Home

Pharmacogenomics Experiments User Guide

1. Set the default analysis settings Call Settings T Control Identifiers QC Settings Study Level Settings 7 Override Control Settings from Experiments NTC for all Assays NTC Positive Controls VIC VIC Negative Controls Positive Controls VIC FAM Manually enter identifiers or paste identifiers from a spreadsheet application Positive Controls FAM FAM Use commas to separate identifiers commas are not allowed within identifiers Assay ID any string any character Assay Specific Settings Assay ID Assay Name Negative Controls PC VIC VIC PC VIC FAM PC FAM FAM Reset C___177489_10 G a C___940286_10 o z C 1046426 10 5 C___1085595_10 5 C__1213693_10 G C__1240647_1_ 5 C___1240651_20 5 C___1332250_10 G C__1376137_10 5 C__1551497_10 5 C___1839948 10 5 z Aly Pharmacogenomics Experiments User Guide 55 5 Chapter 5 Prepare run and analyze OpenArray PGx experiments Perform analysis in TagMan Genotyper Software Impact of analysis This section describes the impact of the following analysis settings in the Analysis settings Settings dialog box e Hardy Weinberg for Analysis check box e Heterozygote analysis option for sex chromosome targets Note In the toolbar click Analysis Settings to open the Analysis Settings dialog box Hardy Weinberg for Analysis check box For targets expected to follow Hardy Weinberg equilibrium select Use Hardy Weinberg for Analysis to
2. Item Catalog no TaqMan RNase P Detection Reagents Kit 4316831 TaqMan DNA Template Reagents Kit 401970 TaqMan Genotyping Master Mix 2X 4371355 Optional TaqMan Fast Advanced Master Mix for samples 4444557 with PCR inhibitors Nuclease free Watert 10977 015 MicroAmp Optical Adhesive Film 4360954 MicroAmp Optical Reaction Platet e MicroAmp EnduraPlate Optical 384 Well Clear Reaction 4483273 Plates with Barcode s MicroAmp Optical 96 Well Reaction Plate e 4316813 e MicroAmp Fast Optical 96 Well Reaction Plate 0 1 mL e 4346907 T Also provided in the MagMAX DNA Multi Sample Ultra Kit T Select one to fit your PCR instrument block Pharmacogenomics Experiments User Guide 88 Appendix B Sample quantification using the RNase P Detection Reagents Kit Procedure Prepare reagents standards and samples Prepare reaction mix 89 1 Remove the 20X RNase P Primer Probe mix from the TaqMan RNase P Detection Reagents Kit and thaw at room temperature 2 Remove the tubes labeled DNA Templates 1 2 3 4 and 5 from the TaqMan DNA Template Reagents Kit and thaw at room temperature 3 Remove samples from storage and thaw at room temperature if necessary 4 Vortex the reagents and samples from Steps 1 3 briefly and centrifuge to collect contents at the bottom of the tubes 5 Remove the TaqMan Genotyping Master Mix from storage and thaw Once thawed mix gently by invers
3. 12K Flex Software v1 2 1 File Edit Instrument Analysis Tools S New Experiment 2 Open ki Save 3 Close Pr Import 4 Create Side E Print Report g Experiment Description Frequency Fluorescence is offscale signal in well itive control failed number of samples in cluster ation in negative control amplification higher than others in plate spikes EXPFAIL exponential algorithm faled BLFAIL algorithm failed THOLDFAIL Thresholding algorithm faled CTFAIL Kr algorithm failed Analysis A1hS Aih6 A2HS A2h6 AHS A26 A Allelic Alal A1b1 AlcS Aldi Ald2 A1d8 Al Discrimination Plot piae jars o Amplification Plot Multicomponent Plot Raw Data Plot sn LA If you click each flag it will bring up and explanation of what the flag means and a troubleshooting link on the right as shown below Experiment Type Reagents Flag Description Frequency wells d j i Flag EXPFAR Exponentid agonthm fated SE LTE p I Flag Detail The software cannot identify the exponential region of the amplification plot IROSIGNAL No apan wel p i ia pran Poste contral faled p Flagged Wels None SMCLUSTER Ema number of Ee P Guster p PFAIL Troubleshooting Information AMENC pmelication P negative control p GE Te seas p Norse Note higher than others n plate
4. Adjustable micropipettors MLS Multi channel micropipettors MLS Optional but recommended Magnetic Stand 96 Cat no AM10027 Plastics and consumables MagMAX Express 96 Deep Well Plates Cat no 4388476 MagMAx Express 96 Standard Plates Cat no 4388475 MagMAx Express 96 Deep Well Tip Combs Cat no 4388487 MicroAmp Clear Adhesive Film Cat no 4306311 Puritan PurFlock Ultra Flocked Swabs Cat no 22 025 192 2 RNase free Microfuge Tubes 2 0 mL Cat no AM12425 Conical tubes 15 mL Cat no AM12500 Conical tubes 50 mL Cat no AM12502 Aerosol resistant pipette tips MLS Reagent reservoirs MLS Reagents Ethanol 200 proof absolute MLS Isopropanol 100 molecular grade or higher MLS Optional Proteinase K 500 reactions 4 mL Cat no A25561 Optional DNA Binding Beads 500 reactions 8 mL Cat no A25562 21 Available from Fisher Scientific 11 See If needed download the KingFisher Flex program on page 2 technologies Pharmacogenomics Experiments User Guide Sample collection and storage Test subjects should thoroughly rinse their mouths with water and swallow prior to swabbing 1 Remove swab from container and thoroughly swab both cheeks of the test subject for 30 seconds each to maximize collection of buccal cells Note Use polyester swabs for optimum r
5. 5 Select QuantStudio 12K Flex Real Time PCR System from the Instrument drop down menu Enter in the number of 10 packs for your order and your Array description You can also click Save Your Array if you want to complete your order later or save it for future orders 6 Click Add to Cart to add your OpenArray plates to your shopping cart where you can begin the checkout process to complete your order Table 5 Storage conditions for TagMan OpenArray Genotyping Plates If the TaqMan OpenArray Genotyping Plate is Stored eon O02 Frozen unopened Store at 20 C until the expiration date provided on the product label Thawed unopened Store at room temperature for up to 24 hours Thawed opened Store at room temperature for up to 1 hour Loaded and sealed pre Store at room temperature in the dark for up to thermal cycling 24 hours Loaded and sealed post Store at 4 C in the dark for up to 72 hours thermal cycling Order single tube TaqMan Assays Chapter 2 Background and tools for assay content selection on page 13 provides instructions for searching for predesigned TaqMan SNP and Copy Number assays Chapter 2 also provides resources such as lists of commonly used and recommended specialty PGx assays Methods of ordering assays are briefly described here Following a predesigned assay search assays may be selected and added to a shopping cart for ordering Order passing cus
6. Real time genotyping graphs used for making accurate calls when using samples with very high DNA lt we ooo ome concentration lne Ae KK rnr Ae ra T R 46 Pharmacogenomics Experiments User Guide Chapter 5 Prepare run and analyze OpenArray PGx experiments 5 Analysis settings in the QuantStudio 12K Flex Software The default run type for genotyping experiments is real time mode indicated by the check mark in the Include Amplification box shown below The default settings also have a check mark in the Include Pre read box this setting is strongly recommended to correct for background fluorescence on the plate Run OpenArray S w Load the reaction plate into the instrument Select the instrument and enter the setup files then click Start Run Select Instrument FOSHAYASHK1L04 READY Setup OpenA rray Run Get Plate IDs Confirm Plate Centers Run Type Genotyping V Include Amplification X Include Pre read Reagent Type TaqMan Opendrray 1 DEBO1 Setup File loaded_DEBO1 spf Experiment File Location lex Software User Files Experiments Browse Sample File Experiment File Name DEBO1_2012_03_05_124756 eds OpenArray 2 Setup File rowse Experiment File Location Experiment File Name Opendrray 3 a Setup File l Browse Experiment File Location Experiment File Name Opendrray 4 Setup File Br
7. Software and go to Instrument gt Edit Preferences as shown below thy OpenArray AccuFill System Deck a l File Instrument Service Help Setup and Load OpenArray Plates Cancel Current Operation Setup Show Deck Show Loading History Show Instrument Log Run System Self Test Edit Preferences 42 Pharmacogenomics Experiments User Guide Chapter 5 Prepare run and analyze OpenArray PGx experiments Track samples b In the Preferences dialog box check Require Sample Integration c Create the directories shown in the Location column in the table below then create shortcuts to these folders on the desktop Folder Location Contents Input drive Program Files Applied Biosystems OpenArray AccuFill SPF spf files that are downloaded from the web at www lifetechnologies com 0A platefiles Sample Plate drive Program Files Applied Biosystems OpenArray AccuFill Samples Contains sample csv files Loaded OpenArray Plate drive Program Files Applied Biosystems OpenArray AccuFill Loaded SPF Integrated spf files with sample names The QuantStudio OpenArray AccuFill Software automatically places the integrated spf file with sample names in this folder after the QuantStudio OpenArray AccuFill Software run The resulting spf file includes the sample names d Click Change to select the folders created for the Input Sample Pl
8. dye in both assays and one probe for one of the minor alleles which is labeled with the second reporter dye FAM dye To generate accurate sample genotypes the two assays must be run independently on the same panel of samples and the resulting allelic discrimination plots must be analyzed in concert comparing the expected cluster positions from both assays to a map of the true sample genotypes Sample genotypes can be assigned with the help of a spreadsheet program and a chart of the expected genotypes see Table 10 on page 65 or the AlleleTyper Software can be used to translate the results See the application note TagMan Drug Metabolism Genotyping Assays for Triallelic SNPs Pub no 135AP01 01 for more details on manual analysis of triallelic SNPs using 2 DME SNP assays or refer to the AlleleTyper Software User Guide Pub no 4469874 for information on having the genotypes assigned automatically by this software Table3 TaqMan DME Assays to triallelic SNPs TaqMan DME assay C_11711720C_30 C_11711720D_40 CYP2C9 rs7900194 C__25625804_10 C_25625804D_20 Gene rsSNP ID Allele name Assay alleles ABCB1 rs2032582 ABCB1 c 3095G gt T C A ABCB1 c 3095G gt A C T CYP2C9 8 c 449G gt A A G CYP2C9 27 c 449G gt T T G CYP2D6 rs5030865 C_30634117C_K0 C_30634117D_M0 CYP1A1 rs41279188 C_30634152C_70 C_30634152D_80 CYP2C8 rs72558195 C_72650009C_10 C_72650009D_20 CYP2D6 8 g 1758G gt T A C CYP
9. A260 A280 ratio of approximately 1 6 2 0 Limited product warranty Life Technologies Corporation and or its affiliate s warrant their products as set forth in the Life Technologies General Terms and Conditions of Sale found on Life Technologies website at www lifetechnologies com termsandconditions If you have any questions please contact Life Technologies at www lifetechnologies com support The information in this guide is subject to change without notice DISCLAIMER LIFE TECHNOLOGIES CORPORATION AND OR ITS AFFILIATE S DISCLAIM ALL WARRANTIES WITH RESPECT TO THIS DOCUMENT EXPRESSED OR IMPLIED INCLUDING BUT NOT LIMITED TO THOSE OF MERCHANTABILITY FITNESS FOR A PARTICULAR PURPOSE OR NON INFRINGEMENT TO THE EXTENT ALLOWED BY LAW IN NO EVENT SHALL LIFE TECHNOLOGIES AND OR ITS AFFILIATE S BE LIABLE WHETHER IN CONTRACT TORT WARRANTY OR UNDER ANY STATUTE OR ON ANY OTHER BASIS FOR SPECIAL INCIDENTAL INDIRECT PUNITIVE MULTIPLE OR CONSEQUENTIAL DAMAGES IN CONNECTION WITH OR ARISING FROM THIS DOCUMENT INCLUDING BUT NOT LIMITED TO THE USE THEREOF Important Licensing Information This product may be covered by one or more Limited Use Label Licenses By use of this product you accept the terms and conditions of all applicable Limited Use Label Licenses 2014 Thermo Fisher Scientific Inc All rights reserved All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified VWR is a trademark
10. 11 Translation table for the CYP2C19 2 10 adjacent SNP assays Note that because the 2 and 10 alleles have not been observed to occur on the same chromosome diplotypes including the A T haplotypes are not included sala Diplotypes 2 assay 681 G A 680C 10 assay 681G 680 C T CYP2C19 C__25986767_70 C__30634128_10 G C G C 1 1 G G C C G C G T 1 10 G G C T G C A C 1 2 G A C C G T G T 10 10 noamp T T G T A C 2 10 A A T T A C A C 2 2 A A noamp Optional Single tube reintegration 66 If a sample fails to cluster well with other samples or fails to amplify properly with one or more assays i e there are UND and NOAMP calls in the run there is an option to rerun such samples using single tube DME assays on 96 well or 384 well plates It is recommended to run control gDNA samples along with the unknown samples or use a reference panel see Optional Generate and import a reference panel on page 60 The controls will help to provide more accurate genotype calling of the unknown samples Pharmacogenomics Experiments User Guide Prepare run and analyze copy number experiments This chapter covers S Introduction to copy number analysis 0 eee eee 67 L How the assays Work 6 eee ee eee ee aE 67 S Prepare the reaction plates 6 eee eee ees 68 m Experimental setup conditions 6 eee ees 68 E Set up the instrument software eee eee ee
11. Elution Buffer 1 25 mL 5 x 25 mL DNA Elution Buffer 2 25 mL 5x 25 mL T Also available as Cat no A25919 containing Cat no A25597 with one additional tube each of Proteinase K 4 mL and DNA Binding Beads 8 mL 2 Also available as Cat no A25920 containing Cat no A25598 with 5 additional tubes of Proteinase K 4 mL each and 5 additional tubes of DNA Binding Beads 8 mL each 3l Proteinase K is also available as Cat no A25561 and DNA Binding Beads are also available as Cat no A25562 4l Not used for DNA isolation from buccal swabs 5 Final volume see Before first use of the kit prepare Wash Solutions on page 2 For Research Use Only Not for use in diagnostic procedures Materials required but not supplied Unless otherwise specified all materials are available from Life Technologies MLS major laboratory supplier Item Source Magnetic particle processor MagMAx Express 96 Magnetic Particle Processor Cat no 4400077 KingFisher Flex Magnetic Particle Processor Thermo Scientific Cat no 5800630 Equipment Thermo Scientific Titer Plate Shaker Cat no 14 271 9 21 One of the following incubators or an equivalent in shelves and thermometer cubator with slatted Economy Lab Incubator Cat no S50441A 21 VWR Digital Mini Incubator VWR Cat no 10055 006 Fisher Scientific Analog Vortex Mixer Cat no 02 215 365 21
12. QuantStudio 12K Flex Software User Files experiments 5 Click Create Experiments at the bottom of the window oS Batch Experiment Setup Utility sl Provide input files select the barcode file naming convention and export location then click Create Experiments Q For multi well plate experiments array card experiments or experiments that use sample integration select an edt file For OpenArray experiments select an edt file or the folder that contains spf or tpf files Optionally select additional input files aif txt 1 Input Files Experiment Template File edt or Setup File Folder spf tpf _C Users yourname Desktop Loaded spf Files Assay Information File aif Plate Setup File txt 2 Barcode s and Naming Convention Create Experiment Files Using Barcode 8 Specify number of files 25 File Name Format Attribute Include oar ae a Custom Name Field Plate Barcode ID Filename from SPF TPF E File Name Preview Filename from SPF TPF 3 Sample Files Folder Match by Plate Barcode Match by ID Expected Sample File Name Filename from SPF TPF csv 4 Export Location Export setup files to C Applied Biosystems QuantStudio 12K Flex Software User Files experiments Create Experiments Cancel Pharmacogenomics Experiments User Guide 45 5 Chapter 5 Prepare run
13. Safety Data Sheets SDSs and follow the handling instructions Wear appropriate protective eyewear clothing and gloves Safety Data Sheets SDSs are available from www lifetechnologies com support Product information The MagMAX DNA Multi Sample Ultra Kit is designed for rapid high throughput isolation of high quality genomic DNA from a variety of sample matrices The kit uses MagMAX magnetic bead technology ensuring reproducible recovery of PCR ready DNA suitable for a broad range of applications such as SNP genotyping and copy number experiments This protocol describes isolation of DNA from buccal swabs optimized for use with the MagMAX Express 96 Deep Well Magnetic Particle Processor or with the KingFisher Flex Magnetic Particle Processor 96 well deep well setting The typical DNA yield obtained from 1 buccal swab is 2 12 ug at a concentration suitable for OpenArray analysis Kit contents and storage Cat no Cat no Component A255970 A255982 Storage 500 rxns 2500 rxns Proteinase 9 4mL 5x4mL 15 C to 25 C PK Buffer 96 mL 5x96 mL r 15 C to 30 C Multi Sample DNA 100 mL 5 x 100 mL Lysis Buffer RNase All 2x 1 25mL 10x 1 25mL 15 C to 25 C DNA Binding 5 5 Beadslal 8 mL 5x 8mL 2 C to 8 C Nuclease free Water 100 mL 5x 100 mL Hi Solution 1 80 mL 5 x 80 mL oncentrate ad Solution 2 162 mils 5 x 162 mL 15 C to 30 C oncentrate DNA
14. Software to troubleshoot and make genotyping calls Appendix C Troubleshooting C OpenArray plate assembly and handling errors Diffused clusters and loss of heterozygosity may be due to an insufficient amount of starting DNA concentration 50 ng uL recommended In addition there may be an abundance of samples that did not amplify ones that are called as noamp and that run close to NTCs in genotyping plots If it is not possible to increase the concentration of the starting material preamplification is recommended See the preamplification protocol in Chapter 4 Optional Preamplify DNA samples on page 36 The image below shows poor quality SNP data left that is improved by preamplifying the samples right N S E a e oe Allele 2 FAM C 2222 8 3 dee a are 1 000 1 250 1 500 1 750 2 000 2 250 o 250 500 750 1 000 1 250 1 500 1 750 2 000 2 250 Allele 1 VIC G Allele 1 VIC G See Analysis settings in the QuantStudio 12K Flex Software in Chapter 5 on page 39 to view real time traces in the QuantStudio 12K Flex Software Real times traces can be used to identify outlier data points and make manual calls In the example below looking at data from an earlier cycle number helped in determining the correct genotypes for the samples in question On the left the QuantStudio 12K Flex Software called many data points heterozygous However the real time traces show signal saturation of
15. assay data in TaqMan Genotyper Software is always advised certain assays require manual examination of the data and adjustment of the genotype calls Special circumstance SNP and DME genotyping assays include those that target polymorphisms that are in genes associated with CNV or target triallelic or adjacent SNPs TaqMan DME genotyping assays to genes in copy number variation regions As detailed in Chapter 2 on page 13 some DME Assays target polymorphisms in genes that exhibit Copy Number Variation including CYP2D6 CYP2A6 CYP2E1 GSTM1 GSTT1 and SULT1A1 Copy number variation analysis must be done in addition to genotyping with DME assays The frequency of the CYP2D6 CYP2A6 CYP2E1 and SULT1A1 gene deletions are low and samples that carry no copies of these genes will be rare However the frequency of deletion of GSTM1 and GSTT1 genes is very high in a number of populations and complete absence of these genes in individuals is common For a given DME assay that targets a gene that can be deleted or duplicated the following genotyping results are possible e If both copies of a gene are deleted in a sample copy number of 0 samples will not be amplified and will run with NTCs If a sample running near the NTCs has been called as undetermined that call can be manually adjusted to noamp e Ifasample contains 1 2 or more than 2 copies of the gene and only one SNP allele is present the samples will cluster together in a ho
16. assays will not amplify female samples because females do not carry the Y chromosome For SNP targets on the X and Y chromosomes select Disallow in Males from the Heterozygote drop down menu to improve the accuracy of the genotype calls Note SNP targets located in the PAR region of the X and Y chromosomes behave like autosomal SNP targets and males can be heterozygotes The gender assay C_990000001_10 target X and Y chromosome specific sequences in the amelogenin gene males run as heterozygotes and females run as VIC homozygotes The Disallow in Males flag should not be set with these assay types 56 Pharmacogenomics Experiments User Guide Chapter 5 Prepare run and analyze OpenArray PGx experiments 5 Perform analysis in TagMan Genotyper Software The Disallow in Males drop down menu is shown below Control Identifiers Study Level Settings Call Method Autocaling Classification Scheme Use Hardy Weinberg for Analysis V Protect Manual Cals V Baseline for Real time Data E Use Positive Controls for Ang Cycle Number l Heterozygote Disallow in M x Use Reference Panels for Autocalling T Note If you select Disallow in Males for other types of targets the genotype call accuracy may be negatively impacted Set the QC settings About QC settings The QC settings are a collection of criteria that the software uses to analyze data in a study You select the flags criteria that you want the
17. by drawing a box around the data point in the scatter plot Pharmacogenomics Experiments User Guide 61 5 Chapter 5 Prepare run and analyze OpenArray PGx experiments Optional Generate and import a reference panel b Right click in the scatter plot then select Tag for Ref Panel from the menu VIC NIC VIC FAM FAM FAM No Amplification Undetermined Possible Rare Allele Clear Manual Call Omit Un omit Tag for Ref Panel r Un tag Selected Set Bookmarks Note To remove a reference sample tag from a sample draw a box around the data point right click in the scatter plot then select Un tag Selected from the menu In the Reference Sample column in the Results table checkmarks appear next to the selected samples 6 Save the study 7 From the menu bar select File Generate Reference Panel 62 Pharmacogenomics Experiments User Guide Chapter 5 Prepare run and analyze OpenArray PGx experiments 5 Optional Generate and import a reference panel 8 In the Generate Reference Panel dialog box browse to and select a save location enter a name for the reference panel file or accept the default name then click Save Generate Reference Panel Save in User Data i amp Pla les gt 7 My Recent Documents Desktop My Documents My Computer My Network _ Places Files of type Study Reference Panel Files lap v E File name Example 1_Refer
18. for an Unknown sample is less than the threshold a flag will be raised 58 5 Click OK to save the changes and close the Analysis Settings dialog box Pharmacogenomics Experiments User Guide Chapter 5 Prepare run and analyze OpenArray PGx experiments 5 Perform analysis in TagMan Genotyper Software The Analysis Settings dialog box with QC settings is shown below yw Analysis Settings a S Fa a i Well Level QC Flags v Set the default analysis settings Call Settings Control Identifiers QC Settings Use Icon Flag Name Failed Control Description Condition Threshold The control call does not match the predefined expect Genotype Quality Low The quality value of the data point s genotype determi Low ROX Intensity The ROX dye intensity for the data point is below th NTC FAM Intensity High The FAM dye intensity for the no template control is NTC VICE Intensity High The VIC dye intensity for the no template control is Reference Sample Discordance The sample call does not match the reference sample c Replicate Sample Discordance The sample call does not match the replicate sample call Study Level QC Flags Use Icon Flag Name Experiment Low Description Value Condition Threshold ROX Rate High The percentage of data points for the experiment with Percentage Assay Call Rate Lo
19. genome strand orientation the bracketed SNP alleles denote the dye allele association VIC FAM Nomenclature if applicable links to CYP NAT and UGT allele nomenclature web sites Gene details transcript accession SNP location SNP type codon change amino acid change e View allele frequency information If minor allele frequency MAF information is available for a SNP click the Allele Frequency button to view MAF information generated by Applied Biosystems AB HapMap or Applera Genome Initiative AGI e View full product details To view an assay page containing all information for a given assay click the View Full Product Details button at the bottom of the Assay Details page e View Assay on Map Click the View Assay on Map link to view the selected assay in its genomic context along with other neighboring assays Pharmacogenomics Experiments User Guide 17 18 Chapter 2 Background and tools for assay content selection Select assays e Add to Cart To order single tube assays click Add to Cart To order a panel of assays for an OpenArray plate export a list of assays for import into the OpenArray Configurator see Chapter 3 Ordering information on page 27 e Export search results The returned assay list can be exported to look over before ordering and to provide a list of assays for an OpenArray order The export file will contain the assay ID along with annotations including catalog numb
20. of VWR International LLC NanoDrop is a trademark of NanoDrop Technologies Inc TaqMan is a trademark of Roche Molecular Systems Inc used under permission and license Boekel is a trademark of Boekel Scientific Inc For support visit lifetechnologies com support or email techsupport alifetech com lifetechnologies com 24 July 2014 technologies Sample quantification using the RNase P Detection Reagents Kit OVETVIEW te ee iets career ee ate ar ne hace aad pig Se ne ase Sw Ree ee oleae 88 PROCEDULC lt seas R ATR irisa be Sei ee ene E RER SEES 88 Materials required ss sso cis aiio ade eas AR NER RLRE REE sae ied 88 Prepare reagents standards and samples 6 0 cece eee ee eee eee 89 Prepare reaction MIX 2 6 nee 89 Prepare the PCR reaction plate 0 6 6 tiers ue 9 9 R E E R S RE eens 90 Setup and run the Standard Curve Experiment 6 00 c cee eee eee 90 Analyze and Export the Results 94 Overview The Ribonuclease P RNA component H1 gene RPPH1 is a single copy gene encoding the RNA moiety H1RNA of the RNase P enzyme It is a useful gene for quantifying amplifiable genomic DNA when used in conjunction with a standard curve generated from a genomic DNA standard of known concentration The TagqMan RNase P Detection Reagents Kit contains a 20X mix of primers and probe FAM dye labeled that will amplify genomic copies of the RNase P RPPH1 gene Procedure Materials required
21. ordered through the tool TM Gaedigk A Bradford LD Alander SW and Leeder JS 2006 CYP2D6 36 gene arrangements within the cyp2d6 locus association of CYP2D6 36 with poor metabolizer status Drug Metab Dispos 3 563 9 He Y Hoskins JM McLeod HL 2011 Copy number variants in pharmacogenetic genes Trends Mol Med 17 244 51 Oscarson M McLellan RA Asp V Ledesma M Bernal Ruiz ML Sinues B Rautio A and Ingelman Sundberg M 2002 Characterization of a novel CYP2A7 CYP2A6 hybrid allele CYP2A6 12 that causes reduced CYP2A6 activity Hum Mutat 20 275 83 Ramamoorthy A Flockhart DA Hosono N Kubo M Nakamura Y and Skaar TC 2010 Differential quantification of CYP2D6 gene copy number by four different quantitative real time PCR assays Pharmacogenet Genomics 20 451 4 Sim S C and Ingelman Sundberg M 2010 The Human Cytochrome P450 CYP Allele Nomenclature website a peer reviewed database of CYP variants and their associated effects Hum Genomics 4 278 281 Pharmacogenomics Experiments User Guide Ordering information This chapter covers configuring and ordering OpenArray plates using the online TaqMan OpenArray Configurator tool and ordering single tube assays It also provides tables of reagents required for PGx genotyping experiments The chapter covers S Order custom OpenArray plates 27 m Order single tube TaqMan Assays 02sec eee e cette tence eens 31 E Reagents in doce cdesian eoe
22. p SPIKE Nowe spikes p EAL P T SL H L p T THOLDFATL thresholding algorithm failed pe TAINS Aih AJS Ad ASS AS A EIS Ei faled p L A1b1 A1c5 Aldi A1d2 A188 Al Note Do not be concerned about the CTFAIL flag for genotyping data Some samples do not have both alleles present This flag will be shown if the amplification curve from the absent allele does not meet quality metrics but the amplification will be poor if an allele is absent For analysis using the help of the real time traces from the QuantStudio 12K Flex v1 2 Software go through the data by assay and manually call data if necessary e g if any real time traces do not show a smooth progression in signal throughout the run 50 Pharmacogenomics Experiments User Guide Chapter 5 Prepare run and analyze OpenArray PGx experiments 5 Transfer files to a user computer Transfer files to a user computer Transfer files from QuantStudio 12K Flex Software without a network connection Transfer files from QuantStudio 12K Flex Software with a network connection If the QuantStudio 12K Flex is connected to a computer and the run has been downloaded to the computer then the user can browse for the folder containing the run and download the file to storage media If there is no computer and the instrument is not connected to the network then a user can insert a USB drive into one of the USB ports in the front panel The user can then use
