Home

DECIPHER User Manual

1. Linsley P S Beijrsbergen R L and Bernanrds R 2004 A large scale RNAi screen in human cells identifies new components of the p53 pathway Nature 428 431 437 Buchschacher G L and Wong Staal F 2000 Development of lentiviral vectors for gene therapy for human diseases Blood 95 2499 2504 Burns J C Friedmann T Driever W Burrascano M and Yee J K 1993 Vesicular stomatitis virus G glycoprotein pseudotyped retroviral vectors concentration to a very high titer and efficient gene transfer into mammalian and non mammalian cells Proc Natl Acad Sci USA 90 8033 8034 Cann A J ed 2000 RNA Viruses A Practical Approach Oxford Univ Press Dull T Zufferey R Kelly M Mandel R J Nguyen M Trono D and Naldini L 1998 A third generation lentivirus vector with a conditional packaging system J Virol 72 8463 8471 Gould D J and Favorov P 2003 Vectors for the treatment of autoimmune diseases Gene Therapy 10 912 927 Khvorova A Reynolds A and Jayasena D 2003 Functional siRNAs and miRNAs exhibit strand bias Cell 115 209 216 505 Lee N S Dohjima T Bauer G Li H Li M J Ehsani A Salvaterra P and Rossi J 2002 Expression of small interfering RNAs targeted against HIV 1 rev transcripts in human cells Nature Biotechnol 20 500 505 Lockhart D Dong H Byrne M C Follettie M T Gallo M V Chee M C Mittmann M Wang C Kobayashi M Horton H
2. A Nimmo et al 2007 Harnessing telomerase in cancer therapeutics Anticancer Agents Med Chem 7 4 475 83 Martin S E and N J Caplen 2007 Applications of RNA interference in mammalian systems Annu Rev Genomics Hum Genet 8 81 108 Carpten J D A L Faber et al 2007 A transforming mutation in the pleckstrin homology domain of AKT1 in cancer Nature 448 7152 439 44 Echeverri C J and N Perrimon 2006 High throughput RNAi screening in cultured cells a user s guide Nat Rev Genet 7 5 373 84 Moffat J and D M Sabatini 2006 Building mammalian signalling pathways with RNAi screens Nat Rev Mol Cell Biol 7 3 177 87 Moffat J D A Grueneberg et al 2006 A lentiviral RNAi library for human and mouse genes applied to an arrayed viral high content screen Cell 124 6 1283 98 Brummelkamp T R A W Fabius et al 2006 An shRNA barcode screen provides insight into cancer cell vulnerability to MDM2 inhibitors Nat Chem Biol 2 4 202 6 Tech Support tech cellecta com 23 of 27 v 7a 7 28 10 Cellecta Inc 320 Logue Ave Mountain View CA 94043 www cellecta com CELLECTA 650 938 3910 Shabalina S A A N Spiridonov et al 2006 Computational models with thermodynamic and composition features improve siRNA design BMC Bioinformatics 7 65 Taxman D J L R Livingstone et al 2006 Criteria for effective design construction and gene knockdown by
3. Primer Name Sequence Fwd U6 1 FwdU6 CAAGGCTGTTAGAGAGATAATTGGAA Tech Support tech cellecta com 4 of 27 v 7a 7 28 10 Cellecta Inc 320 Logue Ave Mountain View CA 94043 www cellecta com 650 938 3910 CELLECTA C Packaging Protocol for Lentiviral shRNA Libraries The following protocol describes the generation of a pseudoviral packaged pooled lentiviral 27K shRNA library 27K shRNA complexity using Invitrogen s Lipofectamine and Plus Reagent Other transfection reagents may be used but the protocol should be adjusted to fit the manufacturer s protocol The yield of recombinant lentiviral particles typically produced under these optimized conditions is 1 10 x 10 TU ml In this protocol using ten 10 15 cm plates at least 3 x 10 TU of total pseudoviral particles can be made and then concentrated to up to 100 fold using several described methods 1 Start growing 293T cells in D MEM medium plus glutamine see Required Materials supplemented with 10 FBS without antibiotics 2 to 3 days prior to transfection Day 1 Plate Cells 2 Twenty four 24 hours prior to transfection plate 12 5 x 10 293T cells in each of ten 10 untreated 15 cm plates or 150 cm flasks Use 30 ml of media per plate Disperse the cells and ensure even distribution At the moment of transfection the cells should have reached 70 80 confluency Increase or decrease the number of 293T cells seeded if optimal conflu
4. and Trono D 2003 Conditional suppression of cellular genes lentivirus vector mediated drug inducible RNA interference J Virology 16 8957 8961 Lentiviral delivery vector reviews Curran MA Nolan GP Nonprimate lentiviral vectors Curr Top Microbiol Immunol 2002 261 75 105 Curran MA Nolan GP Recombinant feline immunodeficiency virus vectors Preparation and use Methods Mol Med 2002 69 335 50 Loewen N Barraza R Whitwam T Saenz DT Kemler I Poeschla EM FIV Vectors Methods Mol Biol 2003 229 251 71 Naldini L Lentiviruses as gene transfer agents for delivery to non dividing cells Curr Opin Biotechnol 1998 Oct 9 5 457 63 Sauter SL Gasmi M FIV vector systems Somat Cell Mol Genet 2001 Nov 26 1 6 99 129 Tech Support tech cellecta com 27 of 27 v 7a 7 28 10
5. lacking packaging signals and share no significant homology to any of the expression lentivectors pVSV G expression vector or any other vector to prevent generation of recombinant replication competent virus None of the HIV 1 genes gag pol rev will be present in the packaged pseudoviral genome as they are expressed from packaging plasmids lacking packaging signal therefore the lentiviral particles generated are replication incompetent Pseudoviral particles will carry only a copy of your expression construct Despite the above safety features use of HIV based vectors falls within NIH Biosafety Level 2 criteria due to the potential biohazard risk of possible recombination with endogenous viral sequences to form self replicating virus or the possibility of insertional mutagenesis For a description of laboratory biosafety level criteria consult the Centers for Disease Control Office of Health and Safety Web site at http www cdc gov od ohs biosfty bmbl4 bmbl4s3 htm It is also important to check with the health and safety guidelines at your institution regarding the use of lentiviruses and follow standard microbiological practices which include Wear gloves and lab coat at all times when conducting the procedure Always work with pseudoviral particles in a Class II laminar flow hood All procedures are performed carefully to minimize the creation of splashes or aerosols Work surfaces are decontaminated at least once a day and
6. transduction was treated as an independent sample Each independent sample had an estimated average of 200 transduced clones per shRNA Day 1 Cells were trypsinized and resuspended to a density of 1 x 10 cells ml in D MEM supplemented with 10 FBS and 5 ug ml Polybrene 25 ml of cells were aliquoted to each 15 cm plate 6 plates per replicate 1 5 x 10 cells per replicate and enough pseudovirus was added to achieve 9 x 10 infected cells per plate Cells were returned to CO incubator and grown under standard conditions for 24 hours Day 2 At 18 hours post transduction media containing pseudovirus Polybrene was replaced with fresh media Day 4 At 72 hours post transduction three 3 samples were harvested and stored as frozen cell pellets untreated samples Three cell samples were treated with DMEM media supplemented with TGF B 1 ng ml to induce apoptosis Day 14 Cells that survived apoptosis were harvested and centrifuged and each sample was stored as a frozen cell pellet TGF B treated samples Genomic DNA was then extracted and purified from the entire cell populations from both TGF B treated and untreated samples shRNA specific bar codes were amplified from the entire amount of isolated genomic DNA 20 100 ug and enumerated by HT sequencing Negative Selection Screen Identification of genes essential for viability of AR 1 negative Human Prostate Cancer DU145 cells treatment is time An shRNA libr
7. 90 Note Depending on cell type you may need to wait 72 hours after transduction before estimating titer by RFP fluorescence Puromycin based titering At 48 hours after infection split cells into two samples Grow one sample with antibiotic selection and one sample without NOTE Before performing the following experiment we recommend to first determine the optimal concentration of antibiotic using the Puromycin Kill Curve protocol below After 48 hours of growth in puromycin count the number of viable cells in the selected and unselected samples The ratio of selected unselected viable cells gives the percentage of infected cells Then calculate relative pseudoviral titer as previously described Please note that the titer determined by Puromycin selection may differ from the titer determined by counting RFP positive cells using flow cytometry and it also depends on cell type and selection conditions Puromycin Kill Curve In order to generate a purely transduced population of cells it is important to determine the minimum amount of puromycin required to kill untransduced cells This can be done empirically by generating a kill curve as follows Trypsinize and resuspend cells to a density of 1 x 10 cells ml in growth media aliquot 1 ml per well in a 12 well plate and add puromycin at O ug ml 0 5 ug ml 1 ug ml 2 ug ml 5 ug ml and 10 ug ml in six different wells Mix and return cells to
