Cancer MicroRNA qPCR Array with QuantiMir User Manual, v.1
Contents
1. Cat s 4368577 4367650 4367659 4368706 4368702 4368708 4367660 from Applied Biosystems 2 SYBR GreenER qPCR SuperMix for ABI PRISM instrument from Invitrogen Cat s 11760 100 11760 500 and 11760 02k 3 RT Real Time SYBR Green ROX PCR Cat s PA 012 and PA 112 from SuperArray Resuspend Primers in Primer plate with 10ul RNase free water per well before use the primers are dried down in the Primer plate Then Load 1ul per well of each of the Primers from the Primer plate into your qPCR plate well A1 into qPCR plate A1 etc The Mastermix contents can be scaled up or down depending upon on your experimental needs If you want to perform the reactions in triplicate scale up the QuantiMir reactions by 3 fold and add 3X the RNA input Or simply follow the above recipe three times for each of the qPCR plates you want to run as replicates Once reagents are loaded into the wells cover the plate with an optical adhesive cover and spin briefly in a centrifuge to bring contents to bottom of wells Place plate in the correct orientation well A1 upper left into the Real time qPCR instrument and perform analysis run HELP Use a Multichannel pipette to load the qPCR plate with MasterMix and Primers Pour the Mastermix into a reservoir trough and use a 8 or 12 channel pipette to load the entire 96 well qPCR plate with the Mastermix Then load the primers from the primer plate to the qPCR plate using2. SBI System Biosciences Cancer MicroRNA qPCR Array with QuantiMir Cat RA610A 1 User Manual Store kit at 20 C on receipt A limited use label license covers this product By use of this product you accept the terms and conditions outlined in the Licensing and Warranty Statement ver 1 070306 contained in this user manual Cancer MicroRNA qPCR Array with QuantiMir Cat Contents Vi Vil Troubleshooting Introduction and Background Overview ooo Importance of MicroRNAs and Other Small RNAs Overview of Entire Protocol moppp Protocol A QuantiMir RT Reaction Setup o B Real time qPCR Reaction Setup o C How the MicroRNA Specific Primers Are Designed D Cancer MicroRNA Array Arrangement Quality Control and Sample Data A Cancer qPCR Array Primer Validation Tests B Sensitivity Tests C D Specificity Tests Sample Data References A General References Appendix A Related Products 888 266 5066 Toll Free 650 968 2200 outside US RA610A 1 ao BND NY esa at se 19 20 ata best 22 23 24 Page 1 System Biosciences SBI User Manual I Introduction and Background A Overview This manual provides details and information necessary to use the QuantiMir RT Kit to tag and convert small non coding RNAs into detectable and quantifiable cDNAs The system allows for the ability to quantitate fold differences of 95 separate microRNAs between 2 separate e
3. MIMATO000420 uguaaacauccuacacucagcu MIMATOOOO073 ugugcaaaucuaugcaaaacuga MIMATOOO0074 ugugcaaauccaugcaaaacuga lt MIMATO000094 Fa E a users F3 miR 200a MIMATO000682 uaacacugucugguaacgaugu Fe 200 Jama roooot Jusauncusecsaiunaugwa F5 miR 200c MIMATOO00617 Juaauacugecggguaaugaugg et Ra aroe aae ae eaaa miR 203 MIMATOD00264 gugaaauguuuaggaccacuag Fa farz Juma roooae Jucewucauucescesgngucug F9 miR 205 MIMATOO00266 uccuucauuccaccggagucug CE E a F11 miR21 MIMATOO00076 uagcuuaucagacugauguuga Pet a rose Jaesasazacasayasandeau G1 miR214 MIM amp TO0000271 acagcaggcacagacaggcag es E ooo Jaanaugeugezecanugagezi 63 miR372 MIMATO000724 aaagugcugegacauuugagegu asin aft famaren torent G5 miR218 MIMATO000275 uugugcuugaucuaaccaugu et miza mAT eoo Jasatusecoguugsngescugu 22 MIMATOO00077 Jaagcugccaguugaagaacugu es i oot Juma roooneo Jaseuaeauugusugeugaguue 69 miR 221 MIMATO000278 Jagcuacauugucugcuggguuuc G10 miR 222 MIMATO000279 Jagcuacaucuggcuacugggucuc G11 miR 223 MIMATO000280 ugucaguuugucaaauacccc 612 miR 224 MIMATO000281 caagucacuagugguuccguuua H miR 23a MIMATOO00078 aucacauugccagggauuuce ear para fragen H3 miR 25 MIMATOOOO081 cauugcacuugucucggucuga H miR 26a MIMATOOO0082 uucaaguaauccaggauaggc HS miR26b _ MimaToo000e3 uucaaguaauucaggauagguu SS ee eee MIMaTooD0419 uucacaguggcuaaguucuge MIMATO000244 uguaaacauccuacacucucagc a MIMA
