Home

pBAD/Thio His TOPO manual - Thermo Fisher Scientific

1. Life Technologies Corporation shall have no responsibility or liability for any special incidental indirect or consequential loss or damage whatsoever The above limited warranty is sole and exclusive No other warranty is made whether expressed or implied including any warranty of merchantability or fitness for a particular purpose Purchaser Notification Introduction Limited Use Label License No 5 Invitrogen Technology Limited Use Label License No 21 Bac to Bac and Bac to Bac HT Limited Use Label License No 22 Vectors and Clones Encoding Histidine Hexamer Use of the Bac to Bac HBM TOPO Expression System and the pFastBac HBM TOPO vector is covered under the licenses detailed below The purchase of this product conveys to the buyer the non transferable right to use the purchased amount of the product and components of the product in research conducted by the buyer whether the buyer is an academic or for profit entity The buyer cannot sell or otherwise transfer a this product b its components or c materials made using this product or its components to a third party or otherwise use this product or its components or materials made using this product or its components for Commercial Purposes The buyer may transfer information or materials made through the use of this product to a scientific collaborator provided that such transfer is not for any Commercial Purpose and that such collaborat
2. cells 3 Pick colonies isolate plasmid DNA see below and screen for insert directionality by sequencing expression clones with the primers provided in the kit For detailed instructions refer to the Bac to Bac TOPO Cloning Kit manual part no A10605 supplied with this kit The Bac to Bac TOPO Cloning Kit manual is also available at www invitrogen com or from Technical Support see page 56 1 Pick 10 overnight grown colonies from the selective plates and culture them overnight in LB medium containing 100 pg mL ampicillin 2 Isolate plasmid DNA using your method of choice If you need ultra pure plasmid DNA for automated or manual sequencing we recommend using Invitrogen s PureLink HiPure Mini Plasmid Purification Kit see page 53 for ordering information You need 1 ng of purified recombinant plasmid 5 uL at 200 pg pL to TM transform into DH10Bac E coli for transposition into the bacmid see page 11 Note If you have used One Shot Mach1 T1 Chemically Competent E coli for your transformation you can prepare plasmid DNA 4 hours after inoculating a single overnight grown colony in the selective media of choice Note that this feature is not limited to ampicillin selection When generating the recombinant plasmid containing your gene of interest for use in the Bac to Bac HBM TOPO Secreted Expression System you must follow certain design parameters for your PCR insert and the recommendations for the
3. system Control over environmental Murhammer amp e Dissolved oxygen control variables in the culture Goochee 1988 module Increased cell densities Onken amp Weiland 1983 e Dissolved oxygen electrode Elevated protein production Moa 3 i Rei tal e Microbial air filters oy Qon e 1 4 stainless steel tubing e Silicone tubing e Circulating water bath Insect Larvae Trichoplusia ni larvae and More accurate Medin et al facilities to grow larvae posttranslational modification 1990 of recombinant protein does Wood et al not rely on one cell type only 1993 Higher levels than in cell culture Inexpensive 43 Troubleshooting Cloning into the For troubleshooting any problems you may encounter when generating your pFastBac HBM pFastBac HBM TOPO construct refer to the Bac to Bac TOPO Cloning Kit TOPO Vector manual part no A10605 supplied with this kit The Bac to Bac TOPO Cloning Kit manual is also available at www invitrogen com or by contacting Technical Support see page 56 Generating The table below lists some potential problems that you may encounter when Recombinant generating the recombinant bacmid following transformation into DH10Bac Bacmid DNA E coli Problem Reason Solution 44 No blue colonies non recombinant obtained i e all colonies are white Note Although you will pick white colonies you should expect t