8. Genome wide screening for gene function using RNAi in mammalian cells Immunol Cell Biol 83 217 23 Devi G R siRNA based approaches in cancer therapy Cancer Gene Therapy 13 819 829 2006 Downward J 2004 Use of RNA interference libraries to investigate oncogenic signaling in mammalian cells Oncogene 23 8376 8383 Eggert U S Kiger A A Richter C Perlman Z E Perrimon N Mitchison T J and Field C M 2004 Parallel chemical genetic and genome wide RNAi screens identify cytokinesis inhibitors and targets PLOS Biology 2 1 8 Friedman A and Perrimon N 2004 Genome wide high throughput screens in functional genomics Cur Opin Genet Develop 14 470 476 Huesken D Lange J Mickanin C et al 2005 Design of a genome wide siRNA library using an artificial neural network Nature Biotechnol 23 995 1001 Leung RK Whittaker PA 2005 RNA interference from gene silencing to gene specific therapeutics Pharmacol Ther 107 222 39 Liang Z 2005 High throughput screening using genome wide siRNA libraries IDrugs 11 924 926 Moffat J Sabatini DM 2006 Building mammalian signalling pathways with RNAi screens Nat Rev Mol Cell Biol 7 177 187 Moffat J Grueneberg DA Yang X Kim SY Kloepfer AM Hinkle G Piqani B Eisenhaure TM Luo B Grenier JK Carpenter AE Foo SY Stewart SA Stockwell BR Hacohen N Hahn WC Lander ES Sabatini DM Root DE 2006 A lentiviral RNAi library for human and mouse gen
9. beginning your experiment For other plate formats the volumes should be adjusted depending on the growth area of the well or plate Day 1 1 Quickly thaw the pseudoviral particles in a water bath at 37 C Transfer the thawed particles to a laminar flow hood gently mix by rotation inversion or gentle vortexing and keep on ice Caution Only open the tube containing the pseudoviral particles in the laminar flow hood Note Unused pseudoviral stock may be refrozen at 80 C but it will result in a loss of about 10 20 in titer 2 Trypsinize and resuspend cells to a density of 1 x 10 cells ml in D MEM supplemented with 10 FBS and 5 ug ml Polybrene Aliquot 1 ml well in a 12 well plate and add O ul 1 ul 3 3 ul 10 ul 33 ul and 100 ul pseudoviral stock prepared by serial dilution to six different wells Mix and return cells to CO2 incubator Grow cells under standard conditions for 24 hours Day 2 3 At 24 hours post transduction replace media with fresh D MEM supplemented with 10 FBS and without Polybrene Return cells to CO2 incubator and grow under standard conditions for 24 hours Tech Support tech cellecta com 7 of 27 v 7a 7 28 10 Cellecta Inc 320 Logue Ave Mountain View CA 94043 www cellecta com CELLECTA 650 938 3910 Day 3 48 hours after transduction Fluorescence based titering Transduced cells express RFP reporter protein from an internal UbiC promoter By calculating the percentage of RFP p
10. can optimize the protocol for enrichment depletion of cells with induced phenotypic changes for your experiment with the shRNA library As negative control cells which should not be enriched depleted during the selection steps you can use cells infected by non targeting shRNA constructs e g against Luciferase or a scrambled shRNA control The packaged positive control shRNA constructs can also be added to the shRNA library in a ratio of about 1 1 000 Transduction Units TU also known as Infectious Units ifu or IU in order to monitor by PCR enrichment depletion of the positive control constructs during the selection step Optimize the enrichment depletion protocol The quality of genetic screen data will depend significantly on the design and conditions used for the phenotype specific selection step A high enrichment depletion level of target cells optimally 50 100 fold with a specific trait will help to identify shRNA constructs that are significantly enriched depleted above the inevitable background level of non enriched depleted shRNA inserts In most cases transduced cells can be used to start a phenotypic screen at approximately 2 3 days after infection However this is based on anecdotal observations and the time it usually takes the lentiviral cassette to integrate and the shRNAs to express in most cell types For certain genes and selections the knockdown effect may happen quickly 1 day or take significantly longer 4 7 days t
11. in the Lipofectamine protocol 2 Inefficient production of the pseudovirus Problem 293T Cells are of poor quality Solutions e Optimize growth conditions check growth medium and don t grow 293T cells for more than 20 passages e Check for mycoplasma contamination e Do not overgrow the cells do not allow the cells to reach more than 90 confluency in order to keep the culture continuously in logarithmic growth phase Problem Pseudoviral supernatant harvested too early or too late Solution Harvest supernatant 48 hours after transfection Inefficient Transduction of Packaged shRNA Library 1 Poor infection efficiency Problem Target cells have too high or too low density Solution Plate fewer or more cells in order to have about 50 confluency at infection stage Problem Target cell line may be difficult to transduce Solutions e Use a higher concentration of pseudoviral particles e Optimize the transduction protocol and use HEK293 cell line as positive control cells e Perform Spinoculation to improve transduction efficiency email tech cellecta com for protocol e Check to see if Polybrene was added at 5 ug ml Problem Wrong amount of Polybrene added during infection stage Solution If Polybrene is toxic to the target cells optimize Polybrene concentration in the range of 0 5 ug ml Problem Loss of pseudoviral titer during storage Solution Ensure storage of aliquoted packaged shRNA libra
12. patients with features of good prognosis Clin Cancer Res 2 7 1177 84 McCann A H A Kirley et al 1995 Amplification of the MDM2 gene in human breast cancer and its association with MDM2 and p53 protein status Br J Cancer 71 5 981 5 Marchetti A F Buttitta et al 1995 mdm2 gene alterations and mdm2 protein expression in breast carcinomas J Pathol 175 1 31 8 Champeme M H I Bieche et al 1994 Int 2 FGF3 amplification is a better independent predictor of relapse than c myc and c erbB 2 neu amplifications in primary human breast cancer Mod Pathol 7 9 900 5 Borg A B Baldetorp et al 1992 c myc amplification is an independent prognostic factor in postmenopausal breast cancer Int J Cancer 51 5 687 91 General references Abbas Terki Blanco Bose N Deglon Pralong W and Aebischer P 2002 Lentiviral mediated RNA interference Hum Gene Ther 13 2197 2201 Tech Support tech cellecta com 25 of 27 v 7a 7 28 10 Cellecta Inc 320 Logue Ave Mountain View CA 94043 www cellecta com CELLECTA 650 938 3910 Aza Blanc P Cooper C L Wagner K Batalov S Deveraux Q L and Cooke M P Identification of modulators of TRAIL induced apoptosis via RNAi based phenotypic screening Mol Cell 2003 12 627 637 Berns K Hijmans E M Mullenders J Brummelkamp T R Velds A Helmerlks M Kerkhoven R M Madiredjo M Nijkamp W Weigelt B Agami R Ge W Cavet G
13. the preparation of bar coded probes for high throughput HT sequencing and analysis of raw sequencing data sets Please read the entire user manual before proceeding with your experiment Designing and Performing HT RNAi Genetic Screens Specific screening protocols will vary depending on the particular biological mechanism to be studied For general information and examples of successful genetic screening experiments we recommend that you refer to the References in Section J Although the specific protocol and controls may be different depending on the cell type functional assay and selection protocol e g FACS apoptosis induction toxic chemical survival etc it is critical to carefully design your experiment in order to generate statistically significant data With this in mind consider the following suggestions when setting up your experiment Model Phenotype Selection with Positive Control shRNA Construct s Before performing a large scale genetic screen with a pooled lentiviral shRNA library we suggest making several shRNA constructs designed against one or more particular target genes whose inactivation is known to elicit the desirable phenotypic changes in the target cells Then by Tech Support tech cellecta com 1 of 27 v 7a 7 28 10 Cellecta Inc 320 Logue Ave Mountain View CA 94043 www cellecta com CELLECTA 650 938 3910 packaging and transducing these positive control shRNA constructs into target cells you