23. points at the assay level The software doesn t allow you to select data points at the study level that is if you select a data point for one assay it is not selected for all assays in the study 2 In the Workflow Menu pane select Analysis gt Results to open the Results screen 3 Select the Results tab Pharmacogenomics Experiments User Guide Chapter 5 Prepare run and analyze OpenArray PGx experiments 5 Optional Generate and import a reference panel 4 From the View drop down menu select Reference Sample to display the Reference Sample column in the Results table Auto resize all columns Bookmark Call Manual Quality VIC FAM ROX Control Gender Population Well Experiment Name Plate Barcode Annotation 5 In the Results table or the scatter plot select the samples that you want to use as reference samples In the Results table a Select a sample in the Results table To select more than one sample at a time press Ctrl or Shift b From the Tag drop down menu select Tag for Ref Panel view lt ES croup by Bookmark Reference Sample Sample ID Omit Un omit ag fo ane Un tag Selected Comment Note To remove a reference sample tag from a sample you can either deselect the check box in the Reference Sample column or select the sample then select Un tag Selected from the Tag drop down menu In the scatter plot a Select a sample
24. polymorphisms MNPs that are 6 bases or fewer in length This tool can also be used to input and order primer and probe sequences of assays that have already been designed that contain FAM or VIC labels and MGB NFQ quenchers Note that sequences must be SNP and repeat masked before submission to CADT Additionally the genome uniqueness for assays must first be established because custom assays are not compared to the genome e g by BLAT or BLASTn to determine target specificity Any target on the unavailable list described on page 25 should not be submitted to CADT because an assay may be designed but it will fail to function properly For targets that present assay design challenges contact our fee for design custom assay design service at custom solutions lifetech com Targets of interest that are not covered by the extensive Life Technologies human TaqMan Copy Number Assay collection can be submitted to Custom TaqMan Copy Number Assay design The GeneAssist Copy Number Assay Workflow Builder is available on the Life Technologies website www lifetechnologies com This tool can be used to search for predesigned assays and to design custom plus assays SNP masking and genome quality checks are included or other custom assay types including submission of primer and probe sequences for previously designed FAM dye MGB NFQ probe assays All assay types including requisite TaqMan Copy Number Reference Assays can also be
25. requested PGx marker assays Special assay considerations DME genes and Several DME genes exhibit Copy Number Variation CNV or other structural copy number alterations due to recombination and gene conversions events between highly related variation loci He et al 2011 Pre tested TaqMan Copy Number assays are available for these genes These assays were run on 90 Coriell g DNA samples from African American and Caucasian populations the same panel used for DME Assay validation The pretested assays for the DME genes in CNV regions are listed in on page 20 along with their target location in the gene and the major DME alleles that can be tested by these assays Table 2 Pre tested DME gene TaqMan Copy Number Assays for CNV and hybrid gene analysis Gene Gene symbol Assay ID SE Major alleles tested CYP2D 6 Hs04083572_cn Intron 2 CYP2D6 Deletion 5 Duplications 1xN 2xN Ax2 9x2 10x2 17xN 35x2 2D6 2D7 hybrid alleles with 2D7 exon 9 sequences 36 83 CYP2D 6 Hs04502391_ cn Intron 6 CYP2D6 Deletion 5 Duplications 1xN 2xN 4x2 9x2 10x2 17xN 35x2 2D6 2D7 hybrid alleles with 2D7 exon 9 sequences 36 83 CYP2D 6 Hs00010001_cn Exon 9 CYP2D6 Deletion 5 Duplications 1xN 2xN 4x2 9x2 10x2 17xN 35x2 CYP2A6 Hs07545273_cn Exon 1 CYP2A6 Deletion 4 Duplication 1x2 CYP2A6 Hs07545274_cn Intron 1 CYP2A6 Deletion 4 Duplication 1x2 CYP2A6 Hs04488984
26. system 106 support obtaining 120 T TaqMan Copy Number Assays selecting 16 TaqMan Drug Metabolism Genotyping Assays In dex searching 19 TaqMan SNP DME Assays selecting 15 Terms and Conditions 120 training information on 120 translation analysis 35 77 translation information sources 78 troubleshooting 98 AccuFill loading errors 101 case leaks and bubbles 99 entire subarrays missing 102 expected versus unexpected no amps and unde termined calls 105 image analysis 98 OpenArray plate assembly and handling 102 sample plate preparation errors 100 W warranty 120 workflow PGx 11 123 Pharmacogenomics Experiments User Guide For support visit lifetechnologies com support or email techsupport lifetech com technologies lifetechnologies com 4 August 2014
27. the Y or X axis respectively whereas heterozygous samples contain both FAM and VIC dye signal and will cluster roughly along the diagonal position between the homozygous clusters Genotyping assay context sequences The reporter dye information for TaqMan Drug Metabolism and SNP Genotyping Assays is represented in the assay context sequence which is posted on the Life Technologies web site and provided in the Assay Information File that you can download from the web at www lifetechnologies com OA platefiles The context sequence is the nucleotide sequence surrounding the SNP site It is provided in the genome strand orientation relative to the NCBI reference genome The SNP alleles are included in brackets where the order of the alleles corresponds to the association with probe reporter dyes where Allele 1 VIC dye Allele 2 FAM dye For example the C__27102431_D0 assay which targets the CYP2D6 4 g 1846G gt A SNP rs3892097 has the following context sequence AGACCGTTGGGGCGAAAGGGGCGTC C T TGGGGGTGGGAGATGCGGGTAAGGG Pharmacogenomics Experiments User Guide 15 Chapter 2 Background and tools for assay content selection Select assays TaqMan Copy Number Assays Search using the Assay Search Tool 16 The VIC dye probe is associated with the C allele and the FAM dye probe is associated with the T allele Note that in this example the SNP alleles C T are the reverse complement of those given in
28. the touchscreen and press Collect Results Search for the desired runs to be downloaded and touch the screen to select the run names After the names have been highlighted the user can press Save to USB 1 In the Home screen of the QuantStudio 12K Flex Software click Instrument Console TM 2 In the Instrument Console select the desired QuantStudio 12K Flex Instrument from the list of instruments on the network then click Add to My Instruments 3 After the QuantStudio 12K Flex Instrument is added to your list select it then click Manage Instrument 4 In the Instrument Manager click Manage Files then click File Manager 5 In the File Manager screen transfer the file s from the QuantStudio 12K Flex Instrument a In the Folders field select the folder that contains the files that you want to download b In the Experiments field select the files to download To select multiple files Ctrl click or Shift click files in the list c When you have selected the files that you want to download click Download d In the Send experiment to instrument dialog box select the folder to which you want to download the selected file s then click Open For more details on file transfers please refer to the networking chapter in the Applied Biosystems QuantStudio 12K Flex Real Time PCR System Maintenance and Administration User Guide Pub no 4478673 Perform analysis in TaqMan Genotyper Software Creat
29. to DNA isolation next step 4 Wash the beads and elute the DNA Select the program on the instrument s 4413021 DW blood on MagMAX Express 96 Magnetic Particle Processor e A25597_Blood_Buccal on KingFisher Flex Magnetic Particle Processor Start the run and load the prepared processing plates to their positions when prompted by the instrument see Table 1 Load the PK Plate containing lysate isopropanol and Bead RNase Mix at position 1 when prompted by the instrument When prompted by the instrument approximately 28 30 minutes into the run 1 Remove the Elution Plate from the instrument 2 Add 50 uL of DNA Elution Buffer 2 to each sample well IMPORTANT Add DNA Elution Buffer 2 immediately after the prompt to prevent excessive drying of any beads that are still captured on the Tip Comb 3 Load the Elution Plate back onto the instrument and press Start At the end of the run approximately 30 35 minutes after initial start remove the Elution Plate from the instrument and seal immediately with a new MicroAmp Clear Adhesive Film e If precipitated DNA is visible pipet up and down 5 10 times before sealing the plate to ensure complete resuspension MagMAX DNA Multi Sample Ultra Kit whole blood Instructions Pharmacogenomics Experiments User Guide Wash the beads and e Eluates can also be transferred to a new elution plate after collection elute the DNA e If excess bead residue is s
30. to mix then centrifuge for 1 minute at 1000 rpm to eliminate bubbles Mark the filled 48 well sections on the foil Place the sample plate on ice for up to 1 hour Pharmacogenomics Experiments User Guide 41 5 Chapter 5 Prepare run and analyze OpenArray PGx experiments Track samples Load samples 1 On the OpenArray AccuFill instrument software click Setup amp Load In the using the Sample Plate field browse to and open the csv file that contains the 384 well Open Array sample plate layout sTM AccuFill Setup Load Information instrument Loading information Specify the type of load you want to perform Enter Plate and OpenArray Plate barcodes by scanning them typing them or selecting the associated file B CO Use Sample Integration Samples Per Subarray 1 B Sample Plate Plate Holder Position 1 ABC12 Plate Holder Position 2 Plate Holder Position 3 Plate Holder Position 4 Select Samples to Load Click the section on the sample plate from which the first sample will be extracted The image on the right shows how the sample will be applied to the OpenArray Plates _Plate Holder Position 1 ABC12 ate Holder Position 2 IHI 5 ate Holder Position 2 IHI 5 ate Holder Position 4 Sample section s already used 1 on 2 1 2012 IHI 5 2 Set up sample integration in the QuantStudio OpenArray AccuFill Software a Launch QuantStudio OpenArray AccuFill
31. 0 uL Wash Plate 3 4 Deep Well Wash Solution 2 150 uL Elution Platel 5 Standard DNA Elution Buffer 1 50 pL Place a MagMAX Express 96 Deep Well Tip Tip Comb 6 Deep Well Comb in a MagMAX Express 96 Deep Well Plate 1l Position on the instrument 2 The instrument prompts the user to add DNA Elution Buffer 2 to the Elution Plate after incubation with DNA Elution Buffer 1 Wash the beads and elute the DNA on page 3 3 Add Multi Sample DNA a Optional At the end of the 65 C incubation briefly centrifuge the plate for 1 2 minutes at 1500 x g if Lysis Buffer condensation is present isopropanol and DNA b Add 200 uL of Multi Sample DNA Lysis Buffer to each sample Binding Bead Mix c Seal the plate with a MicroAmp Clear Adhesive Film and shake for 5 minutes at speed 8 d Transfer lysates to the wells of anew Mag MAX Express 96 Deep Well Plate PK Plate and discard the plate containing the buccal swabs e Add 240 uL of isopropanol to each sample seal the plate and shake for 5 minutes at speed 8 L Vortex DNA Binding Bead Mix at moderate speed to ensure thorough mixing add 40 uL to each sample and proceed immediately to DNA isolation next step 4 Wash the beads and a Select the program on the instrument elute the DNA s 4413021 DW blood on MagMAX Express 96 Magnetic Particle Processor e A25597_Blood_Buccal on KingFisher Flex Magnetic Particle Processor b Start the run and load the prepared processing plates to th
32. 16 Search the TaqMan Drug Metabolism Genotyping Assays Index 0 000e ee 19 Search the PharmaADME Core Marker Bet 19 Search the PGx Common Markers file 0 00 c eee eee eee ene e eee 19 Special assay considerationS 00 cece cece cece tte eee ee eee 20 DME genes and copy number variation 0000 cece eee rnnr rreren 20 GSTM1 and GSTT1 DME assays and CNV 2 0200s 21 CYP2D6 copy number variation and CYP2D6 CYP2D7 hybrid alleles n nunnan nannan 21 CYP2A6 CNV and CYP2A6 CYP2A7 hybrid alleles n n nunnan nunnana narrer 22 TaqMan DME Assays for genotyping triallelic SNPs 0 c cece eee eee eae 23 TaqMan DME Assays for genotyping adjacent SNPs 0 ccc eee ence eee 24 Gender assays ice a baie we tnd eld dake dda oer tee dt loe E 24 Clinical research targets oirrsa da K engaged R R Relea ecient ad ARR deen 25 Unavailable DME and clinical research targets eee eee eee eee eee 25 Custom TaqMan SNP Assays wae ctis enc a ATE AR RAR RTS wid desta Beles nea 25 Custom TaqMan Copy Number Assays 0 nanna c cece eee cece nen een een eens 26 RELERENCES E pda EE 0 a Medd eh a ed Mint E TE E T E 26 S CHAPTER 3 Ordering information 00cce cece eens 27 Order custom OpenArray plates 2 0 00 nuna ccc ccc nee ented raruraru rnrn 27 Order single tube TaqMan Assays 2 0 00 c ccc cnn ence nnn tence een eens 31 Pharmacogenomics Experiments User Guide 3 Cont
33. 2D6 14 g 1758G gt A T C CYP1A1 5 g 2461C gt A G T CYP1A1 9 g 2461C gt T G A CYP2C8 7 c 556C gt T G A CYP2C8 8 c 556C gt G G C Note On the Life Technologies Assay Search results pages the annotation for the DME assays is tied to the SNP ID and not the SNP alleles Therefore both assays for a triallelic SNP will be assigned the same allele nomenclature Refer to the Important Information and or the context sequence to determine which alleles are interrogated by each assay Example ABCB1 c 3095G gt T A triallelic SNP rs2032582 assays C_11711720C_30 ABCB1c 3095 G gt T TATTTAGTTTGACTCACCTTCCCAG C A ACCTTCTAGTTCTTTCTTATCTTTC C_11711720D_40 ABCB1c 3095 G gt A TATTTAGTTTGACTCACCTTCCCAG C T ACCTTCTAGTTCTTTCTTATCTTTC After running paired assays for triallelic SNPs in separate reactions on the same gDNA samples examine the cluster plots in TaqMan Genotyper Software Sample calls may need to be adjusted and the results of each assay compared to determine the true sample genotype as detailed on page 64 Pharmacogenomics Experiments User Guide 23 7 Chapter 2 Background and tools for assay content selection Special assay considerations TaqMan DME Assays for genotyping adjacent SNPs Gender assays 24 For certain highly studied DME targets two SNPs are located adjacent to one another complicating the SNP genotype analysis given that for each assay the probes will fail to bind target seque
34. 5x96 mL C 15 C to 30 C Multi Sample DNA 100 mL 5 x 100 mL Lysis Buffer RNase A 2x 1 25 mL 10 x 1 25 mL 15 C to 25 C DNA Binding 5 5 Raas 8 mL 5x8mL 2 C to 8 C Nuclease free Water 100 mL 5 x 100 mL Hi Solution 1 80 ml I 5 x 80 wl I oncentrate ad Solution 2 162 mill 5 x 162 mL 15 C to 30 C oncentrate DNA Elution Buffer 1 25 mL 5x 25 mL DNA Elution Buffer 2 25 mL 5x 25 mL Beads 8 mL each page 2 11 Also available as Cat no A25919 containing Cat no A25597 with one additional tube each of Proteinase K 4 mL and DNA Binding Beads 8 mL 2 Also available as Cat no A25920 containing Cat no A25598 with 5 additional tubes of Proteinase K 4 mL each and 5 additional tubes of DNA Binding 3l Proteinase K is also available as Cat no A25561 and DNA Binding Beads are also available as Cat no A25562 4 Final volume see Before first use of the kit prepare Wash Solutions on For Research Use Only Not for use in diagnostic procedures Materials required but not supplied Unless otherwise specified all materials are available from Life Technologies MLS major laboratory supplier Item Source Magnetic particle processor MagMAx Express 96 Magnetic Particle Processor Cat no 4400077 KingFisher Flex Magnetic Particle Processor Thermo Scientific Cat no 5800630 Equipment Thermo Scientific Titer Plate Shaker Cat no 14 271 9 21 One of t
35. 8 NCBI dbSNP genotype data 000 eee eee nents 109 Centers for Disease Control and Prevention CDC reference materials 109 TaqMan Copy Number Assays for DME genes 0c anann nnan eee neces 109 Plasmid controls 3 55 ursa s Ear E ea eee da bee etd edge eee 109 APPENDIX F Good PCR practice 000 ccc eee eee eens 112 Prevent contamination and nonspecific amplification 0c c cece cece 112 PCR good laboratory practices 0000 cece cence eens 112 APPENDIX G Safety cccuicehctee ceded s wet eee eensy wetted 114 GeneraliSalety 23 scart tae he ee I elena ee L fest oes et eee ae Me 114 Chemicalsafety sienn T a esc ATR Ea ve Gvide be naivade pe bed Peon ee heb rene cay hereon ener ners 115 Biological hazand satety lt 2 2e4cceies ods Warde bee eee eel Heer oe aa eel ene ee 116 Documentation and support 0 0 e e cece e eee eens 118 Related documentation erwies T acs ety bape eed ed iad eed nt ae Eee ee 118 Pharmacogenomics Experiments User Guide Contents Obtaining sDSs4 5 tere se sere oh ce te oer ee ae Be ea det tee ec aa Ea 120 Obtaining Certificates of Analysis 0c e eee e ee aee 120 Obtaining support isasi sar one eka eae ee Rie eee Ree ESR Ses te eee ee 120 Limited product Warranty cece eee eee eee cent anann 120 us gt ae rape nn Pe er Coe ae ee ner oe 122 Pharmacogenomics Experiments User Guide 7 Contents 8 Pharmacogenomics Experiments User Guide About this guide IMPOR
36. 9 2 mL Total PK Mix 200 uL 20 mL c Invert PK Mix several times to thoroughly mix components then add 200 uL to each sample well of a MagMAX Express 96 Deep Well Plate PK Plate d Transfer 50 uL of whole blood to the appropriate well containing PK Mix IMPORTANT Invert the tube containing the blood sample before pipetting to ensure homogenous mixing e Seal the plate with a MicroAmp Clear Adhesive Film Shake the sealed plate for 5 minutes at speed 8 g Incubate for 20 45 minutes at 65 C IMPORTANT Arrange samples in the incubator to allow adequate flow around the plate wells to ensure that samples quickly reach and maintain the incubation temperature Pharmacogenomics Experiments User Guide MagMAX DNA Multi Sample Ultra Kit whole blood Instructions 2 Set up the MagMAX Express 96 processing plates While the samples are incubating at 65 C set up the MagMAX Express 96 Wash Elution and Tip Comb Plates outside the instrument as described in the following table Table 1 MagMAX Express 96 processing plates MagMAX Plate ID Plate position Express 96 plate Reagents Volume per well type Wash Plate 1 2 Deep Well Wash Solution 1 150 uL Wash Plate 2 3 Deep Well Wash Solution 2 150 uL Wash Plate 3 4 Deep Well Wash Solution 2 150 uL Elution Platel 5 Standard DNA Elution Buffer 1 50 uL Place a MagMAX Express 96 Deep Well Tip Tip Comb 6 Deep Well C
37. EEE ae mea ES 73 S CHAPTER 7 Perform translation analysis in AlleleTyper SOMA TTT 77 Introduction to AlleleTyper Software 0 0 ccc eee eee een rnnr rrenean 77 Sources of PGx translation information and example translation tables 78 APPENDIX A DNA isolation using the MagMAX DNA Multi Sample Ultra Kits occas Kaa arctan ce ns epee AT ena hata es el 79 MagMAX DNA Multi Sample Ultra Kit User Guide buccal swabs 00 c cee aee 80 MagMAX DNA Multi Sample Ultra Kit User Guide whole blood 0 cece eee e ee 84 APPENDIX B Sample quantification using the RNase P Detection R agents IVE AX ne Za see So ceca a aor ese meena cere a oh 88 OVERVIEW aa a ian ie R R T Re R R K edt Ghd vnc TR H T A ee a H AK dean oe ea 88 Procede oc heats en snier ahd viet Radi ta ie shed nd wate a td on pied A eee oe 88 Materials required cece eee eee eee e eee a teen ees 88 Prepare reagents standards and samples 000 c eee e cece eee e eee e eens 89 Prepareireactlon mix 32 EET ata RTE iat a ainda cate ARa D attendee ce aes 89 Prepare the PCR reaction plate 0 0 c cece cece cece eee eee aee 90 Setup and run the Standard Curve Experiment cece eee eens 90 Pharmacogenomics Experiments User Guide 5 Contents Analyze and Export the Results cece cece e cent eee eee 94 APPENDIX Troubleshooting ccc ec cece eens 98 Inmage analyeiS aa 2 9 ea gd pained RUSE anid gale L edad co
38. GETRM MaterialsAvailability aspx Several DME genes occur in CNV regions see Special assay considerations in Chapter 2 Background and tools for assay content selection on page 13 In addition the CYP2D6 and CYP2A6 genes are known to recombine with related pseudogene sequences to generate hybrid genes many of which have decreased or null gene activity TaqMan Copy Number Assays can be used to detect deletions duplications and hybrid gene alleles TaqMan Copy Number Assays for the major known DME genes that exhibit CNV have been pre tested on a panel of 45 each African American and Caucasian the same samples as were used for TaqMan DME Genotyping Assay validation studies A complete list of the samples used and their genotypes is available at www lifetechnologies com pgx The gDNA samples can be ordered from the Coriell Cell Repositories http ccr coriell org Plasmid controls 109 Life Technologies has successfully used synthetic major and minor allele template DNAs cloned into plasmids to test the performance of over 300 TaqMan DME assays In addition to major or minor allele sequences plasmids carry the RNase P RPPH1 gene for accurate quantitation of plasmids by the standard curve analysis before use in genotyping experiments Equal quantities of major and minor allele plasmids are mixed together to create heterozygous controls The homozygous and heterozygous plasmid controls can be used to demonstrate amplifica
39. MAX DNA Multi Sample Ultra Kit human buccal swabs Instructions 3 Pharmacogenomics Experiments User Guide Recommended quantitation methods Note Mix the samples by pipetting up and down before quantitation tad eer if they h n stored frozen Standard curve analysis is the most accurate quantitation method ETRE stored Oze whereas UV absorbance measurements can be used to assess both the Revisi i evision histor concentration and the quality of the isolated DNA y e Standard curve analysis Use the TaqMan RNase P Copy Revision Date Description Number Reference Assay Cat no 4403326 for human genomic m c C 0 July 2014 Addit f tant dural DNA and the TaqMan DNA Template Reagents Cat no 401970 ed gui d Sn S L to create a standard curve Refer to Creating Standard Curves with l Genomic DNA or Plasmid DNA Templates for Use in Quantitative PCR B 0 July 2014 Correction of the kit name Pub no 4371090 A 0 May 2014 New document e UV absorbance measurements Use a NanoDrop or other comparable instrument Pure genomic DNA should have an A260 A280 ratio of approximately 1 6 2 0 Limited product warranty Life Technologies Corporation and or its affiliate s warrant their products as set forth in the Life Technologies General Terms and Conditions of Sale found on Life Technologies website at www lifetechnologies com termsandconditions If you have any questions please contact Life Technologies at www li
40. MAX DNA Multi Sample Ultra Kit User Guide High throughput isolation of PCR ready DNA from buccal swabs Pub no MANO0010293 s MagMAX DNA Multi Sample Ultra Kit User Guide High throughput isolation of PCR ready DNA from whole blood Pub no MANO010294 Follow the recommendations and guidelines for specimen collection and storage in the appropriate user guide Quantify DNA samples Quantify the isolated DNA by one of the following methods Prior to quantification mix the samples well to ensure sample homogeneity especially if samples have been stored s Standard curve analysis recommended Use the TaqMan RNase P Detection Reagents Kit Cat no 4316831 for human gDNAs Use your own human DNA samples or the TaqMan DNA Template Reagents PN 401970 to create a standard curve Refer to Appendix B Sample quantification using the RNase P Detection Reagents Kit on page 88 or Creating Standard Curves with Genomic DNA or Plasmid DNA Templates for Use in Quantitative PCR Pub no 4371090 e UV absorbance measurements Use a NanoDrop or other comparable instrument Pure gDNA should have an A260 A2g0 ratio of approximately 1 8 2 0 e Fluorometric analysis Use a Qubit dsDNA BR or HS Assay Kit Pharmacogenomics Experiments User Guide 35 4 Chapter 4 Prepare DNA samples Split DNA samples for copy number experiments Note Standard curve analysis is the most accurate quantitation method whereas A260 and Ango readi
41. ME activity levels e g functional decreased function or nonfunctional variants The combination of star allele haplotypes i e the diplotype within a sample can be used to predict the DME phenotype e g ultrarapid extensive intermediate or poor Genetic variants within a haplotype can include SNPs InDels and CNVs The allele nomenclature for a specific gene family is maintained and standardized by an affiliated group of scientists that curate each site independently This nomenclature can be complicated because many alleles contain more than one polymorphism i e they are haplotypes and conversely many polymorphisms are associated with several alleles Pharmacogenomics Experiments User Guide 13 14 Chapter 2 Background and tools for assay content selection Allele nomenclature The star allele nomenclature contains the DME gene name such as CYP2D6 followed by a numeric allele name such as 3 A star allele conventionally contains at least one causative variant e g a frameshift mutation Variants are given reference gene and or cDNA coordinates such as g 2549delA full variant name CYP2D6 3 g 2549delA The causative star allele variant may be associated with other nucleotide variants in different haplotypes groups such sub alleles are denoted by letters following the numeric allele identifier e g 3A On the Cytochrome P450 CYP Allele Nomenclature web site the defining causative variant for a star allele is oft
42. Procedure 3 Export the results by first clicking the Export tab in the left pane Browse to destination file location for the export file and select the Results tab Click on the blue Start Export button at the bottom of the screen to save the results file to the destination folder The results file will have the quantification results for each sample in the Quantity Mean column of the spreadsheet Fle Edit Instrument Analysis Tools Help E New Experiment B Open N Save 2 Cose S Import 58 Create Side Print Report Experiment Reagents Export 2 E Auto Export Format ViiA 7 oa Export Data To One File Separate Files F Open file s when export is complete Export File Location C Applied Biosystems ViIA7 Software v1 2 experiments Gad e no Fie Name 2013 07 23 MagMaxBlood_Norm_46 ViiA7 export Fie Type s C sample Setup C Raw Data C Ampification C Muticomponent B pesk Select Content man G Omit Sample Target Task Reporter Quencher CT CL Mean ctsD Quantity Quantity Quanti All Fields Sample 1 Target1 UNKNOWN FAM NFQ MGB 26 973 26 914 0 049 19 424 20 345 Ca F wel a Sample 1 Target1 UNKNOWN FAM NFQ MGB 26 854 26 914 0 049 21 303 20 345 oS k Sample2 Target 1 UNKNOWN FAM NFQ MGB 27 127 27 105 0 029 17 236 17 545 t 7 Wel Postion Sample2 Target1 UNKNOWN FAM NFQ MGB 27 072 27 105 0 029 17 996 17 545 c 9 Sample3 Target 1 UNKNOWN FAM NFQ MGB 27 833 27 792 0 068 9 977 10 306 E Om
43. QuantStudio 12K Flex Software Help Detailed online Help for batch file setup in QuantStudio 12K Flex Software Chapter 5 Prepare run and analyze OpenArray PGx experiments Pharmacogenomics Experiments User Guide 118 Documentation and support Related documentation Related Document Pub no Description PGx Chapter s QuantStudio 12K Flex 4470935 Provides detailed information about genotyping Chapter 5 Prepare run Real Time PCR System experiments in Booklet 2 QuantStudio 12K Flex and analyze OpenArray OpenArray Experiments OpenArray Genotyping Starter Kit PGx experiments User Guide QuantStudio 12K Flex 4470689 Maintenance procedures include information on Chapter 5 Prepare run Real Time PCR System networking and transferring files and analyze OpenArray Maintenance and PGx experiments Administration User Guide TaqMan Genotyper 4448637 Detailed description of TagMan Genotyper Chapter 5 Prepare run Software Getting Started analysis and analyze OpenArray Guide PGx experiments TagMan Copy Number 4397425 Full instructions for running TaqMan Copy Chapter 6 Prepare run Assays Protocol Number Assay experiments and analyze copy number experiments CopyCaller Software 4400042 A complete description of CopyCaller Software Chapter 6 Prepare run v2 0 User Guide features and guidance on using the software and analyze copy number experiments OpenArra