4. Analyzing Recombinant Protein Continued Glycosylation Purifying Recombinant Protein Removing the 6xHis Tag Using AcTEV Protease Assay for B glucuronidase When expressing and purifying a glycosylated protein in a heterologous expression system quickly determine whether the protein is glycosylated properly Refer to published protocols for carbohydrate analysis of proteins to characterize glycosylated proteins of interest Ausubel et al 1994 Further information about glycosylation in eukaryotes is also available in published literature Varki amp Freeze 1994 The presence of the C terminal 6xHis tag in the pFastBac HBM TOPO vector allows the purification of your recombinant protein with a metal chelating resin such as ProBond and Ni NTA available from Invitrogen see page 55 for ordering information Refer to the manual included with each product for guidelines to purify your fusion protein These manuals are available for downloading at www invitrogen com or by contacting Technical Support page 56 The pFastBac HBM TOPO vector contains a Tobacco Etch Virus TEV recognition site that allows the removal of the 6xHis tag from your recombinant fusion protein using AcTEV Protease available separately from Invitrogen see page 53 for ordering information Instructions for digestion are included with the product For more information refer to www invitrogen com or contact Technical Support see
5. Inlow D Shauger A and Harano D 1988 Large Scale Insect Cell Culture for Recombinant Protein Production Bio Technology 6 1406 1410 Medin S A Hunt L Gathy K Evans R K and Coleman M S 1990 Efficient Low cost Protein Factories Expression of Human Adenosine Deaminase in Baculovirus infected Insect Larvae Proc Natl Acad Sci USA 87 2760 2764 Murhammer D and Goochee C F 1988 Scale up of Insect Cell Cutures Protective Effects of Pluronic F 68 Bio Technology 6 1411 1415 Continued on next page 59 References Continued O Reilly D R Miller L K and Luckow V A 1992 Baculovirus Expression Vectors A Laboratory Manual W H Freeman and Company New York N Y Onken U and Weiland P 1983 Airlift Fermentors Construction Behaviour and Uses Biotechnol Proc 1 67 95 Tom R L Caron A W Massie B and Kamen A 1995 Scale up of Recombinant Virus and Protein Production in Stirred tank Reactors Methods in Molecular Biology Richardson C D Ed 39 Humana Press Totowa NJ Varki A and Freeze H H 1994 The Major Glycosylation Pathways of Mammalian Membranes A Summary Subcell Biochem 22 71 100 Wood H A Trotter K M Davis T R and R H P 1993 Per Os Infectivity of Preoccluded Virions from Polyhedrin Minus Recombinant Baculoviruses J Invert Path 62 64 67 2009 Life Technologies Corporation All rights reserved For research use o
6. EEC on the contained use of genetically modified organisms The parental strain of Mach1 T1 E coli is the non K 12 wild type W strain ATCC 9637 S A Waksman Although the parental strain is generally classified as Biosafety Level 1 BL 1 we recommend that you consult the safety department of your institution to verify the Biosafety Level TM The DH10Bac strain is genetically modified and carries the pBR322 derived plasmid pMON7124 bom tra mob As a condition of sale this product must be in accordance with all applicable local legislation and guidelines including EC Directive 90 219 EEC on the contained use of genetically modified organisms References Ausubel F M Brent R Kingston R E Moore D D Seidman J G Smith J A and Struhl K 1994 Current Protocols in Molecular Biology Greene Publishing Associates and Wiley Interscience New York Barry G F 1988 A Broad Host Range Shuttle System for Gene Insertion into the Chromosomes of Gram negative Bacteria Gene 71 75 84 Ciccarone V C Polayes D and Luckow V A 1997 Generation of Recombinant Baculovirus DNA in E coli Using Baculovirus Shuttle Vector Methods in Molecular Medicine Reischt U Ed 13 Humana Press Inc Totowa NJ Davis T R Trotter K M Granados R R and Wood H A 1992 Baculovirus Expression of Alkaline Phosphatase as a Reporter Gene for Evaluation of Production Glycosylation and Secre