4. or license for use other than those explicitly listed in this Licensing and Warranty Statement Use of the Product for any use other than described expressly herein may be covered by patents or subject to rights other than those mentioned SBI disclaims any and all responsibility for injury or damage which may be caused by the failure of the buyer or any other person to use the Product in accordance with the terms and conditions outlined herein SBI has pending patent applications related to the Product For information concerning licenses for commercial use contact SBI Limited Warranty SBI warrants that the Product meets the specifications described in the accompanying Product Analysis Certificate If it is proven to the satisfaction of SBI that the Product fails to meet these specifications SBI will replace the Product or provide the purchaser with a refund This limited warranty shall not extend to anyone other than the original purchaser of the Product Notice of nonconforming products must be made to SBI within 30 days of receipt of the Product SBI s liability is expressly limited to replacement of Product or a refund limited to the actual purchase price SBI s liability does not extend to any damages arising from use or improper use of the Product or losses associated with the use of additional materials or reagents This limited warranty is the sole and exclusive warranty SBI does not provide any other warranties of any kind expr
5. 306 www systembio com Cancer MicroRNA qPCR Array with QuantiMir Cat RA610A 1 A polycistronic microRNA cluster miR 17 92 is overexpressed in human lung cancers and enhances cell proliferation Cancer Res 2005 Nov 1 65 21 9628 32 Hayashita Y Osada H Tatematsu Y Yamada H Yanagisawa K Tomida S Yatabe Y Kawahara K Sekido Y Takahashi T MicroRNA and lung cancer N Engl J Med 2005 Jun 9 352 23 2446 8 Eder M Scherr M Pancreatic Cancer Expression profiling identifies microRNA signature in pancreatic cancer Int J Cancer 2006 Dec 5 Epub ahead of print Lee EJ Gusev Y Jiang J Nuovo GJ Lerner MR Frankel WL Morgan DL Postier RG Brackett DJ Schmittgen TD Solid Tumors A microRNA expression signature of human solid tumors defines cancer gene targets Proc Natl Acad Sci U S A 2006 Feb 14 103 7 2257 61 Epub 2006 Feb 3 Volinia S Calin GA Liu CG Ambs S Cimmino A Petrocca F Visone R lorio M Roldo C Ferracin M Prueitt RL Yanaihara N Lanza G Scarpa A Vecchione A Negrini M Harris CC Croce CM MicroRNA and Cancer Reviews Other Publications Cancer genomics small RNAs with big impacts Nature 2005 Jun 9 435 7043 745 6 Meltzer PS MicroRNAs in Gene Regulation When the Smallest Governs It All J Biomed Biotechnol 2006 2006 4 69616 Ouellet DL Perron MP Gobeil LA Plante P Provost P MicroRNAs as oncogenes Curr Opin Genet Dev 2006 Feb 16 1 4 9 Epub 2005 Dec 19 Hammond SM
6. Oncomirs microRNAs with a role in cancer Nat Rev Cancer 2006 Apr 6 4 259 69 Esquela Kerscher A Slack FJ MicroRNAs as oncogenes and tumor suppressors Dev Biol 2006 Aug 16 Epub ahead of print Zhang B Pan X Cobb GP Anderson TA MicroRNAs and the hallmarks of cancer Oncogene 2006 Oct 9 25 46 61 70 5 Dalmay T Edwards DR MicroRNAs exhibit high frequency genomic alterations in human cancer Proc Natl Acad Sci U S A 2006 Jun 13 103 24 9136 41 Epub 2006 Jun 5 Zhang L Huang J Yang N Greshock J Megraw MS Giannakakis A Liang S Naylor TL Barchetti A Ward MR Yao G Medina A O brien Jenkins A Katsaros D Hatzigeorgiou A Gimotty PA Weber BL Coukos G 888 266 5066 Toll Free 650 968 2200 outside US Page 21 System Biosciences SBI User Manual VI Appendix A Related Products e QuantiMir RT Kit Cat RA420A 1 Complete reagent kit for anchor tagging small RNAs and converting them to quantifiable cDNA Kit contains enough reagents for 20 RT reactions and can generate hundreds of qPCR templates A universal reverse adaptor primer and positive control primers for Human U6 snRNA and Human miR 16 are also included with the kit e miRANDA qPCR Ready miRNA Tissue Expression Array Kit Cat RA600A 1 18 Human individual normal tissue miRNA cDNAs arrayed into a qPCR optical plate 4 complete sets of the 18 tissues 72 individual reactions A universal reverse adaptor primer and a positive control forw
7. RNA 500ng STEP 1 2 ul 5X PolyA Buffer 1 pl 25mM MnCl PolyA Tail 1 51 5mM ATP 0 5 ul PolyA Polymerase 10 ul Total in tube Incubate for 30 min at 37 C Add 0 5 yl Oligo dT Adaptor STEP 2 Anneal Anchor dT Adaptor Heat for 5 min at 60 C Let cool to room temp for 2 min Add 4 ul 5X RT Buffer STEP 3 2 ul dNTP mix 5 1 5 ul 0 1M DTT Synthesize 1 5 yl RNase free H20 cDNAs 1 ul Reverse Transcriptase 20 5 ul Total in tube Incubate for 60 min at 42 C Heat for 10 min at 95 C The QuantiMir cDNAs can be stored at 20 C For more sensitive applications a single phenol chloroform extraction Do ne with ethanol precipitation can be performed on the cDNA to remove proteins unutilized dNTPs and primers Typically this is not necessary Page 6 ver 1 070306 www systembio com Cancer MicroRNA qPCR Array with QuantiMir Cat RA610A 1 B Real time qPCR Reaction Setup 1 Mastermix qPCR Reaction Setup for 1 entire 96 well qPCR plate To determine the expression profile for your miRNAs under study mix the following for 1 entire qPCR plate For 1 entire plate 1 750 wl 2X SYBR Green qPCR Mastermix buffer 60 ul Universal Reverse Primer 10 uM 20 ul User synthesized QuantiMir cDNA 1 670 ul RNase free water 3 500 ul Total Aliquot 29u1 of Mastermix per well in your qPCR Plate SBI has tested and recommends SYBR Green Master mix from three vendors 1 Power SYBR Master Mix