14. to the upper phase and mix well Centrifuge at 15 000 rpm for 20 minutes at RT in a JA 20 rotor using a Beckman centrifuge or equivalent Wash pellet twice with 70 ethanol Centrifuge each wash step at 15 000 rpm for 10 minutes at RT Air dry pellet and dissolve in distilled water If necessary heat solution at 70 C to dissolve DNA precipitate For the following amplification step the optimal concentration of sonicated DNA is 5 ug ul for syringe shared DNA it is 2 ug ul Tech Support tech cellecta com 12 of 27 v 7a 7 28 10 Cellecta Inc 320 Logue Ave Mountain View CA 94043 www cellecta com CELLECTA 650 938 3910 H Amplification of shRNA specific Bar Codes from Genomic DNA The pooled bar codes should be amplified from 200 ug of genomic DNA isolated from cell samples in the previous step by two rounds of PCR using Titanium Taq DNA polymerase mix Clontech Takara see Required Materials Use the entire amount of genomic DNA and a proportionally fewer number of 100 ul reactions per sample when amplifying bar codes from samples generated by positive selection screens The protocol was optimized using an ABI GeneAmp PCR System 9700 Use of other PCR enzymes and or thermal cyclers may require additional optimization The lentiviral shRNA library and PCR primer designs include sequences complementary to the sequences of the immobilized primers necessary for generating amplification clusters in Illumina s Genome Analyzer IIx and
15. 0 5 ug l mix of second generation packaging plasmids psPAX2 and pMD2 G provided by AddGene Cat s 12260 and 12259 or Cellecta pC Pack2 Packaging Mix 293T Cell Line ATCC Cat CRL 11268 or Cellecta Dulbecco s Modified Eagle s Medium D MEM high glucose with sodium pyruvate Note ADD FRESH GLUTAMINE 1X at the time a sealed bottle of D MEM is opened even if the label indicates glutamine has already been added Glutamine in solution at 4 C has a half life of 1 2 months so glutamine D MEM purchased off the shelf from a supplier is to be regarded as glutamine In our experience the addition of glutamine increases titer approximately 2 fold Fetal Bovine Serum recommended Mediatech Cat MT 35 010 CV Puromycin D PBS Trypsin EDTA Polybrene hexadimethrine bromide Sigma Aldrich Cat 107689 0 2 0 45 um PES sterile syringe filters Nalgene Cat 194 2520 Tissue Culture Plates and Related Tissue Culture Supplies Lipofectamine Reagent Invitrogen Cat 18324 111 Plus Reagent Invitrogen Cat 11514 015 Buffer P1 50mM Tris HCl pH 8 0 10mM EDTA QIAGEN Cat 19051 RNase A QIAGEN Cat 19101 Phenol Chloroform pH 8 0 Sigma Aldrich Cat P3803 DNase I RNase free Epicentre Cat D9905K Titanium Taq DNA polymerase with PCR buffer Clontech Takara Cat 639242 dNTP Mix 10 mM each QIAquick PCR purification kit QIAGEN Cat 28106 QIAquick Gel Extraction Kit QIAGEN
16. 10 2333 40 Hahn W C S K Dessain et al 2002 Enumeration of the simian virus 40 early region elements necessary for human cell transformation Mol Cell Biol 22 7 2111 23 Tuschl T 2002 Expanding small RNA interference Nat Biotechnol 20 5 446 8 Hannon G J 2002 RNA interference Nature 418 6894 244 51 Vogel C L M A Cobleigh et al 2002 Efficacy and safety of trastuzumab as a single agent in first line treatment of HER2 overexpressing metastatic breast cancer J Clin Oncol 20 3 719 26 Naidu R N A Wahab et al 2002 Expression and amplification of cyclin D1 in primary breast carcinomas relationship with histopathological types and clinico pathological parameters Oncol Rep 9 2 409 16 Elenbaas B L Spirio et al 2001 Human breast cancer cells generated by oncogenic transformation of primary mammary epithelial cells Genes Dev 15 1 50 65 Ross J S and J A Fletcher 1998 The HER 2 neu oncogene in breast cancer prognostic factor predictive factor and target for therapy Stem Cells 16 6 413 28 Steck P A M A Pershouse et al 1997 Identification of a candidate tumour suppressor gene MMAC1 at chromosome 10q23 3 that is mutated in multiple advanced cancers Nat Genet 15 4 356 62 Seshadri R C S Lee et al 1996 Cyclin DI amplification is not associated with reduced overall survival in primary breast cancer but may predict early relapse in
17. 24 hours post transfection replace the medium containing complexes with fresh D MEM medium supplemented with 10 FBS DNase I 1 U ml and MgCl 4 mM Continue incubation in the CO incubator at 37 C for 24 hours Overnight DNase I treatment before harvesting pseudovirus does not negatively affect viral titer or infectivity and helps prevent undesirable carryover of plasmid library into the pseudovirus prep Tech Support tech cellecta com 5 of 27 v 7a 7 28 10 Cellecta Inc 320 Logue Ave Mountain View CA 94043 www cellecta com CELLECTA 650 938 3910 Note Failure to change the media the day after transfection results in large carryover of plasmid free and or Lipofectamine bound in your pseudoviral prep This may cause problems with most downstream molecular biology applications especially whenever there is a PCR step involved Day 4 Collect Pseudoviral Supernatant 8 At 48 hours post transfection collect all 30 ml of the pseudovirus containing medium from each plate and filter the supernatant 300 ml through a Nalgene 0 2 0 45 um PES filter a low protein binding filter to remove debris and floating packaging cells Failure to filter supernatant could result in carry over of cells into your pseudoviral prep Note Usually the peak of pseudovirus production is achieved at 48 hours post transfection We recommend collecting the supernatant only once at 48 hours post transfection in order to achieve higher titers Su
18. Cat 28706 PCR primers for bar code amplification from genomic DNA IDT Primer Name Sequence FwdHTS2 FwdHTS TCTCTGGCAAGCAAAAGACGGCATA Gex1MS FwdGex CAAGCAGAAGACGGCATACGAGA RevcPPT 5 RevHTS TGCCATTTGTCTCGAGGTCGAGAA Gex2M RevGex AATGATACGGCGACCACCGAGA IND1 AATGATACGGCGACCACCGAGAGGTTCAGAGTTCTACAGTCCGAAACCCCAAACGCACGAA IND2A AATGATACGGCGACCACCGAGAGGTTCAGAGTTCTACAGTCCGAAACCTCAAGCGCACGAA IND2B AATGATACGGCGACCACCGAGAGGTTCAGAGTTCTACAGTCCGAAACTCCAAGCGCACGAA IND2C AATGATACGGCGACCACCGAGAGGTTCAGAGTTCTACAGTCCGAAATCCCAAGCGCACGAA IND3A AATGATACGGCGACCACCGAGAGGTTCAGAGTTCTACAGTCCGAAACTCCAGACGCACGAA IND3B AATGATACGGCGACCACCGAGAGGTTCAGAGTTCTACAGTCCGAAATTCCAGACGCACGAA Tech Support tech cellecta com 3 of 27 v 7a 7 28 10 Cellecta Inc 320 Logue Ave Mountain View CA 94043 www cellecta com CELLECTA 650 938 3910 IND3C AATGATACGGCGACCACCGAGAGGTTCAGAGTTCTACAGTCCGAAGCTCCAGACGCACGAA IND4A AATGATACGGCGACCACCGAGAGGTTCAGAGTTCTACAGTCCGAAATCCCGAACGCACGAA IND4B AATGATACGGCGACCACCGAGAGGTTCAGAGTTCTACAGTCCGAAGCCCCGAACGCACGAA IND5 IND4C AATGATACGGCGACCACCGAGAGGTTCAGAGTTCTACAGTCCGAAGCCCTAAACGCACGAA e HT sequencing primers IDT Primer Name Sequence GexSeqN GexSeq ACAGTCCGAAACCCCAAACGCACGAA HPLC Purified GexSeqM GexSeqIND AGAGGTTCAGAGTTCTACAGTCCGAA HPLC Purified e Primer for sequencing shRNA inserts in control shRNA constructs IDT
19. Cellecta Inc 320 Logue Ave Mountain View CA 94043 www cellecta com CELLECTA 650 938 3910 DECIPHER User Manual Genetic Screens with Pooled Lentiviral Bar Coded shRNA Libraries Table of Contents Page A Background ee 1 B Required Materials 3 C Packaging Protocol for Lentiviral shRNA Libraries Lo 5 D Pseudoviral Titer Estimation kkk LLL LLL LLL LLL LaaLa LLL 7 E Protocols for Genetic Screens with Pooled Lentiviral ShRNA Libraries 9 F Examples of HT RNAi Screens 10 G Genomic DNA Extraction for Bar Code Amplification and HT Sequencing 12 H HT sequencing of Pooled shRNA specific Bar codes in Illumina s Genome Analyzer GAIIx or HiSeq 2000 HT Sequencing Platform k LLL LLL LLL aaao 15 I Bar code Enumeration Conversion of raw sequencing data to number of reads for each BareCOde yi satotnaln ch lot al a a dato wiatolobuta torent oral a star gtels ee istetot he 15 J Statistical Analysis of shRNA hits enriched depleted in genetic screen 15 K Interpretation of genetic screen data 15 L Troubleshooting ne 16 M Technical Support O O a 18 N Safety Guidelines ns 19 O Cellecta Limited Use License LL 20 P References 21 A Background The protocols below provide the instructions on how to package titer and transduce target cells with pre made DECIPHER or custom pooled lentiviral shRNA libraries Also provided are examples for both positive and negative selection screens Additional protocols provide guidelines for