44. SNT Targets a gt Experiment Raser vA Properties e ee ee ee ee ee ee ee ee ee C Define re 8 va gt Samples _____ LET E Run Method MA 1 Materials List Sample 3 SHN J Sample 4 Le C C C C C C s C a C C V osare 5 1 9 gt saroe 6 3 an a Ke Biological Groups E5 lL M N o P A wels T 40 E o Clo 344 Empty Pharmacogenomics Experiments User Guide 92 Appendix B Sample quantification using the RNase P Detection Reagents Kit Procedure 11 Enter the concentration for each standard by double clicking on the well to activate a pop up window 12 Select Standard under Task and enter the concentration Quantity for the selected standard S Target RnaseP lt Task Standard lt Quantity 12 Sample Standard 4 lt Once all of the samples and standard have been defined click on the Run Method tab on left window to view the thermal cycling protocol Change the reaction volume to 10 uL and confirm that the run protocol is identical to what is shown in the figure below A Pret Report Reagents Run Method Reaction Volume per Wet 19 9 Optical ters POR Stage Humber of Cycles 40 Enade AtoOeta Starting Cycle 1 LU aen L v Gael PR Ota Collection On Data Collection OF A AutcDeta On A AutoDeka O 15 Select the Run tab on the left pane a
45. Sample Copy Number field enter the number of copies of the target sequence expected in the majority of samples The number of copies must be a whole number greater than zero Optional Expand the Advanced settings box to review and or edit empirical thresholds or to create copy number bins for confidence estimates Refer to the CopyCaller Software v2 0 User Guide Pub no 4400042 for more information on these features Click Apply to apply the analysis settings and perform copy number analysis using the revised analysis settings Repeat steps through as necessary to analyze any remaining assays Display the results of the analysis a In the Assay Selection Table verify that the assays that you want to add to the analysis show Y in the Analysis Status column If not analyze the unanalyzed assay s as explained above b Inthe y Display Analysis Results column select the check boxes for up to 10 analyzed assays that you want to display Pharmacogenomics Experiments User Guide Review results Chapter 6 Prepare run and analyze copy number experiments Analyze results using CopyCaller Software Review the Copy Number Plot e Samples should have calculated copy number values close to integers and small range bars Review the plot for intermediate copy numbers The presence of intermediate calculated copy number values such as 1 5 can indicate that the calibrator or copy number was specified incorrectly
46. Sample preparation PCR setup PCR amplification Analysis of PCR products Do not bring amplified PCR products into the PCR setup area Open and close all sample tubes carefully Centrifuge tubes before opening Avoid splashing or spraying PCR samples Keep reactions and components capped as much as possible Clean lab benches and equipment periodically with 10 bleach solution Use DNAZap Solution Pub no AM9890 Pharmacogenomics Experiments User Guide 112 Appendix F Good PCR practice Prevent contamination and nonspecific amplification 113 Pharmacogenomics Experiments User Guide Safety This appendix covers Generalisatety o renienpi de mies As tA ot a ee TEENS 114 Chemical safety TT 115 Biological hazard sate 116 General safety WARNING GENERAL SAFETY Using this product in a manner not specified in the user documentation may result in personal injury or damage to the instrument or device Ensure that anyone using this product has received instructions in general safety practices for laboratories and the safety information provided in this document Before using an instrument or device read and understand the safety information provided in the user documentation provided by the manufacturer of the instrument or device Before handling chemicals read and understand all applicable Safety Data Sheets SDSs and use appropriate personal protective equipment gloves gowns eye protection etc To obta
47. TANT Before using products described in this manual read and understand the information in the Safety appendix in this document Revision history Revision Date Description of change B 0 4 August 2014 e DNA sample preparation procedures in Chapter 4 updated for use of the MagMAX DNA Multi Sample Ultra Kit Users referred to a new Appendix A for complete procedures e Perform analysis in TaqMan Genotyper Software topic in Chapter 5 reorganized for better workflow e Sample quantification procedure using the RNase P Detection Reagents Kit added to a new Appendix B e Corrections and clarifications made to Appendix C Troubleshooting A 0 21 January 2014 New document Purpose The Pharmacogenomics Experiments User Guide provides procedures for using Life Technologies products to perform flexible scalable fast and economical pharmacogenomic PGx experiments Pharmacogenomics Experiments User Guide About this guide Purpose 10 Pharmacogenomics Experiments User Guide About the PGx Workflow This chapter covers E Introdtchoniacs ec tew eh ehh as oA ee tee be te teleey ents 11 Me Workflow s occ eS oes Sl ee eo ee ai eee DE Ss EE ca 3S 12 Introduction Pharmacogenomics PGx is the study of genetic variation as it relates to drug response PGx studies involve testing samples for multiple variants in drug metabolism enzyme DME and transporter genes The Pharmacogenomics Experiments User Gui
48. UDP Glucuronosyltransferase genes http www pharmacogenomics pha ulaval ca cms ugt_alleles Note Other DME gene variants alleles have nomenclature that is reported in the literature but there is no public nomenclature web site for them For some key variants allele nomenclature can be found in the Very Important PGx VIP gene summary pages on the Pharmacogenomics Knowledge Base web site http www pharmgkb org Where applicable and possible such allele nomenclature has been provided for non CYP NAT and UGT variants in the PGx Common Markers file see Select assays Pharmacogenomics Experiments User Guide Select assays TaqMan SNP DME Assays Chapter 2 Background and tools for assay content selection J Select assays The TaqMan Drug Metabolism Genotyping Assays a collection of 2 700 assays detect potentially causative SNP MNP or InDel polymorphisms in 221 drug metabolism enzyme DME and associated transporter genes The DME assays were designed using an optimized DME assay design algorithm that uses a high level of bioinformatics to ensure a lack of underlying polymorphisms and high target specificity i e gene family members and pseudogenes will not amplify Manual design was required for some of the more difficult targets All DME Assays underwent stringent wet lab validation including testing with 180 unique DNA samples from four different populations African American Caucasian Chinese and Japanese T
49. USER GUIDE applied biosystems by Lefe technologies Pharmacogenomics Experiments For use with TaqMan OpenArray Genotyping Plates QuantStudio 12K Flex System QuantStudio 12K Flex System with OpenArray Block with Accufill System TaqMan Genotyper Software CopyCaller Software AlleleTyper Software Catalog Numbers 4475395 4471090 and 4486060 Publication Number MANOO009612 Revision B 0 6 For Research Use Only Not for use in diagnostic procedures technologies The information in this guide is subject to change without notice DISCLAIMER LIFE TECHNOLOGIES CORPORATION AND OR ITS AFFILIATE S DISCLAIM ALL WARRANTIES WITH RESPECT TO THIS DOCUMENT EXPRESSED OR IMPLIED INCLUDING BUT NOT LIMITED TO THOSE OF MERCHANTABILITY FITNESS FOR A PARTICULAR PURPOSE OR NON INFRINGEMENT TO THE EXTENT ALLOWED BY LAW IN NO EVENT SHALL LIFE TECHNOLOGIES AND OR ITS AFFILIATE S BE LIABLE WHETHER IN CONTRACT TORT WARRANTY OR UNDER ANY STATUTE OR ON ANY OTHER BASIS FOR SPECIAL INCIDENTAL INDIRECT PUNITIVE MULTIPLE OR CONSEQUENTIAL DAMAGES IN CONNECTION WITH OR ARISING FROM THIS DOCUMENT INCLUDING BUT NOT LIMITED TO THE USE THEREOF Important Licensing Information These products may be covered by one or more Limited Use Label Licenses By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses Trademarks All trademarks are the property of Thermo Fisher S
50. _cn Intron 2 CYP2A6 Deletion 4 Duplication 1x2 hybrid allele with 2A7 exons 1 2 and 2A6 exons 3 9 12 CYP2A6 Hs07545275_ cn Intron 7 CYP2A6 Deletion 4 Duplication 1x2 hybrid allele with 2A7 exons 1 2 and 2A6 exons 3 9 12 CYP2A7 Hs07545276_cn Exon 1 CYP2A6 hybrid allele with 2A7 exons 1 2 and 2A6 exons 3 9 12 CYP2A7 Hs04488016_cn Intron 2 CYP2A6 hybrid allele with 2A7 exons 1 2 and 2A6 exons 3 9 12 CYP2A7 Hs07545277_cn Intron 7 No CYP2A alleles CYP2E1 Hs00010003_cn Promoter CYP2E1 Duplication 1x2 GSTM1 Hs02575461_cn Exon 1 GSTM1 Deletion 0 Duplication GSTT1 Hs00010004_cn Intron 1 GSTT1 Deletion 0 SULT1A1 Hs03939601_cn Intron 2 SULT1A1 Deletion Duplication UGT2B17 Hs03185327_cn Exon 1 UGT2B17 in 150 kb Deletion 2 20 Pharmacogenomics Experiments User Guide GSTM1 and GSTT1 DME assays and CNV CYP2D6 copy number variation and CYP2D6 CYP2D7 hybrid alleles Chapter 2 Background and tools for assay content selection J Special assay considerations Note For the CYP genes having multiple assays available those assays in boldface type are the most frequently used for CNV and hybrid gene analysis Note The copy number assays are not SNP allele specific and cannot be used to determine which SNP allele is duplicated when a sample is heterozygous and has three gene copies For DME gene variants that are associated with copy number variation it i
51. aADME Core Markers gt 95 coverage This assay set is comprised of both TaqMan DME and Copy Number assays to 172 SNP InDel and CNV targets e 164 DME assays include 10 assays to genotype 5 triallelic SNPs paired assays e 10 copy number assays cover deletions and duplications in 6 total DME genes A tabular list of the available assays can be downloaded at http tools lifetechnologies com content sfs brochures cms_082106 xls Life Technologies has pretested over 300 TaqMan DME and SNP assays to highly studied important DME and other gene variants on OpenArray plates run on the QuantStudio 12K Flex Real Time PCR System All assays on this list were tested on this system with 44 Coriell g DNAs 22 each African American and Caucasian samples a subset of the DME Assay 90 sample validation panel and most were also tested with synthetic plasmid constructs representing each genotype You can download the PGx Common Markers file that contains a list of the most commonly requested assays from this set at Pharmacogenomics Experiments User Guide 19 7 Chapter 2 Background and tools for assay content selection Special assay considerations www lifetechnologies com pgx The file includes common allele names context sequences and other useful annotations Note From the same web page you can also download TaqMan DME Genotyping Assays on OpenArray Plates a presentation containing screen shots of the test data for the most commonly
52. aging 102 OpenArray plate assembly and handling errors eens 102 Expected versus unexpected no amps and undetermined calls 105 Image analysis Many problems with OpenArray results can be diagnosed by examining the quality control QC images taken at various points during a cycling imaging run In the QuantStudio Software with the experiment in question open click Export QC Images in the Export tab A set of images will be exported to the chosen folder location Export a set of images to a unique folder as exporting another run to the same folder will overwrite the images The images exported are either fluorescent or reflected light images taken before during and after cycling Image name Description BARCODE IMAGE tiff Reflected light image of the entire OpenArray plate useful for confirming the identity of a folder full of images PRE READ_CHANNEL_4 tiff Pre and post ROX images useful for assessing the POST READ_ CHANNEL 4 tiff loading quality s00_c001_t01_p0001_m2_x3_e1_cp _spotfind tiff Pre run reflected light spotfinding image used by the software for determining the location of the holes useful for checking for existing contamination on the case and or heated cover s03_c001_t03_p0001_m2_x3_e1_cp _spotfind tiff Mid run reflected light spotfinding image useful for identifying potential leaks or other contamination that only appears mid run s04_c001_t02_p0001_m2_x3_e1_cp _spotfin
53. ally called In the Results screen each positive control is identified as the genotype that was assigned to it in the Control Identifiers tab This allows the software to preferentially use the positive control data points to help determine the calls of Unknown data points We recommend that you carefully review the coordinates of positive control data points and omit these data points if they are not located in an expected position in the scatter plot Positive controls are similar to reference samples in that the software can use both to bias the calls of Unknown data points However a positive control represents a well that physically contains known template and is included in one of the experiments in the current study A reference sample can represent any well from any experiment in any study For more information on reference samples see the TaqMan Genotyper Software Getting Started Guide Pub no 4448637 To add control identifiers 1 In the toolbar click Analysis Settings to open the Analysis Settings dialog box 2 Select the Control Identifiers tab 3 Select or deselect the Override Control Settings from Experiments check box 54 Pharmacogenomics Experiments User Guide Chapter 5 Prepare run and analyze OpenArray PGx experiments 5 Perform analysis in TagMan Genotyper Software When this check box is s Selected The software uses the control identifiers that you set in the Control Identifiers tab steps a
54. and analyze OpenArray PGx experiments Run OpenArray SNP genotyping experiments The experiments folder will now contain a directory named with a date and time stamp Name Date modified Type di 2013 08 30 132957 8 30 2013 1 30 PM File folder The folder will contain one eds file corresponding to each loaded spf file Z Name Date modified Type Size a Loaded_EYG13 eds 8 30 2013 1 30 PM QuantStudio 12K 51 KB 8 Loaded_EYG14 eds 8 30 2013 QuantStudio 12K 51 KB d Loaded_EYG15 eds g QuantStudio 12K 51 KB For more information about batch files click on the in the top right corner of the Batch Experiment Setup Utility window to link to the relevant section of the QuantStudio 12K Flex Software Help Run OpenArray SNP genotyping experiments Real time vs end Itis strongly recommended that users run all OpenArray plates on the QuantStudio point genotyping instrument in real time experiment mode If you run the OpenArray plates on a experiments thermal cycler outside of the instrument you cannot observe genotype data over time to assess the accuracy genotype calls by observing the location of a given sample relative to others throughout all cycles The example below shows where the DNA concentration is higher than the recommended amount With real time Traces Without Traces e PE pe mg rcr Mee eke Porres Meke 7 doe e Allele x ebara Calls based on end point reads could be incorrect na
55. ast two assays are required to detect copy number variation in CYP2A6 The CYP2A6 intron 7 assay can be used to detect 4 deletion and 1 duplication alleles This assay will amplify both full length CYP2A6 and the partially active CYP2A6 CYP2A7 hybrid allele CYP2A6 12 but will not be able to discern them The intron 1 assay can also be used to detect 4 deletion and 1 duplication alleles This assay will amplify full length CYP2A6 but will not be able to amplify the CYP2A6 12 hybrid allele If both CYP2A6 assays are run 12 alleles can be distinguished from full length alleles For example a 1 12 sample will give 2 copies using the intron 7 assay and 1 copy using the intron 1 assay whereas a 1 1 sample will give 2 copies with both assays Additionally CYP2A7 assays can be used to corroborate the presence of CYP2A6 12 alleles The CYP2A7 exon 1 assay will amplify the hybrid CYP2A6 12 allele whereas the intron 7 assay will not amplify intact CYP2A6 or the CYP2A6 12 allele Pharmacogenomics Experiments User Guide TaqMan DME Assays for genotyping triallelic SNPs Chapter 2 Background and tools for assay content selection J Special assay considerations Several important DME gene variants are triallelic SNPs wherein 3 bases occur at the same genomic location Triallelic SNP targets can be interrogated using a pair of TaqMan assays Each assay contains one probe for the major SNP allele which is labeled with the same reporter dye VIC
56. ate and Loaded OpenArray Plate folders Force Sing Sample Leadng l 7 Require Sarpila integration H Openssrray Plate File input Folder Sample Plate File Folder Openia AcofillSanples Change Loaded OpenAvray Flate File Folder OK Cancel 3 Enter the data for the OpenArray plates For the first plate a Select 1 from the Samples Per Subarray drop down list Pharmacogenomics Experiments User Guide 43 44 Chapter 5 Prepare run and analyze OpenArray PGx experiments Track samples 11 b In the plate holder Position 1 text field enter the 5 character alphanumeric serial number of the OpenArray plate you will load into the first position of the plate holder You can e Click Browse then navigate to and open the plate setup file spf that corresponds to the OpenArray plate The software automatically displays the serial number in the Plate Holder Position 1 field s Scan the serial number barcode located on the OpenArray plate e Type the serial number c Thaw the OpenArray plates for 15 minutes at room temperature Do not leave them at room temperature for more than 2 hours before use d Place a thawed sample plate into the plate holder Hold the OpenArray plate by the edges and place it into the plate holder with the barcode face up and to the left IMPORTANT When you integrate a SamplelID csv into a plate setup file and enter the serial number by scanning or typing the plate s
57. ay AccuFill instrument on page 42 Click the Sample Mapping button in the left bar in the Sample Tracker Software and export the sample information in table csv format 1 Select plates to export as csv files s Recommended 384 well Plate Use this file with the QuantStudio OpenArray AccuFill Software to create a loaded SNP plate file spf e Optional OpenArray Plate n Use this csv file to import setup information into the QuantStudio 12K Flex Software Note For OpenArray Plate n n refers to the number for the OpenArray plate export For example you can export OpenArray Plate 1 OpenArray Plate 2 OpenArray Plate 3 or OpenArray Plate depending on what the customer wants to export All plates are saved to individual csv files in the export directory The OpenArray Sample Tracker Software automatically assigns the file names Pharmacogenomics Experiments User Guide Transfer samples to OpenArray 384 well sample plates Chapter 5 Prepare run and analyze OpenArray PGx experiments 5 Track samples 2 Label and mark the plate Using a fine tip marker e Label the 384 well sample plate with a unique identifier or use barcoded plates Pub no 4453929 e Mark the 48 well sections of the 384 well sample plate that you will transfer the samples to from the 96 well reaction plates using the tracking information that you obtained when you entered experiment and sample information and chos
58. bination with upstream pseudogene CYP2A7 sequences e g the reduced function 12 allele contains exons 1 2 of CYP2A7 origin and exons 3 9 of CYP2A6 origin Oscarson et al 2002 Several copy number assays to CYP2A6 and CYP2A7 sequences are available for examining copy number variants and hybrid alleles see DME genes and copy number variation on page 20 for the complete list e Hs07545274_cn specifically targets CYP2A6 intron 1 sequences and Hs07545273_cn specifically targets 5 end CYP2A6 sequences within the promoter and exon 1 These assays will not amplify CYP2A7 or CYP2A6 CYP2A7 hybrid alleles carrying CYP2A7 intron 1 or 5 end sequences respectively e g CYP2A6 12 e Hs07545275_cn specifically targets CYP2A6 intron 7 sequences and Hs04488984_cn specifically targets CYP2A6 intron 2 sequences These assays will not amplify CYP2A7 but they will amplify CYP2A6 CYP2A7 hybrid alleles carrying CYP2A6 intron 7 or intron 2 sequences respectively e g CYP2A6 12 e Hs07545276_cn specifically targets CYP2A7 exon 1 sequences and it will not amplify CYP2A6 but will amplify CYP2A6 CYP2A7 hybrid alleles carrying CYP2A7 exon 1 sequences e g CYP2A6 12 e Hs07545277_cn specifically targets CYP2A7 intron 7 sequences and Hs04488016_cn specifically targets CYP2A7 intron 2 sequences These assays will not amplify CYP2A6 or CYP2A6 CYP2A7 hybrid alleles carrying CYP2A6 intron 7 or introns 2 sequences respectively e g CYP2A6 12 At le
59. cates x 120 48 uL of each sample at a concentration of 5 ng uL These diluted samples can be stored at 4 C for immediate use or at 25 C to 15 C for long term storage Optional Preamplify DNA samples Overview 36 This abbreviated protocol provides guidelines for any user to perform a targeted multiplex preamplification of 1 to 256 SNP loci located within human genomic DNA samples The protocol is compatible for use with TaqMan SNP Genotyping Assays The user will use a multiplex pool of TaqMan SNP Genotyping Assays to simultaneously preamplify up to 256 target polymorphisms in a single reaction using a reduced amount of input DNA sample The product of this multiplex targeted preamplification may then be used as the sample template input for SNP genotyping reactions with any of the individual TaqMan SNP Genotyping Assays included in the multiplex preamplification assay pool A custom OpenArray Preamp Pool specific for your TaqMan SNP assay panel can be ordered along with your OpenArray plate order please contact your sales representative for details Pharmacogenomics Experiments User Guide Chapter 4 Prepare DNA samples Optional Preamplify DNA samples Reagents Reagent Catalog no TaqMan PreAmp Master Mix 4391128 OpenArray PreAmp Pool 4485255 Genomic DNA samples Supplied by user 1X TE Buffer pH 8 0 12090015 Nuclease free Water Major laboratory supplier T This product cannot be orde
60. cientific and its subsidiaries unless otherwise specified TaqMan and AmpliTaq Gold are registered trademarks of Roche Molecular Systems Inc TaqMan used under permission and license Online Mendelian Inheritance in Man and OMIM are registered trademarks of Johns Hopkins University NanoDrop is a registered trademark of NanoDrop Technologies LLC Puritan and PurFlock are trademarks of the Puritan Medical Products Company LLC 2014 Thermo Fisher Scientific All rights reserved Contents Aboutthis Guide c22csscaniwechedeutweviwaheeacueiaveensebereegend 9 REVISION HISTORY erratia ne anh gtoe ead SEER Bako a e iaaa ce ama aes ates teases 9 S Ep ete Anata SA eet Sette cath anne inna ine aes teh es oe eet TT 9 S CHAPTER 1 About the PGx Workflow 00 eee eee 11 aessa Dc sichue eu hee enmh seat wt eu bee wna oe Sard wed Wee deed a 11 Work OW sens sas eee e way carded aed cad Rae eied sae RE dae a wereld aa raise eee ee 12 S CHAPTER 2 Background and tools for assay content selection 13 About assay content selection cc cece tenet ene eee eee enerne 13 Allele nomenclature 2 0 0 0 ccc cece net Ke Ta aE ATE RAE ete heia 13 Sel ctassayS n re tthe goa we sade 4 ees ee ee is Sige ta ee Be bet 15 TaqMan SNP DME Assays nnan Ouares ob a onadiac cc adaushuc Cecdua ban cc aceeheeees 15 TaqMan Copy Number Assays 0000 cece cnn cence nnn ence eee ne ni 16 Search using the Assay Search Tog cece eee eect e teenie eeee
61. com lifetechnologies com 24 July 2014 technologies USER GUIDE ap plied biosystems oy life technologies Mag MAX DNA Multi Sample Ultra Kit High throughput isolation of PCR ready DNA from whole blood Catalog Number A25597 and A25598 Pub No MANO0010294 Rev C 0 WARNING Read the Safety Data Sheets SDSs and follow the handling instructions Wear appropriate protective eyewear clothing and gloves Safety Data Sheets SDSs are available from www lifetechnologies com support Product information The MagMAX DNA Multi Sample Ultra Kit is designed for rapid high throughput isolation of high quality genomic DNA from a variety of sample matrices The kit uses MagMAX magnetic bead technology ensuring reproducible recovery of PCR ready DNA suitable for a broad range of applications such as SNP genotyping and copy number experiments This protocol describes isolation of DNA from mammalian whole blood samples optimized for use with the MagMAX Express 96 Deep Well Magnetic Particle Processor or with the KingFisher Flex Magnetic Particle Processor 96 well deep well setting The typical DNA yield obtained from 50 uL of whole blood is 1 5 4 ug at a concentration suitable for OpenArray analysis Kit contents and storage Cat no Cat no Component A255970 A255982 Storage 500 rxns 2500 rxns Proteinase KI mL 5x 4mL 15 C to 25 C PK Buffer 96 mL
62. cular star alleles that an assay detects e Required reference assays Copy Number Assays must be run in duplex PCR with TaqMan Copy Number Reference Assay RNase P default assay and TERT alternate assay assays are available and you can add them to your shopping cart via the Required Reference Assays box e View assay details Additional annotations can be viewed for any assay by clicking the Assay Details button Additional annotations include Target Gene details e g assay gene and transcript locations links to NCBI Target Copy Number Variation Details e g copy number variants that the copy number assay maps to links to DGV e View full product details To view an assay page containing all information for a given assay click the View Full Product Details button at the bottom of the Assay Details page e View assay on map Click the View Assay on Map link to view the selected assay in its genomic context along with other neighboring assays Pharmacogenomics Experiments User Guide Search the TaqMan Drug Metabolism Genotyping Assays Index Search the PharmaADME Core Marker Set Search the PGx Common Markers file Chapter 2 Background and tools for assay content selection J Select assays e Add to cart To order single tube assays click Add to Cart Remember to add the required copy number reference assay along with your target copy number assays e Export search results You can export the re
63. d in genetic testing and assay performance experiments All TaqMan DME Genotyping Assays were run on 180 unique DNA samples from four different populations in assay performance and reproducibility testing Samples tested included a panel of 45 African American and 45 Caucasian samples obtained from the Coriell Cell Repositories and a panel of 45 Japanese and 45 Chinese samples provided by a collaborator The minor allele frequencies determined for each assay are provided on the Life Technologies web site assay search results and in the DME Index It is important to note that many of the polymorphisms interrogated by this assay collection have very low minor allele frequencies MAFs of less than 1 thus the minor allele was not detected for all assays within the 180 test samples For TaqMan DME assays having a reported Applied Biosystems AB MAF in the African American or Caucasian populations heterozygous or minor allele homozygous samples may be used as reference or control samples in genetic testing and assay performance studies A complete list of the samples used and their genotypes is available at www lifetechnologies com Pharmacogenomics Experiments User Guide 108 Appendix E Genotyping and copy number controls Plasmid controls NCBI dbSNP genotype data Centers for Disease Control and Prevention CDC reference materials TaqMan Copy Number Assays for DME genes Order the gDNA samples from the Coriell Cell Reposit
64. d tiff Post run reflected light spotfinding image useful for identifying potential leaks or other contamination Pharmacogenomics Experiments User Guide 98 C Appendix C Troubleshooting Case leaks and bubbles Image name Description STAGEx_CYCLEy_CHANNEL_z tiff FAM z 1 or VIC z 2 images at a particular cycle y of a particular stage x of the run useful for looking at patterns in the florescent data e g gradients Case leaks and 99 Note cp in the image file name refers to the position 1 4 within the QuantStudio 12K Flex instrument To view images a free imaging program called ImageJ is recommended due to its ability to easily manipulate the images in ways that programs such as the built in Windows image viewers can t Many images will need to be adjusted for brightness contrast in order to really be able to see what is happening To do this open the image in ImageJ then open the brightness contrast adjustment via Image gt Adjust gt Brightness Contrast or press Ctrl Shift C Then click the Auto button or adjust the sliders until the features of interest in the image are visible bubbles Improper sealing of the OpenArray plate in the OpenArray Case can lead to immersion fluid leaks or bubble formation inside the case leading to uneven heating and imaging throughout PCR and to poor quality genotyping data Below are some examples of OpenArray plates that have been af
