROX dyes to increase due to increased concentration of the dyes The degree of evaporation influences the assay results e Mild If the PCR reaction is not affected the ROX dye can compensate for the increased signals and the assay will work correctly e Mild to moderate You may see outlier samples Depending on the number of wells affected the plot may show only a few outliers or it may
115. ts relevant to the type of genotyping assays About the Assay Information File Table 3 Table 3 Documents included in the CD ROM Predesigned SNP DME Custom SNP TaqMan SNP Genotyping Assays Protocol pdf Assay Information File AIF txt xml and html Understanding Your Shipment Document pdf Datasheet pdf Safety Data Sheet SDS pdf Certificate of Analysis CofA pdf TaqMan SNP Genotyping Assays Protocol pdf Assay Information File AIF txt and xml Understanding Your Shipment Document pdf Product Insert pdf TaqMan SNP Genotyping Assays Protocol pdf Assay Information File AIF txt xml and html Understanding Your Shipment Document pdf Datasheet pdf Safety Data Sheet SDS pdf Certificate of Analysis CofA pdf Custom TaqMan Assays Design and Ordering Guide pdf The Assay Information File AIF contains information about each ordered TaqMan SNP Genotyping Assay Predesigned and DME Assays AIFs contain genomic information about the polymorphism including Gene name Chromosomal location Allele frequency if available Context sequence with nucleotide variation in square brackets Reporter dye concentrations Dye SNP allele associations Custom SNP Assay AIFs provide Assay concentration Forward and reverse primer sequences Probe sequences Reporter dye concentrations For more info
116. ture e Exposing DNA samples to heat or physical shearing TaqMan SNP Genotyping Assays User Guide Appendix A Troubleshooting 7 Sample preparation problems e Purifying DNA samples inefficiently so residual nucleases remain What to do e Run an agarose gel to determine if your DNA is degraded Look for a tight band of high molecular weight smearing indicates degraded DNA Figure 11 illustrates DNA degraded by heat If the DNA is substantially degraded use more caution in interpreting your results If possible consider repeating the assay using freshly prepared genomic DNA samples 0 second 30 seconds 3 minutes Size stnd 10 minutes 15 minutes 30 minutes Sample A Sample B Figure 11 Agarose gel stained with ethidium bromide showing two samples of human gDNA subjected to heating at 99 C for 0 to 30 minutes e For future experiments follow the sample storage guidelines in Table 14 Discussion As the average size of the DNA in a degraded sample approaches the size of the target sequence the amount of PCR product generated is reduced because there are fewer intact templates in the size range necessary for amplification An example of degradation by heating is illustrated in Figure 12 You can expect similarly poor assay results for g DNA degraded by other causes TaqMan SNP Genotyping Assays User Guide 49 Appendix A Troubleshooting Sample preparation problems Me wm de
117. tware 27 H Haplotypes maps 8 HapMap 8 Hardy Weinberg Equilibrium equation 59 l Indels 8 L limited product warranty 97 LIMS 81 M Material Data Safety Sheets MSDSs See Safety Data Sheets SDSs Minor groove binding MGB Minor groove binding MGB Minor groove binding MGB Probe 65 Multi nucleotides polymorphism MNP 8 9 8 N Non fluorescent quencher NFQ 9 101 Index 0 Outliers 54 59 P PCR inhibition 48 Polymorphism 9 Probe hybridization 65 R related documentation 95 Reporter dye information 9 Rescaling 59 S safety biohazard 94 Safety Data Sheets SDSs obtaining 96 Supplementary Sample Information SSI 27 102 support obtaining 97 T Tag SNP 8 terms and conditions 97 training information on 97 U UV spectroscopy 48 V VIC dye 27 65 VIC dye labeled probe 9 W warranty 97 TaqMan SNP Genotyping Assays User Guide q Headquarters 5791 Van Allen Way Carlsbad CA 92008 USA Phone 1 760 603 7200 Toll Free in USA 800 955 6288 For support visit lifetechnologies com support or email techsupportfdlifetech com technologies lifetechnologies com 30 January 2014
118. umber polymorphism 44 target However the growing number of SNPs discovered in studies of different ethnic populations make it likely that some of the primers and or probes in the TaqMan SNP and DME Genotyping Assays may overlap currently unknown polymorphisms in certain populations In some rare cases there are some assays where primers and probes are located over SNPs or other polymorphisms due to the close proximity of the two SNPs For these assays the vector cluster falls in line with samples of the same genotype but the reduced PCR efficiency causes a reduction in signal intensity A copy number polymorphism for a gene may or may not appear as an anomaly in the allelic discrimination plot e If an individual is homozygous with more than three copies of the gene and each copy has the same genotype the data will most likely appear in the homozygous cluster e If an individual is heterozygous with an odd number of copies and the copies have different genotypes then the data will probably fall between the clusters for the heterozygote T A and the homozygote A A Several of the genes included in the TaqMan Genotyping and DME Assays are known to have copy number polymorphisms CYP2D6 Ouahchi 2006 Wilkinson 2005 GSTM1 Ouahchi 2006 GSTT Quahchi 2006 CYP2E1 Liew 2005 and CYP2A6 Ouahchi 2006 Oscarson 2001 Rao 2000 Xu 2002 TaqMan SNP Genotyping Assays User Guide 6 0 6 0 4 0 0 0 Figure 7