20. Genet 7 5 373 84 Moffat J and D M Sabatini 2006 Building mammalian signalling pathways with RNAi screens Nat Rev Mol Cell Biol 7 3 177 87 Voorhoeve P M and R Agami 2003 Knockdown stands up Trends Biotechnol 21 1 2 4 Genetic Screens with siRNA libraries Aza Blanc P Cooper C L Wagner K Batalov S Deveraux Q L and Cooke M P 2003 Identification of modulators of TRAIL induced apoptosis via RNAi based phenotypic screening Molecular Cell 12 627 637 Bailey S N Ali S M Carpenter A E Higgins C and Sabatini D 2006 Microarrays of lentiviruses for gene function screens in immortalized and primary cells Nature Methods 3 117 122 Berns K Hijmans E M Mullenders J et al 2004 A large scale RNAi screen in human cells identifies new components of the p53 pathway Nature 428 431 437 Bortone K Michiels F Vandeghinste N Tomme P and van Es P 2004 Functional screening of viral siRNA libraries in human primary cells Drug Discovery World Fall 20 27 Brummelkamp TR Fabius AW Mullenders J Madiredjo M Velds A Kerkhoven RM Bernards R Beijersbergen RL 2006 An shRNA barcode screen provides insight into cancer cell vulnerability to MDM2 inhibitors Nat Chem Biol 2 4 202 206 Tech Support tech cellecta com 21 of 27 v 7a 7 28 10 Cellecta Inc 320 Logue Ave Mountain View CA 94043 www cellecta com CELLECTA 650 938 3910 Cullen LM Arndt GM 2005
21. HiSeq 2000 flow cells see www illumina com for details Please use 10 ng of plasmid shRNA library as an amplification control in the first round of PCR and use the subsequent PCR products in all remaining steps First Round of PCR 1 For each sample prepare 4 x 100 ul reactions containing 200 ug of genomic DNA ul Genomic DNA 50 ug ul FwdHTS primer 10 uM ul RevHTS primer 10 uM 50X dNTP 10 mM each ul 10X Titanium Taq Buffer ul Deionized water ul 50X Titanium Taq 100 ul Total volume Sacre ONWW 94 C 3 minutes 1 cycle 94 C 30 seconds 65 C 10 seconds 16 cycles 72 C 20 seconds 68 C 2 min 1 cycle Second Round of PCR The second round of PCR nested PCR can be performed in one of two ways depending on the model of the Illumina HT Sequencing machine For the GAIIx model which has an output of approximately 10 20 x 10 reads per sample amplify each DNA sample with the FwdGex and RevGex primer set and perform HT sequencing with 18nt reads on one sample per lane in flow cell with GexSeq primer If using the new HiSeq 2000 machine which outputs approximately 200x10 reads per lane a set of 10 indexing primers can be used Each indexing primer contains an 8nt sample specific bar code and individual primers can be used in combination with the FwdGex primer for amplification of each DNA sample After the amplification gel purification steps amplified bar codes from 3 10 samples can be mixed and sequ
22. Platform HT sequencing of pooled amplified bar codes can be performed on the Illumina Genome Analyzer IIx with approximately 5 10 x 10 reads per sample using the GexSeq primer and following the manufacturer s protocol Alternatively if using the HiSeq 2000 platform you can combine equal amounts of 10nM bar code PCR products amplified from up to 10 samples for HT sequence analysis using the GexSeqIND primer and following the manufacturer s protocol I Bar code Enumeration Conversion of raw sequencing data to number of reads for each bar code Coming soon Please contact Cellecta at tech cellecta com for more information J Statistical Analysis of shRNA hits enriched depleted in genetic screen Please contact Cellecta at tech cellecta com for more information K Interpretation of genetic screen data Please contact Cellecta at tech cellecta com for more information Tech Support tech cellecta com 15 of 27 v 7a 7 28 10 Cellecta Inc 320 Logue Ave Mountain View CA 94043 www cellecta com CELLECTA 650 938 3910 L Troubleshooting Low Pseudoviral Titer lt 10 TU ml in supernatant 1 Poor transfection efficiency Problem 293T Cells have too high or too low density Solution Plate fewer or more cells in order to have about 70 80 confluency at transfection stage Problem Plasmid DNA Lipofectamine Plus Reagent ratios are incorrect Solution Optimize the ratios using the guidelines provided
23. Proc Natl Acad Sci USA 100 183 188 Quinn T P and Trevor K T 1997 Rapid quantitation of recombinant retrovirus produced by packaging cell clones Biotechniques 23 1038 1044 Reynolds A Leake D Scaringe S Marshall W Boese Q and Khvorova A RNA interference mechanistic implications and rational siRNA design Nat Biotech 2004 22 326 330 Robinson I B and Gudkov A V Genetic suppressor elements in the characterization and identification of tumor suppressor genes In Methods in Molecular Biology Tumor Suppressor Genes Pathways and Isolation Strategies Ed Wafik S E Humana Press Inc Totowa NJ 2002 222 411 434 Sui G Soohoo C Affar E B Gay F Forrester W C and Shi Y 2002 Tech Support tech cellecta com 26 of 27 v 7a 7 28 10 Cellecta Inc 320 Logue Ave Mountain View CA 94043 www cellecta com CELLECTA 650 938 3910 A DNA vector based RNAi technology to suppress gene expression in mammalian cells Proc Natl Acad Sci U S A 99 5515 5520 Viskers T A Koo S Bennett C F Crooke S T Dean N M and Baker B F Efficient reduction of target RNAs by small interfering RNA and RNase H dependent antisense agents J Biol Chem 2003 278 9 7108 7118 Zheng L Liu J Batalov S Zhou D Orth A Ding S and Schultz G An approach to genomewide screens of expressed small interfering RNAs in mammalian cells Proc Natl Acad Sci 2004 101 135 140 Wiznerowicz M
24. Schlabach MR Sheth N Bradshaw J Burchard J Kulkarni A Cavet G Sachidanandam R McCombie WR Cleary MA Elledge SJ Hannon GJ 2005 Second generation shRNA libraries covering the mouse and human genomes Nat Genet 37 11 1281 8 Sugimoto A 2004 High throughput RNAi in Caenorhabditis elegans genome wide screens and functional genomics Differentiation 72 81 91 Vanhecke D and Janitz M 2005 Functional genomics using high throughput RNA interference Drug Discov Today 10 205 212 Tech Support tech cellecta com 22 of 27 v 7a 7 28 10 Cellecta Inc 320 Logue Ave Mountain View CA 94043 www cellecta com CELLECTA 650 938 3910 Voorhoeve PM le Sage C Schrier M Gillis AJ Stoop H Nagel R Liu YP van Duijse J Drost J Griekspoor A Zlotorynski E Yabuta N De Vita G Nojima H Looijenga LH Agami R 2006 A genetic screen implicates miRNA 372 and miRNA 373 as oncogenes in testicular germ cell tumors Cell 124 6 1169 81 Willingham AT Deveraux QL Hampton GM Aza Blanc P 2004 RNAi and HTS exploring cancer by systematic loss of function Oncogene 23 51 8392 400 Zheng L Liu J Batalov S Zhou D Orth A Ding S and Schultz P 2004 Proc Natl Acad Sci 101 135 140 Viability Screens and Synthetic Lethality References Reinhardt H C H Jiang et al 2009 Exploiting synthetic lethal interactions for targeted cancer therapy Cell Cycle 8 19 3112 9 McLaughlin Drubin M E an
25. after any spill of viable material All cultures stocks and other regulated wastes are decontaminated before disposal by an approved decontamination method such as autoclaving Materials to be decontaminated outside of the immediate laboratory area are to be placed in a durable leakproof properly marked biohazard infectious waste container and sealed for transportation from the laboratory Tech Support tech cellecta com 19 of 27 v 7a 7 28 10 Cellecta Inc 320 Logue Ave Mountain View CA 94043 www cellecta com CELLECTA 650 938 3910 O Cellecta Limited Use License Agreement The Lentiviral Plasmid and or Packaged shRNA Library the Product is intended to be used for internal research purposes only The Product or components of the Product may not be used in vitro or in vivo for any diagnostic preventative therapeutic or vaccine application or in the manufacture or testing of a product thereof or used directly or indirectly in humans for any purpose Cellecta Products their Progeny Modified Derivatives or Components may not be transferred to a Third Party resold modified for resale or used to manufacture commercial products or perform commercial services including but not limited to the sale of data generated in the course of internal research for any Third Party without approval from Cellecta The Buyer End User acknowledges that Product has been developed by Cellecta based on licenses from Third Parties and a