7. One Shot Mach1 T1 Chemically Competent E coli 1 kit MAX Efficiency DH10Bac Competent E coli 4 kits Cellfectin II Reagent 1each Bac to Bac TOPO Cloning Kit manual 1 each Bac to Bac HBM TOPO Secreted Expression System 1 each manual Shipping Storage The Bac to Bac HBM TOPO Secreted Expression System is shipped in four boxes as described below Upon receipt store each box as detailed below All reagents are guaranteed for six months if stored properly Box Item Shipping Storage 1 Bac to Bac HBM TOPO Cloning Kit Dry ice 20 C 2 One Shot Mach1 T1 Chemically Dry ice 80 C Competent E coli 3 MAX Efficiency DH10Bac Competent Dry ice 80 C E coli 4 Cellfectin II Reagent Gel ice 4 C Continued on next page Kit Contents and Storage Continued Bac to Bac HBM TOPO Cloning Kit The cloning reagents for the Bac to Bac HBM TOPO Cloning Kit are listed below Store the contents at 20 C plasmid Item Concentration Amount pFastBac HBM TOPO 20 mL at 10 ng pl in 20 ul Sector 50 glycerol 50 mM Tris HCl pH 7 4 at 25 C 1mMEDTA 2 mM DTT 0 1 Triton X 100 100 pg mL BSA 30 pM bromophenol blue 10X PCR Buffer 100 mM Tris HCI pH 8 3 at 42 C 100 uL 500 mM KCI 25 mM MgCl 0 0176 gelatin dNTP Mix 12 5 mM each dATP dCTP dGTP 10 uL and dTTP neutralized at pH 8 0 in water Salt Solution 1
8. The time points provided below assume that the transfection was successful i e transfection efficiency was high Signs of Infection Phenotype Description Early first 24 hours Increased cell diameter A 25 50 increase in cell diameter may be seen Increased size of cell nuclei Nuclei may appear to fill the cells Late 24 72 hours Cessation of cell growth Cells appear to stop growing when compared to a cell only control Granular appearance Signs of viral budding vesicular appearance to cells Detachment Cells release from the plate or flask Very Late gt 72 hours Cell lysis Cells appear lysed and show signs of clearing in the monolayer Preparing the P1 Viral Stock 1 When the transfected cells from Step 6 previous page demonstrate signs of late stage infection e g 72 hours post transfection collect the medium containing the virus from each well 2 mL and transfer to sterile 15 mL snap cap tubes Centrifuge the tubes at 500 x g for 5 minutes to remove cells and large debris 2 Transfer the clarified supernatant to fresh 15 mL snap cap tubes This is the P1 viral stock Store at 4 C protected from light See the next page for additional storage information Note To concentrate your viral stock to obtain a higher titer filter your viral supernatant through a 0 2 um low protein binding filter after the low speed centrifugati
9. transformation procedure outlined in the Bac to Bac TOPO Cloning Kit manual To ensure proper expression of your recombinant protein it is imperative that you read the sections on generating the blunt end PCR product blunt end TOPO Cloning transforming One Shot Mach1 T1 Chemically Competent EF coli and analyzing transformants in the Bac to Bac TOPO Cloning Kit manual before beginning For a vector map of pFastBac HBM TOPO see page 51 For more instructions on generating your recombinant plasmid containing your gene of interest refer to the Bac to Bac TOPO Cloning Kit manual part no A10605 supplied with this kit also available at www invitrogen com or by contacting Technical Support see page 56 Generating the Recombinant Bacmid Transforming DH10Bac E coli Introduction After you have generated your pFastBac HBM construct containing your gene of interest transform purified plasmid DNA into DH10Bac E coli for transposition into the bacmid Use blue white selection to identify colonies containing the recombinant bacmid MAX Efficiency DH10Bac chemically competent cells are supplied with the Bac to Bac HBM TOPO Secreted Expression System These cells are also available separately from Invitrogen see page 53 Guidelines and instructions for transforming DH10Bac cells are provided in this section Positive Control The pFastBac HBM TOPO vector is supplied with the control plasmid
10. Check the quality of your plasmid DNA make sure that the DNA is not degraded Gentamicin omitted from plates Prepare fresh selective plates containing 50 ug mL kanamycin 7 ug mL gentamicin 10 ug mL tetracycline 100 ng mL Bluo gal and 40 ug mL IPTG Few colonies obtained Used LB medium for recovery expression period Use S O C Medium for the 4 hours growth time Recovery expression time too short Increase the recovery time to gt 4 hours at 37 C or 6 hours at 30 C Poor blue white colony differentiation Agar not at correct pH Adjust pH of LB agar to 7 0 Intensity of the blue color too weak e Use Bluo gal not X gal e Increase the concentration of Bluo gal to 300 pg mL e Use dark and light backgrounds to view plates Too many or too few colonies on plate Adjust the serial dilutions of cells to obtain an optimal number of colonies Incubation period too short or temperature too low e Do not pick colonies until 48 hours after plating e Incubate plates at 37 C IPTG concentration not optimal Optimize the IPTG concentration A range of 20 60 pg mL IPTG generally gives optimal color development Continued on next page 45 Troubleshooting Continued Isolating Bacmid The table below lists some potential problems and possible solutions to help you DNA troubleshoot recombinant bacmid DNA isolat