65. de functions as a complete guide for Life Technologies complete sample to result PGx workflow solution using the QuantStudio 12K Flex Real Time PCR System Pharmacogenomics Experiments User Guide 11 1 Chapter 1 About the PGx Workflow Workflow Workflow 1 Select TaqMan SNP DME Genotyping 1 Select TagMan Copy Number Assays Assays 2 Order single tube assays Purify and quantify gDNA samples Optional Split samples and perform preamplification for OpenArray plates 2 Order OpenArray plates Run SNP genotyping experiments on OpenArray plates Run copy number experiments on 96 or e Review data in QuantStudio 12K Flex 384 well plates Software e Review data in QuantStudio 12K Flex e Review data in TaqMan Genotyper Software Software e Review data in CopyCaller Software e Export TaqMan Genotyper Software e Export CopyCaller Software results file results file Run translational analysis in AlleleTyper Software Note See Appendix D for system specifications 12 Pharmacogenomics Experiments User Guide Background and tools for assay content selection This chapter covers m About assay content selection 0 66 eee eens 13 M Allele nomenclature sss e eee ec cee eee eee ee ee ee 13 E Selectiassaysiisi 24 25 roel peda hd Ud AWE ee eA LSS DO Dh ad alee 15 S Special assay considerations 0 cece eee eens 20 E References noain Sete Net ey hs eerie Gs Ae
66. de in highly polymorphic genomic regions polymorphisms interfere with amplification in some samples e Share high sequence identity with another genomic region base differences are not available for specific assay development e Are microsatellite polymorphisms or e Are base deletions within a homopolymer sequence A list of commonly requested DME and clinical research targets that are not good candidates for TaqMan Assay design and suggestions for alternative technologies to use are included in the PGx Common Markers file www lifetechnologies com pgx Targets of interest that are not covered by the current Life Technologies TaqMan SNP Genotyping collection can be submitted to Custom TaqMan SNP Assay design The Custom TaqMan Assay Design Tool CADT is available on the Life Technologies website www lifetechnologies com Order a custom TaqMan SNP Genotyping Assay by first entering a sequence with the SNP in brackets for example A G then submitting the chosen target sites for assay design Upon notification of successful assay design by email click the link in the message and add the desired custom assays to your shopping basket Pharmacogenomics Experiments User Guide 25 Chapter 2 Background and tools for assay content selection References Custom TaqMan Copy Number Assays References 26 CADT can be used to design assays targeting biallelic SNPs or insertion deletion polymorphisms and multi nucleotide
67. der custom OpenArray plates 3 Upload your assay list You can upload your assays from a tab delimited text file txt or paste the IDs in the Enter a list of Assays IDs search box and click Import Entered List Import your assay list Upload a list of Assay IDs Enter a list of Assay IDs Import Entered List After you import the assays the assays are automatically populated into the through holes diagram for each subarray You can rearrange the assay position by dragging and dropping the assay into the desired destination In the following example we moved assays from the positions g1 g2 h1 and h2 into positions h5 through h8 Pharmacogenomics Experiments User Guide 29 3 Chapter 3 Ordering information Order custom OpenArray plates QW Array Configurator x TR gt L wwulifetechnologies com order custom array configure Array Unique Array name D Array type Targets Filed invalid Empty Test Panel TaqMan OpenArray Genotyping paie 60 O O Select Edit Move Export Save Your Array Save A Copy Assay Target rs10046 ID C__6234731_20 Species Human Wells Atc4 Display Assay Target 5j 183211371 K Sub Array 1841303343 Filled 189923231 Invalid 1810264272 185030862 Enpi 137294 1312248560 1328399499 137900194 1556337013 134986893 18776746 Array Configurator gt C 7 wwifetechnologiescom order custom array configure Array Unique Array name 1D Array ty
68. dialog box select one or more real time PCR files to analyze Pharmacogenomics Experiments User Guide 71 Chapter 6 Prepare run and analyze copy number experiments Analyze results using CopyCaller Software 4 Click Open to import the data from the selected real time PCR results 5 Repeat steps through as needed to add files to the analysis Select and analyze assay data 1 72 In the Assay Selection Table select one or more assays to analyze To select an assay Click anywhere in a row of the Assay Selection Table the software highlights the selected row in blue In the toolbar click Z Analysis Settings In the Analysis Settings dialog box Calibrator selection panel specify the calibrator sample settings for the selected assay s depending on whether or not a calibrator sample of known copy number is available If a calibrator is present a Select With Calibrator Sample b In the Calibrator Sample Name drop down list select or enter a sample to use as the calibrator for the analysis The median ACy value is also available can also be selected as the calibrator and works best when most samples have an equivalent copy number c In the Calibrator Sample Copy Number field enter the number of copies of the target sequence that are in the calibrator sample The number of copies must be a whole number greater than zero If a calibrator is not present a Select Without Calibrator Sample b Inthe Most Frequent
69. e a study in TaqMan Genotyper Software For a detailed description of genotype analysis with TaqMan Genotyper Software please refer the TaqMan Genotyper Software Getting Started Guide Pub no 4448637 Create a new study or create a study from a template To create a study in the toolbar on the TaqMan Genotyper Software Home screen click Create Study Alternatively create a study from a template file Click Create Study from Template then select and open a template file using the Select Template dialog box Note See the TaqMan Genotyper Software Getting Started Guide Pub no 4448637 for details on creating study templates Pharmacogenomics Experiments User Guide 51 5 Chapter 5 Prepare run and analyze OpenArray PGx experiments Perform analysis in TagMan Genotyper Software Enter study properties 1 In the Workflow Menu pane select Setup gt Properties to open the Properties screen The Properties screen is the default view Enter a study name Select QuantStudio 12K Flex Real Time PCR System from the Instrument Type drop down menu Select Real time from the Experiment Type drop down menu Optional Enter a description of the study Optional In the Comments field enter comments for the study then click Add The software records the comments your user name and the date and time you added the comments Note The Comments field allows you to enter detailed informati
70. e panel file 60 This section provides step by step procedures to e Generate a reference panel file this page e Import the reference panel file page 63 e If needed Delete a reference panel file page 63 A reference panel file is a user generated TaqMan Genotyper Software file that contains reference samples Reference samples are data points in an experiment that you select to be representative of the clusters for an individual assay You can identify collect and store reference samples for multiple assays in a reference panel file for use in current or future studies After you import a reference panel file into a study the software uses the reference samples as a guide for the calls of Unknown data points The reference samples cannot be modified and are not calculated in the call rates Note Reference samples are similar to positive controls in that the software can use both to guide the calls of Unknown data points However a positive control represents a well that physically contains known template and is included in one of the experiments in the current study A reference sample can represent any well from any experiment in any study Before you can import a reference panel file into a study you must first generate the file in the TaqMan Genotyper Software 1 In the TaqMan Genotyper Software open a study that contains data points that you want to use as reference samples Note You must select the data
71. e plates to export Thaw the 96 well reaction plate containing prepared gDNA samples at room temperature Mix the gDNA samples by vortexing then spin for 1 minute at 1000 rpm Review the concentration of the normalized gDNA samples The recommended starting concentration for human gDNA samples is 50 ng uL Note For optimal results it is important to normalize all g DNA samples in an experiment For human gDNA make sure the samples are close to the recommended starting concentration of 50 ng uL Mix the 2X TaqMan OpenArray Genotyping Master Mix by gently inverting the bottle 10 times Based on the layout you determined load the 384 well sample plate a Add the master mix to the 384 well sample plate b Using a 12 channel pipette transfer the normalized gDNA samples from the 96 well reaction plate to the 384 well sample plate Volumet when transferring to Component Format 64 Format 16 Format 32 2X TaqMan 2 9 UL 1 5 UL 2 0 uL OpenArray Genotyping Master Mix Normalized gDNA 2 5 UL 1 5 uL 2 0 uL sample human gDNA starting concentration 50 ng pL Total volume 5 0 uL 3 0 uL 4 0 uL T One well of a 384 well sample plate corresponds to one subarray of an TaqMan OpenArray plate The number of subarrays required depends on the format of the TaqMan OpenArray plate T Starter kit experiment and larger formats Cover the sample plate with foil Vortex gently
72. e same copy number are present copy number values will be calculated but quality metrics will not be calculated Pharmacogenomics Experiments User Guide Chapter 6 Prepare run and analyze copy number experiments Set up the instrument software Set up the instrument software Use your QuantStudio 12K Flex Software to set up the experiment Use the Standard Curve experiment type to capture the cycle threshold Cy data from the duplex PCR run The real time PCR Cy data are subsequently used by CopyCaller Software to calculate sample copy number values by relative quantitation Create a 384 well or 96 well plate experiment for the run using the Standard Curve experiment type TaqMan Reagents and the Standard run mode Define Target names s Enter the TaqMan Copy Number Assay ID or user defined name as the Target Name with FAM as the Reporter and NFQ MGB as the Quencher If using AlleleTyper Software for data analysis the copy number assay id must contain the suffix _cn and must match the target assay name used in the translation table s Enter the TaqMan Copy Number Reference Assay gene target or user defined name as the Target Name with VIC as the Reporter and TAMRA as the Quencher Assign to each well of the plate that contains a reaction a sample name and a detector target that includes dye information reporter and quencher Create unique sample names so that the CopyCaller Software analyzes each samp
73. e windows near the alphanumeric plate ID Apply the plug to the port and tighten until the black handle breaks off from the screw For more information please refer to Applied Biosystems QuantStudio 12K Flex Real Time PCR System OpenArray Plate Quick Reference Guide Pub no 4478673 Pharmacogenomics Experiments User Guide Chapter 5 Prepare run and analyze OpenArray PGx experiments 5 Create a batch of experiments in eds file format Create a batch of experiments in eds file format The following steps must be performed after sample integration using the AccuFill instrument to load the OpenArray plate s Loaded spf files created during this process are required so that DNA sample locations are included Although other options are available for batch file creation the steps recommended below describe the easiest workflow Note Before using this workflow the Setup Folder direction should be set under drive Program Files AppliedBiosystems OpenArray AccuFill Loaded SPF 1 With the instrument powered on start the QuantStudio Software by double clicking its icon 2 On the uppermost tool bar click Tools r Batch Experiment Setup 3 In the next window under Input Files File Setup Folder click Browse and select the following directory drive Program Files AppliedBiosystems OpenArrayAccuFill Loaded SPF 4 Under Export Location click Browse and select the following directory drive Applied Biosystems
74. ead calculation to determine genotyping calls This calculation removes noise that may result from fluorescent materials in the system Real time Rn Select if you included amplification in the run and you want to use the reporter Rn data from the cycle 40 or a user defined cycle from the real time plots to determine genotype calls Real time Rn Median Rna to Rnb Select if you want to use the subtracted median of the reporter Rn data from cycling stages a and b to determine genotype calls where Rna to Rnb refers to all the cycles from the Start Cycle Number a to the End Cycle Number Default values are a 3 and b 15 The median subtraction provides improved data accuracy by performing a baseline correction The analysis we recommend for the PGx application is the Analyze Real Time Rn Median Rna to Rnb setting This setting will normalize for any run and system noise to improve data accuracy Click Apply Analysis Settings at the lower left corner of the analysis settings window after choosing the analysis settings If you choose the recommended analysis setting then you can turn on the real time trace option by clicking the icon highlighted in yellow below Plot Type S Change Call v Re lt gt 48 To view real time traces open the experiment In the toolbar on the left select Analysis gt Allelic Discrimination Plot Then select the box highlighted in yellow above Click the pl
75. eae E E wade dc a E COA Hea anaes 33 Order custom OpenArray plates Design and order custom QuantStudio 12K Flex TaqMan OpenArray Genotyping plates which are delivered with assays dried down in the through holes you specify using the TaqMan OpenArray Plate Configurator To order custom panels of TaqgMan Genotyping Assays pre plated on OpenArray plates 1 Navigate to the TaqMan OpenArray Real Time PCR Plate with Genotyping Assays web page found at the Life Technologies website www lifetechnologies com Life Sciences TaqMan Real Time PCR Assays gt TaqMan SNP Genotyping Assays OpenArray Plates Configure a TaqMan OpenArray Genotyping Plate The page contains a table of the available OpenArray custom formats ranging from 16 256 assays per plate i TeqMan Opendray x e G wwuwilifetechnologies com TaqMan OpenArray Real Time PCR Plate with Genotyping Assays Anew ordering interface Design your own plate building trom your custom assays and over 4 5 milion predesigned genotyping assays including 2 700 inventoried drug metabolizing enzymes assays Minimum order quantity is dependent upon OpenArray format Select your array format Minimum Format Number of Assays Number of Samples Order aty 4 10 pack 6 10 pack 8 10 pack Pharmacogenomics Experiments User Guide 27 3 Chapter 3 Ordering information Order custom OpenArray plates Click View Layout to vis
76. een in the wells place the Elution Plate on the Magnetic Stand 96 to collect continued any residue prior to downstream use of the DNA IMPORTANT Do not allow the purified samples to sit uncovered at room temperature for more than 10 minutes to prevent evaporation and contamination The purified samples are ready for immediate use Alternatively store the covered Elution Plate e At 2 6 C for up to 24 hours e At 20 C or 80 C for long term storage Recommended quantitation methods Note Mix the samples by pipetting up and down before quantitation a ee if they h n stored frozen Standard curve analysis is the most accurate quantitation method FET have BEO Shore froz whereas UV absorbance measurements can be used to assess both the Revisi i evision histor concentration and the quality of the isolated DNA y Standard curve analysis Use the TaqMan RNase P Copy Revision Date Description Number Reference Assay Cat no 4403326 for human genomic ra C 0 July 2014 Addit f tant dural DNA and the TaqMan DNA Template Reagents Cat no 401970 Ral guidelines Ren AN pepe to create a standard curve Refer to Creating Standard Curves with Genomic DNA or Plasmid DNA Templates for Use in Quantitative PCR B 0 July 2014 Correction of the kit name Pub no 4371090 A 0 May 2014 New document e UV absorbance measurements Use a NanoDrop or other comparable instrument Pure genomic DNA should have an
77. eir positions when prompted by the instrument see Table 1 Load the PK Plate containing lysate isopropanol and DNA Binding Bead Mix at position 1 when prompted by the instrument When prompted by the instrument approximately 28 30 minutes into the run 1 Remove the Elution Plate from the instrument 2 Add 50 uL of DNA Elution Buffer 2 to each sample well IMPORTANT Add DNA Elution Buffer 2 immediately after the prompt to prevent excessive drying of any beads that are still captured on the Tip Comb 3 Load the Elution Plate back onto the instrument and press Start At the end of the run approximately 30 35 minutes after initial start remove the Elution Plate from the instrument and seal immediately with a new MicroAmp Clear Adhesive Film e If precipitated DNA is visible pipet up and down 5 10 times before sealing the plate to ensure complete resuspension e Eluates can also be transferred to a new elution plate after collection e If excess bead residue is seen in the wells place the Elution Plate on the Magnetic Stand 96 to collect any residue prior to downstream use of the DNA IMPORTANT Do not allow the purified samples to sit uncovered at room temperature for more than 10 minutes to prevent evaporation and contamination The purified samples are ready for immediate use Alternatively store the covered Elution Plate At 2 6 C for up to 24 hours At 20 C or 80 C for long term storage Mag
78. elow the threshold a flag will be raised Low ROX Intensity A Low ROX Intensity flag can be raised for any data point If the ROX dye intensity determined by the software for a data point is below the threshold a flag will be raised NTC FAM Intensity High An NTC FAM Intensity High flag can be raised for any data point that is identified or tasked as an NTC If the FAM dye signal intensity for a data point tasked as NTC is greater than the threshold a flag will be raised Pharmacogenomics Experiments User Guide 57 5 Chapter 5 Prepare run and analyze OpenArray PGx experiments Perform analysis in TagMan Genotyper Software QC flag Description NTC VIC Intensity High An NTC VIC Intensity High flag can be raised for any data point that is identified or tasked as an NTC If the VIC dye signal intensity for a data point tasked as NTC is greater than the threshold a flag will be raised Reference Sample Discordance A Reference Sample Discordance flag can be raised for any data point that is identified or tasked as an Unknown If the software algorithm assigned genotype for a data point is discordant with the genotype of a reference sample data point that has exactly the same sample assay identification a flag will be raised Replicate Sample Discordance A Replicate Sample Discordance flag can be raised for any data point that is identified or tasked as an Unknown If the
79. en in bold font Note 1 refers to the reference gene sequence which has normal function The reference gene sequence is not necessarily equivalent to the reference genome assembly sequence and it does not necessarily contain the major allele for a given SNP which can vary between populations particularly for highly polymorphic SNPs The defining variant for a given DME gene star allele may be the only variant that needs to be interrogated to identify that particular star allele The defining allele is sometimes referred to as the common allele Common allele names are provided for many DME variants in the PGx Common Markers file see Select assays on page 15 The DME Assay collection variants have been mapped for the genes having public allele nomenclature sites This allele nomenclature is searchable on the DME assay product pages and in the downloadable TaqMan Drug Metabolism Genotyping Assays Index file available on the Life Technologies website The public allele nomenclature websites provide information on known DME gene star allele haplotypes the defining polymorphisms for these alleles and in many cases links to the NCBI dbSNP website if an rsSNP identifier has been assigned Table 1 DME allele nomenclature websites Gene family Allele nomenclature website CYP Cytochrome P450 CYP genes http www cypalleles ki se NAT1 and NAT2 Arylamine N http nat mbg duth gr Acetyltransferase genes UGT
80. encePanel lap save Import the 1 In the TaqMan Genotyper Software open a study that you want to import the reference pa nel file reference panel file into 2 In the Workflow Menu pane select Setup gt References to open the References screen 3 Click Import 4 In the Import dialog box browse to and select the reference panel file of interest then click Import Note The software automatically analyzes the study whenever you import the reference panel file 5 To view the imported reference samples for each assay a From the Workflow Menu pane select Analysis gt Results b In the Results table select the Reference Samples tab to see the listing of reference samples applied to an assay For more information see the TaqMan Genotyper Software Getting Started Guide Pub no 4448637 Optional Delete a In the References screen select the reference panel file to delete To delete more reference panel file than one file at a time press Ctrl or Shift when you select the files 2 Click Delete then click Yes to confirm Note The software automatically analyzes the study whenever you delete a reference panel file Pharmacogenomics Experiments User Guide 63 5 Chapter 5 Prepare run and analyze OpenArray PGx experiments Assays that require manual genotype calls Assays that require manual genotype calls Special circumstance SNP and DME genotyping assays 64 While reviewing all project
81. entify any mistyped samples For more information go to http www cstl nist gov strbase Amelogenin htm An example of a Genotyping Bar Code Y chromosome assay that can be used C___1083232_10 to the polymorphic rs2032598 SNP in USP9Y Only male samples will amplify with this assay female samples will cluster with the no template controls NTCs TaqMan SNP Genotyping Assays to clinical research targets are often included in PGx studies These assays are found within the predesigned TaqMan SNP Genotyping Assays collection and are searchable on the Life Technologies web site by NCBI dbSNP rsSNP ID Note that common names for disease associated alleles e g Factor V Leiden are not yet search terms Public web sites that can be used to identify the rsSNP ID for common disease alleles include e Online Mendelian Inheritance in Man OMIM http omim org e SNPedia a wiki investigating human genetics http snpedia com In addition TaqMan SNP Genotyping Assays to commonly tested clinical research targets are included in the PGx Common Markers file that can be downloaded from www lifetechnologies com pgx TaqMan SNP Genotyping Assays are an ideal technology for interrogation of most DME and clinical research target polymorphisms offering highly specific target amplification and allele discrimination However there are some polymorphisms that are not well suited for TaqMan assay development These include targets that e Resi
82. ents REAGCNISs 25 4 h ae eet A etree fete eee eee TTT 33 CHAPTER 4 Prepare DNA samples ce 35 Isolate and purify genomic DNA 0 00 e eens 35 Quantify DNA samples 0 0 0 cece rinsio RR R R nent eee R R NR e 35 Split DNA samples for copy number experiments cece eee eee eeeeee 36 Optional Preamplify DNA samples 0000 c ccc ccc nnn n runnar rnnr 36 OVERVIOW 8 soa 3 Ga aa Pn ann A E a oa ec eee Sin tae Meee te Real etal 36 REAGENTS ccc chim tng bie ee ea en eee di gee erases yd ca ees dees ed 37 Proced ra E L Sees toed seeder ea Ree 37 CHAPTER 5 Prepare run and analyze OpenArray PGx Experimente oo sete a R ARA TR NE da EN NA tes 39 About the OpenArray chemistry protocol 0 ccc eee cece eee e tenet e eens 39 Track Sam plese TTT Ac imedl gente lit and 39 OpenArray plate loading overview 0 c ccc cc cece cnn teen ee nren nann 39 Enter experiment and sample information 000000 e cece cece eee eee tees 40 Export sample information x a d K Aa RVR ade Mee bee ee ae eee ee 40 Transfer samples to OpenArray 384 well sample plates 0 0 c cece eee eee eee 41 Load samples using the OpenArray AccuFill Instrument 00 cece e eee ee 42 Create a batch of experiments in eds file format 2 000 cece eee eee 45 Run OpenArray SNP genotyping experiments 0 0 c cc ccc ccc nen nen eens 46 Real time vs end point genotyping experiments 000 c cece cece eee ees 46 Ana
83. er e Assays with Non human part numbers include predesigned SNP assays that are designed to mouse SNPs and custom SNP assays designed to any non human organism Non human part numbers can also applied to assays to human targets that would fail the human assay functional test e g Y chromosome SNP assays fail as 8 of 20 samples are female and will not amplify Table 7 TaqMan Copy Number Assays made to order Number of reactions Part no t Scale Concentration 384 well 96 well Pre designed Custom Plus Custom 10 uL 20 pL assays assays assays Small 20X 720 360 4400291 4442487 4400294 Medium 20X 1500 750 4400292 4442520 4400295 Large 60X 5800 2900 4400293 4442488 4400296 T Only human assay part numbers are listed in this table 32 Pharmacogenomics Experiments User Guide Chapter 3 Ordering information Reagents Table 8 TaqMan Copy Number Reference Assays inventoried Number of reactions Product Concentration 384 well 96 well Part no 10 pL 20 pL Human assays TaqMan Copy Number Reference Assay 1 tube 20X 1500 750 4403326 RNase P 750 Reactions TaqMan Copy Number Reference Assay 4 tubes 20X 6000 3000 4403328 RNase P 3000 Reactions TaqMan Copy Number Reference Assay 1 tube 20X 1500 750 4403316 TERT 750 Reactions TaqMan Copy Number Reference Assay 4 tubes 20X 6000 3000 4403315 TERT 3000 Reactions Reagents TaqMan Genotyping Master M
84. er SNP gene context sequence genomic location allele nomenclature and MAF AB HapMap AGI annotations Search for TaqMan Copy Number Assays To search for TaqMan Copy Number Assays using the Assay Search tool select the Copy Number experiment type and the human species Search terms include gene symbol assay ID and Database of Genomic Variants DGV variation IDs Single keyword or batch search options are available as is a search by genomic location e View assay search result The assay search result page will display the assay ID along with the genomic location coordinate position within the assay probe sequence the gene symbol number of associated Database of Genomics Variants DGV variant IDs cytoband and amplicon length Pre tested TaqMan Copy Number assays are available for several DME genes known to lie with copy number variant regions see DME genes and copy number variation on page 20 These can be identified by searching by gene symbol or name and then applying the pre tested assay filter to the results A Pre tested note will appear in a box beside the assay ID in the search results indicating that the assay was run on 90 samples 45 each from African American and Caucasian populations IMPORTANT Read any Important Information notes associated with the Assay ID in the search results These provide information required for making ordering decisions for example information on the parti
85. esults cotton swabs may contain PCR inhibitors We recommend using Puritan PurFlock Ultra Flocked Swabs Fisher Scientific Cat no 22 025 192 2 Process or store samples shortly after collection Alternatively they can be stored e At room temperature or 4 C overnight e Between 20 C and 80 C for up to several weeks Important procedural guidelines e Perform all steps at room temperature 20 25 C unless otherwise noted e Equilibrate buccal swabs to room temperature to maximize DNA recovery e Cover the plate during incubation and shaking steps to prevent spill over and cross contamination The same MicroAmp Clear Adhesive Film can be used throughout the procedure unless it becomes contaminated e If you use a plate shaker other than the Thermo Scientific Titer Plate Shaker verify that The MagMAX Express 96 Deep Well Plate fits securely on your titer plate shaker The recommended speeds are compatible with your titer plate shaker Ideal speeds should allow for thorough mixing without splashing e Per plate volumes for reagent mixes are sufficient for one 96 well plate plus overage To calculate volumes for other sample numbers refer to the per well volume and add 5 overage s If the DNA yield is lower than expected extend the Proteinase K digestion time to 45 minutes Perform DNA extraction and elution If needed download the KingFisher Flex program The program required for this pro