26. and Brown E L 1996 Expression monitoring by hybridization to high density oligonucleotide arrays Nat Biotech 14 1675 1680 Lorens J B Sousa C Bennett M K Molineaux S M and Payan D G The use of retroviruses as pharmaceutical tools for target discovery and validation in the field of functional genomics Curr Opin In Biotechnol 2001 12 613 621 Michiels F Es H and Tomme P One step further towards real high throughput functional genomics Trends in Biotechol 2003 21 147 152 Morgan R A Cornetta K and Anderson W F 1990 Application of the polymerase chain reaction in retroviral mediated gene transfer and the analysis of gene marked human TIL cells Hum Gene Ther 1 135 149 Paddison P J Silva J M Conlin D S Sclabach M Li M Aruleba S Balija V O Shaughnessy A Gnoj L Scolbe K Chang K Westbrook T Cleary M Sachldanandam R McCombie W R Elledge S and Hannon G J 2004 A resource for large scale RNA interference based screens in mammals Nature 428 427 431 Pfeifer A Kessler T Yang M Baranov E Kootstra N Cheresh D A Hoffman R M and Verma I M 2001 Transduction of liver cells by lentiviral vectors Analysis in living animals by fluorescence imaging Mol Ther 3 319 322 Qin X F An D S Chen I S and Baltimore D 2003 Inhibiting HIV 1 infection in human T cells by lentiviral mediated delivery of small interfering RNA against CCR5
27. ary of 27K complexity was used Six independent transductions were performed Each transduction consisted of 2 x 10 cells infected at 30 efficiency 6 x 10 infected cells Each transduction was treated as an independent sample Each independent sample had an estimated average of 200 clones per shRNA Day 1 Cells were trypsinized and resuspended to a density of 2 x 10 cells ml in D MEM supplemented with 10 FBS and 5 ug ml Polybrene 25 ml of cells were aliquoted to each 15 cm plate 4 plates per replicate 2 x 10 cells per replicate and enough pseudovirus was added to achieve 1 5 x 10 infected cells per plate Cells were returned to CO incubator and grown under standard conditions for 24 hours Tech Support tech cellecta com 10 of 27 v 7a 7 28 10 Cellecta Inc 320 Logue Ave Mountain View CA 94043 www cellecta com CELLECTA 650 938 3910 Day 2 At 24 hours post transduction media containing pseudovirus Polybrene was replaced with fresh media Day 3 At 48 hours post transduction three 3 samples were harvested and stored as frozen cell pellets baseline samples Puromycin was added to the three 3 remaining samples at a final concentration of 1 ug ml Day 9 Time treated samples were harvested and stored as frozen cell pellets Genomic DNA was then extracted and purified from treated and untreated samples shRNA insert bar codes were amplified from genomic DNA and enumerated by HT sequencing Tech S
28. d K Munger 2009 Oncogenic activities of human papillomaviruses Virus Res 143 2 195 208 Luo J M J Emanuele et al 2009 A genome wide RNAi screen identifies multiple synthetic lethal interactions with the Ras oncogene Cell 137 5 835 48 Scholl C S Frohling et al 2009 Synthetic lethal interaction between oncogenic KRAS dependency and STK33 suppression in human cancer cells Cell 137 5 821 34 Jiang H H C Reinhardt et al 2009 The combined status of ATM and p53 link tumor development with therapeutic response Genes Dev 23 16 1895 909 Boudreau R L I Martins et al 2009 Artificial microRNAs as siRNA shuttles improved safety as compared to shRNAs in vitro and in vivo Mol Ther 17 1 169 75 Luo B H W Cheung et al 2008 Highly parallel identification of essential genes in cancer cells Proc Natl Acad Sci US A 105 51 20380 5 Kassner P D 2008 Discovery of novel targets with high throughput RNA interference screening Comb Chem High Throughput Screen 11 3 175 84 Schwartz G F K S Hughes et al 2008 Proceedings of the international consensus conference on breast cancer risk genetics amp risk management April 2007 Cancer 113 10 2627 37 Elliott D D S I Sherman et al 2008 Growth factor receptors expression in anaplastic thyroid carcinoma potential markers for therapeutic stratification Hum Pathol 39 1 15 20 Fakhoury J G
29. dard to measure the relative levels of each shRNA insert species in the transduced cell population without selection Without this control it is difficult to determine which shRNA species are enriched depleted in the transduced cells after the selection step Design the experiment with at least triplicate samples Due to non optimized conditions and variations in cell number cultivation treatment conditions transduction efficiency performance of DNA purification bar code amplification high throughput sequencing etc you may expect some variation in shRNA specific bar code HT sequencing reads between each experimental sample In order to achieve statistically significant identification of genes involved in phenotypic responses it is necessary to design the experiment with at least triplicate samples for each population of phenotype selected and reference control cells Tech Support tech cellecta com 2 of 27 v 7a 7 28 10 Cellecta Inc 320 Logue Ave Mountain View CA 94043 www cellecta com CELLECTA 650 938 3910 B Required Materials Plasmid Lentiviral shRNA Library Pre made DECIPHER or Custom shRNA Library from Cellecta Lentiviral shRNA cloning expression vector Cellecta Positive control targeting lentiviral shRNA constructs Custom from Cellecta or generated by Customer Negative control non targeting lentiviral shRNA constructs Custom from Cellecta or generated by Customer Packaging plasmid mix
30. enced together with 36nt reads to reduce the HT sequencing cost 1 Combine together the 4 x 100 ul First Round PCR reactions and use a 2 ul aliquot in the second round of analytical PCR with nested primers in each 100 ul reaction Tech Support tech cellecta com 13 of 27 v 7a 7 28 10 Cellecta Inc 320 Logue Ave Mountain View CA 94043 www cellecta com CELLECTA 650 938 3910 2 ul First Round PCR Product 5 ul FwdGex1 primer 10 uM 5 ul RevGex or Indexing primer 10 uM 2 ul 50X dNTP 10 mM each 10 ul 10X Titanium Taq Buffer 75 ul Deionized water 1 ul 50X Titanium Taq 100 ul Total volume 94 C 3 minutes 1 cycle 94 C 30 seconds 65 C 10 seconds 10 12 or 14 cycles 72 C 10 seconds 68 C 2 min 1 cycle The amplified pooled bar code cassettes are then analyzed on a 3 5 agarose 1XTAE gel The results should reveal 106 bp amplified bar code products The goal of this analytical PCR step is to optimize the starting amount of First Round PCR product and the number of cycles if necessary in order to achieve equal intensities of a single 106 bp bar code band across all DNA samples from the genetic screen Avoid overcycling of PCR reactions this will usually result in the generation of a longer 130 150 bp band which corresponds to a fusion double bar code product Repeat second round amplification of bar codes from each sample using the optimized volume of First Round PCR product 3 x 100 ul of Second Round PCR produc
31. ency is not achieved in 24 hours Incubate at 37 C in a CO incubator for 24 hours Day 2 Transfection 3 Mix 600 ul 300 ug of the packaging plasmid mix with 60 ug 60 ul 600 ul depending on concentration of the plasmid library and then add the plasmid mixture to 30 ml D MEM medium without serum or antibiotics Add 600 ul of Plus Reagent mix and incubate at room temperature for 15 min 1 plate 10 plates Component 60 ul 600 ul Packaging plasmid mix 0 5 yg ul 6 ul 60 ul Plasmid shRNA Library 1 yg ul 3 000 ul 30 000 ul D MEM no FBS no antibiotics 60 ul 600 ul Plus Reagent 3 126 ul 31 260 ul Total volume 4 Add 900 ul of Lipofectamine Reagent to 30 ml of D MEM medium without serum or antibiotics Mix gently 1 plate 10 plates Component 3 000 ul 30 000 ul D MEM no FBS no antibiotics 90 ul 900 ul Lipofectamine 3 090 ul 30 900 ul Total volume 5 Add the diluted Lipofectamine Reagent from step 4 to the DNA Plus Reagent complex from step 3 mix gently by inversion and incubate at room temperature for 15 min 6 Add 6 ml of the DNA Plus Reagent Lipofectamine Reagent complex from step 5 to each 15 cm plate from step 2 and mix complexes with medium by gentle rotation Take care not to dislodge cells from the plate Incubate at 37 C in the CO incubator for 24 hours Day 3 DNase Treatment Optional 7 At
32. es applied to an arrayed viral high content screen Cell 124 6 1283 98 Ngo VN Davis RE Lamy L Yu X Zhao H Lenz G Lam LT Dave S Yang L Powell J Staudt LM 2006 A loss of function RNA interference screen for molecular targets in cancer Nature Mar 29 Paddison J P Silva J M Conklin D S et al 2004 A resource for large scale RNA interference based screens in mammals Nature 428 427 431 Paddison PJ Schlabach MR Sheth N Bradshaw J Burchard J Kulkarni A Cavet G Sachidanandam R McCombie WR Cleary MA Elledge SJ Hannon GJ 2005 Second generation shRNA libraries covering the mouse and human genomes Nat Genet 37 1281 8 Poulin G Nandakumar R Ahringer J 2004 Genome wide RNAi screens in Caenorhabditis elegans impact on cancer research Oncogene 23 8340 8345 Sachse C Echeverri CJ 2004 Oncology studies using siRNA libraries the dawn of RNAi based genomics Oncogene 23 8384 8391 Sachse C Krausz E Kronke A et al 2005 High throughput RNA interference strategies for target discovery and validation by using synthetic short interfering RNAs Functional genomic investigations of biological pathways Methods in Enzymology 392 242 277 Silva J Chang K Hannon G J and Rivas F V 2004 RNA interference based functional genomics in mammalian cells reverse genetics coming of age Oncogene 23 8401 8409 Silva JM Li MZ Chang K Ge W Golding MC Rickles RJ Siolas D Hu G Paddison PJ