8. TOOO0086 uagcaccaucugaaaucgguu MIMATOOOOLO0 juagcaccauuugaaaucaguguu MIMATOOO0681 juagcaccauuugaaaucggu Eine ire s00 5p arate Juguasazauosucjacungana H10 miR30a 5 MIMATOO00087 uguaaacauccucgacuggaag talus sama heat rae ET H12 U6snRNA NCBI X07425 1 caccacguuuauacgecgqug Page 12 ver 1 070306 www systembio com Cancer MicroRNA qPCR Array with QuantiMir Cat RA610A 1 lll Quality Control and Sample Data A Cancer qPCR Array Primer Validation Tests 1 Real time qPCR Validation AA MM z nenn The Cancer qPCR Array plate was tested using a pool of 18 Normal and 7 Tumor RNA samples converted to cDNA using the QuantiMir RT Kit The resulting cDNA was tested using 0 5 ul per well Shown at left is the resulting Real time amplification plot for the entire plate The Cts ranged from 13 93 to 25 50 reflecting over a 4 log fold cian expression detection range The experiment was performed as detailed in Section ILE Quantitative signals were observed for all wells in the array 2 End point PCR Validation M123 45 67 8 9 101112 The Cancer qPCR Array plate was tested using a pool of 18 Normal and 7 Tumor RNA samples converted to cDNA using the QuantiMir RT Kit The resulting cDNA was tested using 0 5 ul per well Shown at left is the resulting End point PCR analysis with equal amount of each PCR reaction loaded The PCR products
9. a separate multichannel pipette 888 266 5066 Toll Free 650 968 2200 outside US Page 7 System Biosciences SBI User Manual Page 8 Real time qPCR Instrument Parameters Follow the guidelines as detailed for your specific Real time instrumentation The following parameters tested by SBI were performed on an Applied Biosystems 7300 Real time PCR System but can also apply to an ABI 7500 or an ABI 7900 96 well system The details of the thermal cycling conditions used in testing at SBI are below A screenshot from SBI s ABI7300 Real time instrument setup is shown below also Default conditions are used throughout Create a detector 1 Create a new Detector 2 Name the Detector any name will do 3 Select Reporter Dye as SYBR 4 Select Quencher Dye as none 5 Highlight all wells and select this new detector to measure the signals Instrument Setup qPCR cyclingand OS data accumulation Eninsed Tie Remaing mn smee ase conditions KA rte 1 50 C 2 min mom ton pas 2 95 C 10 min Sao 3 95 C 15 sec Thama Pete Ado incemert amp Re 4 60 C 1 min aom i rs 40 cycles of steps 3 and 4 data read at 60 C 15 sec Step gold rectangle Attia asanda _AdsSinp _AdDenccton ace _ j e yana Sango Voima bA Fun Mase uda THD Daa Colection Stage 2 Siep 28008100 An additional recommendation is to include a melt analysis after the qPCR run to assess the Tm of
10. and heart The sensitivity of the assays also reveals very low but detectable signals in additional tissues miR 122a is known to be highly abundant in liver ver 1 070306 www systembio com Cancer MicroRNA qPCR Array with QuantiMir Cat RA610A 1 2 Analysis of Tumor and Normal Tissue MicroRNA Expression Levels using the QuantiMir Kit and Real time qPCR The QuantiMir cDNAs were synthesized from both Normal and Tumor Breast Lung Ovary Colon and Lymph node RNAs MicroRNA forward primers specific for miR 9 1 miR 155 miR 125 miR 145 miR 7 miR 17 3p miR 18a miR 20a and miR 92 were used to detect the corresponding microRNA species in the tissues detailed in the expression graph below Figure 5 The signals were normalized to expression levels of the U6 snRNA transcript Fold increases and decreases in Normal vs Tumor tissues are graphed below and are consistent with published findings for the particular microRNA in the specific tumor type Lymph Node Le E Normal E Tumor Colon Breast X aN Ovary m g E Fig 5 Quantitative analysis of MicroRNA expression in tumor and normal tissue samples The Bar graph data are grouped by tissue type with normal tissues in blue bars and tumor tissues in red bars The specific MicroRNAs being detected are listed below the bar graphs The expression levels are normalized to U6 snRNA transcript levels to control for RNA input The MicroRNA expr
11. ard primer U6 snRNA are also included with the kit e miRANDA Universal miRNA cDNA template Cat RA650A 1 Pool of all 18 Human miRNA cDNAs enough for 20 50 ul reactions a universal reverse adaptor primer and a positive control forward primer U6 snRNA e MicroRNA Discovery Kit Cat RA410A 1 Rapid identification of new MicroRNAs and MicroRNA like molecules Amplification and cloning can be initiated in a single day 3 steps 1 day The alternative method takes approximately 1 week 9 steps e Pre Made MicroRNA Enriched cDNAs Cat RA500A 1 RA509A 1 Tissue specific amplified cDNA generated by SBI using the MicroRNA Discovery Kit can be used for cloning microRNA e Global MicroRNA Amplification Kit Cat RA400A 1 Simple amplification kit allows cDNA amplification for qRT PCR and microarray studies from as little as 50 ng of starting total RNA e Full Spectrum Complete Transcriptome RNA Amplification Kit Cat RA101A 1 The Full Spectrum RNA Amplification Kit provides an inexpensive method to amplify reverse transcribed RNA in a sequence independent unbiased and uniform manner with better representation of 5 end of mRNA sequences This approach maintains the relative levels of each transcript in the starting Page 22 ver 1 070306 www systembio com Cancer MicroRNA qPCR Array with QuantiMir Cat RA610A 1 mRNA samples even when using starting amounts of RNA as low as 5ng or when using he