11. Express Five SFM One 24 well plate per sample Microcentrifuge tubes Protocol 1 Seed 2 x 10 High Five cells per well in a 24 well plate Let cells attach for at least 30 minutes Remove the media and rinse the cells once with fresh growth media Replace with 300 mL of fresh media Add the pFastBac HBM baculoviral stock to each well at the desired MOI Include the appropriate controls mock infected uninfected cells pFastBac Gus positive control baculovirus previously characterized recombinant baculoviruses To calculate the amount of virus to add see Calculating Virus Volumes page 34 Incubate cells in a 27 C humidified incubator Harvest each well at the designated time point Scrape the cells from each well and transfer the entire solution from each well to a microcentrifuge tube Pellet the cells at 800 x g for 10 minutes at 4 C Keep the samples at 4 C or on ice to prevent proteolysis Transfer supernatant to a new tube Label each tube Proceed to Analyzing Recombinant Protein page 37 or store the cell pellet and the supernatant at 80 C for analysis at a later time Analyzing Recombinant Protein Introduction Protease Inhibitors Preparing Cell Lysates The next step after harvesting baculovirus infected insect cells is to analyze the secreted expression of your protein by SDS PAGE or western blot In addition to analyzing the supernatant we recommend that you analyze the cell lysat
12. The figure below depicts the generation of recombinant baculovirus and the expression of your gene of interest using the Bac to Bac HBM TOPO Secreted Foreign Ppy Gene Bacmid E coli LacZ containing recombinant bacmid Determine viral titer by plaque assay O00 0OO00000 Y Recombinant gene expression or viral amplification O00 0CO0000 0 Recombinant baculovirus particles Mini prep of high molecular weight DNA 00006 EF Nf ff fet Recombinant bacmid DNA Continued on next page Experiment Outline Continued Flow Chart The figure below illustrates the general steps required to express your gene of interest using the Bac to Bac HBM TOPO Secreted Expression System pFastBac HBM TOPO Plasmid Clone gene of interest Recombinant pFastBac HBM Construct Transform into MAX Efficiency DH10Bac Cells containing bacmid and helper E coli Colonies with Recombinant Bacmid i Restreak Verified E coli Colonies with Recombinant Bacmid Grow overnight culture and isolate recombinant bacmid DNA Recombinant Bacmid DNA i Transfect insect cells using Cellfectin9 Reagent P1 Recombinant Baculovirus Stock 109 pfu ml Infect insect cells to amplify virus P2 Recombinant Baculovirus Stock 107 pfu ml Titer and infect insect cells Protein Expression and Secretion Methods Culturing Insect Cells General Guidelines Introducti
13. a protocol for adaptation to suspension culture refer to the Growth and Maintenance of Insect Cell Lines manual part no 25 0127 available at www invitrogen com or from Technical Support see page 56 Expression of secreted alkaline phosphatase SEAP using its native secretion signal was evaluated in eight different cell lines including High Five Sf9 and Sf21 On a per cell basis High Five cells produced 20 fold more protein than Sf21 cells and 23 fold more protein than Sf9 Since High Five cells are larger than Sf9 or Sf21 cells and the assays were performed on adherent cells the amount of SEAP was also determined per milliliter of culture medium In this case High Five cells produced 5 fold more SEAP than Sf9 cells and 8 fold more than Sf21 Davis et al 1993 Continued on next page Expressing Your Recombinant Protein Continued Guidelines for Expression Positive Control General guidelines are provided below to infect insect cells with the recombinant baculovirus to express your protein of interest As with any expression system optimal expression conditions depend on the characteristics of the protein being expressed Cell line We recommend using High Five cells see page 54 for ordering information for expression of secreted recombinant proteins Note You may also use other cell lines such as Sf9 Sf21 or Mimic Sf9 but your secreted expression levels will be lower Culture Conditions We