33. gham A T Q L Deveraux et al 2004 RNAi and HTS exploring cancer by systematic loss of function Oncogene 23 51 8392 400 Downward J 2004 Use of RNA interference libraries to investigate oncogenic signalling in mammalian cells Oncogene 23 51 8376 83 Tech Support tech cellecta com 24 of 27 v 7a 7 28 10 Cellecta Inc 320 Logue Ave Mountain View CA 94043 www cellecta com CELLECTA 650 938 3910 Yuan B R Latek et al 2004 siRNA Selection Server an automated siRNA oligonucleotide prediction server Nucleic Acids Res 32 Web Server issue W130 4 Zhao J J O V Gjoerup et al 2003 Human mammary epithelial cell transformation through the activation of phosphatidylinositol 3 kinase Cancer Cell 3 5 483 95 Martin A C and D G Drubin 2003 Impact of genome wide functional analyses on cell biology research Curr Opin Cell Biol 15 1 6 13 Voorhoeve P M and R Agami 2003 Knockdown stands up Trends Biotechnol 21 1 2 4 Aza Blanc P C L Cooper et al 2003 Identification of modulators of TRAIL induced apoptosis via RNAi based phenotypic screening Mol Cell 12 3 627 37 Brummelkamp T R S M Nijman et al 2003 Loss of the cylindromatosis tumour suppressor inhibits apoptosis by activating NF kappaB Nature 424 6950 797 801 Kumar R D S Conklin et al 2003 High throughput selection of effective RNAi probes for gene silencing Genome Res 13
34. grees with the Terms of Limited Use for the Buyer End User provided by the Third Parties Life Technologies Corporation End User Label License for the use of Lentiviral Expression System This product or service based upon the Lentiviral Expression System is sublicensed from Life Technologies Corporation under U S Patent Nos 5 686 279 5 834 256 5 858 740 5 994 136 6 013 516 6 051 427 6 165 782 6 218 187 6 428 953 6 924 144 7 083 981 and 7 250 299 and corresponding patents and applications in other countries for internal research purposes only Use of this technology for gene therapy applications or bioprocessing other than for nonhuman research use requires a license from GBP IP LLC Please contact GBP IP LLC 537 Steamboat Road Suite 200 Greenwich CT 06830 Use of this technology to make or sell products or offer services for consideration in the research market requires a license from Life Technologies Corporation 5791 Van Allen Way Carlsbad CA 92008 Agilent Technologies Inc End User Label License for the use of shRNA libraries comprising Oligo Libraries This Internal Use only license grants End Users the sole right to use and fully consume or destroy this product the Product Use of the Product is limited to Research Use ONLY not for diagnostic procedures In all cases sale or other transfer or distribution to third parties of i the Product or any portion ii DNA RNA and protein constructs or l
35. i screens we recommend optimizing transduction conditions and starting your experiment with 25 50 transduced cells transduced cells 10 20 30 40 50 60 70 80 90 gt 90 MOI 0 1 0 23 0 36 0 51 0 7 0 93 1 22 1 64 2 3 gt 2 5 MOI cannot be reliably calculated if of transduced cells is gt 90 Table 1 Conversion of transduced cells to MOI Percentage of cells with 0 1 2 3 or 4 integrants Table 2 Number of Integrations based on Poisson Distribution showing the expected number of shRNA integrants per cell at different MOIs At a specific MOI the number of cells having 0 1 2 3 or 4 pseudoviral integrants per cell is listed For example at a MOI of 0 3 an estimated 12 3 of 25 of the infected cells have more than one pseudoviral integrant At an MOI of 0 8 about 34 19 of 55 have more than one integrant Tech Support tech cellecta com 9 of 27 v 7a 7 28 10 Cellecta Inc 320 Logue Ave Mountain View CA 94043 www cellecta com CELLECTA 650 938 3910 F Examples of HT RNAi Screens Positive Selection Screen Identification of shRNAs conferring resistance to TGF 8 mediated apoptosis in Human Hepatocellular Carcinoma Hep3B cells treatment is TGF B An shRNA library of 27K complexity was used Six independent transductions were performed Each transduction consisted of 1 5 x 10 cells infected at 35 efficiency 5 3 x 10 infected cells Each
36. ibraries created from the Product or any portion or of iii transformed phage viruses cells or tissues created directly or indirectly from the Product or any portion is strictly prohibited without prior written approval by Agilent Technologies Inc Evrogen IP JSC End User Label License for the use of lentiviral shRNA constructs comprising TagRFP encoded gene This product is for internal non commercial research use only No rights are conveyed to modify or clone the gene encoding fluorescent protein contained in this product The right to use this product specifically excludes the right to validate or screen compounds For information on commercial licensing contact Evrogen Licensing Department email license evrogen com Tech Support tech cellecta com 20 of 27 v 7a 7 28 10 Cellecta Inc 320 Logue Ave Mountain View CA 94043 www cellecta com CELLECTA 650 938 3910 P References Cellecta First Generation shRNA Library References Tsujii H Eguchi Y Chenchik A Mizutani T Yamada K Tsujimoto Y 2010 Screening of Cell Death Genes With a Mammalian Genome wide RNAi Library J Biochem Apr 26 Epub ahead of print PubMed PMID 20421362 Ossovskaya V S G Dolganov et al 2009 Loss of function genetic screens reveal MTGR1 as an intracellular repressor of beta1 integrin dependent neurite outgrowth J Neurosci Methods 177 2 322 33 Gumireddy K A Li et al 2009 KLF17 is a negative regulator
37. incubator Grow cells under standard conditions for 48 hours For puromycin the minimum antibiotic concentration to use is the lowest concentration that kills 100 of cells in 48 hours Tech Support tech cellecta com 8 of 27 v 7a 7 28 10 Cellecta Inc 320 Logue Ave Mountain View CA 94043 www cellecta com CELLECTA 650 938 3910 E Protocols for Genetic Screens with Pooled Lentiviral shRNA Libraries To ensure reproducible and reliable results when using pooled shRNA libraries it is critical that you infect enough cells to maintain sufficient representation of each shRNA construct present in the cellular library The number of cells stably transduced with the shRNA library at the time of infection should exceed the complexity of the shRNA library by at least 100 fold or optimally 1 000 fold After infection no cells should ever be discarded at any time during the experiment e g at splitting steps If the number of cells is too high to grow e g 5 x 108 cells you can discard a fraction of the cells However the number of remaining cells should always exceed the complexity of the library by at least 1 000 fold e g keep at least 100 x 10 cells after splitting step Additionally when using pooled shRNA libraries you should consider that the higher the percentage of transduced cells and MOI the higher the percentage of infected cells that will bear two or more different shRNA constructs see Tables 1 and 2 below For most RNA
38. ing Target Cells What MOI did you use to transduce your target cells What target cells did you use How many replicates did you use e duplicate triplicate etc Did you use puromycin after transduction and at what concentration For how long did you use puromycin on the cells SO eal RNAi Screen 10 Could you briefly explain your experiment 11 How many infected cells were used Sample Preparation amp HT Sequencing 12 How much PCR product was used for HT Sequencing 13 How many sequences were read per sample 14 Would you be able to send us the raw data so that it may help us diagnose the issue Tech Support tech cellecta com 18 of 27 v 7a 7 28 10 Cellecta Inc 320 Logue Ave Mountain View CA 94043 www cellecta com CELLECTA 650 938 3910 N Safety Guidelines The HIV based lentivector system is designed to maximize its biosafety features which include A deletion in the enhancer of the U3 region of 3 ALTR ensures self inactivation of the lentiviral construct after transduction and integration into genomic DNA of the target cells The RSV promoter upstream of 5 LTR in the lentivector allows efficient Tat independent production of viral RNA reducing the number of genes from HIV 1 that are used in this system Number of lentiviral genes necessary for packaging replication and transduction is reduced to three gag pol rev The corresponding proteins are expressed from different plasmids