12. ature Nucleic Acids Research 34 D140 D144 Shingara J Keiger K Shelton J Laosinchai Wolf W Powers P Conrad R Brown D Labourier E 2005 An optimized isolation and labeling platform for accurate microRNA expression profiling RNA 11 1461 1470 He L Thomson J M Hemann M T Hernando Monge E Mu D Goodson S Powers S Cordon Cardo C Lowe S W Hannon G J 888 266 5066 Toll Free 650 968 2200 outside US Page 19 System Biosciences SBI User Manual Hammond S M 2005 A microRNA polycistron as a potential human oncogene Nature 435 828 833 16 Lai E C Wiel C Rubin G M 2004 Complementary miRNA pairs suggest a regulatory role for miRNA miRNA duplexes RNA 70 171 175 17 Ambros V Bartel B Bartel D P Burge C B Carrington J C Chen X Dreyfuss G Eddy S R Griffiths Jones S Marshall M Matzke M Ruvkun G Tuschl T 2003 A uniform system for microRNA annotation RNA 9 277 279 18 Obernosterer G Leuschner P J F Alenius M Martinez J 2006 Post transcriptional regulation of microRNA expression RNA 12 1 7 19 Dostie J Mourelatos Z Yang M Sharma A Dreyfuss G 2003 Numerous microRNPs in neuronal cells containing novel microRNAs RNA 9 180 186 B MicroRNA and Cancer References Breast Cancer MicroRNA gene expression deregulation in human breast cancer Cancer Res 2005 Aug 15 65 16 7065 70 lorio MV Ferracin M Liu CG Ve
13. avily degraded RNA e Full Spectrum MultiStart Primers for T7 IVT Cat RA300A 2 Extract more data from your RNA than currently available primers in nearly all commercially available T7 IVT kits using Full Spectrum technology Just replace the existing T7 primer with the Full Spectrum primers Compatible with Affymetrix GeneChip hybridization B Technical Support For more information about SBI products and to download manuals in PDF format please visit our web site http www systembio com For additional information or technical assistance please call or email us at System Biosciences SBI 1616 North Shoreline Blvd Mountain View CA 94043 Phone 650 968 2200 888 266 5066 Toll Free Fax 650 968 2277 E mail General Information info systembio com Technical Support tech systembio com Ordering Information orders systembio com 888 266 5066 Toll Free 650 968 2200 outside US Page 23 System Biosciences SBI User Manual Vil Licensing and Warranty Statement Limited Use License Use of the Cancer MicroRNA qPCR Array Kit wth QuantiMir i e the Product is subject to the following terms and conditions If the terms and conditions are not acceptable return all components of the Product to System Biosciences SBI within 7 calendar days Purchase and use of any part of the Product constitutes acceptance of the above terms Purchase of the product does not grant any rights
14. enough for 20 reactions E Additional Required Materials Real time qPCR Instrument Instrument specific optical qPCR plates Thermocycler with heated lid Thermocycler PCR tubes or plates for end point reactions PCR Mastermix including Taq polymerase for PCR 3 0 3 5 Agarose Gel in Tris Borate EDTA TBE or Tris Acetate EDTA TAE Buffer e DNA Size Ladder with markers from 50 to 2 000 bp Bio Rad AmpliSize DNA Ladder Cat 170 8200 e Nuclease free water for GPCR reactions IMPORTANT Recommended 2X SYBR Green qPCR Mastermixes SBI has tested and recommends SYBR Green Master mix from three vendors Power SYBR Master Mix Cat s 4368577 4367650 4367659 4368706 4368702 4368708 4367660 from Applied Biosystems SYBR GreenER qPCR SuperMix for ABI PRISM instrument from Invitrogen Cat s 11760 100 11760 500 and 11760 02K and RT Real Time SYBR Green ROX PCR Cat s PA 012 and PA 112 from SuperArray 888 266 5066 Toll Free 650 968 2200 outside US Page 5 System Biosciences SBI User Manual ll Protocol A QuantiMir RT Reaction Setup for 1 RNA sample to be assayed on 1 qPCR plate It is important to start with total RNA that includes Wi the small RNA fraction RNA input can be as low as 10 ng ul For optimum signals perform the following gt Dilute your RNA to 100 ng ul In a thin walled PCR tube or Start PCR compatible plate well combine 5 ul Total