86. etup file must be located in the following directory drive Program Files Applied Biosystems OpenArray AccuFill Sample Otherwise the software will not be able to locate the file The drive is the computer hard drive on which the QuantStudio OpenArray AccuFill Software is installed unless a custom installation is performed the default drive is C Note The AccuFill Software uses the serial number to access the appropriate plate setup files During an instrument run information in the plate setup files is used to populate the Assays screen in the QuantStudio 12K Flex Software As you enter the serial number it is reflected in the representation of the OpenArray plates in the lower section of the window Repeat step for the remaining OpenArray plates then click Next Place tip boxes OpenArray plates and sample plate on the deck of the AccuFill instrument Also ensure the waste bin is empty Follow the window prompts until the instrument begins to load the array Once the loading is complete place the loaded OpenArray plate onto the plate press Peel protective layers from the lid and place onto the loaded OpenArray plate on the plate press Engage the plate press and allow the plate to sit in the press for 20 seconds Remove the assembled OpenArray plate from the plate press and add immersion fluid Load immersion fluid until there is a small bubble that is enough to just fill one of the squar
87. etween target and reference sequences then compares the ACy values of test samples to a calibrator sample s known to have two copies of the target sequence The copy number of the target is calculated to be two times the relative quantity because the human genome is diploid Pharmacogenomics Experiments User Guide 67 Chapter 6 Prepare run and analyze copy number experiments Prepare the reaction plates In a copy number quantitation reaction purified genomic DNA is combined with TM s The TaqMan Copy Number Assay containing two primers and a FAM dye labeled MGB probe to detect the genomic DNA target sequence e The TaqMan Copy Number Reference Assay containing two primers and a VIC dye labeled TAMRA probe to detect the genomic DNA reference sequence e The TaqMan Genotyping Master Mix containing AmpliTaq Gold DNA Polymerase UP Ultra Pure and dNTPs required for the PCR reactions Reactions are run on an Applied Biosystems Real Time PCR System After amplification data files containing the sample replicate Cy values for each reporter dye can be exported from the real time PCR instrument software and imported into a software analysis tool Applied Biosystems CopyCaller Software is recommended for post PCR data analysis of copy number quantitation experiments Prepare the reaction plates Copy Number analysis is a sensitive application For optimal results use high quality purified and quantified gDNA sa
88. experiments 5 Perform analysis in TagMan Genotyper Software Import 1 Inthe Workflow Menu pane select Setup gt Experiments to open the Experiments experiments into screen the study 2 Click Import 3 In the Import dialog box browse to and select the experiment of interest To import more than one experiment at a time press Ctrl or Shift when you select the experiments Be sure that all experiments meet the criteria defined in the TaqMan Genotyper Software Getting Started Guide Pub no 4448637 4 Click Import The Experiments screen after import is shown below ea TaqMan Genotyper Software Version 1 0 User Name Administrator Last Log In 3 4 10 1 06 PM File Edit Analysis Tools Help p Eb Save Ee Clase gt A Analysis Settings Ka Help o gt S Import Delete x Setup Experiment Name Plate Barcode of Assays of Samples of Wells Description Date Added Bn properties 121707_Performance_Strong01_Assays1 8_AD_MM sds A3038YTE B 47 3 05 2010 13 52 20 EST 121707_Performance_StrongO1_Assays9 16_AD_MM sds A303MK7I 8 47 384 03 05 2010 13 52 20 EST Efperiments 121707_Performance_StrongO2_Assays1 8_AD_MM sds A303824Y 8 47 384 03 05 2010 13 52 20 EST 121707_Performance_StrongO2_Assays9 16_AD_MM sds 43038242 8 47 384 03 05 2010 13 52 21 EST Po 121707_Performance_StrongO3_Assays1 8_AD_MM sds 43038256 8 47 384 03 05 2010 13 52 21 EST y 121707 _Perf
89. experiments 67 analyze and export results 70 experimental setup 68 instrument software setup 69 prepare reaction plates 68 preparing reactions 69 running reactions 70 CopyCaller Software 71 Pharmacogenomics Experiments User Guide Index custom OpenArray plates ordering 27 D documentation related 118 L Limited Product Warranty 120 M Material Data Safety Sheets MSDSs See Safety Data Sheets SDSs N nomenclature allele 13 0 OpenArray PGx experiments 39 analysis setup 47 control identifiers 54 creating a batch of experiments 45 creating a study in Genotyper Software 51 entering experiment information 40 exporting analysis data 59 exporting sample information 40 generating and importing a reference panel 60 loading samples using the OpenArray Accu Fill instrument 42 manual calls 64 plate loading 39 QC settings 57 real time vs end point genotyping experiments 46 running genotyping experiments 46 single tube reintegration 66 tracking samples 39 transferring files toa user computer 51 transferring samples to OpenArray plates 41 ordering information 27 122 Index P PharmaADME Core Marker Set searching 19 R reagents ordering 33 related documentation 118 S safety biohazard 116 chemical 115 Safety Data Sheets SDSs obtaining 120 single tube reintegration 66 single tube TaqMan Assays ordering 31 special circumstance SNP and DME genotyping assays 64 specifications
90. favor genotype distributions based on the Hardy Weinberg principle over other distributions and reduce the risk of incorrect calls Control Identifiers Study Level Settings Call Method Autocaling Classification Scheme Call Settings Use Hardy Weinberg for Analysis IV Protect Manual Cals V Baseline for Real time Data 7 Use Positive Controls for Analysis IT Use Reference Panels for Autocaliing I Cycle Number l Heterozygote allow S l Note X and Y chromosome specific SNP targets do not follow a Hardy Weinberg distribution SNP targets located in the pseudo autosomal PAR region of the X and Y chromosomes behave like autosomal SNP targets and follow a Hardy Weinberg distribution Note The probes of the gender assay C_990000001_10 target X and Y chromosome specific sequences in the amelogenin gene males run as heterozygotes and females run as VIC homozygotes The VIC probe detects a sequence in the gene found only on the X chromosome and the FAM probe detects a sequence in the gene found on the Y chromosome Hardy Weinberg rules will not apply and this box should be unchecked for this assay Heterozygote analysis options for sex chromosome targets SNP targets on the e X chromosome cannot be heterozygous in males because males carry only one copy of the X chromosome e Y chromosome cannot be heterozygous in males because there is only one copy of the Y chromosome Y chromosome specific
91. fected by immersion fluid leaks The images show where leaked fluid has condensed on the underside of the heated cover windows and obscured the view of the through holes SESH HERR TARE wy X Dy TROT Pharmacogenomics Experiments User Guide Appendix C Troubleshooting Sample plate preparation errors Possible cause Recommendation Plate press was not engaged for at least 20 seconds Ensure that the plate press is fully engaged for at least 20 second on future experiments Damaged lid adhesive Visually inspect the lid adhesives for defect when the liner has been removed Ensure that adhesive is not damaged or warped Damaged fill port screw gasket Visually inspect the screw to ensure that the orange gasket is present and not damaged Damaged fill port screw assembly Breaks off too easily The screw may be mis threaded Unscrew it and use a new screw assembly Oily lid or case from immersion fluid overflow Wipe off excess overflow of immersion fluid from the lid case bottom and crevices with 70 isopropyl alcohol using a lint free cloth the cloth included with the OpenArray plate is acceptable Immersion fluid exposed to air for too long Do not remove the immersion fluid syringe cap or draw air bubbles into the syringe until you are ready to load Do not draw air bubbles into the syringe Too large of a bubble inside the OpenArray case after sealing Minimize the size of
92. fetechnologies com support The information in this guide is subject to change without notice DISCLAIMER LIFE TECHNOLOGIES CORPORATION AND OR ITS AFFILIATE S DISCLAIM ALL WARRANTIES WITH RESPECT TO THIS DOCUMENT EXPRESSED OR IMPLIED INCLUDING BUT NOT LIMITED TO THOSE OF MERCHANTABILITY FITNESS FOR A PARTICULAR PURPOSE OR NON INFRINGEMENT TO THE EXTENT ALLOWED BY LAW IN NO EVENT SHALL LIFE TECHNOLOGIES AND OR ITS AFFILIATE S BE LIABLE WHETHER IN CONTRACT TORT WARRANTY OR UNDER ANY STATUTE OR ON ANY OTHER BASIS FOR SPECIAL INCIDENTAL INDIRECT PUNITIVE MULTIPLE OR CONSEQUENTIAL DAMAGES IN CONNECTION WITH OR ARISING FROM THIS DOCUMENT INCLUDING BUT NOT LIMITED TO THE USE THEREOF Important Licensing Information This product may be covered by one or more Limited Use Label Licenses By use of this product you accept the terms and conditions of all applicable Limited Use Label Licenses 2014 Thermo Fisher Scientific Inc All rights reserved All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified VWR is a trademark of VWR International LLC NanoDrop is a trademark of NanoDrop Technologies Inc Puritan and PurFlock are trademarks of Puritan Medical Products Company LLC TaqMan is a trademark of Roche Molecular Systems Inc used under permission and license Boekel is a trademark of Boekel Scientific Inc For support visit lifetechnologies com support or email techsupport alifetech
93. he 4 5 million TaqMan SNP Genotyping Assays were designed using a related highly validated SNP assay design algorithm The SNP assays are functionally tested i e for amplification and clustering capabilities when first manufactured on 20 unrelated gDNA samples from three populations African American Caucasian and Japanese In addition over 300 high value TaqMan DME and SNP assays were tested with 44 African American and Caucasian samples and synthetic templates representing each genotype on OpenArray plates run on the QuantStudio 12K Flex Real Time PCR System to ensure assay performance on this platform All TaqMan SNP Genotyping Assays Drug Metabolism Genotyping Assays and Custom SNP Genotyping Assays contain sequence specific forward and reverse primers to amplify the polymorphic sequence of interest and two TaqMan MGB probes with Non fluorescent quencher NFQ s One probe labeled with VIC dye detects the Allele 1 sequence s One probe labeled with FAM dye detects the Allele 2 sequence TaqMan Drug Metabolism and SNP Genotyping Assays may be ordered as single tube assays or pre plated on OpenArray plates see Chapter 3 Ordering information on page 27 TaqMan DME and SNP Genotyping Assay data is analyzed by cluster plot analysis FAM dye signal is plotted on the Y axis and VIC dye signal is plotted on the X axis Samples homozygous for the FAM or VIC labeled alleles will form clusters along
94. he following incubators or an equivalent in shelves and thermometer cubator with slatted Economy Lab Incubator Cat no S50441A 21 VWR Digital Mini Incubator VWR Cat no 10055 006 Fisher Scientific Analog Vortex Mixer Cat no 02 215 365 21 Adjustable micropipettors MLS Multi channel micropipettors MLS Optional but recommended Magnetic Stand 96 Cat no AM10027 Plastics and consumables MagMAX Express 96 Deep Well Plates Cat no 4388476 MagMAx Express 96 Standard Plates Cat no 4388475 MagMAx Express 96 Deep Well Tip Combs Cat no 4388487 MicroAmp Clear Adhesive Film Cat no 4306311 RNase free Microfuge Tubes 2 0 mL Cat no AM12425 Conical tubes 15 mL Cat no AM12500 Conical tubes 50 mL Cat no AM12502 Aerosol resistant pipette tips MLS Reagent reservoirs MLS Reagents Ethanol 200 proof absolute MLS Isopropanol 100 molecular grade or higher MLS Optional Proteinase K 500 reactions 4 mL Cat no A25561 Optional DNA Binding Beads 500 reactions 8 mL Cat no A25562 21 Available from Fisher Scientific T See If needed download the KingFisher Flex program on page 2 technologies Pharmacogenomics Experiments User Guide Sample collection and storage 1 Collect blood samples using proper venipuncture collection and handling p
95. he real time PCR data from TaqMan Copy Number Assay experiments run on Applied Biosystems Real Time PCR Systems including QuantStudio 12K Flex System The software and associated copy number assays can be used to detect and measure copy number variation of specific genomic sequences Use CopyCaller Software to analyze the real time PCR data and to export copy number data files that you can import into AlleleTyper Software for translation CopyCaller Software performs a comparative Cy AAC relative quantitation analysis of the real time data The analysis determines the number of copies of the target sequence in each test genomic DNA sample The comparative CT AAC method first calculates the difference ACy between the threshold cycles of the target and reference assay sequences Then the method compares the AC values of the test samples to a calibrator sample that contains a known number of copies of the target sequence Alternatively the analysis can be performed without the use of a calibrator sample by using a maximum likelihood algorithm Note For a complete description of CopyCaller Software features and guidance on using the software refer to the CopyCaller Software v2 0 User Guide Pub no 4400042 Perform copy Import the results files n mber analysis 1 Start CopyCaller Software 2 Inthe CopyCaller Software toolbar click Import real time PCR results file or select File gt Import 3 In the Import
96. ht Dilute and store the preamplified product Transfer the reaction plate from the thermal cycler to a container with ice Keep the plate on ice until you are ready to dilute the preamplified product Dilute the preamplified product 1 20 using the following procedure 1 Spin the reaction plate briefly prior to removing the film 2 Remove film and add 95 uL of 1X TE Buffer to each well containing a preamplified product 3 Firmly seal the reaction plate with a new MicroAmp Clear Adhesive Film 4 Vortex the reaction plate for 10 seconds and spin briefly Store the preamplified product at 25 C to 15 C Genotyping with preamplified product Perform genotyping using the individual TaqMan SNP Genotyping Assays following the standard protocol with the exception of substituting preamplified product for genomic DNA sample It is not necessary to quantify or normalize preamplified product The preamplified sample can be input directly into the reaction plate or further diluted in 1X TE Buffer to the desired concentration Note Preamplification in OpenArray experiments helps to ensure sufficient template copies in the 33 nL qPCR reaction Typically there is not a need to preamplify samples if template in the qPCR reaction is present at gt 100 copies At low template copy number stochastic effects can dominate the reaction because the random events at each template molecule represent a large portion of the potential exten
97. icient PK Mix according to the following table IMPORTANT Prepare the PK Mix just before use Do not place PK Buffer or PK Mix on ice to avoid precipitation Component Volume per well Volume per plate Proteinase K 8 uL 800 uL PK Buffer 192 uL 19 2 mL Total PK Mix 200 uL 20 mL e Invert PK Mix several times to thoroughly mix components then add 200 uL to each well containing a swab IMPORTANT Do not touch the plastic base of the swab with the pipet tips when pipetting the PK Mix in the sample wells T B b Seal the plate with a MicroAmp Clear Adhesive Film Shake the sealed plate for 5 minutes at speed 8 Incubate for 20 45 minutes at 65 C IMPORTANT Arrange samples in the incubator to allow adequate flow around the plate wells to ensure that samples quickly reach and maintain the incubation temperature Pharmacogenomics Experiments User Guide MagMAX DNA Multi Sample Ultra Kit human buccal swabs Instructions 2 Set up the MagMAX Express 96 processing plates While the samples are incubating at 65 C set up the MagMAX Express 96 Wash Elution and Tip Comb Plates outside the instrument as described in the following table Table 1 MagMAX Express 96 processing plates MagMAX Plate ID Plate position Express 96 plate Reagents Volume per well type Wash Plate 1 2 Deep Well Wash Solution 1 150 uL Wash Plate 2 3 Deep Well Wash Solution 2 15
98. in SDSs see the Documentation and Support section in this document Pharmacogenomics Experiments User Guide 114 Chemical safety 115 Appendix G Safety WARNING GENERAL CHEMICAL HANDLING To minimize hazards ensure laboratory personnel read and practice the general safety guidelines for chemical usage storage and waste provided below and consult the relevant SDS for specific precautions and instructions Read and understand the Safety Data Sheets SDSs provided by the chemical manufacturer before you store handle or work with any chemicals or hazardous materials To obtain SDSs see the Documentation and Support section in this document Minimize contact with chemicals Wear appropriate personal protective equipment when handling chemicals for example safety glasses gloves or protective clothing Minimize the inhalation of chemicals Do not leave chemical containers open Use only with adequate ventilation for example fume hood Check regularly for chemical leaks or spills If a leak or spill occurs follow the manufacturer s cleanup procedures as recommended in the SDS Handle chemical wastes in a fume hood Ensure use of primary and secondary waste containers A primary waste container holds the immediate waste A secondary container contains spills or leaks from the primary container Both containers must be compatible with the waste material and meet federal state and local requirements for conta
99. iner storage After emptying a waste container seal it with the cap provided Characterize by analysis if necessary the waste generated by the particular applications reagents and substrates used in your laboratory Ensure that the waste is stored transferred transported and disposed of according to all local state provincial and or national regulations IMPORTANT Radioactive or biohazardous materials may require special handling and disposal limitations may apply Pharmacogenomics Experiments User Guide Appendix G Safety G Biological hazard safety Biological hazard safety A WARNING BIOHAZARD Biological samples such as tissues body fluids infectious agents and blood of humans and other animals have the potential to transmit infectious diseases Follow all applicable local state provincial and or national regulations Wear appropriate protective equipment which includes but is not limited to protective eyewear face shield clothing lab coat and gloves All work should be conducted in properly equipped facilities using the appropriate safety equipment for example physical containment devices Individuals should be trained according to applicable regulatory and company institution requirements before working with potentially infectious materials Read and follow the applicable guidelines and or regulatory requirements in the following In the U S U S Department of Health and Human Services guidelines pub
100. ion 0 e eee eee eee 66 About the OpenArray chemistry protocol Track samples OpenArray plate loading overview This chapter provides summary procedures for performing experiments described in detail in the QuantStudio 12K Flex Real Time PCR System OpenArray Experiments User Guide Pub no 4470935 The QuantStudio 12K Flex Real Time PCR System OpenArray Experiments User Guide contains detailed instructions for performing experiments on the QuantStudio 12K Flex Real Time PCR System using TaqMan OpenArray plates The guide contains a booklet on running the QuantStudio 12K Flex OpenArray Genotyping Starter Kit In addition to describing how to run the starter kit the booklet provides general information about genotyping experiments To load samples into a TaqMan OpenArray plate 1 Pipet the samples into a 96 well reaction plate 2 Transfer the samples from the 96 well reaction plate to an OpenArray 384 Well Sample Plate using an adjustable or fixed pipette 3 Transfer the samples from the OpenArray 384 Well Sample Plate to the TaqMan OpenArray plate using the OpenArray AccuFill System Pharmacogenomics Experiments User Guide 39 Chapter 5 Prepare run and analyze OpenArray PGx experiments Track samples Enter experiment and sample information Export sample information 40 We recommend that you track the samples from the 96 well reaction plates to the 384 well sam
101. ion 1 Calculate the number of reactions based on the number of samples standards Negative Template Control NTC and replicates This can be calculated using the following formula Number of reactions 5 standards 1 NTC no of samples no of replicates x 1 10 overage factor for pipetting error Example calculation for 36 samples and 4 replicates Number of reactions 5 1 36 x 4 x 1 1 185 reactions 2 Prepare the reaction mix by combining reaction components except for genomic DNA in an appropriately sized tube using the following table as example v Volume for Component Volume reaction 185 reactions example 2X TaqMan Genotyping Master Mix 5 UL 925 UL 20X RNase P Primer Probe mix 0 5 uL 92 5 UL Nuclease free Water 2 5 UL 462 5 UL Total 8 0 uL 1480 pL 3 Vortex the tube gently and set aside Pharmacogenomics Experiments User Guide Appendix B Sample quantification using the RNase P Detection Reagents Kit Procedure Prepare the PCR 1 Prepare the plate layout based on the number of samples and replicates See the reaction plate example layout below for 36 test samples with 4 replicates on a 384 well format PCR plate 2 Pipet 8 uL of the reaction mix into the highlighted wells of the reaction plate 3 Carefully aliquot 2 uL of the standards DNA Templates 1 2 3 4 and 5 unknown samples and NTC Nuclease free Water into the appropriate wells 4 Seal the plate with a MicroAmp Optical Adhes
102. ive Film vortex briefly and centrifuge in a plate centrifuge to collect the reaction at the bottom of the wells Setup and run the 1 Start the QuantStudio System software Standard Curve 2 Open a New Experiment and enter the name of the experiment see figure Experiment below 3 Select the appropriate block format 384 Array Card 96 or Fast 96 Pharmacogenomics Experiments User Guide 90 Appendix B Sample quantification using the RNase P Detection Reagents Kit Procedure 4 Select Standard Curve TaqMan Reagents and Standard as highlighted below when using TaqMan Genotyping Master Mix IMPORTANT If the TaqMan Fast Advanced Master Mix is used select the Fast run mode option Fle Edt Instrument Analysis Help Open N Save G Chose SO Import gt amp Print Report Experiment How do you want to identify this experiment E New Experiment Experiment Name TEETH Comments S U Setup Barcode fer Meet tima Define Which block are you using to run the experiment FSF Well Blok Array Card Block 96 Well Block 0 2mL Fast 96 Well Block 0 1mL What type of experiment do you want to set up a Tn LEER Assign Run Method Materials List High Resolution Melt p Genotyping Presence Absence Q C eP en Which reagents do you want to use to detect the target sequence namene T ono Geen ents hl Js What prope
103. ix is recommended for optimal performance with TaqMan SNP Genotyping Assays and TaqMan Copy Number Assays run on 96 or 384 well plates this master mix cannot be used with OpenArray plate Available volumes for TaqMan Genotyping Master Mix 2X anuna 1 Pack one 10 mL bottle 4371355 2 Pack two 10 mL bottles 4381656 Single Bulk Pack one 50 mL bottle 4371357 Multi Bulk Pack two 50 mL bottles 4381657 Pharmacogenomics Experiments User Guide 33 3 Chapter 3 Ordering information Reagents 34 Pharmacogenomics Experiments User Guide Prepare DNA samples This chapter covers recommended procedures for DNA isolation quantification and optional preamplification m Isolate and purify genomic DN A 35 R Quantify DNA samples lt s e e eee eens 35 S Split DNA samples for copy number experiments n n e nar rnrn 36 m Optional Preamplify DNA samples 0 00 c cece eee eee eee 36 Isolate and purify genomic DNA Use the MagMAX DNA Multi Sample Ultra Kit Cat nos A25597 and A25598 for rapid high throughput isolation of high quality genomic DNA from whole blood or buccal swab samples The kit uses MagMAX magnetic bead technology ensuring reproducible recovery of PCR ready DNA suitable for OpenArray analysis Refer to Appendix A on page 79 of this user guide for complete instructions for use of the kit also available at the product web page at www lifetechnologies com s Mag
104. kground User Guide AlleleTyper Software and describes how to and tools for assay prepare translation tables containing genetic content selection pattern information and how to use these Chanter 7 Perform translation tables to map TaqMan SNP t PE B ranslation analysis in Genotyping Assay and or TaqMan Copy Number TN AlleleTyper Software Assay results to any desired nomenclature used by a laboratory or research group MagMAX 96 DNA Multi 4428202 Sample preparation guidance and instruction on Chapter 4 Prepare Sample Kit MagMAX using the MagMAX Express 96 Magnetic samples Express 96 Magnetic Particle Processor Chapter 6 Prepare run Particle Processor and analyze copy Protocol number experiments Creating Standard Curves 4371090 An application note providing detailed Chapter 4 Prepare with Genomic DNA or instructions for quantification using standard samples Plasmid DNA Templates curve analysis for Use in Quantitative PCR Application Note OpenArray Sample 4460657 Instructions for loading samples into a TagMan Chapter 5 Prepare run Tracker Software Quick OpenArray plate and analyze OpenArray Reference Guide PGx experiments Applied Biosystems 4478673 Instructions for calibrating the instrument and Chapter 5 Prepare run QuantStudio 12K Flex Real Time PCR System OpenArray Plate Quick Reference Guide performing gene expression experiments and analyze OpenArray PGx experiments
105. le separately Apply the same sample name to the wells of each technical replicate group Prepare the reactions 1 Calculate the volumes of components that you need based on the reaction volume and the number of reactions Include excess volume in your calculations to provide for the loss that occurs during reagent transfers Note Life Technologies recommends using four replicates of each sample Volume per well Reaction mixture component 384 well 96 well plate plate 2X TaqMan Genotyping Master Mixt 5 0 uL 10 0 uL TaqMan Copy Number Assay 20X working stock 0 5 uL 1 0 uL TaqMan Copy Number Reference Assay 20X 0 5 uL 1 0 uL Nuclease free water 2 0 uL 4 0 uL Total Volume 8 0 pL 16 0 pL TaqMan Gene Expression or TaqMan Universal Master Mixes can also be used but do not use TaqMan Fast Universal Master Mix If you use large scale assays 60X dilute the assays to a 20X working stock 2 Completely thaw the TaqMan Copy Number Assays and the TaqMan Copy Number Reference Assays Gently vortex the assays to mix them then centrifuge the tubes briefly to bring contents to the bottom of the tube 3 Swirl to thoroughly mix the TaqMan Genotyping Master Mix Pharmacogenomics Experiments User Guide 69 6 Chapter 6 Prepare run and analyze copy number experiments Run the reactions 11 12 Run the reactions Combine the required volumes of reaction components in microcentrifuge t
106. lele may cluster with NTCs or may exhibit weak amplification due to probe nonspecific activity If a weakly amplifying sample is called as undetermined manually adjust the call to noamp Pharmacogenomics Experiments User Guide Expected performance and system specifications The following tables provide system specifications Refer to the OpenArray technology on the QuantStudio 12K Flex System Product Bulletin Pub no CO23802 for more detail on performance and specifications Table 12 QuantStudio 12K Flex OpenArray AccuFill System specification Description Specification Fill rate 99 25 Maximum allowable sample carryover lt 1 Maximum allowable assay carryover lt 1 Maximum number of through hole data lt 5 points lost due to evaporation Table 13 QuantStudio 12K Flex TaqMan OpenArray Genotyping Plates Description Specification Assay conversion rate from a 7900HT Real gt 95 t Time PCR system Concordance with assays run on a 7900HT 99 7 t Real Time PCR system Call rate 95 t Number of haploid copies of gDNA through 250 hole TaqMan OpenArray Genotyping Plate 12 capacity per 8 hr day by a single person Time from purified DNA to genotyping data 5 hr Throughput of one technician in one day 110 000 T Individual performance is dependent on the integrity and purity of samples Pharmacogenomics Experiments User Guide 106 D Appendix D Expected pe