14. by centrifuging at 9 000 x g for 15 minutes Remove all medium 2 Add 04 mL Resuspension Buffer R3 containing RNase A to the pellet and resuspend the cells until homogeneous Transfer the cell suspension to a centrifuge tube 3 Add 0 4 mL Lysis Buffer L7 Mix gently by inverting the capped tube five times Do not vortex Incubate at room temperature for 5 minutes 4 Add 0 4 mL Precipitation Buffer N3 and mix immediately by inverting the capped tube until the mixture is homogeneous Do not vortex 5 Centrifuge the mixture at 215 000 x g at room temperature for 10 minutes Note If the pellet does not adhere to the bottom of the tube incubate the tube at room temperature for 5 minutes to allow the separation of the lysate and gelatinous pellet Pipet the clear lysate into a sterile tube and centrifuge at 215 000 x g for 5 minutes at room temperature to remove any remaining cellular debris 1 Load the supernatant resulting from Step 5 see above onto the equilibrated column Allow the solution in the column to drain by gravity flow 2 Wash the column twice with 2 5 mL Wash Buffer W8 Allow the solution in the column to drain by gravity flow after each wash Discard the flow through Continued on next page 13 Isolating Recombinant Bacmid DNA Continued Eluting and 1 Place a sterile centrifuge tube elution tube under the column Precipitating DNA 2 Add0 9 mL Elution Buffer E4 to the column to elute DNA A
15. end PCR product in a highly efficient one step reaction thus allowing the use of proofreading polymerases in the PCR amplification step e Requires less than 2 weeks to identify and purify a recombinant baculovirus compared to the 4 6 weeks required to generate a recombinant baculovirus using homologous recombination e Reduces the need for multiple rounds of plaque purification because the recombinant virus DNA isolated from selected colonies is not mixed with parental non recombinant virus e Permits rapid and simultaneous isolation of multiple recombinant baculoviruses e Allows secreted expression of protein variants for structure function studies This manual provides an overview of the Bac to Bac HBM TOPO Secreted Expression System and provides instructions and guidelines to 1 Transform the pFastBac construct containing your gene of interest into MAX Efficiency DH10Bac competent E coli to generate recombinant bacmid 2 Transfect the recombinant bacmid DNA into the insect cell line of choice to produce recombinant baculovirus particles 3 Amplify and titer the baculoviral stock and use this stock to infect insect cells to express your recombinant protein TM Detailed instructions for cloning your gene of interest into the pFastBac HBM TOPO vector are provided in the Bac to Bac TOPO Cloning Kit manual part no A10605 supplied with the Bac to Bac HBM TOPO Secreted Expression System The Bac to
16. generally culture High Five cells in serum free conditions using in Express Five SFM see page 54 for ordering information You may grow your cells either in adherent or suspension culture using your culture vessel of choice Depending on your application and the protein of interest note that it may be necessary to supplement the culture post infection with 0 1 to 0 5 FBS or BSA to protect the recombinant protein from proteolysis Protein based protease inhibitors are generally less expensive and more effective than many synthetic protease inhibitors Infection Conditions We recommend infecting cultures while cells are in the mid logarithmic phase of growth at a density of 1 x 10 to 2 x 10 cells mL Make sure that the culture is not rate limited by nutritional i e amino acid or carbohydrate utilization or environmental factors i e pH dissolved Oz or temperature during infection MOI Optimal MOI will vary between cell lines and the relative infection kinetics of the virus isolate or clone used Establish a dose for each virus medium reactor and cell line employed to determine the optimal infection parameters to use for protein expression As a starting point infect cells using an MOI of 5 to 10 Note This MOI recommendation is unlike the generation of a high titer stock where a low MOI of 0 5 1 0 is recommended Time course We recommend performing a time course to determine the expression kinetics for your recombina