15. essed or implied including the merchantability or fitness of the Product for a particular purpose SBI is committed to providing our customers with high quality products If you should have any questions or concerns about any SBI products please contact us at 888 266 5066 2007 System Biosciences SBI Page 24 ver 1 070306 www systembio com
16. ession levels are depicted as ACt vales Y axis Real time assays were performed as described in Section II D 2 of this manual 888 266 5066 Toll Free 650 968 2200 outside US Page 17 System Biosciences SBI User Manual IV Troubleshooting Problem Possible Solution Too much background in Use much less cDNA in the SYBR qPCR signals Green Mastermix No qPCR signals Did you select SYBR Green as the Detector s Reporter Dye Did the U6 control work Use more cDNA in Mastermix Check Mastermix contents and try a subset with U6 as a positive control Also try lowering the Annealing Temperature to 50 C How do select the Threshold Typically place the threshold setting level for Ct analysis in the upper third of the exponential phase of the amplification curve Also see the User Manual for your specific instrument or contact their technical support team for guidance Page 18 ver 1 070306 www systembio com Cancer MicroRNA qPCR Array with QuantiMir Cat RA610A 1 V References A General References d 10 11 12 13 14 15 Sonthelmer E J Carthew R W 2005 Silence from within Endogenous siRNAs and miRNAs Cell 122 9 12 Zamore P D Haley B 2005 Ribo gnome The big world of small RNAs Science 309 1519 1524 Bartel D 2004 MicroRNAs Genomics Biogenesis Mechanism and Function Cell 116 281 297 Kim Narry V 2005 Small RNAs Classification Biogene
17. included in kit 5 TAGCAGCACGTAAATATTGGCG 3 Tm 58 9 C 45 GC and length 22 bases All of the MicroRNA specific primers for the QuantiMir Cancer qPCR Array were designed in this fashion For the MicroRNA family members degenerate primers were designed to detect the MicroRNA family members as listed in the Array plate arrangement Section II D 888 266 5066 Toll Free 650 968 2200 outside US Page 9 System Biosciences SBI User Manual D Cancer MicroRNA Array Arrangement Plate Array Arrangement A ffamily miR7 miR 92 miR93 mi _ miR 101 1 miR 103 __ miR 106a miR 106b miR 107 miR 10b_ miR 1 1 B _ miR 122a miR 125a miR 125b miR 126 miR 128b miR 132__ miR 133a miR 134 _ miR 135b miR 136 __ miR 137 _ miR 140 miR 142 C miR 141_Bp miR 143 _ miR 145 miR 146a miR 149 miR 150 _ miR 151 _ miR 153__ miR 154 miR 155 _ miR 15a miR 17 miR 17 D _ miR 15b_miR 16__Bp pp ImiR 181a miR 181b miR 181c miR 181d miR 183 miR 185 _ miR 186 _ miR 188 miR miR E miR 18a _ miR 190 miR 191 miR 192 _ miR 194 miR 195 _ miR 196a miR 197 _ miR 198_ 199a b __ miR 30b_ 19a b F miR95 miR20a miR 200a miR 200b miR200c miR 202 _ miR 203 miR 204 miR 205 miR 206 miR 21 _ miR 210 G miR 214 miR 215 miR 372 miR 373 miR 218 miR 219 miR 22 miR488 miR 221 miR 222 miR 223 miR 224 ImiR ImiR ImiR 30a miR 30a H _ miR 23a _ miR 24 miR 25 miR26a_ miR26b 7a b MIR30c_ Iatb c B
18. le Cancer MicroRNA Expression Profile Setup QuantiMir cDNA synthesis Use QuantiMir to synthesize cDNA from your RNA Samples Normal tissue RNA Carcinoma tissue RNA Tube 1 j Tube 2 2 hours Combine QuantiMir cDNA Reverse Primer SYBR Green MasterMix Yrorma cDNA Carcinoma cDNA SYBR Green MasterMix MasterMix fi MasterMix Aliquot 30 ul MasterMix into each well Each plate contains 95 miRNA genes and U6 control 30 minutes qPCR Array 1 qPCR Array 2 Each Array Plate contains the x 2 same set of 96 Load Oligos and MasterMix IA ve Spi primers in the Array into qPCR optical plate Perform qPCR Thermal Cycling is Collect real time data according to your instrument s specifications 30 minutes Normal tissue Profile Carcinoma tissue Profile i Wy p jj Yo Run Real time PCR y ie Me ree M 1 5 hours Bamsa a Bar ma Analyze Fold Changes in MicroRNA Expression Normalize 2 plates with U6 levels and Calculate fold changes present in 95 different miRNAs h il mM AVA all ahhh ul mI hl ma Discover MicroRNA Biomarkers Start with as little of 200 pg total RNA and convert to cDNA with the QuantiMir RT System Use this cDNA as template mixed in with a SYBR Green Mastermix plus the Universal reverse primer included in kit Aliquot SYBR Green Mastermix into qPCR optical plate Resuspend primers in Primer plate with 10ul RNase free water then pipet 1ul of each of the MicroRNA specific prime