39. m for 1 hour at 4 C in a Beckman JA14 or JA10 or equivalent rotor Mark the tubes to identify the location where the pellet will be At the end of centrifugation you may or may not be able to see a pellet assume it is at the location of the mark Immediately discard the supernatant by aspirating Place the tube on ice resuspend the in visible pellet in PBS 10 FBS make aliquots and freeze at 80 C Alternatively you may concentrate pseudovirus by the any of the methods below However the yield of pseudovirus is superior 80 recovery using Cellecta s protocol above Ultracentrifugation at 50 000 x g for 90 min at 4 C Sucrose cushion ultracentrifugation PEG precipitation followed by low speed centrifugation Tech Support tech cellecta com 6 of 27 v 7a 7 28 10 Cellecta Inc 320 Logue Ave Mountain View CA 94043 www cellecta com CELLECTA 650 938 3910 D Pseudoviral Titer Estimation Cellecta s lentiviral shRNA vectors all express both RFP and Puromycin Resistance markers Titers are calculated based on the percentage of either RFP positive or Puromycin resistant cells We recommend that you estimate the titer of the pseudovirus containing supernatant before proceeding with transduction experiments for the following reasons e To ensure that pseudoviral stock is viable e To determine the amount of pseudoviral particles transduction units TU necessary to achieve the desirable percentage of transduced ta
40. o manifest When performing a genetic screen experiment make an effort to minimize the time necessary for functional selection Extended growth of phenotypically selected cells reduces the reproducibility of identification of functional shRNAs in triplicate cell samples due to heterogeneity of cellular pools differences in clonal cell growth spontaneous apoptosis etc ie genetic drift Based on our experience the maximum number of cell duplications for negative selection viability screens should be no more than 8 10 divisions In the case of positive selection screens with high levels of enrichment 50 100 fold of phenotype specific cells grow selected cell pools up to approximately 1 x 10 cells and use all cells for purification of genomic DNA and bar cpde amplification For positive selection screens with low levels of enrichment 3 10 fold consider designing an experiment with two sequential rounds of enrichment and using the entire pool of second round enriched cells for genomic DNA isolation and bar code amplification steps Use Reference Control Cells As a control for the genetic screen it is important to use cells infected with the shRNA library but not selected for a specific phenotype or induced treated by a phenotype inducing agent etc There are many options that can be considered for the selection of appropriate reference control cells depending on your biological system This control is necessary to use as a stan
41. of epithelial mesenchymal transition and metastasis in breast cancer Nat Cell Biol 11 11 1297 304 Chen Y R Cairns et al 2009 Oxygen consumption can regulate the growth of tumors a new perspective on the warburg effect PLoS One 4 9 e7033 Xu M M Takanashi et al 2009 USP15 plays an essential role for caspase 3 activation during Paclitaxel induced apoptosis Biochem Biophys Res Commun 388 2 366 71 Yeung M L L Houzet et al 2009 A genome wide short hairpin RNA screening of jurkat T cells for human proteins contributing to productive HIV 1 replication J Biol Chem 284 29 19463 73 Huang X J Y Wang et al 2008 Systems analysis of quantitative shRNA library screens identifies regulators of cell adhesion BMC Syst Biol 2 49 Hattori H X Zhang et al 2007 RNAi screen identifies UBE2D3 as a mediator of all trans retinoic acid induced cell growth arrest in human acute promyelocytic NB4 cells Blood 110 2 640 50 Hwang G W T Hayashi et al 2007 siRNA mediated inhibition of phosphatidylinositol glycan Class B PIGB confers resistance to methylmercury in HEK293 cells J Toxicol Sci 32 5 581 3 shRNA Library Reviews Martin S E and N J Caplen 2007 Applications of RNA interference in mammalian systems Annu Rev Genomics Hum Genet 8 81 108 Echeverri C J and N Perrimon 2006 High throughput RNAi screening in cultured cells a user s guide Nat Rev
42. ositive cells using flow cytometry you can determine the copy number of integrated lentiviral constructs multiplicity of infection MOI in infected cells You may also visualize the cells for RFP fluorescence by microscopy but the results will be inaccurate due to lower detection sensitivity compared to flow cytometry Detach cells from the plate by trypsin treatment centrifuge resuspend in 1X D PBS at approximately 10 x 10 cells ml and determine the percentage of transduced RFP positive cells by flow cytometry In order to set up a gate for counting RFP positive cells first analyze the background RFP level of control non transduced cells 0 ul of pseudoviral stock Based on the percentage of transduced cells and the volume of pseudoviral stock used calculate the multiplicity of infection MOI and original concentration of infective pseudoviral particles in the pseudoviral stock transduction units per ml TU ml MOI viral integrants cell Titer MOI x cells at infection x ml pseudovirus used TU ml Example if 10 yl of pseudovirus used to infect 1 x 10 cells resulted in 20 RFP positive cells the titer is 0 23 MOI x 100 000 cells 0 010 ml 2 3 x 10 TU ml To convert of infected cells to MOI refer to the table below transduced cells 10 20 30 40 50 60 70 80 90 gt 90T MOI 0 1 0 23 0 36 0 51 0 7 0 93 1 22 1 64 2 3 gt 2 5T t MOI cannot be reliably calculated if of transduced cells is gt
43. pernatant can also be collected at 72 hours post transfection replace the collected 48 hour supernatant with 30 ml of fresh D MEM medium supplemented with 10 FBS and continue incubation in the CO incubator at 37 C for 24 hours Caution You are working with infectious pseudoviral particles at this stage Please follow the recommended guidelines for working with BSL 2 safety class see Section G Safety Guidelines Proceed to concentration step or aliquot and store the non concentrated supernatant at 80 C Freezing and thawing may result in 10 20 loss of pseudoviral titer with each cycle Concentrating Pseudovirus Optional Although concentrating pseudovirus is optional it is recommended if 1 very high titer pseudovirus stock may be needed to achieve desired MOI in hard to infect target cells or 2 pseudovirus should be suspended in another media besides the standard PBS 10 FBS which is optimal for sensitive target cells However because of the additional manipulation of samples there is the added risk of contamination and loss of pseudovirus The following protocol was optimized to concentrate pseudovirus with high recovery The protocol assumes that pseudoviral supernatant was harvested 48 hours after transfection and filtered as in step 8 above 1 2 Aliquot pseudoviral supernatant in clear centrifuge tubes Add Polybrene to a final concentration of 5 ug ml and incubate for 1 hour at 4 C Centrifuge at 10 000 rp
44. pression e Contact Cellecta at tech cellecta com to have the library cloned in another vector with different promoter s Difficulties with Probe Preparation and HT Sequencing 1 No PCR Product Problem Incorrect primers or bad reagents used or missing reagents Solution Include 10 ng of plasmid library DNA as a positive control If it produces the correct amplification product the problem lies with the genomic DNA or previous PCR prep If not confirm use of the correct primers and reagents No bar codes present in HT Sequencing results Problem Incorrect primer used in Illumina Solexa Cluster Generation step Solution Ensure that you or the HT Sequencing core facility uses the GexSeq or GexSeqIND Sequencing primer see Required Materials NOT the Sequencing primer that comes with the Illumina Cluster Generation Kit Tech Support tech cellecta com 17 of 27 v 7a 7 28 10 Cellecta Inc 320 Logue Ave Mountain View CA 94043 www cellecta com CELLECTA 650 938 3910 M Technical Support For additional help with using the Pooled Lentiviral shRNA Library please email technical support at tech cellecta com with the answers to the questions below Library Used 1 Which library did you use and which Module s 2 What are the lot numbers Packaging the Library 3 What was the pseudoviral titer and what was the total number of TU packaged 4 How was the pseudovirus concentrated if applicable Transduc