17. pFastBac Gus for use as a positive transfection and expression control We recommend including the control plasmid in your DH10Bac transformation experiments For a map of the control plasmid see page 52 Materials Needed Your purified pFastBac HBM construct 200 pg mL in TE pH 8 0 see page 9 e Positive expression control i e pFastBac Gus use as a control for transposition e MAX Efficiency DH10Bac chemically competent cells supplied with the Bac to Bac HBM TOPO Secreted Expression System use 1 tube of competent cells for every transformation e pUCI supplied with the MAX Efficiency DH10Bac E coli use as a control for transformation if desired e LB agar plates containing kanamycin gentamicin tetracycline Bluo gal and IPTG 3 freshly prepared plates for each transformation see below e LB agar plate containing 100 ug mL ampicillin for plating pUC19 transformation control e S 0 C Medium e 42 C water bath e 37 C shaking and non shaking incubator in Prepare LB agar plates containing 50 pg mL kanamycin 7 ug mL gentamicin Br Ww 10 ug mL tetracycline 100 ug mL Bluo gal and 40 ug mL IPTG to select for Tal Il transformants See page 50 for instructions to prepare plates If you are preparing LB plates using a pre mixed formulation we use Luria Broth Base see page 53 instead of Lennox L LB Using Lennox L plates reduces the color intensity and may lower the number of colonies o
18. purchasing a license to use this product or the technology embedded in it for any use other than for research use please contact Out Licensing Life Technologies 5791 Van Allen Way Carlsbad California 92008 or outlicensingGlifetech com This product is the subject of U S Patent No 5 348 886 This product is sold under patent license from Monsanto for research purposes only and no license for commercial use is included Requests for licenses for commercial manufacture or use should be directed to Director Monsanto Corporate Research 800 N Lindbergh St Louis Missouri 63167 This product is licensed under U S Patent Nos 5 284 933 and 5 310 663 and foreign equivalents from Hoffmann LaRoche Inc Nutley NJ and or Hoffmann LaRoche Ltd Basel Switzerland and is provided only for use in research Information about licenses for commercial use is available from QIAGEN GmbH Max Volmer Str 4 D 40724 Hilden Germany Continued on next page 57 Purchaser Notification Continued Information for European Customers Using Mach1 T1 Cells Information for All Non U S Customers Using Mach1 T1 Cells Information for European Customers Using DH10Bac cells 58 The Mach1 T1 E coli strain is genetically modified to carry the lacZAM15 hsdR lacX74 recA endA ton A genotype As a condition of sale this product must be in accordance with all applicable local legislation and guidelines including EC Directive 90 219
19. stock contains a mixture of recombinant and non recombinant baculovirus Perform plaque purification to isolate recombinant baculovirus Baculovirus not recombinant e Verify transposition of bacmid DNA by PCR analysis using the pUC M13 Forward and Reverse primers e Re transfect insect cells with new recombinant bacmid DNA Used too low or too high viral titer Optimize infection conditions by varying the MOI Time of cell harvest not optimal Perform a time course of expression to determine the optimal time to obtain maximal protein expression Cell growth conditions and medium not optimal e Optimize culture conditions based on the size of your culture vessel and expression conditions e Culture High Five cells in Express Five SFM for optimal cell growth and protein expression Cell line not optimal Use High Five Cells for highest level of secreted expression Protein expression is not optimal Optimize protein expression by varying such parameters as incubation temperature and oxygenation Recipes Appendix Antibiotic Stock Antibiotics can be ordered in either dry powdered form or as a stabilized sterile Solutions IPTG Bluo gal premixed solution Store these solutions according to the manufacturer s recommendations For the antibiotics below prepare and store the stock solutions as directed Antibiotic Stock Solution C