19. ng and quantifying novel miRNA and siRNA molecules involves Northern blotting with hybridization Detecting and quantitating known miRNAs can be done using pre designed reverse priming and reverse transcription followed by primer sets built for the specific miRNA for Real time PCR analysis These sets require many steps and can take several hours to complete and trouble shoot The QuantiMir RT kit provides all the reagents necessary to anchor tail and convert small non coding RNAs into cDNA starting from total RNA samples Once the user performs the reactions on their RNA samples the cDNAs are ready to use for either End point PCR experiments or to perform Real time qPCR analysis MicroRNA expression signatures have become more clinically Page 2 ver 1 070306 www systembio com Cancer MicroRNA qPCR Array with QuantiMir Cat RA610A 1 important recently with the discovery of distinct expression patterns and fold changes observed in Normal versus Tumor RNA samples The Cancer MicroRNA qPCR Array with QuantiMir enables the discovery of new MicroRNA signatures using 95 different MicroRNAs known to be involved in apoptosis cell fate development and cancer from a diverse set of RNA samples Pri mi RNA Mature miRNA within RISC Fig 1 Diagram of MicroRNA biogenesis processing and function 888 266 5066 Toll Free 650 968 2200 outside US Page 3 System Biosciences SBI User Manual C Overview of Entire Protocol Examp
20. or the sense orientation of miR 542 3p No signals are observed in the antisense or no template controls The annealing temperature for the qPCR cycling conditions was lowered to 50 C 888 266 5066 Toll Free 650 968 2200 outside US Page 15 System Biosciences SBI User Manual D Sample Data 1 Page 16 Tissue Expression Pattern Determinations using the QuantiMir Kit on Normal Human Tissues The QuantiMir cDNA sets were synthesized from 18 separate normal Human tissues and tested with 2 primers specific for 2 known miRNA molecules miR 1 heart and skeletal muscle specific and miR 122a abundant in liver The amplification plots and corresponding expression bar graphs are shown in Figure 4 panels a and b mir 1 T a E on ol 25 4576 ea Ee a miR 122a z S a s 123456 7 8 9 10 1112 1314 1516 1718 Fig 4 Real time qPCR data using primers specific for Human miR 1 Panel a and for miR 122a Panel b The amplification plots are shown on the left with the resulting expression profile bar graphs based on Ct values is shown on the right The default qPCR cycling conditions were used with an annealing temperature of 60 C in Step 2 of Stage 3 These two known miRNAs miR 1 and mir 122a have very specific tissue expression patterns Real time qPCR data confirmed that miR 1 is restricted to skeletal muscle
21. p bp ImiR296 U6 snRNA All 95 microRNAs chosen for the array have published implications with regard to potential roles in cancer cell development and apoptosis see Section V B The array plate also includes the U6 transcript as a normalization signal well H12 See accompanying data CD for access to these details Page 10 ver 1 070306 www systembio com Cancer MicroRNA qPCR Array with QuantiMir Cat RA610A 1 MicroRNA Well MicroRNA MirBase Sequence s Al i MIMATOOO00062 jugagquaguagquuguauaquu MIMATOOO0064 ugagguaguagguuguaugguu MIMATOOO0065 jagagquaquagguugcauagu MIMATOO00067 ugagguaguagauuguauaquu A2 A3 A4 miR93 mimaToooo093 aaagugcuguucgugcagguag A5 AG miR9 1 mimaTooo0441 ucuuuggquuaucuagcuguauga miR 101 1 _ iMaTO000099 uacaquacugugauaacugaag AT AB AI miR 106b MIMATODDD6S0 _ uaaagugcugacagugcagau A10 miR 107 agcagcauuguacagggcuauca All MIM amp T0000254 uacccuguagaaccgaauuugu A12 i MIMA4TO000416 Juggaauguaaagaaguaugua B1 MIMATO000421 B3 B3 125b MIMATO000423 ucccugagacccuaacuuguga B5 B5 _ m 128b MIMATOOO0676 ucacagugaaccggucucuuuc B7 B7 miR 133a MIMATO000427 uugguceccuucaaccagcugu Bo B9 _ miR 135b MIMAT0000758 uauggcuuuucauuccuaugug B11 miR 137 MIMATO000429 uauugcuuaagaauacgcguag C1 miR 141 MIMATO000432 uaacacugucugguaaagaugg a G3 43 MIMATO000435 ugagaugaagcacuguagcuca S c5 46a MIMAT0000449
22. ronese A Spizzo R Sabbioni S Magri E Pedriali M Fabbri M Campiglio M Menard S Palazzo JP Rosenberg A Musiani P Volinia S Nenci 1 Calin GA Querzoli P Negrini M Croce CM MicroRNA expression profiles classify human cancers Nature 2005 Jun 9 435 7043 745 6 Lu J Getz G Miska EA Alvarez Saavedra E Lamb J Peck D Sweet Cordero A Ebert BL Mak RH Ferrando AA Downing JR Jacks T Horvitz HR Golub TR B cell Leukemia MicroRNA profiling reveals distinct signatures in B cell chronic lymphocytic leukemias Proc Natl Acad Sci U S A 2004 Aug 10 101 32 11755 60 Epub 2004 Jul 29 Calin GA Liu CG Sevignani C Ferracin M Felli N Dumitru CD Shimizu M Cimmino A Zupo S Dono M Dell Aquila ML Alder H Rassenti L Kipps TJ Bullrich F Negrini M Croce CM A MicroRNA signature associated with prognosis and progression in chronic lymphocytic leukemia N Engl J Med 2005 Oct 27 353 17 1793 801 Calin GA Ferracin M Cimmino A Di Leva G Shimizu M Wojcik SE lorio MV Visone R Sever NI Fabbri M luliano R Palumbo T Pichiorri F Roldo C Garzon R Sevignani C Rassenti L Alder H Volinia S Liu CG Kipps Tu Negrini M Croce CM Lung Cancer Unique microRNA molecular profiles in lung cancer diagnosis and prognosis Cancer Cell 2006 Mar 9 3 189 98 Yanaihara N Caplen N Bowman E Seike M Kumamoto K Yi M Stephens RM Okamoto A Yokota J Tanaka T Calin GA Liu CG Croce CM Harris CC Page 20 ver 1 070