119. ure that you maintain instruments according to the recommendations provided in the relevant instrument manuals For best results make sure to calibrate and maintain your instrument as recommended by Life Technologies Poor thermal cycler performance can result in e Trailing clusters e Some or all samples cluster with the NTCs e Cloudy or diffuse clusters e High signal for the NTCs in one or more of the sample wells To ensure optimal performance of your thermal cycler or Real Time PCR System Life Technologies strongly recommends that you perform routine maintenance Maintenance schedules vary by instrument refer to your relevant instrument manual for details To ensure optimal performance of your thermal cycler or Real Time PCR System Life Technologies strongly recommends that you regularly calibrate your thermal cycler Calibration varies by instrument refer to your specific instrument manual for details TaqMan SNP Genotyping Assays User Guide Types of calibration Appendix A Troubleshooting Troubleshooting software problems ROI calibration ROI calibration allows the Real Time PCR Instrument Software to map the position of the wells on the sample block so that during instrument operation the software can associate increases in the fluorescence with specific wells of the reaction plates Background calibration The background calibration measures the ambient fluorescence that is generated from background electrical signals
120. using the same gDNA or if the same gDNA is used in several experiments drying down the gDNA in the plates is the most convenient method to have the samples ready for use at any time The methods for assays using both wet and dried down DNA are described here Note For both methods it is recommended to use a calibrated positive displacement pipette to minimize contamination and error TaqMan SNP Genotyping Assays User Guide 23 HE Chapter 2 Genotyping experiment overview A karas 24 Set up the PCR reactions Table 11 DNA delivery methods Method Description Experimental uses Wet DNA delivery 1 SNP reaction mix is aliquoted to an optical reaction plate 2 gDNA is delivered to the final reaction mix Note In this method the liquid used to resuspend the DNA is used as a component of the final reaction Large number of DNA templates tested on a limited number of SNP targets Dried down DNA delivery 1 gDNA is applied to the bottom surface of an optical reaction plate 2 DNA sample is dried down completely by evaporation 3 SNP reaction mix is added and the DNA disperses in the final reaction mix This method can be used in either of these conditions e Low DNA concentration results in large sample volumes 2 to 5 uL to run the assay e Limited number of DNA templates tested repeatedly on different SNP targets e Large number of DNA samples prepared in plates
121. uster a vector cluster You may see points that are in agreement with a cluster but trail behind the main cluster a vector cluster when there is an additional SNP under the probe Figure 6 The presence of a SNP under a probe leads to lower fluorescence intensity TaqMan SNP Genotyping Assays User Guide Appendix A Troubleshooting Genetic issues Allelic Discrimination Plot Figure 6 SNP under probe circled in red The red cluster is a vector cluster What to do To confirm the presence of another SNP under the probe or primer 1 Repeat the experiment and evaluate overall assay performance e Do the assay results appear in tight clusters e Do clusters have good separation 2 Verify the presence of the outlier 3 Examine the sample s performance in other assays to rule out problems caused by this particular sample such as sample impurity or degradation 4 Search the public databases such as dbSNP to see if the additional SNP has been discovered 5 Perform comparative sequencing on the subjects to identify any undocumented SNPs present under the primer or probe The presence of extra SNPs may cause angle clusters or vector clusters Discussion Life Technologies assay design process included many checks to assure that primers and probes were not designed over polymorphisms other than the intended SNP TaqMan SNP Genotyping Assays User Guide 43 g Appendix A Troubleshooting Genetic issues Gene has a copy n
122. values based on the fluorescence signals from each well then determines which alleles are in each sample Note If no pre read data is available no pre read background subtraction is performed The general process for analyzing data for allelic discrimination or genotyping involves e Creating and setting up a post PCR plate read document e Performing a post PCR plate read on a real time PCR instrument e Analyzing the experiment e Making automatic or manual allele calls e Verifying allele types Note Refer to the allelic discrimination or genotyping section of the appropriate instrument user guide for instructions on how to use the system software to perform the post PCR plate read and analysis For more information see Appendix A Troubleshooting Life Technologies real time instrument software plots the results of the allelic discrimination data as a scatter plot of Allele 1 VIC dye versus Allele 2 FAM dye Each well of the 96 well or 384 well reaction plate is represented as an individual point on the plot Variation in clustering due to the genotype of the target allele is shown in Figure 1 TaqMan SNP Genotyping Assays User Guide 27 Chapter 2 Genotyping experiment overview Analyze data using TaqMan Genotyper Software 28 Post PCR plate read and analysis 2 3 e 4 2 1 8 Homozygous for Allele 2 F fa 2 kii Heterozygous i v 2 e a Ca andil Homozygous for Allele