107. lished in Biosafety in Microbiological and Biomedical Laboratories found at www cdc gov biosafety Occupational Safety and Health Standards Bloodborne Pathogens 29 CFR 1910 1030 found at www access gpo gov nara cfr waisidx_01 29cfr1910a_01 html Your company s institution s Biosafety Program protocols for working with handling potentially infectious materials Additional information about biohazard guidelines is available at www cdc gov In the EU Check local guidelines and legislation on biohazard and biosafety precaution and refer to the best practices published in the World Health Organization WHO Laboratory Biosafety Manual third edition found at www who int csr resources publications biosafety WHO_CDS_CSR_LYO_2004_11 en Pharmacogenomics Experiments User Guide 116 G Appendix G Safety Biological hazard safety 117 Pharmacogenomics Experiments User Guide Related documentation Documentation and support The following related documents provide details supporting the PGx workflow Related Document Pub no Description PGx Chapter s TaqMan Drug 135AP01 01 An annotated application note that provides Chapter 2 Background Metabolism Genotyping details on manual analysis of triallelic SNPs and tools for assay Assays for Triallelic SNPs using 2 DME SNP assays content selection Application Note AlleleTyper Software 4469874 Provides reference information for the use of Chapter 2 Bac
108. llele groups have been identified by the Cytochrome P450 Nomenclature Committee http www cypalleles ki se At least 4 of these groups give rise to alleles with substrate dependent reduced enzyme activity and more than 20 do not encode functional enzymes The CYP2D6 alleles are composed of SNP and InDel variants CNVs and hybrid alleles formed by recombination between CYP2D6 and highly related upstream pseudogene CYP2D7 sequences Individuals may carry null alleles 5 or extra copies of CYP2D6 1 2 4 9 10 17 35 Some CYP2D6 alleles contain sequences derived from the highly homologous CYP2D7 pseudogene e g CYP2D6 36 as well as 4N and 83 contains a gene conversion to CYP2D7 sequences in exon 9 associated with negligible CYP2D6 enzyme activity and poor metabolizer phenotype Gaedigk et al 2006 Three different copy number assays to CYP2D6 sequences are available for determining CYP2D6 gene copy number and to aid identification of some hybrid alleles see DME genes and copy number variation on page 20 e Hs00010001_cn specifically targets CYP2D6 exon 9 sequences and it will not amplify CYP2D7 or CYP2D8 pseudogenes or CYP2D6 CYP2D7 hybrid alleles carrying CYP2D7 exon 9 sequences e g CYP2D6 36 e Hs04083572_cn specifically targets CYP2D6 intron 2 sequences and Hs04502391_cn specifically targets CYP2D6 intron 6 sequences These assays will not amplify pseudogenes but they will amplify CYP2D6 CYP2D7 hybrid alleles ca
109. lysis settings in the QuantStudio 12K Flex Software 0000 cece e cece eee ees 47 AN ALYSIS SEtU Decne ad wed REAT cathe el s aid AR oe ed ee al ce angie tne ad 47 Transfer files toa user computer 00000 0c rnrn rnnr rnrn eee nents eees 51 Transfer files from QuantStudio 12K Flex Software without a network connection 51 Transfer files from QuantStudio 12K Flex Software with a network connection 51 Perform analysis in TaqMan Genotyper Software 0 0 cc cece cece rr nee neces 51 Create a study in TaqMan Genotyper Software 0 0 ccc cece cece rnrn 51 Import experiments into the study 00 00 c eee eee eee eee eeee 53 Import assay information files 0000 eee eee eee eee ee es 53 Add controlide ntitiers c0 kittie ed ae ed pa ed ee et one ed 34 Impact of analysis settings 000 eee eee eee eee eens 56 Set the QG settings rssi RR Sd ea bid ceed Meade eae 57 Export analysis data 1 rR X oe 9 aa a Gaels K Pade Passe EAR K bade des ZRA LA ead 59 Optional Generate and import a reference panel 0 00 cece cece cence nce eens 60 About reference panel files and reference samples cece eee ee ee eees 60 Generate a reference panel file 0000 ccc eee eee aee 60 Import the reference panel HG 00 ccc eee eee teen eee ees 63 Optional Delete a reference panel Tile 63 Assays that require manual genotype calls 0 unnan rnane nrnna 64 Special ci
110. ments User Guide 94 Appendix B Sample quantification using the RNase P Detection Reagents Kit Procedure 2 In the Cy Settings tab uncheck both the Default Settings and Automatic Threshold boxes that are in the lower right portion of the window Set the Threshold value to 0 1 Be sure that the Auto Baseline box is checked Then click Apply Analysis Settings i Analysis Settings for 2014 06 02 Experiment Name Example t Use Default Settings then 7 Select the step and stage to use for Ct analysis Only stage step combinations for which data suitable for Ct analysis have Select the algorithm to calculate Cr been collected are displayed x Baseline Threshold w Stage 2 Step 2 v i Default Cr Settings Default Cr settings are used to calculate the Cr for targets without custom settings To edit the default settings dick Edit Default Settings Threshold AUTO Baseline Start Cycle AUTO Baseline End Cycle AUTO 1121 ETI G Cr Settings for RnaseP _ Threshold Baseline Start Baseline End Cr Settings to Use F Default Settings 0 1 AUTO AUTO E Automatic Threshold Threshold O 7 Automatic Baseline Baseline Start Cyde 3 54 End Cyde 151 Save to Library Load from Library Revert to Default Analysis Settings Apply Analysis Settings 95 Pharmacogenomics Experiments User Guide Appendix B Sample quantification using the RNase P Detection Reagents Kit
111. mozygous allele Occasionally clusters will show some splitting with the samples containing less target running closer to the NTCs and those with more target having more signal but this is rare e Ifa sample carries more than 2 copies of a gene and both SNP alleles are present it will fall within the heterozygous cluster or occasionally to one side or the other of it i e the heterozygous cluster may exhibit some spreading If a sample close to the heterozygous cluster has been called as undetermined manually adjust the call to heterozygous Pharmacogenomics Experiments User Guide Chapter 5 Prepare run and analyze OpenArray PGx experiments 5 Assays that require manual genotype calls TaqMan DME genotyping assays to triallelic SNPs and adjacent SNP targets As detailed in Chapter 2 triallelic SNP and adjacent SNP targets can be interrogated using a pair of TaqMan assays For triallelic SNPs each assay contains one probe for the major SNP allele which is labeled with the same reporter dye in both assays e g VIC dye and one probe for one of the minor alleles which is labeled with the second reporter dye e g FAM dye After running paired assays for triallelic SNPs in separate reactions on the same genomic DNA samples the results of the 2 assays are compared to determine the sample genotype For a given assay e Samples that are heterozygous for the alleles detected by an assay will run as heterozygous e Samples ru
112. mples Life Technologies recommends using MagMax purified samples for both OpenArray and Copy Number Variation experiments See Chapter 4 Prepare samples on page 35 High quality quantified sample DNA stocks of 5 ng uL are recommended for copy number experiments see Split samples for copy number experiments on page 44 e Use 10 ng DNA in 10 uL reactions on 384 well plates e Use 20 ng DNA in 10 uL reactions on 96 well plates IMPORTANT You must use the same amount of gDNA for each sample and for each sample replicate that is run with the same assay Experimental setup conditions Sample types to be run on each plate Template replicates Number of samples run per plate 68 e Samples or Unknowns gDNA samples in which the copy number of the target is unknown e No Template Control NTC A sample that does not contain a DNA template It shows the background fluorescence and allows for the detection of contamination e Calibrator sample A DNA sample with a known copy number for the target of interest Also known as the reference sample To generate the reliable copy number calls Life Technologies strongly recommends using four replicates for each gDNA sample If CopyCaller Software is used for copy number analysis recommended quality metrics including confidence values will be calculated when at least 7 samples of the same copy number group are present on the plate If fewer than 7 samples of th
113. nces when the adjacent SNP is present However when the adjacent SNPs are present in only 3 haplotypes these SNPs can be interrogated similarly to triallelic SNPs using two assays see TaqMan DME Assays for genotyping triallelic SNPs on page 23 Life Technologies currently provides assay sets to two highly studied SNPs that have an adjacent less frequently detected SNP In each case the minor alleles of each SNP are not found together in the same haplotype The assays and targets are shown in Table 4 Assays and targets Gene SNP ID TaqMan DME assay Allele name CYP2C19 rs4244285 C__25986767_70 CYP2C19 2 681G gt A rs6413438 C 20624128 10 CYP2C19 10 c 680C gt T CYP2C9 rs1057910 C__27104892_10 CYP2C9 3 c 1075A gt C rs 6165452 C 20624121 20 CYP2C9 4 c 1076T gt C Example CYP2C19 2 10 adjacent SNP assays Only 3 haplotypes have been observed for the CYP2C19 2 and 10 SNPs http www cypalleles ki se cyp2c19 htm the rare 10 c 680T allele and the 2 c 681A do not occur on the same chromosome Thus these adjacent SNPs can be analyzed similarly as for triallelic SNPs When the 2 assay is run on a sample containing a 10 allele the probes will fail to detect the 10 containing allele the converse is true when the 10 assay is run on a sample containing a 2 allele Below are shown the context sequences for each assay After running paired assays for adjacent SNPs in separate reactions on the same gDNA sam
114. nd below and overrides any control identifiers tasks that may have been set in the original experiment file If a sample ID does not match a control identifier the software assumes the sample is an Unknown s Deselected The software uses the control identifiers tasks that were set in the original experiment file 4 In the Study Level Settings pane enter the sample IDs to use as controls for all assays in the study Use a comma to separate multiple control identifiers Note The Study Level Settings apply to all assays in the study 5 In the Assay Specific Settings pane enter the sample IDs to use as controls for individual assays in the study Use a comma to separate multiple control identifiers Note By default the Assay Specific Settings are the same as the Study Level Settings If you modify the Assay Specific Settings your changes apply only to the selected assay and override the Study Level Settings for the selected assay If needed click the Reset symbol to reset the assay s settings to the Study Level Settings 6 Click Apply to save the changes The Analysis Settings dialog box with Control Identifiers window is shown below Note When experiments are added to a study assay IDs are automatically populated in this window Assay names can be added by importing an assay information file to which an Assay Names column has been added 3 ldd ee x pme E i rn pa
115. nd start the run by clicking the green Start Run button 93 Pharmacogenomics Experiments User Guide Appendix B Sample quantification using the RNase P Detection Reagents Kit Procedure Analyze and Export 1 After the run is complete select the Analysis tab from the left pane and then click the Results the blue Analysis Settings button in the upper right corner to activate the Analysis Settings window Fie Edit Instrument Analysis Tools Help Open i Save 2 Chose X Import 4 Create Side E Print Report E New Experiment lt Experiment e rss Analysis Settings 2 Plot Type ARn vs Cycle lt Graph Type Log E Save current settings as the defaut lt Plot Color Well D ba K a B BARR Rh A c Amplification Plot D 1 01 kd mm 1 00 La alysis o Z 7 5 k tion Plot Ken HL HEFE ee linin 4 4464 Standard Curve eat gt gt gt ss Se ee L Cycle 1 ugo aana MA Mic Mic Mp Mc Br Mic MH ary 9 SI BI BL RL Bu Bu RO R B 1 Raw Data Plot M N QC Summary Target Target 1 Threshold 7 Auto 0 2 Auto Baseline o P Multiple Plots View Show J Threshold F Baseline Start Well Target amp Baseline End Well Target wels I 39 B 1 Qo 344 Empty 4 Well Summary In Plate 384 Sat Up 0 Analyzed 0 Flagged 0 Omitted by Analysis 0 Omitted Manually 0 Samples Used 0 Targets Used 0 Pharmacogenomics Experi
116. nde RR Ae 98 Case leaks and bubbles a cR sacs ed deed nie breed a AE E bance ne eee R aoe 99 Sample plate preparation errors 0 0 cece cece cette eee ete eet ee eeee 100 ACCUEIL loading errors aed cx heme ead Gace K 9 20 Anal ae N d R aoe a aA 4G 101 Entire subarrays MISSING 2 KR R riaa RR a R E KRK g eee K K eee R K 102 OpenArray plate assembly and handling errors 0 cc cece ccc nrnna rnnr 102 Sample blow out during the addition of Immersion uid 102 Evaporation of reaction mixture 020 cece cece eee ee eaee 103 Stability of assembled OpenArray plates n n nnan ccc cece cece eee eens 103 Insufficient sample input 000 c ccc eee eee eens 104 Using QuantStudio 12K Flex Software to troubleshoot and make genotyping calls 104 Expected versus unexpected no amps and undetermined calls ee eee 105 TaqMan DME genotyping assays to genes in copy number variation regions 105 TaqMan DME genotyping assays to triallelic SNPs and adjacent SNP targets 105 APPENDIX D Expected performance and system specifications 106 APPENDIX E Genotyping and copy number controls ee e ed wet aa ea ve he eee ad 5 108 OVENVIEW initia erin ee el Si ate teal ae eee E een ae eae 108 Cell line gDNA Controls 2 s c 5 oc negiees Sug acines Segue Pee RAR e ARR RA eee he 108 TaqMan Drug Metabolism Genotyping Assays test data 0 cece eee eee 10
117. ngs can be used to assess both the concentration and the quality of the sample Conventionally 50 ng L DNA stock solutions are recommended for OpenArray genotyping experiments and A260 A2g0 ratios should be approximately 1 8 2 0 If samples are of low concentration lt 10 ng uL or contain PCR inhibitors samples may fail to amplify may fail to cluster properly and in the worst case scenario may provide incorrect genotypes e g apparent loss of heterozygosity if only one chromosomal copy is predominantly amplified and a heterozygous sample clusters within a homozygous cluster If sample preparations perform poorly on the OpenArray platform with a number of assays we recommend preamplifying samples see Optional Preamplify DNA samples which can serve both to generate higher concentrations of target amplicons and to dilute PCR inhibitors Split DNA samples for copy number experiments Reserve a portion of DNA from the MagMAX preparation for the TaqMan Copy Number Assay workflow Dilute the samples to a suitable working concentration the recommendation is 5 ng uL for each sample The required input for each 10 uL PCR is 10 ng of DNA Additionally each sample must be run in quadruplicate for each copy number assay For example if you are running 5 copy number assays prepare at least of assays x Vol of 5 ng uL DNA per 10 uL reaction x of replicates x 120 for dead volume 5 Assays x 2 uL x 4 repli
118. nning in or near a homozygous cluster can be either a true homozygote for the reported allele or can be a heterozygous for a reported allele and for the unreported SNP allele of a given assay Samples having just one reported allele may run together with or close to those carrying two reported homozygous alleles If a sample close to a homozygous cluster is called as undetermined manually change the call to homozygous e Samples that are homozygous for the unreported allele may cluster with NTCs or may exhibit weak amplification due to probe nonspecific activity If a weakly amplifying sample is called as undetermined manually adjust the call to noamp The TaqMan Genotyper Software results can be exported and files imported into AlleleTyper for translation using a biallelic translation specific for the triallelic SNP assay pair If AlleleTyper is not used for translation analysis use the method exemplified in the table below to manually determine the sample genotypes The example translation table is for the ABCB1 c 3095G gt T A triallelic SNP 1s2032582 assays If AlleleTyper is not used for translation analysis use the method exemplified in the table below to manually determine the sample genotypes Note that the alleles reported by the ABCB1 SNP assays are given in the plus strand genome orientation whereas the ABCB1 gene maps to the minus genome strand Thus the reported SNP assay alleles and the SNP cDNA annotations are the
119. o analyze the data for such assays As detailed in Chapter 5 some DME Assays target polymorphisms in genes that exhibit Copy Number Variation Copy number variation analysis must be done in addition to genotyping with DME assays e If both copies of a gene are deleted in a sample copy number of 0 samples will not be amplified and will run near or with the NTCs e Ifasample carries more than 2 copies of a gene and both SNP alleles are present it will fall within the heterozygous cluster or occasionally to one side or the other of it in which case it may be called as undetermined These should be manually called as heterozygous for data analysis purposes As detailed in Chapter 5 Prepare run and analyze OpenArray PGx experiments triallelic SNP and adjacent SNP targets can be interrogated using a pair of TaqMan SNP assays Each assay contains one probe for the major SNP allele or haplotype and one probe for one of the minor alleles or haplotypes After running paired assays in separate reactions on the same genomic DNA samples the results of the 2 assays are compared to determine the sample genotype For a given assay it is expected that e Samples having just one reported allele may run close to or within a homozygous cluster Any samples running close to homozygous clusters that are called as undetermined should be manually called as homozygous for data analysis purposes e Samples that are homozygous for the unreported al
120. omb in a MagMAX Express 96 Deep Well Plate 1 2 Position on the instrument The instrument prompts the user to add DNA Elution Buffer 2 to the E Wash the beads and elute the DNA on page 3 ution Plate after incubation with DNA Elution Buffer 1 Add Multi Sample DNA Lysis Buffer Bead RNase Mix and isopropanol n p Optional At the end of the 65 C incubation briefly centrifuge the PK Plate for 1 2 minutes at 1500 x g if condensation is present Add 200 uL of Multi Sample DNA Lysis Buffer to each sample Seal the PK Plate with the MicroAmp Clear Adhesive Film and shake for 5 minutes at speed 8 Prepare Bead RNase Mix according to the following table IMPORTANT Prepare the Bead RNase Mix up to 20 minutes before use Prolonged storage at room temperature can reduce its efficiency Vortex the DNA Binding beads at moderate speed to form a uniform suspension before pipetting Component Volume per well Volume per plate DNA Binding Beads 16 UL 1 6 mL RNase A 5 UL 500 pL Nuclease free Water 19 uL 1 9 mL Total Bead RNase Mix 40 uL 4mL Vortex the Bead RNase Mix at moderate speed to ensure thorough mixing then add 40 uL to each sample and pipet up and down 5 times using a multi channel micropipettor Seal the PK Plate with the MicroAmp Clear Adhesive Film and shake for 5 minutes at speed 8 Add 240 uL of isopropanol to each sample and proceed immediately
121. on about the study for example observations about the data reasons why you made specific decisions and so on After you click Add the comment is permanently recorded in the study that is the comment cannot be modified or removed and the comment is included in any audit trails that are exported for the study Note You can enter comments at any time You may prefer to enter comments after viewing and analyzing the data The Properties screen after study creation is shown below uu TaqMan Genotyper Software Version 1 3 File Edit Analysis Tools Help N g Setup Experiments Assays Samples References C Save Sie Close gt Ba Analysis Settings 2 Help E Study Properties Study Name Example1 Experiment Type Real time Study Contents History Summary Created by GUEST Last Modified Date Last Modified by Template Information Instrument Type QuantStudio 12K Flex Real Time PCR System Number of Experiments in Study Number of Assays in Study Number of Samples in Study Number of Reference Samples in Study Creation Date 12 09 2013 09 26 06 PST Template File Name Originating Study Name Template Creation Date Template Created by User ID Software Version Number Description Example Study Comments Add eee lt 52 Pharmacogenomics Experiments User Guide Chapter 5 Prepare run and analyze OpenArray PGx
122. opy number 21 CopyCaller Software calculates confidence and absolute z score values for each sample set that has a non zero predicted copy number value and sufficient data for the estimation Note The software cannot calculate the confidence and absolute z score values for sample sets that have fewer than seven samples of a single copy number because the algorithm requires a minimum number of data points Pharmacogenomics Experiments User Guide 73 74 Chapter 6 Prepare run and analyze copy number experiments Analyze results using CopyCaller Software e Under optimal experimental conditions where samples are of high quality copy number and reference assays have amplified and sample replicates have similar Cr and ACy values Samples that have low copy numbers 1 2 or 3 commonly have confidence values greater than 95 As copy numbers increase confidence progressively decreases due to the decreased separation of ACy subdistribution values of copy numbers Review samples that have confidence values greater than 95 Samples that have high confidence values can sometimes deviate significantly from the mean copy number for the copy number subdistribution For sample copy number calls with confidence values greater than 95 look at the absolute z scores then consider accepting or rejecting the copy number call based on the following Z Scorel Status lt 1 75 Pass 2 69 gt z gt 1 75 Pass with ca
123. or a potential problem exists with the associated test sample or calibrator sample Review the copy number range bars for each sample Large bars may indicate that the technical replicates of the associated sample exhibit a broad range of ACy values possibly indicating that sample data quality is suboptimal Note The copy number range of replicates is frequently larger for samples that have high target copy numbers gt 3 as a result of their smaller ACy values Review the Results Table e Examine the confidence values and absolute z score values to assess the reliability of each copy number call Review samples having a predicted copy number of Undetermined which occurs if the reference assay did not amplify sufficiently indicating low sample quantity or quality A sample is Undetermined if CopyCaller Software cannot analyze the sample because the Reference assay did not amplify sufficiently possibly indicating low sample quality Replicate data for a sample were conflicting Review samples having a predicted copy number of 0 zero copy samples Zero copy samples produce reference assay amplification passing VIC dye and weak or nonexistent target amplification CopyCaller Software cannot calculate confidence values for zero copy number samples However samples that produce no FAM signal are by definition high confidence calls because no target DNA was amplified Review samples having a predicted c
124. ories at http ccr coriell org Please note that the genotypes of these samples were for the most part not verified by sequence analysis Another source of DME assay control samples is the rsSNP submissions in the NCBI database of Short Genetic Variations dbSNP at http www ncbi nlm nih gov SNP One can search by rsSNP to navigate to specific rsSNP pages that may have genotype information listed in the Population Diversity table Submissions from sources such as the HapMap project used Coriell samples the sample genotypes may be found by clicking on the submission ss to navigate to the submission details page For HapMap samples the sample genotypes may also be found at the HapMap web site http hapmap ncbi nlm nih gov Clinical Laboratory Improvement Amendments CLIA http wwwn cdc gov clia Resources GETRM default aspx The Centers for Disease Control and Prevention CDC provides genetic information on cell line DNAs that can be used as reference materials for genetic testing and assay validation Some of these cell lines were characterized by the Genetic Testing Reference Materials Coordination Program GeT RM One major focus category is the Genetic Inherited Disease amp Pharmacogenetics section Tables of reference samples that contain PGx DME or disease allele variants many of which have been confirmed by multiple labs and genetic testing technologies can be downloaded from this site http wwwn cdc gov clia Resources
125. ormance_Strong03_Assays9 16_AD_MM sds 43038257 8 47 384 03 05 2010 13 52 21 EST Samples References Im port assay The assay information file that you can download from the web at information files www lifetechnologies com OA plate contains important information including the assay IDs context sequence containing the SNP alleles and their association with reporter dyes NCBI SNP reference IDs and gene names This assay information can be imported into TaqMan Genotyper software The SNP alleles will then be reported by the software otherwise the alleles will be reported as VIC and FAM alleles 1 In the Workflow Menu pane select Setup gt Assays to open the Assays screen 2 Click Import browse to and select the assay information file of interest then click Import IMPORTANT The assay information file must include an assay ID in the Assay ID column for each assay listed in the file The software matches the assay IDs in the file with the existing assay IDs in the study 3 Ifthe assay information file contains information for an assay ID that is already in the study the software prompts you to ignore the new information replace the existing information or cancel the import Click the appropriate option Pharmacogenomics Experiments User Guide 53 5 Chapter 5 Prepare run and analyze OpenArray PGx experiments Perform analysis in TagMan Genotyper Software 4 View the imported assay information in the A
126. orough mixing without splashing e Per plate volumes for reagent mixes are sufficient for one 96 well plate plus overage To calculate volumes for other sample numbers refer to the per well volume and add 5 overage s If the DNA yield is lower than expected extend the Proteinase K digestion time to 45 minutes If needed download the KingFisher Flex program The program required for this protocol is not pre installed on the KingFisher Flex Magnetic Particle Processor 1 On the MagMAX DNA Multi Sample Ultra Kit web page scroll down to the Product Literature section 2 Right click A25597_Blood_Buccal and select Save as Target to download to your computer 3 Refer to Thermo Scientific KingFisher Flex User Manual Cat no N07669 and BindIt Software User Manual Cat no N07974 for instructions for installing the program on the instrument Before first use of the kit prepare Wash Solutions Prepare the Wash Solutions from the concentrates e Add 25 mL of isopropanol to Wash Solution 1 Concentrate mix and store at room temperature e Add 132 mL of ethanol to Wash Solution 2 Concentrate mix and store at room temperature Proteinase K b Prepare sufficient PK Mix according to the following table IMPORTANT Prepare the PK Mix just before use Do not place PK Buffer or PK Mix on ice to avoid precipitation Component Volume per well Volume per plate Proteinase K 8 uL 800 uL PK Buffer 192 uL 1
127. ot to view the genotype calls by color It can be difficult for the secondary analysis software TaqMan Genotyper Software to make distinct genotype calls for assays with merging clusters see example below In these cases the end point cycle number can be manually adjusted to an earlier cycle using the Reveal Traces scroll bar so that the clusters will have a greater degree of separation Pharmacogenomics Experiments User Guide Chapter 5 Prepare run and analyze OpenArray PGx experiments 5 Analysis settings in the QuantStudio 12K Flex Software Plot Type HP Change call Deu ES w E G 300 0 800 0 1300 0 1800 0 2300 0 2800 0 Allele 1 Reveal Traces Show Cycle 40 Save the run after all adjustments are made Take note of the cycle number for each assay that has been adjusted These numbers can later be entered into the TaqMan Genotyper Software Note A lower call cycle presently does not transfer to the TagMan Genotyper Software TaqMan Genotyper Software will re set the cycle number to 50 cycles Set up a separate study with the lower cycle number If you click the QC Summary tab in the analysis section on the left hand side of the software as shown below then you can view the QC flags for the run Pharmacogenomics Experiments User Guide 49 5 Chapter 5 Prepare run and analyze OpenArray PGx experiments Analysis settings in the QuantStudio 12K Flex Software DB QuantStudio