23. rs from the Primer plate into the corresponding well of the qPCR plate primer in well A1 goes into A1 in the qPCR plate etc Perform Real time PCR run and analyze fold changes in 95 different MicroRNAs after normalizing to the control U6 well H12 in your 2 experimental sample tissues in this example Normal vs Carcinoma You can use the quantitation results MS Excel file provided on the CD with the kit to help you perform the normalization and fold differences calculations with graphical analysis of your experiment if you choose Page 4 ver 1 070306 www systembio com Cancer MicroRNA qPCR Array with QuantiMir Cat RA610A 1 D List of Components Each MicroRNA Cancer qPCR Array Kit contains the following components with enough material to perform 20 QuantiMir cDNA synthesis reactions and enough Primers in the Primer Array plate to perform 10 qPCR plates as outlined in this manual 80 ul 5X Reverse Transcriptase Buffer enough for 20 reactions End point or qPCR Assay Array Primers dried down in Primer plate enough for 1 200 reactions 100 moles resuspend in 10p RNase free Water RNase free Water The kit is shipped on blue ice and should be stored at 20 C upon arrival Properly stored kits are stable for 1 year from the date received The oligonucleotides for the specific MicroRNAs are dried down in the wells of the optical qPCR plates Resuspend in 10ul RNase free water 10 pl Poly A Reaction
24. sis and Function Mol Cells 19 1 15 Valencia Sanchez MA Liu J Hannon GJ Parker R 2006 Control of translation and mRNA degradation by miRNAs and siRNAs Genes Dev 20 515 525 Lewis B P Burge C B Bartel D P 2005 Conserved seed pairing often flanked by adenosines indicates that thousands of human genes are microRNA targets Cell 120 15 20 Xie X Lu J Kulbokas E J Goulub T R Mooth V Lindblad Toh K Lander E S and Kellis M Systematic discovery of regulatory motifs in human promoters and 3 UTRs by comparison of several mammals Nature 434 338 45 Lagos Quintana M Rauhut R Lendeckel W Tuschl T 2001 Identification of Novel Coding for Small Expresses RNAs Science 294 853 858 Basyuk E Suavet F Doglio A Bordonne R Bertrand E 2003 Human let 7 stem loop precursors harbor features of RNase IIl cleavage products Nucleic Acids Res 31 6593 6597 Chomczynski P and Mackey K One hour downward capillary blotting of RNA at neutral pH 1994 Anal Biochem 221 303 305 Shi R Chiang V L 2005 Facile means for quantifying microRNA expression by real time PCR BioTechniques 39 519 525 Ding Y Chan C Y and Lawrence C E 2005 RNA secondary structure prediction by centroids in a Boltzmann weighted ensemble RNA 11 1157 1166 Griffiths Jones S Grocock R J Van Dongen S Bateman A Enright A J 2006 miRBase microRNA sequences targets and gene nomencl
25. t Page 14 ver 1 070306 www systembio com Cancer MicroRNA qPCR Array with QuantiMir Cat RA610A 1 C Specificity Tests To assess the specificity and proper orientation of the miRNA array oligonucleotide primers are synthesized both in the sense and the antisense orientation An example for the known documented miRNA miR 542 3p is detailed below Hsa miR 542 3p Mature sequence MIMAT0003389 Sequence of mature miRNA as forward primer in sense IDE hsa miR 542 3p oligo design and then designed in the antisense Sequence 22 so uavescauauuasussnnases 7 2 oligo as control assena MIMATOOO3389 ae experimental cloned 1 The mature miRNA sequence 5 ugugacagauugauaacugaaa 3 can be converted to a DNA sequence along with designing its complement or antisense primer sequence Forward sense primer for hsa miR 542 3p 5 TGTGACAGATTGATAACTGAAA 3 Forward antisense primer for hsa miR 542 3p 5 TTTCAGTTATCAATCTGTCACA 3 Tm 49 6 C 32 GC and length 22 bases miR542 3p Sense and Antisense Signal Profiles Sigal Undil 1 2 1 5 1 10 NTC Undil 1 2 15 1 10 NTC Fig 3 Sense and antisense test of the QuantiMir cDNA Dilutions of the QuantiMir cDNA template as well as no template controls NTC were tested with either sense or antisense orientation for the Human miR 542 3p molecule Quantitative results are observed f
26. the PCR amplicon to verify the specificity of the amplification reaction Refer to the User Manual for your specific instrument to conduct the melt analysis and the data analyses of the amplification plots and Cycle Threshold Ct calculations In general Cycle thresholds should be set within the exponential phase of the amplification plots with software automatic baseline settings ver 1 070306 www systembio com Cancer MicroRNA qPCR Array with QuantiMir Cat RA610A 1 C How the miRNA Specific Primers are Designed for Detection and Quantitation in the Array MicroRNAs typically range in size from 19 24 nt We recommend using the exact sequence of the miRNA or siRNA being studied when designing the forward primer If the miRNA under study is known and documented using the miRBase database can be an easy starting point http microrna sanger ac uk sequences search shtml An example of the known and documented miRNA Human miR 16 is shown below Hsa miR 16 Mature sequence MIMATO000069 Simple Directly use sequence of mature miRNA as forward primer in oligo design Freese MIMATOOOO069 IBE hsa miR 16 14 uagcagcacguaaauauuggcg 35 Sequence mea experimental cloned 1 5 7 Northern 1 6 The mature miRNA sequence 5 uagcagcacguaaauauuggcg 3 can be simply converted to a DNA sequence and used directly as the forward primer for end point and qPCR analysis Forward primer for hsa miR 16