20. the control of the strong polyhedrin Py promoter After transfection you may assay expression of B glucuronidase as appropriate see page 39 Continued on next page 18 Transfecting Insect Cells Continued Materials Needed MOGOMEN 7 uf NO o jp E Transfection Conditions Important Guidelines for Transfection TM e Purified recombinant bacmid DNA from your pFastBac HBM construct 500 ng pL in TE Buffer pH 8 0 e Purified recombinant bacmid DNA from the pFastBac Gus control construct if desired 500 ng uL in TE Buffer pH 8 0 e Sf9orSf21cells cultured in the appropriate medium e Cellfectin II Reagent store at 4 C until use e Grace s Insect Cell Medium Unsupplemented see page 54 media should not contain supplements FBS or antibiotics e 6 well tissue culture plates and other tissue culture supplies e 1 5 mL sterile microcentrifuge tubes e Complete growth medium for culturing insect cells e g Sf 900 II SFM Sf 900 III SFM TNM FH Grace s Supplemented Insect Cell Culture Medium or other suitable medium Calculate the number of Sf9 or Sf21 cells that you need for your transfection experiment and expand cells accordingly Make sure your cells are healthy with greater than 95 viability and are growing in the logarithmic phase with a density of 1 5 x 10 2 5 x 10 cells mL before proceeding to transfection We generally produce baculoviral stocks in Sf9 or Sf21 cells u
21. the following protocol to prepare your cells for transfection in a 6 well format All amounts and volumes are given on a per well basis To transfect cells in other tissue culture formats first determine the optimal conditions to use 1 Verify that the Sf9 or Sf21 cells are in the log phase 1 5 x 106 2 5 x 106 cells mL with greater than 95 viability 2 Prepare transfection samples If the cell density is in range of 1 5 x 10 2 5 x 10 cells mL and the culture is without antibiotics a Add 2 mL of Grace s Insect Medium Unsupplemented without antibiotics and serum in each well b Seed 8 x 10 Sf9 or Sf21 cells from Step 1 per well Do not change medium or wash the cells The medium carried over will enhance the transfection efficiency c Allow cells to attach for 15 minutes at room temperature in the hood Proceed to step 3 If the cell density is not in this range or the cell culture contains antibiotics a Prepare 10 mL of plating medium by mixing 1 5 mL Supplemented Grace s Insect Medium containing 10 FBS without antibiotics and 8 5 mL Grace s Insect Medium Unsupplemented without FBS and antibiotics b Plate 8 x 10 Sf9 or Sf21 cells from Step 1 per well c Allow cells to attach for 15 minutes at room temperature in the hood d Remove the medium Add 2 5 mL plating medium from step 2a per well Proceed to step 3 3 Foreach transfection sample prepare complexes as follows a Mix Cellfectin II b
22. viral clone by plaque purifying your baculovirus if desired Use a protocol of your choice or the procedure below Materials Needed Plate containing well spaced viral plaques from Plaque Assay Procedure Step 11 page 28 do not stain plates with Neutral Red Log phase Sf9 or Sf21 cells at greater than 95 viability Sterile Pasteur pipette and bulb Procedure 1 Follow Steps 1 3 in the Plaque Assay Procedure page 28 to seed Sf9 or Sf21 cells Using a sterile Pasteur pipette and bulb carefully pick a clear plaque and transfer the agarose plug containing virus to a 1 5 mL microcentrifuge tube containing 500 uL of complete growth medium Mix well by vortexing Add 100 uL of the agarose plug solution to each well Incubate the cells in a 27 C humidified incubator for 72 hours Collect the medium containing virus from each well 2 mL and transfer to sterile 15 mL snap cap tubes Centrifuge the tubes at 500 x g for 5 minutes to remove cells and large debris Transfer the clarified supernatant to fresh 15 mL snap cap tubes This is your plaque purified viral stock Proceed to Amplifying Your Baculoviral Stock page 23 31 Expressing Your Recombinant Protein Introduction RT M D 4 B VeL o p E High Five Cells Secretion in High Five Cells 32 TM Once you have generated a pFastBac HBM baculoviral stock with a suitable titer e g 1 x 10 pfu mL you are ready to use the baculoviral stoc
23. virus when 70 80 of cells are dead e You cannot amplify the baculovirus indefinitely because the baculovirus acquires deleterious mutations with each passage Usually P3 is highest usable passage Follow the guidelines below to amplify your P1 viral stock in a 6 well plate 1 Onthe day of infection prepare your Sf9 or Sf21 cell suspension and plate cells at 2 x 10 cells well Incubate cells at room temperature for 1 hour to allow attachment After 1 hour inspect cells under an inverted microscope to verify attachment Add the appropriate amount of P1 viral stock to each well Incubate the cells for 48 hours in a 27 C humidified incubator Qv gm co om 48 hours post infection collect 2 mL of medium containing virus from each well and transfer the virus to sterile 15 mL snap cap tubes Centrifuge the tubes at 500 x g for 5 minutes to remove cells and large debris and to obtain clarified baculoviral stock Note It is possible to harvest virus at later times after infection e g 72 hours Because optimal harvest times can vary determine them for each baculoviral construct Remember that culture viability decreases over time as cells lyse 6 Transfer the supernatant to fresh 15 mL snap cap tubes This is the P2 viral stock Store at 4 C protected from light For long term storage you may store an aliquot of the P2 stock at 80 C protected from light See page 22 for storage guidelines 7 Proceed to the next sect