123. versal Master Mix II and Sample to SNP GTXpress Master Mix reagents Note that standard PCR conditions are recommended for DME Assays over Fast PCR conditions see the DME Assay thermal cycling conditions in Perform the PCR on page 26 Most assays use universal reagent concentrations and thermal cycling condition and require only one PCR amplification step with an endpoint reading to obtain results For DME assays the recommended PCR protocol includes a longer extension time with additional cycles to take into account the typically longer amplicon lengths see Appendix C About the Drug Metabolism Enzyme genes TaqMan SNP Genotyping Assays User Guide Assay contents Context sequence representation Shipment contents Chapter 1 Product Information Product overview Y o ae i TaqMan Predesigned and Custom SNP Genotyping Assays 40X and 80X and TaqMan DME Genotyping Assays 20X contain e Sequence specific forward and reverse primers to amplify the polymorphic sequence of interest e Two TaqMan MGB probes with NFQ One VIC labeled probe to detect Allele 1 sequence One FAM labeled probe to detect Allele 2 sequence Reporter dye information for the TaqMan SNP and DME Genotyping Assays are represented in the assay context sequence The context sequence is the nucleotide sequence surrounding the SNP site and is provided in the genome strand orientation relative to the NCBI reference ge
124. w The following workflow illustrates the steps of a genotyping experiment using TaqMan SNP Genotyping Assays Extract and purify genomic DNA on page 23 y Quantitate the gDNA on page 23 vy Set up the PCR reactions on page 21 Prepare the reaction mix on page 21 v Prepare the reaction plate with the OR Prepare the reaction plate with the wet DNA method on page 24 DNA dry down method on page 25 v Perform the PCR on page 26 vy Post PCR plate read and analysis on page 27 Genotyping Assay overview In the first step of a TaqMan Genotyping Assay experiment AmpliTaq Gold DNA polymerase from the TaqMan Genotyping Master Mix amplifies target DNA using sequence specific primers TaqMan MGB probes from the Genotyping Assay provide a fluorescence signal for the amplification of each allele PCR amplification requires one to 1 Prepare the reaction mix on page 21 2 Prepare the DNA samples on page 23 3 Prepare the reaction plate with the wet DNA method on page 24 or Prepare the reaction plate with the DNA dry down method on page 25 20 TagMan SNP Genotyping Assays User Guide Assay setup guidelines Reagents and samples preparation Chapter 2 Genotyping experiment overview 5 Set up the PCR reactions 4 Perform the PCR on page 26 See Appendix G Good laboratory practices for PCR RT PCR for general
125. with the assay or the TaqgMan SNP or DME Genotyping Assays page at www lifetechnologies com to determine if the assay is for a target located on the X chromosome 2 Check your results by gender Discussion When a SNP is located on the X chromosome only the females in the population can be heterozygous Males with only one X chromosome will always be homozygous Depending upon the minor allele frequency you may see males in only one of the two homozygous forms Note that there are no male heterozygotes in Figure 10 When a gene is on the Y chromosome and the population is made up of both males and females female samples will appear with the NTC samples This result does not reflect assay performance but is due to the fact that female samples will not amplify As result only 2 clusters will be visible because males have only one Y chromosome Sample preparation problems Degraded DNA 48 Problems with preparing genomic DNA for the assay may include e Degraded DNA on page 48 e PCR inhibitors in sample on page 51 e Tnaccurate DNA quantitation on page 52 Degraded DNA can affect PCR efficiency due to the presence of fewer template copies which will affect the success of TaqMan SNP Genotyping Assay Degradation can result from e Using very old DNA samples e Using DNA extracted from formalin fixed paraffin embedded samples e Freezing and thawing DNA samples repeatedly e Leaving DNA samples at room tempera
126. y with TaqMan Genotyping Assays on the instruments and reaction plates specified in Table 5 and Table 6 Because of differences in ramp rates and thermal accuracy you may need to adjust thermal cycling settings if you use a thermal cycler that is not listed In the plate document in the case of real time PCR systems select the Standard mode thermal cycling setting TaqMan SNP Genotyping Assays User Guide Chapter 2 Genotyping experiment overview Bi Post PCR plate read and analysis 8 a Note If using GTXpress Master Mix follow the protocol provided with the Master Mix IMPORTANT TaqMan Genotyping Master Mix is not for use with Fast Mode thermal cycling conditions If you use TaqMan Genotyping Master Mix on the 7500 Fast or ViiA 7 96 Well Fast Block or the 9800 Fast Thermal Cycler use only Standard Mode thermal cycling conditions 3 Set the reaction volume according to the following table Reaction Plate Reaction Volume MicroAmp Optical 384 Well Reaction Plate 5 00 uL MicroAmp Fast Optical 96 Well Reaction Plate 10 00 uL MicroAmp Optical 96 Well Reaction Plate 25 00 uL 4 Load the reaction plate in the thermal cycler then start the run Post PCR plate read and analysis Overview After PCR amplification perform a post PCR plate read on a real time PCR instrument Using the fluorescence measurements made during the plate read the real time PCR instrument software plots R

TaqMan® SNP Genotyping Assays User Guide

Contents

Download Pdf Manuals

Related Search

Related Contents

TaqMan&reg; SNP Genotyping Assays User Guide

Contents

Download Pdf Manuals

Related Search

Related Contents

TaqMan® SNP Genotyping Assays User Guide