45. rget cells multiplicity of infection MOTI e To control the number of copies of integrated pseudoviral constructs per target cell To check pseudoviral titer we recommend choosing a cell line appropriate for your experimental system Most of the commonly used mammalian cell lines can be effectively transduced by lentiviral constructs Relative titers can vary up to 50 fold depending on the chosen cell line Check Toxicity of Polybrene Polybrene is a polycation that neutralizes charge interactions to increase binding between the pseudoviral envelope and the cellular membrane The optimal concentration of Polybrene depends on cell type and may need to be empirically determined Excessive exposure to Polybrene can be toxic to some cells Before conducting the titer estimation experiment we recommended performing a Polybrene toxicity titration in target cells Grow cells in complete culture medium with a range of Polybrene concentrations 0 ug ml 2 5 ug ml 5 ug ml for 24 hours and then replace old medium with Polybrene free complete culture medium Grow cells for an additional 48 hours and then check toxicity by counting viable cells For your experiments use the highest concentration of Polybrene that results in less than 10 cell toxicity compared to no Polybrene typically 5 pg ml is recommended For some cell types you cannot use Polybrene Transduction Protocol For Titering in HEK293 cells Please read the entire protocol before
46. ry at 80 C Each freeze thaw cycle causes reduction of the titer by 10 20 Use a fresh stock for transduction Tech Support tech cellecta com 16 of 27 v 7a 7 28 10 Cellecta Inc 320 Logue Ave Mountain View CA 94043 www cellecta com CELLECTA 650 938 3910 Problem The assay is performed too early Solution Normally the maximal expression of integrated provirus is expected to develop by 48 72 hours after infection However some cells exhibit delayed expression Try the assay at a later time such as 96 hours Transduction affects target cell viability Problem Polybrene is toxic for target cells Solution Optimize the concentration and exposure time to Polybrene during the transduction step For some sensitive cells Polybrene should not be used Problem Pseudovirus containing conditioned media is toxic to target cells Solution Concentrate and resuspend the pseudovirus in target cell growth media Problem Pseudovirus itself is toxic to target cells Polybrene and or conditioned media is not toxic Solutions e Decrease the incubation time of pseudovirus with target cells e Perform two sequential transductions with short incubation times No expression of RFP or Puro or shRNAs in target cells Problem The UbiC or U6 promoter is not functional in target cells Solutions e Change the target cells e Replace the ineffective promoter s with EF1 CMV or PGK for marker expression and or H1 for shRNA ex
47. shRNA vectors BMC Biotechnol 6 7 Schilling S H M B Datto et al 2006 A phosphatase controls the fate of receptor regulated Smads Cell 125 5 838 40 Massague J and R R Gomis 2006 The logic of TGFbeta signaling FEBS Lett 580 12 2811 20 An D S F X Qin et al 2006 Optimization and functional effects of stable short hairpin RNA expression in primary human lymphocytes via lentiviral vectors Mol Ther 14 4 494 504 Birmingham A E M Anderson et al 2006 3 UTR seed matches but not overall identity are associated with RNAi off targets Nat Methods 3 3 199 204 Cullen B R 2006 Induction of stable RNA interference in mammalian cells Gene Ther 13 6 503 8 Olson A N Sheth et al 2006 RNAi Codex a portal database for short hairpin RNA shRNA gene silencing constructs Nucleic Acids Res 34 Database issue D153 7 Farmer H N McCabe et al 2005 Targeting the DNA repair defect in BRCA mutant cells as a therapeutic strategy Nature 434 7035 917 21 MackKeigan J P L O Murphy et al 2005 Sensitized RNAi screen of human kinases and phosphatases identifies new regulators of apoptosis and chemoresistance Nat Cell Biol 7 6 591 600 Silva J M M Z Li et al 2005 Second generation shRNA libraries covering the mouse and human genomes Nat Genet 37 11 1281 8 Huesken D J Lange et al 2005 Design of a genome wide siRNA library using an ar
48. t per sample and 12 14 cycles of PCR Set up 3 x 100 ul reactions for each sample containing an adjusted equal amount of First Round PCR product Hl First Round PCR Product Hl FwdGex1 primer 10 uM ul RevGex or Indexing primer 10 uM ul 50X dNTP 10 mM each 10 ul 10X Titanium Taq Buffer 75 ul Deionized water 1 ul 50X Titanium Taq 100 ul Total volume NW UN 94 C 3 minutes 1 cycle 94 C 30 seconds 65 C 10 seconds 12 or 14 cycles 72 C 10 seconds 68 C 2 min 1 cycle Analyze the PCR products by gel electrophoresis on a 3 5 agarose 1XTAE gel in order to ensure equal yields of amplified bar codes for all samples Combine amplified bar codes from the 3 x 100 ul Second Round PCR reactions and purify the samples as follows 1 Purify the PCR product with the QIAquick PCR purification kit QIAGEN following the manufacturer s protocol 2 Separate by electrophoresis in a preparative 3 5 agarose 1XTAE gel 3 Cut out band and extract DNA from the gel using the QIAquick gel purification kit QIAGEN and Tech Support tech cellecta com 14 of 27 v 7a 7 28 10 Cellecta Inc 320 Logue Ave Mountain View CA 94043 www cellecta com CELLECTA 650 938 3910 4 Quantitate using A260 nm measurement using NanoDrop spectrophotometer or equivalent and adjust concentration to 10nM 0 75 ng ul H HT sequencing of Pooled shRNA specific Bar codes in Illumina s Genome Analyzer GAIIx or HiSeq 2000 HT Sequencing
49. tificial neural network Nat Biotechnol 23 8 995 1001 Boese Q D Leake et al 2005 Mechanistic insights aid computational short interfering RNA design Methods Enzymol 392 73 96 Jagla B N Aulner et al 2005 Sequence characteristics of functional siRNAs RNA 11 6 864 72 Wu G M Xing et al 2005 Somatic mutation and gain of copy number of PIK3CA in human breast cancer Breast Cancer Res 7 5 R609 16 Kaelin W G Jr 2005 The concept of synthetic lethality in the context of anticancer therapy Nat Rev Cancer 5 9 689 98 Sachse C E Krausz et al 2005 High throughput RNA interference strategies for target discovery and validation by using synthetic short interfering RNAs functional genomics investigations of biological pathways Methods Enzymol 392 242 77 Silva J K Chang et al 2004 RNA interference based functional genomics in mammalian cells reverse genetics coming of age Oncogene 23 51 8401 9 Zheng L J Liu et al 2004 An approach to genomewide screens of expressed small interfering RNAs in mammalian cells Proc Natl Acad Sci US A 101 1 135 40 Mangeot P E F L Cosset et al 2004 A universal transgene silencing method based on RNA interference Nucleic Acids Res 32 12 e102 Du Q H Thonberg et al 2004 Validating siRNA using a reporter made from synthetic DNA oligonucleotides Biochem Biophys Res Commun 325 1 243 9 Willin
50. upport tech cellecta com 11 of 27 v 7a 7 28 10 Cellecta Inc 320 Logue Ave Mountain View CA 94043 www cellecta com CELLECTA 650 938 3910 Genomic DNA Extraction for Bar Code Amplification and HT Sequencing Resuspend cell pellet approximately 100x10 cells if the number of cells in the sample after the screen is more than 100x10 cells in 10 ml Buffer P1 supplemented with 100 pg ml RNase A see Required Materials in a 30 ml screw cap Beckman Centrifuge tube If the number of cells in the sample after the genetic screen e g positive selection screen is less than 100x10 cells use proportionally less volume of P1 RNase A buffer Add 0 5 ml 10 SDS gently mix and incubate 5 minutes at RT In the preferred protocol sonicate to shear DNA into 10kb size fragments Thoroughly wash the ultrasound head in 1 SDS solution to prevent contamination between samples Alternatively share genomic DNA by passing cell lysate 5 10 times through a 22 gauge syringe needle Add 10 ml phenol chloroform pH 8 0 solution vortex vigorously for 60 seconds and centrifuge for 20 minutes at 15 000 rpm at RT in a JA 20 rotor using a Beckman centrifuge or equivalent Using a large bore pipette transfer upper phase 10 ml to a clean 30 ml screw cap Beckman centrifuge tube Avoid contamination of DNA containing upper phase with interphase Repeat steps 4 and 5 Add 0 1 volume 1 ml of 3M Sodium Acetate and 0 8 volume 8 ml of isopropanol

DECIPHER User Manual

Contents

Download Pdf Manuals

Related Search

Related Contents