128. ow Analyze the experiment Pharmacogenomics Experiments User Guide Chapter 6 Prepare run and analyze copy number experiments Analyze results using CopyCaller Software 4 Review the analyzed data and troubleshoot any flags or problematic data Verify that the amplification curves for the e Reference Assay VIC dye signal in all samples have a distinct linear amplification phase s Copy Number Assay FAM dye signal in most wells have a distinct linear amplification phase Note Samples that contain zero copies of the target of interest do not amplify well if at all with the copy number assay Such samples have high or undetermined FAM Crs e Review any displayed quality check QC flags then review the real time data of the associated samples For information on troubleshooting problematic real time data see Appendix C Troubleshooting on page 98 or refer to the User Guide or Getting Started Guides for your Real Time PCR System Export the results After you use the Real Time PCR System software to analyze each TaqMan Copy Number Assay experiment export experiment results to one or more exported real time PCR files Use the tab delimited txt format if using CopyCaller Software for downstream copy number analysis recommended Analyze results using CopyCaller Software About CopyCalle r CopyCaller Software performs relative quantitation analysis of genomic DNA targets Software using t
129. owse Experiment File Location Experiment File Name EE For additional information about genotyping experiments refer to Booklet 2 QuantStudio 12K Flex OpenArray Genotyping Starter Kit in Applied Biosystems QuantStudio 12K Flex Real Time PCR System OpenArray Experiments User Guide Pub no 4470935 This document provides information about genotyping experiments in general in addition to describing how to run the starter kit Analysis settings in the QuantStudio 12K Flex Software Analysis setup After the run has completed click the analysis settings button In the analysis settings window there will be a data analysis settings portion near the top of the window as shown below Data Analysis Settings Analyze Data from Post PCR Read Only Analyze Data from Pre PCR Read and Post PCR Read Analyze Real Time Rn Data gt Each of the analysis settings is described in Pharmacogenomics Experiments User Guide 47 5 Chapter 5 Prepare run and analyze OpenArray PGx experiments Analysis settings in the QuantStudio 12K Flex Software Table 9 Analysis settings Analysis type Explanation Post PCR Select if you do NOT want to use data from the pre PCR read to determine genotyping calls just the post read data will be used Pre PCR and Post PCR Select if you included the pre PCR read in the run and you want to use the data to do a post read minus pre r
130. pare the individual preamplification reactions in a 96 well reaction plate For each individual genomic DNA sample combine the reaction reagents as described in the table below PreAmp Master Mix and OpenArray PreAmp Pool can be prepared as a single cocktail and distributed to the plate in 3 75 uL aliquots These volumes can be increased 2 fold It is convenient to use plates with well volumes that can accommodate a 20X larger volume than the reaction for the 20 fold dilution step after preamplification Reagent Stock conc Final conc Volume TaqMan PreAmp Master Mix 2X 1X 2 5 UL OpenArray PreAmp Pool 4X 0 20X each assay 1X 0 05X each assay 1 25 uL Genomic DNA Sample 0 4 ng L to 4 ng pL 0 1 ng L to 1 ng L 1 25 uL 150 1500 copies Total 5 0 uL Pharmacogenomics Experiments User Guide 37 38 Chapter 4 Prepare DNA samples Optional Preamplify DNA samples 2 Firmly seal the reaction plate with a MicroAmp Clear Adhesive Film 3 Vortex the reaction plate for 10 seconds and spin briefly 4 Run the preamplification cycling program on a GeneAmp 9700 PCR System silver or gold block or Veriti Thermal Cycler using the following temperature and time settings The number of cycles can range from 10 to 14 Stage Step Temp Time Hold Activate 95 C 10 min Cycling 10 14 cycles Denature 95 C 15 sec Anneal Extend 60 C 4 min Hold Inactivate 99 9 C 10 min Hold 4 C up to 1 h or overnig
131. pe Targets Filled Invalid Empty Test Panel TagMan OpenArray Genotyping o o Click to select assays Click amp drag to move assays Ciri C i Display Assay Target S 183211371 9 Sub Array 1841303343 RA 189923231 Invalid 1810264272 139030862 Empty 137294 1812248560 1328399499 137900194 1356397013 134986893 13776746 15762551 Array Configurator x N J gt G M wwilifetechnologies com order custom array summary PRATT RAF Back To Array Configurator Unique Array name Array ID Array type Targets Filled Invalid Empty TagMan OpenArray Genotyping G ooo Test Panel PB76MUA Plates Save Your Array Save A Copy Hooray Your design is almost complete Please fill out the following fields if applicable Remember to review your plate for any warnings or errors and then click Add to Cart above Array Qty 10 packs Description Instrument QuantStudio 12K Flex Real Time PCR System Array Layout L 1 2 3 4 5 6 ff 8 C__30634242_40 C__32287188_10 C__30403261_20 C__30203950_10 C__27531552_A0 C__7473918 10 C___469857_10 C__60732926_20 183211371 1841303343 189923231 1810264272 183030862 137294 1312248560 1528399499 C_25625A04D_20_C__27AR1810 10 C__27861809_10 C_26201809_30 C__ 8881221 40 C__8303531_40 C__1492134_10 C__29057362_10 javascriptvoid O a 4 a 30 Pharmacogenomics Experiments User Guide Chapter 3 Ordering information 3 Order single tube TaqMan Assays
132. ple plates using the OpenArray Sample Tracker Software Note This section provides brief procedures for using the OpenArray Sample Tracker Software For detailed procedures refer to the OpenArray Sample Tracker Software Quick Reference Guide Pub no 4460657 In the Sample Tracker Software Properties window enter general information about your experiment 1 From the drop down lists make the following selections Drop down list Selection Experiment type Genotyping OpenArray Plate The appropriate TaqMan OpenArray plate format Pipettor Appropriate pipettor Fixed or Adjustable 2 If you have added a serial number or barcode to the OpenArray 384 Well Sample Plate enter the serial number or scan the barcode using a barcode reader 3 Manually enter sample information from the 96 well reaction plates into the OpenArray Sample Tracker Software or import a csv file as described in the OpenArray Sample Tracker Software Quick Reference Guide Pub no 4460657 4 Go to the sample mapping section on the software to begin the export process The OpenArray Sample Tracker Software automatically maps the sample locations from the 96 well reaction plates to the appropriate locations in the 384 well sample plates and TaqMan OpenArray plates Next export sample information in preparation for setting up plates with QuantStudio OpenArray AccuFill Software see Load samples using the OpenArr
133. ples examine the cluster plots in TaqMan Genotyper Software Sample calls may need to be adjusted and the results of each assay compared to determine the true sample genotype as detailed on page 64 CYP2C19 2 c 681G gt A C__25986767_70 TTCCCACTATCATTGATTATTTCCc A G GGAACCCATAACAAATTACTTAAAA CYP2C19 10 c 680 C gt T C__ 30634128 10 TTTCCCACTATCATTGATTATTTCC C T gGGAACCCATAACAAATTACTTAAA 10 2 TTTTCCCACTATCATTGATTATTTCC C T G A GGAACCCATAACAAATTACTTAAA Gender specific assays can be included in PGx studies to aid sample tracking The TaqMan SNP Genotyping Assay C_990000001_10 targets a gender specific polymorphic region in the amelogenin gene that is commonly used in forensic sex determination tests A 6 base deletion occurs in the X specific amelogenin gene which is detected by the VIC dye probe whereas the FAM dye probe detects Y chromosome sequences In genotyping experiments male samples will run in the heterozygous cluster position and female samples will run in the VIC homozygote Pharmacogenomics Experiments User Guide Clinical research targets Unavailable DME and clinical research targets Custom TaqMan SNP Assays Chapter 2 Background and tools for assay content selection J Special assay considerations cluster Note that some males lack the Y specific amelogenin gene and they will type as female Thus the C_990000001_10 assay should be run in combination with a Y chromosome assay to id
134. r Software data files AlleleTyper Software then matches the sample genetic pattern data to patterns in the biallelic translator and reports back the designated nomenclature for each matching pattern on a gene by gene basis when a multigene translator is used Pharmacogenomics Experiments User Guide 77 7 Chapter 7 Perform translation analysis in AlleleTyper Software Sources of PGx translation information and example translation tables Sources of PGx translation information and example translation tables 78 Life Technologies provides example AlleleTyper Software translation table template files and translation tables including monoallelic and biallelic tables single gene and multigene translators for commonly tested drug metabolism gene variants These can be downloaded from the AlleleTyper Software web page on www lifetechnologies com pgx and used as templates for creating translators specific to your TaqMan Assays panel The PharmGKB website www pharmgkb org provides comprehensive haplotype translation tables for CYP gene variants found in the Human Cytochrome P450 CYP Allele Nomenclature Database www cypalleles ki se as well as for other drug metabolism gene variants These can be used as reference tables for creating AlleleTyper Software translation tables The translation tables provided by both Life Technologies and PharmGKB use the convention whereby the variant alleles are provided in the strand o
135. rcumstance SNP and DME genotyping assays cece eee eee 64 Pharmacogenomics Experiments User Guide Contents Optional Single tube reintegration 0 cece cece ence een tence rnrn 66 S CHAPTER 6 Prepare run and analyze copy number experiments 67 Introduction to copy number analysis 0000 c cece eect cette eeees 67 How the assays Work 2 20 cect eee eee eee raara 67 Prepare the reaction plates cece ene ene eee eeeees 68 Experimental setup conditions 000 cece eee eee ee eee e eee eeees 68 Sample types to be run on each plate 0 00 cece eect tte eens 68 Ternplate replicates vra een neg A edie ty eed de nod Mage HERS Rea eth ce ee 68 Number of samples run per plate 000 cece eee eee eee eee 68 Set up the instrument software 0 c cece eee eee eee ete tte eee eee 69 Prepare the reaction s lt aL enade wert eet de et eked aa dee T AR RR wees N 69 Ramine TeaChONS tars ics cae LER EEE s Rabie Vie soi Cacia Saal E S 70 RUM the ALETE PEE E A AM it Mt een Te eee Nt A leh 70 Analyze and export result 70 Analyze the results 70 Exportithe Pesults erse wages oxic janine ae Biles Balad RESE eee ee eaten cee 71 Analyze results using CopyCaller Software ccc ccc ccc e nc rnrn rnrn rnrn rnrn 71 About CopyCaller Software 0 cc ccc cc ccc nce n nee nee et eennees 71 Perform copy number analysis 0000 00 e eee eee eee eee eee e nena 71 REVIEW resullS sessin eied eie edie nadine eave wit E
136. red directly from the Life Technologies website For information on ordering an OpenArray Preamp Pool please contact your Life Technologies sales representative Procedure Guidelines for DNA sample concentration Genomic DNA samples at a concentration up to 25 ng uL may be preamplified without dilution but the ideal range is 0 4 ng uL to 4 0 ng uL DNA with concentrations outside this range may work but DNA samples at a concentration gt 30 ng L may fail to amplify well because of the presence of PCR inhibitors High concentration DNA samples may yield good results after dilution The preamplification protocol was developed using genomic DNA samples within a starting concentration range of 0 4 ng uL to 4 0 ng uL gives 0 5 ng to 5 ng total in the preamplification reaction 1 ng of human genomic DNA 300 genomic copies 150 copies of each allele ina heterozygote Preamplification of DNA at concentrations lt 0 4 ng uL is not recommended due to the potential for stochastic events arising from low target number in the early rounds of the preamplification and qPCR reactions Optimal performance will be achieved if the starting concentration of genomic DNA samples is near the middle of the working range 2 5 ng uL Refer to Appendix B Sample quantification using the RNase P Detection Reagents Kit on page 88 for a recommended protocol to accurately quantify your genomic DNA samples Perform the preamplification 1 Pre
137. reverse complement of one another Table 10 Translation table for the ABCB1 c 3095G gt T A triallelic SNP rs2032582 assays C A assay C T assay Genotype c 3095G gt T A893T c 3095G gt A A893S ABCB1 c 3095G gt T A C_11711720C_30 C_11711720D_40 G G C C C C G A C C C T A A No amp T T G T C A C C T A A A T T T T A A No amp Pharmacogenomics Experiments User Guide 65 5 Chapter 5 Prepare run and analyze OpenArray PGx experiments Optional Single tube reintegration Similarly pairs of assays are available for some adjacent SNP targets for which only 3 haplotypes are noted For a given assay to one SNP allele e Samples that are heterozygous for the haplotypes detected by an assay will run as heterozygous e Samples running in or near a homozygous cluster can be either a true homozygote for the reported haplotype or can be heterozygous for a reported haplotype and an unreported haplotype of a given assay Samples having just one reported haplotype may run together with or close to those carrying two reported homozygous haplotypes If a sample close to a homozygous cluster is called as undetermined manually change the call to homozygous e Samples that are homozygous for the unreported haplotype may cluster with NTCs or may exhibit weak amplification due to probe nonspecific activity If a weakly amplifying sample is called as undetermined manually adjust the call to noamp Table
138. rformance and system specifications 107 Pharmacogenomics Experiments User Guide Overview Genotyping and copy number controls This appendix covers OVERVIEW ccc seh ieee alee ba Sia sn bd Se ee ee et 108 Cell line gDNA controls TAR R E nee ene ees 108 Plasmid eT pue nese nicea 35 4 8 an aaa i ba eA OREO OG DA LAE Oe ed 109 Many laboratories desire to test the performance of their selected TaqMan SNP and DME Genotyping assays on OpenArray plates by using samples that represent all three genotypes homozygous major allele homozygous minor allele and heterozygous to test for both amplification and cluster separation Some laboratories prefer to use samples that represent at least two genotypes homozygous major and minor alleles or homozygous major allele and heterozygous to test that both assay probes function Ideally g DNA samples of known genotypes can be used for such experiments However for rare DME variants that are not well represented in populations it may be necessary to use synthetic templates This Appendix includes information on sources of control cell line sample DNAs for DME and SNP genotyping assays as well as for copy number assays It also includes information on ordering synthetic template DNAs in plasmids Cell line gDNA controls TaqMan Drug Metabolism Genotyping Assays test data This section describes some publicly available sources for reference or control materials that can be use
139. rientation of the reference genome Likewise TaqMan SNP and DME Genotyping Assays context sequences are provided in the genome strand orientation In contrast the allele nomenclature for many PGx genes does not follow this convention the variant alleles may map to the strand of the reference genome and thus are given in the reverse complement orientation e g CYP2D6 which maps to the genome strand For successful translation of sample genotyping results by AlleleTyper Software the base alleles used in your translation table must match the base alleles used in the TaqMan Genotyper Software results files As well the assay identifiers must match between the translation table and the TaqMan Genotyper and or CopyCaller Software results files Pharmacogenomics Experiments User Guide A DNA isolation using the MagMAX DNA Multi Sample Ultra Kit Refer to the MagMAX DNA Multi Sample Ultra Kit User Guides on page 80 buccal swab or page 84 whole blood for detailed procedures for isolating and purifying genomic DNA These user guides are also available at the product web page at www lifetechnologies com Pharmacogenomics Experiments User Guide 79 USER GUIDE ap plied biosystems oy life technologies Mag MAX DNA Multi Sample Ultra Kit High throughput isolation of PCR ready DNA from buccal swabs Catalog Number A25597 and A25598 Pub No MANO0010293 Rev C 0 WARNING Read the
140. rocedures in EDTA or sodium citrate anticoagulant tubes Note Heparin is not recommended as an anti coagulant since it can cause inhibition of PCR reactions Invert the tube to ensure thorough mixing Process samples shortly after collection or freeze them immediately after collection and store them between 20 C and 80 C IMPORTANT To minimize DNA degradation do not re freeze samples after they have been thawed We recommend storing the blood in single use aliquots to avoid multiple freeze thaw cycles Important procedural guidelines If the whole blood is frozen prior to use thaw the sample at 25 37 C in a water bath until it is completely liquid and place on ice until needed Perform all steps at room temperature 20 25 C unless otherwise noted When mixing samples by pipetting up and down avoid creating bubbles Cover the plate during incubation and shaking steps to prevent spill over and cross contamination The same MicroAmp Clear Adhesive Film can be used throughout the procedure unless it becomes contaminated If you use a plate shaker other than the Thermo Scientific Titer Plate Shaker verify that The MagMAX Express 96 Deep Well Plate fits securely on your titer plate shaker Perform DNA extraction and elution 1 Digest the samples with a Preheat an incubator to 65 C The recommended speeds are compatible with your titer plate shaker Ideal speeds should allow for th
141. rrying CYP2D6 intron 2 and intron 6 sequences respectively e g CYP2D6 36 Pharmacogenomics Experiments User Guide 21 7 Chapter 2 Background and tools for assay content selection Special assay considerations CYP2A6 CNV and CYP2A6 CYP2A7 hybrid alleles 22 The primary CYP2D6 copy number assay for CNV analysis is the exon 9 Hs00010001_cn assay that predominantly detects full length CYP2D6 alleles and not the fairly common non functional 36 allele If copy number information for both CYP2D6 and hybrid genes including the CYP2D6 36 allele is desired then the intron 2 and or intron 6 assays can additionally be used Ramamoorthy et al 2010 In some cases adding intron 2 and or intron 6 assays is required for proper sample genotyping For example use of upstream intron 2 and or intron 6 assays along with the exon 9 assay can help to identify 13 alleles that carry upstream CYP2D7 sequences and downstream CYP2D6 sequences if the exon 9 assay alone is used the 13 non functional alleles will go undetected and be counted as normal 1 alleles Currently 38 CYP2A6 alleles have been defined by the Cytochrome P450 Nomenclature Committee http www cypalleles ki se At least 4 of these alleles do not encode functional enzymes and several others encode reduced function enzymes The genotyping of CYP2A6 alleles is complicated by the presence of copy number variant deletion 4 and duplication 1 alleles and hybrid alleles formed by recom
142. rties do you want for the instrument run ST et Home E 2014 06 02 15 x 5 Click the Define tab from the left window pane see figure below 6 In the Targets pane enter RnaseP for the Target Name select FAM for Reporter and TAMRA for Quencher 91 Pharmacogenomics Experiments User Guide Appendix B Sample quantification using the RNase P Detection Reagents Kit Procedure 7 Sample names and standards can be entered in the Samples pane on the right side of the window Fle Edit Instrument Analysis Tools Help E New Experiment Z Open Nd Save BF Cose EG Import amp Print Report p Experiment Reagents Targets T A Setup Target Name Reporter Quencher Experiment Properties RnaseP IFAM Assign Run Method Biological Replicate Groups Materials List New Biological Group Name Comments 8 Click the Assign tab on the left window pane to assign the samples and standards to well positions see figure below 9 Select the well for each sample or standard and check the sample name from the Sample pane on the left 10 Be sure to assign the RuaseP target for all the wells from the Targets pane Fie Edit Instrument Analysis Tools Help S New Experiment BF Open N Save G Sose C Import amp Print Report Experiment Reagents lt DS Define and Set Up Standards lt o
143. s citations and other product support documents e Obtain information about customer training e Download software updates and patches Limited product warranty Life Technologies Corporation and or its affiliate s warrant their products as set forth in the Life Technologies General Terms and Conditions of Sale found on Life Technologies website at www lifetechnologies com termsandconditions If you have any questions please contact Life Technologies at www lifetechnologies com support Pharmacogenomics Experiments User Guide 120 Documentation and support Limited product warranty 121 Pharmacogenomics Experiments User Guide A allele nomenclature 13 AlleleTyper Software 35 77 assay considerations clinical research targets 25 Custom TaqMan Copy Number Assays 26 Custom TaqMan SNP Assays 25 CYP2A6 CNV and CYP2A6 CYP2A7 hybrid alleles 22 CYP2D6 copy number variation and CYP2D6 CYP2D7 hybrid alleles 21 DME genes and copy number variation 20 gender assays 24 GSTM1 and GSTT1 DME assays and CNV 21 TaqMan DME Assays for genotyping adjacent SNPs 24 TaqMan DME Assays for genotyping triallelic SNPs 23 unavailable DME and clinical research targets 25 Assay Search Tool 16 B biohazard safety 116 C Certificates of Analysis obtaining 120 chemical safety 115 Common Marker file searching 19 content selection assay 13 controls copy number 108 cell line gDNA controls 108 plasmid controls 109 copy number
144. s 69 R Prepare the reactions o cerner ie e E eee eee ee eee ee 69 M R n the teactlons is cohen eee RA es eh lea ab ee hates Lr cas ats 70 m Analyze and export results 06 eee eee eee 70 m Analyze results using CopyCaller Software 00 cece eee eee ee 71 Introduction to copy number analysis Copy number variation must be assessed for DME genes that are known to exhibit copy number variation For full details on running TaqMan Copy Number Assay experiments refer to the TaqMan Copy Number Assays Protocol Pub no 4397425 The protocol provides step by step instructions for performing and analyzing copy number variation quantitation experiments using TaqMan Copy Number Assays and TaqMan Copy Number Reference Assays for the ViiA 7 Real Time PCR System The same instructions apply for running experiments on the QuantStudio 12K Flex Real Time PCR System How the assays work TaqMan Copy Number Assays are run simultaneously with a TaqMan Copy Number Reference Assay in a duplex real time PCR reaction The Copy Number Assay detects the target gene or genomic sequence of interest and the Reference Assay detects a sequence that is known to exist in two copies in a diploid genome for example the human RNase P H1 RNA gene The number of copies of the target sequence in each test sample is determined by relative quantitation RQ using the comparative Cr AACy method This method measures the Cy difference ACy b
145. s necessary to run both DME genotyping assays and copy number assays to determine sample genotypes For a given DME assay that targets a gene that can be deleted or duplicated in individuals e g CYP2D6 samples having no gene will not amplify samples having 1 or more copies that are homozygous for the SNP allele will cluster together and samples having more than 2 copies that are heterozygous may run within the 2 copy heterozygous cluster or between it and one of the homozygous clusters Copy number quantitation of the gene target must thus be used to determine which samples carry gene deletions or duplications to discern the sample genotype Additionally use of multiple copy number assays for a gene may be required for hybrid gene analysis Note that the copy number assays are not SNP allele specific and cannot be used to determine which SNP allele is duplicated when a sample is heterozygous and has three gene copies The GSTM1 and GSTT1 genes have a very high frequency of deletion and are entirely missing in a substantial number of individuals in multiple populations This means that DME genotyping assays to variants within these genes will usually yield results wherein many samples do not amplify and cluster with the no template controls NTCs The CYP2D6 gene is the most highly polymorphic and complex of the DME genes It is also of primary importance as it is responsible for the metabolism of about 25 of current drugs Over 100 star a
146. sion events Typically stochastic events are dominant at levels that are lt 10 template copies and are negligible in qPCR reactions with gt 100 template copies Thus the standard OpenArray protocol for human SNP assays recommends starting with 50 ng uL of genomic DNA When diluted 50 in master mix and loaded into a 33 nL reaction chamber the final template amount is 825 pg This converts to 250 genomic copies 125 genomic copies for each allele in a heterozygote Pharmacogenomics Experiments User Guide Prepare run and analyze OpenArray PGx experiments The information provided in this chapter includes streamlined procedures for running OpenArray genotyping experiments on the QuantStudio 12K Flex Real Time PCR System and for data analysis using the QuantStudio 12K Flex system and TaqMan Genotyper Software The chapter covers m About the OpenArray chemistry protocol 39 E Track samples ii c occas des eee hee AA RE RENO hae aT 39 m Create a batch of experiments in eds file omar nnnnnnn rnrn 45 E Run OpenArray SNP genotyping experiments 0 0 0 0 0 0 c eee eee 46 m Analysis settings in the QuantStudio 12K Flex Software n n onnu 47 m Transfer files to a user computer 6 666 51 m Perform analysis in TaqMan Genotyper Software 51 m Optional Generate and importa reference panel nn nnnnnan nnna 60 m Assays that require manual genotype calls 64 m Optional Single tube reintegrat
147. software algorithm assigned genotype for a data point is discordant with the genotype of a replicate sample data point that has exactly the same sample assay identification a flag will be raised A flag will be raised for all data points that have the sample assay identification because the software cannot know which data point has the correct genotype 4 In the Study Level QC Flags pane a Select the flags that the software uses to analyze all assays in the study b For each flag select condition and threshold values that are appropriate for your laboratory QC flag Description Experiment Low ROX Rate High An Experiment Low ROX Rate High flag can be raised for any experiment If the percentage of data points in an experiment with a low ROX dye intensity flag is greater than the threshold a flag will be raised Assay Call Rate Low An Assay Call Rate Low flag can be raised for any assay If the percentage of Unknown data points with a genotype call for an assay is less than the threshold a flag will be raised Experiment Call Rate Low An Experiment Call Rate Low flag can be raised for any experiment If the percentage of Unknown data points in an experiment with a genotype call is less than the threshold a flag will be raised Sample Call Rate Low A Sample Call Rate Low flag can be raised for any sample identified or tasked as an Unknown If the percentage of assays with a genotype call
148. software to use and if applicable enter a condition and threshold value appropriate for your laboratory There are two categories of criteria that the software uses to analyze data The first category looks at concordance of data points either to an expected call or to a replicate call The second category looks at the data to meet a specified condition and threshold value In either case if the resulting data violates a criterion a flag is generated By default all flags are enabled in the software Set QC settings 1 In the toolbar click Analysis Settings to open the Analysis Settings dialog box 2 Select the QC Settings tab 3 In the Well Level QC Flags pane a Select the flags that the software uses to analyze the study at the well level b For each flag select condition and threshold values that are appropriate for your laboratory QC flag Description Failed Control A Failed Control flag can be raised for any data point that is identified as a control NTC Negative Control or Positive Control If the user assigned control identifier or task for a data point is inconsistent with the call that would be assigned by the software algorithm to an Unknown with the same FAM and VIC dye intensities a flag is raised Genotype Quality A Genotype Quality Low flag can be raised for any data point that is identified or tasked as an Unknown If the quality value assigned by the software algorithm for a data point is b