27. ugagaacugaauuccauggguu cr C7 150 MIMA amp TO000451 ucucccaacccuuguaccagug a C9 _ miR 153 MIMAT0000439 uugcauagucacaaaaguga c10 MIMATOO00452 uagguuauccguguugccuucg c11 155 MIMATOO00646 uuaaugcuaaucgugauagggg C12 MIMATOO00068 uagcagcacauaaugguuugug D1 MIMATOO004 17 uagcagcacaucaugguuuaca m2 D3 miR ma N MIMATOOO007 1 acugcagugaaggcacuugu D4 miR 17 5p MIMATOO00070 caaagugcuuacagugcagguagu D5 miksta Mima Toomas aacauucaacgcugucugugagu D6 _ Oe aacauucauugcugucgguggg D7 MIM amp T0000258 _ aacauucaaccugucggugagu D8 i MIMATO002821 aacauucauuguugucgguggguu it D10 _ miR 185 MIMATO000455 uggagagaaaggcaguuc D12_ miR 188 MIMATO000457 caucccuugcaugguggagggu 888 266 5066 Toll Free 650 968 2200 outside US Page 11 System Biosciences SBI User Manual MicroRNA Well MicroRNA MirBase Sequence s MIMATOOOOO72 juaaggugcaucuagugcagaua E2 miR 190 MimATOD00458 _ ugauauguuugauauauuaggu E3 miR 191 OO MIMATODD0440 caacggaaucccaaaagcagcu E4 miR 192 OC mmaTo000222 cugaccuaugaauugacagee ES miRidi MImATODD0460 _luguaacagcaacuccauguaga E6 miR 195 MImATODD0461 Juageageacagaaauauugge E7 miR 196a____ vimaTo000226 uagquaguuucauguuguugg E8 miR 197 mimaToD00227 Jfuucaccaccuucuccacccage E9 miR 198_____ mumaToo00228 gquecagaggggagauagg miR 199aeb MIMATO000231 cccaguguucagacuaccuguuc MIMATOO00263 cccaguguuuagacuaucuguuc
28. were separated on a 3 5 agarose gel and imaged The array locations are identical to the well labels for the specific MicroRNA primer being tested Various band intensities reflect the spectrum of expression levels observed for the particular MicroRNA detected in the cDNA sample pool o 0 Uu PF E a 9 a 888 266 5066 Toll Free 650 968 2200 outside US Page 13 System Biosciences SBI User Manual B Sensitivity Tests The QuantiMir cDNAs were synthesized using decreasing amounts of total starting RNA input from a pool of Human Brain Heart Kidney Placenta and Testes RNAs Real time quantitative qPCR assays were performed with Forward primers specific for Human miR 16 and Human miR 24 For procedure see Section II D 1 Protocol Real time qPCR j if SA ne in it gt y P N j RNA Input Signal Signa RMA input miR 16 fpe 098 s s 2 4772 GETT miR 24 yr 092 20196 Pa n 09037 ae Fig 2 Real time qPCR data for Human miR 16 and Human miR 24 Real time qPCR amplification plots are shown in the upper inset Cycle threshold Ct values were determined using the software automatic baseline and Ct settings The Bar graph depicts the relative Signal per RNA input amount for the microRNA The graph below shows the linear regression analysis with a R value of 0 971 for miR 16 and 0 993 for miR 24 Both microRNAs are readily detectable down to 200 pg of total starting RNA inpu
29. xperimental RNA samples The array plate also includes the U6 transcript as a normalization signal All 95 microRNAs chosen for the array have published implications with regard to potential roles in cancer cell development and apoptosis To ensure optimal results please read the entire manual before using the reagents and material supplied with this kit B Importance of MicroRNAs and Other Small Non Coding RNAs The field of non coding RNAs has gained increasing attention in recent years particularly due to the discovery of small interfering RNAs siRNAs and micro RNAs miRNA These RNAs are short typically 19 24 nucleotides single stranded moieties that regulate the expression of target genes by interacting with complementary sites within the target mRNAs and either repressing translation or eliciting target MRNA degradation miRNAs and siRNAs are conserved groups of non coding RNAs with very important regulatory roles Mature miRNAs and siRNAs are excised from stem loop precursors which are themselves transcribed as part of longer primary transcripts These primary miRNAs appear to be first processed by the RNase Drosha in the nucleus after which the precursor miRNAs are exported to the cytoplasm where the RNase Dicer further processes them These enzymes are also involved in the generation of mature small inhibitory RNAs siRNA from exogenously transferred double stranded siRNA precursors The current standard method for detecti
Download Pdf Manuals
Related Search