149. ssays screen If the assay information file contains incorrect information you can e Edit the information in the Assays screen Select the assay of interest then click Edit to open the Edit Assay dialog box e Edit the information in the assay information file then re import it e Import a different assay information file to replace the incorrect information Add control About control identifiers identifiers Control identifiers identify the samples that the TaqMan Genotyper Software uses as controls when analyzing a study You can identify samples as e NTC No template control The well does not contain any template DNA sample The software automatically identifies any well in the study that has a sample ID of NTC as a no template control IMPORTANT Life Technologies strongly recommends that you run two NTC wells with every assay in a study e Negative Controls The well does not contain known template that is the well should display no amplification signal For example the well may contain a non target template include an inhibitor and so on e Positive Controls The well contains known template to generate a specific genotype call for an assay You can specify positive controls for VIC VIC homozygous sample for the allele detected by VIC VIC FAM heterozygous or FAM FAM homozygous for the allele detected by FAM Positive controls are not called by the software and cannot be manu
150. t Sample3 Target1 UNKNOWN FAM NFQ MGB 27 827 27 792 0 068 10 024 10 306 c n Name Sample4 Target1 UNKNOWN FAM NFQ MGB 26 983 27 016 0 069 19 273 18 806 c E Sample4 Target 1 UNKNOWN FAM NFQ MGB 27 120 27 016 0 069 17 337 18 806 IF Target Name Sample5 Target1 UNKNOWN FAM NFQ MGB 27 349 27 327 0 032 14 516 14 765 d Sample 5 Target1 UNKNOWN FAM NFQ MGB 27 280 27 327 0 032 15 316 14 765 F Task Sample6 Target1 UNKNOWN FAM NFQ MGB 26 929 26 981 0 062 20 097 19 324 t Sample6 Target 1 UNKNOWN FAM NFQ MGB 27 071 26 981 0 062 18 000 19 324 c T Reporter Sample 7 Target1 UNKNOWN FAM NFQ MGB 27 084 27 057 0 058 17 831 18 213 B Quencher BI Samele 7 Target 1 z UNKNOWN FAM NFQMGB 27 091 27 057 0 058 17 731 18 213 K stat Export Save Exort ost As Load export Sot E 2013 07 23 Ma x 4 Refer to your instrument s software user guide for further information Pharmacogenomics Experiments User Guide 96 Appendix B Sample quantification using the RNase P Detection Reagents Kit Procedure 97 Pharmacogenomics Experiments User Guide Troubleshooting This appendix provides troubleshooting information for running PGx experiments using OpenArray plates on the QuantStudio 12K Flex System Umma Pera aly S185 sas ters 55 6 E cock la Sag k Beech lore E bee bonne taeda MCs eo EE EE AS 98 Case leaks and bubbles 66 29 Sample plate preparation errors cee nee 100 AccuFill loading errors 101 Entire subarrays m
151. tStudio 12K Flex Real Time PCR System A copy number assay protocol has not yet been developed for the OpenArray plate About the Life Technologies website Assay Search Tool The Life Technologies web site provides an easy to use assay search tool to aid selection of TaqMan DME SNP and Copy Number Assays The search tool can be accessed from the Real Time PCR Assays page or any of the specific product pages accessed from the Life Technologies web site Search for TaqMan SNP Genotyping assays To search for TaqMan DME or SNP Genotyping Assays using the Assay Search tool select the SNP Genotyping experiment type You can choose to search for All SNP Genoty ping Human includes the DME Assays or just the validated Drug Metabolism Assays collection Search terms include gene symbol rsSNP ID allele nomenclature and assay ID Single keyword or batch search options are available as is a search by genomic location option e View assay search result The search results page will include the following information for each assay returned Assay ID SNP ID NCBI dbSNP rs ID or human Celera Variant hCV ID if no rs ID is available Gene Location genomic coordinate chr coordinate Pharmacogenomics Experiments User Guide Chapter 2 Background and tools for assay content selection 7 Select assays SNP Type e g missense mutation Assay type e g DME If many assays are returned in a search the option to fil
152. ta dn dae cas 26 About assay content selection Pharmacogenomic studies involve testing samples for multiple variants in drug metabolism enzyme DME and transporter genes Life Technologies offers a comprehensive collection of validated TaqMan Drug Metabolism Genotyping Assays that are optimized for genotyping single nucleotide polymorphisms SNPs insertions and deletions InDels and multi nucleotide polymorphisms MNPs in drug metabolism related genes in the research setting The DME Assays collection of 2 700 assays detect potentially causative polymorphisms in 221 drug metabolism enzyme DME and associated transporter genes As well 4 5 million predesigned SNP assays and custom SNP assays are available for other targets of interest In addition TaqMan Copy Number Assays are available for examining copy number variation CNV in DME genes This chapter covers an introduction to DME gene allele nomenclature TaqMan SNP and DME Genotyping Assays TaqMan Copy Number Assays and tools and information required for finding and selecting assays for your study Allele nomenclature PGx researchers familiar with drug metabolism genes frequently know a particular SNP by its standardized allele name or star allele nomenclature Sim et al 2010 Star alleles are gene level haplotypes a set of DNA polymorphisms that tend to be inherited together on the same chromosome In many cases these haplotypes have been associated with D
153. ter results will be given in the left side bar e g filter by gene assay type SNP type etc Note If allele nomenclature is used as a search term e g CYP2D6 4 all DME assays to variants within all associated sub alleles will be returned If needed review the variants on the associated allele nomenclature website to determine which are important to evaluate in your study e g only the allele defining variants may be of interest IMPORTANT Read any Important Information notes associated with the assay click the Important Information box that appears beside that Assay ID on the assay search results bar to open a pop up box These provide information required for making ordering decisions For example a copy number assay may be required in addition to the DME assay for sample genetic analysis or the DME assay may be one of a pair of assays interrogating a triallelic SNP C _30634117C_20 Important Information A SNP ID Ge 1s5030865 Cyl CLOSE X Important Information Assay C_30634117C_20 reports the major G and one minor T allele CYP2D6 8 g 1758G gt T of a triallelic SNP Assay C_30634117D_30 reports the major G and other minor A allele C YP2D6 1 4 g 1758G gt A The minor alleles e View Details Additional annotations can be viewed for any assay by clicking the Assay Details button Additional annotations include SNP ID links to NCBI dbSNP page Context Sequence provided in the reference
154. the bubble by tilting the OpenArray case so that the fill port is at the highest point Slowly fill the case with immersion fluid until only a small air bubble remains Attach the screw and wipe off any excess oil that may have spilled onto the case Damaged plate press leading to uneven pressure Contact your field service engineer if you suspect that your plate press may be damaged Sample plate preparation errors Pharmacogenomics Experiments User Guide 100 Appendix C Troubleshooting AccuFill loading errors Possible cause Recommendation Not enough volume of sample was added to the 384 well sample plate Ensure that proper pipettes techniques are performed No air bubbles in the pipette tips after sample aspiration Reaction mix sample master mix is not at the bottom of the 384 well sample plate Ensure that the sample plate is centrifuged at 1000 rpm for 60 seconds AccuFill loading errors Systematic loading problems can occur with the AccuFill instrument indicating a need for service For example when turnholes where the AccuFill instrument changes direction during sample loading see Load Path image below are repeatedly missed across multiple subarrays service is required Oese OOOOCOOO OOOO OO COO0OOO OOOO OO OO OOOO OO OOM OOOO OO OO ere TIO Turn hole Possible cause Recommendation AccuFill instrument is aligned
155. the homozygous cluster towards the heterozygous cluster As a result we have good evidence to change some of the calls from heterozygous to homozygous for the FAM allele Without Traces With real time Traces Ka Y vg e gb ee s i 3 ma ss v v oie inie tammy gone Meke 2 Meke 2 I Mitte Allene erered x nia i Cy 7 ipadad Pharmacogenomics Experiments User Guide 104 C Appendix C Troubleshooting Expected versus unexpected no amps and undetermined calls The QuantStudio 12K Flex Software can be used to view amplification curves As a rule of thumb a Cy value of about 25 indicates that the sample input is approximately 250 haploid copies which is the recommended input amount per 33 nL reaction for OpenArray genotyping plates i e 825 pg of DNA will be loaded per PCR when a stock solution of 50 ng uL is used Expected versus unexpected no amps and undetermined calls TaqMan DME genotyping assays to genes in copy number variation regions TaqMan DME genotyping assays to triallelic SNPs and adjacent SNP targets 105 For certain assays it is expected that there will be some samples that legitimately fail to amplify or to get a genotype call These include samples run with assays that interrogate gene variants that are associated with copy number variation and with assays that detect triallelic SNPs or adjacent SNPs See Assays that require manual genotype calls in Chapter 5 on page 39 for details on how t
156. the star allele nomenclature CYP2D6 4 g 1846G gt A This is because the context sequence alleles are provided in the reference genome strand orientation whereas the star allele nucleotide changes are provided with respect to the CYP2D6 gene reference sequence that maps to the genome strand Copy number variation must be assessed for DME genes that are known to exhibit copy number variation see DME genes and copy number variation on page 20 TaqMan Copy Number Assays are run simultaneously with a TaqMan Copy Number Reference Assay in a duplex real time polymerase chain reaction PCR The Copy Number Assay detects the target gene or genomic sequence of interest and the Reference Assay detects a sequence that is known to exist in two copies in a diploid genome e g the human RNase P H1 RNA gene The number of copies of the target sequence in each test sample is determined by relative quantitation RQ using the comparative Cy AACy method s TaqMan Copy Number Assay contains two primers and a FAM dye labeled MGB probe to detect the genomic DNA target sequence s TaqMan Copy Number Reference Assay contains two primers and a VIC dye labeled TAMRA probe to detect the genomic DNA reference sequence TaqMan Copy Number Assays can be ordered as single tube assays see Chapter 3 Ordering information on page 27 and run on 96 well and 384 well plates on Applied Biosystems Real Time instruments including the Quan
157. tion and detection of all three Pharmacogenomics Experiments User Guide Plasmid controls Appendix E Genotyping and copy number controls genotypes by a given assay Plasmid control samples will often but not always cluster with gDNA samples Example data can be found in the TaqMan DME Genotyping Assays on OpenArray Plates ppt file that can be downloaded from www lifetechnologies com pgx For information on ordering TaqMan DME and SNP genotyping assay plasmid controls please send an email to QuantStudioFrontDesk lifetech com Pharmacogenomics Experiments User Guide 110 Appendix E Genotyping and copy number controls Plasmid controls 111 Pharmacogenomics Experiments User Guide F Good PCR practice Prevent contamination and nonspecific amplification PCR assays require special laboratory practices to avoid false positive amplifications The high throughput and repetition of these assays can lead to amplification of one DNA molecule PCR good When preparing samples for PCR amplification laboratory e Usea positive displacement pipette or aerosol resistant pipette tips practices Follow proper pipette dispensing techniques to prevent aerosols Wear clean gloves and a clean lab coat not previously worn while handling amplified PCR products or used during sample preparation Change gloves whenever you suspect that they are contaminated Maintain separate areas and dedicated equipment and supplies for
158. tocol is not pre installed on the KingFisher Flex Magnetic Particle Processor 1 On the MagMAX DNA Multi Sample Ultra Kit web page scroll down to the Product Literature section 2 Right click A25597_Blood_Buccal and select Save as Target to download to your computer 3 Refer to Thermo Scientific KingFisher Flex User Manual Cat no N07669 and BindIt Software User Manual Cat no N07974 for instructions for installing the program on the instrument Before first use of the kit prepare Wash Solutions Prepare the Wash Solutions from the concentrates e Add 25 mL of isopropanol to Wash Solution 1 Concentrate mix and store at room temperature e Add 132 mL of ethanol to Wash Solution 2 Concentrate mix and store at room temperature Before each use of the kit prepare DNA Binding Bead Mix Vortex DNA Binding Beads thoroughly before pipetting and combine with Nuclease free Water according to the following table Component Volume per well Seer DNA Binding Beads 16 UL 1 6 mL Nuclease free Water 24 uL 2 4 mL Total DNA Binding Bead Mix 40 uL 4mL Store DNA Binding Bead Mix at room temperature for no longer than 24 hours 1 Digest the samples with a Preheat an incubator to 65 C Proteinase K b Place the swabs in the wells of a MagMAX Express 96 Deep Well Plate one per well c Break the stick off the swabs enough to sit in the well without protruding d Prepare suff
159. tom assays through the product specific design tools Select the scale of predesigned or custom assays before adding them to your cart or editing them in the cart note that DME assays come in small scale only Alternatively assays may be ordered through the Quick Order web page accessed from the upper right hand corner of Life Technologies web pages using the part number and Assay ID The TaqMan SNP Genotyping Assay and TaqMan Copy Number Assay products and part numbers are provided in the tables below Pharmacogenomics Experiments User Guide 31 3 Chapter 3 Ordering information Order single tube TaqMan Assays Table 6 TaqMan SNP Genotyping Assays Number of reactions Assay mix Part no Product Scale formulation Non 384 well 96 well Human teen Small 1500 300 40x 4351379 4351384 S aes Medium 5000 1000 40x 4351376 4351382 Large 12000 2400 80x 4351374 4351380 DME Small 750 150 20x 4362691 z Small 1500 300 40x 4331349 4332077 Een Medium 5000 1000 40x 4332072 4332075 Large 12000 2400 80x 4332073 4332076 e DME assays are available only as small scale inventoried product Predesigned and custom SNP assays are made to order and are available in multiple scales e Assays with Human part numbers undergo functional testing on a panel of 20 unrelated Coriell cell line gDNA samples from 3 populations African American Caucasian and Japanese before shipment upon first ord
160. too far to the left or right Please contact your field service engineer to resolve the issue 101 Pharmacogenomics Experiments User Guide Entire subarrays missing Appendix C Troubleshooting C Entire subarrays missing 6 6 e e D 3 C Possible Cause Recommendation Sample Master Mix not added to particular wells in the 384 well sample plate Visually inspect the sample plate to confirm that the wells have sample master mix Stuck tip mandrel on AccuFill instrument may need cleaning Contact your local field service engineer Pipette tip not loaded on mandrel Contact your local field service engineer if this happens regularly infrequent occurrences can be due to a poorly molded tip OpenArray plate assembly and handling errors Refer to the QuantStudio 12K Flex Real Time PCR System OpenArray Experiments User Guide Pub no 4470935 for detailed troubleshooting information Sample blow out during the addition of immersion fluid Rr Pharmacogenomics Experiments User Guide 102 Evaporation of reaction mixture Stability of assembled OpenArray plates 103 Appendix C Troubleshooting OpenArray plate assembly and handling errors Possible cause Recommendation The reactions in A12 were compromised during the addition of immersion fluid Injecting the immersion fluid too quickly can actually purge the sample out of the thro
161. turned assay list to look over before ordering The export file will contain the assay ID along with annotations including catalog number gene DGV and genomic location annotations The TaqMan Drug Metabolism Genotyping Assays Index can be downloaded from www lifetechnologies com taqmandme This file contains a comprehensive list of the DME assays along with annotations listed below This file can facilitate looking for DME assays to polymorphisms of interest given the extensive annotation information within it which includes e Gene symbol and name e NCBI SNP reference if applicable e Polymorphism e g A G e Amino acid change if applicable e Allele nomenclature if available e Polymorphism for example A G e SNP type e g missense mutation e Context sequence VIC FAM in plus strand orientation with SNP alleles in brackets e Applied Biosystems minor allele frequency data Caucasian African American Japanese Chinese populations The PharmaADME consortium www PharmaADME org composed of individuals from academia pharmaceutical and genomic technology industries created a consensus list of known and putative functional variants in key genes involved in the absorption distribution metabolism and excretion ADME of drugs A Core Marker list of variants considered most likely to impact drug metabolism was composed of 184 variants in 33 key ADME genes Life Technologies developed TaqMan assays to the Pharm
162. ualize the assay format in the OpenArray plate A TaqMan OpenArray c x e G B https wwwlifetechnologies com us en home life science pcr real time pcr real time pcr assays snp genotyping taqman assays taqman openarray genotyping pIQ gy Format Number of Assays Number of Samples Order aty x 6 1 E 1 10 pack veniat 2 2 s 1 10 pack veces FOR GT CUSTOM 32 a b L d e f L h 2 Click Select to enter the plate configurator Search for assays find custom assays or import your predefined assay list Array Configurator x V e G 7 wwwilifetechnologies com order custom array cor About Life Careers News Order Support Quick Order Sign nto Your Account lt wf Cat s Play the Lipofectamine technologies Save now Life Sciences Applied Sciences Clinical Shop All Products Technical Resources Array Custom Array Configurator Enable Replacement Assays Replacements assays ensure you get the most from your OpenArray plate Please choose from the following 3 options No Thanks Enabled SpecifyNow Enabled Specify Later Help Array Unique Array name 1D Array type Targets Filled Invalid Empty TagMan OpenArray Genotyping aes o o O Selecty Edit Mover Export Help Save Your Aray Sa Click Jick amp drag t www lifetechnologies com order custom array configure modal file import 28 Pharmacogenomics Experiments User Guide Chapter 3 Ordering information 3 Or
163. ubes Invert or flick the tubes to mix the contents thoroughly then centrifuge the tubes briefly Pipette the reaction mixture into the wells of the reaction plate that you prepared e For 384 well plates pipette 8 uL per well e For 96 well plates pipette 16 uL per well Vortex the gDNA samples that you prepared and diluted Add the gDNA to the wells containing the reaction mixture s For 384 well plates pipette 2 uL of gDNA 5 ng uL per well e For 96 well plates pipette 4 uL of gDNA 5 ng uL per well Note Alternatively you can add the gDNA to the plate first then add the reaction mixture Mix the reaction mixture with the gDNA by pipetting up and down several times Seal the reaction plate with optical adhesive film or optical caps then centrifuge the reaction plate briefly Inspect all the wells to ensure a uniform volume Proceed to the next step Run the reactions Run the plate 1 Load the reaction plate into a real time PCR instrument 2 Run the plate using the parameters below Stage Temperature Time Hold 95 C 10 min Cycle 95 C 15 sec 40 Cycles 60 C 60 sec 3 Unload the reaction plate after the run is complete Analyze and export results Analyze the results 1 70 In the real time PCR Instrument software open the Analysis Settings window and set the following e Manual Cy threshold 0 2 e Autobaseline On Apply the settings then close the wind
164. ugh holes near the fill port Often this is caused by the user not purging the syringe slightly before use A small amount of immersion fluid should be dispensed onto a paper towel before use to ensure smooth operation of the syringe Possible cause Recommendation Too much time elapsed before plate was sealed with lid and immersion fluid In this example the top half of each subarray was intentional left open to the environment to demonstrate the effect of evaporation Donuts are a result of the evaporated fluid in the though holes To minimize the likelihood of evaporation take the plate off of the AccuFill deck seal the case with the lid and add immersion fluid as soon as the case is removed from the plate press Sealed OpenArray plates should be run within one hour of assembly If necessary genotyping plates may be stored at 4 C to 8 C or at room temperature do not freeze for up to 24 hours before cycling However immediate cycling is recommended for best results If plates have been stored at 4 C to 8 C allow them to equilibrate to room temperature before cycling If an OpenArray plate is not cycled immediately after loading minimize light exposure to prevent photobleaching of the dyes Pharmacogenomics Experiments User Guide Insufficient sample input G 1 750 e 1 500 2 1 250 s 2 H 1 000 750 d o ge ea D 250 500 750 Using QuantStudio 12K Flex
165. ution gt 2 65 Fail Note The thresholds in the table above are based on empirical observations and are provided only as guidelines Optional Edit the analysis settings 1 Select one or more assays in the Assay Selection Table then click View Analysis Settings in the toolbar 2 Revise the analysis settings as needed For example if the quality of the calibrator data is poor you can select a different calibrator sample and reanalyze the data 3 Click Apply to perform the copy number analysis using the revised analysis settings Review the Well Table For each replicate group in the Well Table review the Flag column for any quality flags generated during the analysis and determine the source of the warning Some quality flags indicate potential issues with wells or samples For example wells that generate NOVIC or VICET flags did not amplify the reference assay target properly and may contain low quantity or poor quality DNA Review the Analysis Summary Review the Analysis Summary tab for the summarized results of the copy number analysis While viewing the summary you can copy and paste the data into other applications Pharmacogenomics Experiments User Guide Chapter 6 Prepare run and analyze copy number experiments Analyze results using CopyCaller Software Review the Statistics Chart Review the Statistics Chart tab for information about the distribution of copy numbers among the samples in a copy number assa
166. w The percentage of data points for the assay with geno Percentage Experiment Call Rate Low The percentage of data points for the experiment with Percentage Sample Call Rate Low The percentage of data points for the sample with gen Percentage oc Le Lea Export analysis For detailed information about the exported file contents refer to the TaqMan data Genotyper Software Getting Started Guide Pub no 4448637 1 In the Workflow Menu pane select Export Analysis Data then select Basic or Advanced Export Select the type of data to export you can select both options at the same time e Analysis Results e Analysis Settings If you selected Analysis Results in step 2 select Basic or Advanced for use with AlleleTyper Software select Advanced Select the default Separate Files to export the data in separate files All data types you selected in step 2 Analysis Results and or Analysis Settings are exported separately in different files Click Export preview then Start Export in the new window The resulting export file is the data input file for AlleleTyper Software Pharmacogenomics Experiments User Guide 59 5 Chapter 5 Prepare run and analyze OpenArray PGx experiments Optional Generate and import a reference panel Optional Generate and import a reference panel About reference panel files and reference samples Generate a referenc
167. y technology C023802 Descriptive and ordering information for Appendix D Expected on the QuantStudio 12K Flex System Product Bulletin QuantStudio 12K Flex System performance and system specifications 119 Note For additional documentation see Obtaining support on page 120 Pharmacogenomics Experiments User Guide Documentation and support Obtaining SDSs Obtaining SDSs Safety Data Sheets SDSs are available from http www lifetechnologies com support Note For the SDSs of chemicals not distributed by Life Technologies contact the chemical manufacturer Obtaining Certificates of Analysis The Certificate of Analysis provides detailed quality control and product qualification information for each product Certificates of Analysis are available on our website Go to www lifetechnologies com support and search for the Certificate of Analysis by product lot number which is printed on the box Obtaining support For the latest services and support information for all locations go to www lifetechnologies com support At the website you can e Access worldwide telephone and fax numbers to contact Technical Support and Sales facilities e Search through frequently asked questions FAQs e Submit a question directly to Technical Support techsupport lifetech com e Search for user documents SDSs vector maps and sequences application notes formulations handbooks certificates of analysi
168. y While viewing the Statistics Chart you can copy save or print it Review the AC Plot Review the ACy Plot tab for information about the distribution of sample ACy values in a copy number assay experiment While viewing the ACy Plot you can copy save or print it Pharmacogenomics Experiments User Guide 75 Chapter 6 Prepare run and analyze copy number experiments Analyze results using CopyCaller Software 76 Pharmacogenomics Experiments User Guide Perform translation analysis in AlleleTyper Software This chapter covers S Introduction to AlleleTyper Software 0 cece cece eee 77 S Sources of PGx translation information and example translation tables 78 Introduction to AlleleTyper Software AlleleTyper Software is an automated data analysis application that translates genetic pattern information from TaqMan SNP Genotyping Assay and or TaqMan Copy Number Assay results to user defined genotype or diplotype nomenclature For complete instructions on how to use AlleleTyper Software and to create user defined translation tables please refer to the AlleleTyper Software User Guide Pub no 4486002 AlleleTyper Software is a flexible tool used for conversion of sample genotype information for single or multiple genes or loci to the desired nomenclature for example the PGx gene level star allele nomenclature to describe SNP InDel or copy number variant genotypes e g for the C
169. ytochrome P450 genes Star alleles are haplotypes that can contain multiple variants these are associated with functional or nonfunctional gene products AlleleTyper Software can also be used to translate the genotype results for special cases including triallelic or adjacent SNP interrogation using two TaqMan SNP assays as well as used to simply provide a name for a particular genetic outcome for a given SNP or copy number assay Before creating a translation table or translator consider all TaqMan SNP Genotyping Assays includes TaqMan DME Assays and TaqMan Copy Number Assays that will be used in your project and which of these you will want to include in a translation table for reporting sample genotype results using specific nomenclature SNP assay and copy number assay experiment data generated on an Applied Biosystems real time PCR system must be analyzed by TaqMan Genotyper Software and CopyCaller Software respectively because results files exported from these software systems are input files for AlleleTyper Software AlleleTyper Software aids creation of translation tables by automatically converting monoallelic translation tables containing haplotype patterns to biallelic translators containing diplotype or genotype patterns After examining biallelic translators for completeness and accuracy they are imported into AlleleTyper Software along with TaqMan Genotyper Software data files and or CopyCalle

Pharmacogenomics Experiments User Guide

Contents

Download Pdf Manuals

Related Search

Related Contents