24. 0 105 1077 10 6 Remove the medium from each well discard it and immediately replace it with 1 mL of the appropriate virus dilution As a negative control add the appropriate medium without virus 7 Incubate the cells with the virus for 1 hour at room temperature 8 Move the cells and the bottle of plaquing medium from the 40 C water bath Step 4 previous page to a sterile hood 9 Sequentially starting from the highest dilution 105 to the lowest dilution 1075 remove the medium containing virus from the wells and replace it with 2 mL of plaquing medium Work quickly to avoid desiccation of the cell monolayer 10 Allow the agarose overlay to harden for 1 hour at room temperature before moving the plates 11 Incubate the cells in a 27 C humidified incubator for 7 10 days until plaques are visible and ready to count To stain plaques to facilitate counting see the next page To calculate the titer see page 30 Continued on next page Performing a Viral Plaque Assay Continued To improve the visualization of plaques stain the plates using Neutral Red Note Crystalline Blue and other plaque staining dyes containing organic solvents are not recommended because they kill the host cells To stain plaques you may do one of the following Prepare an agarose solution containing Neutral Red and overlay this solution on the plates 4 days post infection Count plaques 7 10 days post infection or Prepare a Ne
25. 2 M NaCl 50 pL 60 mM MgCl Sterile Water 1 mL Control PCR template 50 ng pL in TE buffer pH 8 0 10 uL Control PCR primers 100 ng pL each in TE buffer pH 8 0 10 uL Polyhedrin forward 100 ng uL in TE buffer pH 8 0 20 uL sequencing primer SV40 polyA reverse 100 ng L in TE buffer pH 8 0 20 pL sequencing primer pFastBac Gus control 0 2 ng L in TE buffer pH 8 0 20 pL TE buffer pH 8 0 10 mM Tris HCl 1 mM EDTA pH 8 0 Continued on next page Kit Contents and Storage Continued One Shot Mach1 The following reagents are included in the One Shot Mach1 T1 Chemically Competent E coli kit Transformation efficiency of One Shot Mach1 T18 E coli cells is gt 1 x 10 cfu ug DNA Store cells at 80 C T1 Competent E coli Genotype of Mach1 T1 MAX Efficiency DH10Bac Competent E coli Genotype of DH10Bac Cellfectin II Transfection Reagent vi Reagent Composition Amount One Shot Mach1 T1 21 x 50 pL Chemically Competent E coli S O C Medium 2 tryptone 6 mL may be stored at room 0 5 yeast extract temperature or 4 C 10 mM NaCl 2 5 mM KCl 10 mM MgCl 10 mM MgSO 20 mM glucose pUC19 Control DNA 10 pg uL in 5 mM Tris HCl 50 uL 0 5 mM EDTA pH 8 0 F 80 lacZ AM15 AlacX74 hsdR rk mx ArecA1398 end A1 ton A MAX Efficiency DH10Bac Competent E coli Box 3 have a transformation efficiency of 1 x 10 cfu ug DNA Store at 80 C 0
26. 5 mM EDTA pH 8 0 Item Composition Amount MAX Efficiency DH10Bac 4 kits Competent E coli 4 x 5 reactions pUC19 Control DNA 10 pg uL in 5 mM Tris HCI 100 uL F mcrA A mrr hsdRMS mcrBC 80lacZAM15 AlacX74 recA1 end A1 araD139 A ara leu 7697 galU galK rpsL nupG bMON14272 pMON7124 Cellfectin II Reagent is a proprietary cationic lipid formulation that offers the highest transfection efficiencies and protein expression levels on the widest variety of adherent and suspension insect cell lines Amount supplied 1 mL Composition 1 mg mL transfection reagent in membrane filtered water Storage conditions 4 C do not freeze Introduction Description of the System System Overview Advantages of the Bac to Bac HBM TOPO Secreted Expression System Purpose of This Manual e The Bac to Bac HBM TOPO Secreted Expression System provides a rapid effective method of generating recombinant baculoviruses for secreted expression of your protein of interest The Bac to Bac HBM TOPO Secreted Expression System combines the ease of blunt end TOPO cloning with the efficiency of site specific transposition technology of the Bac to Bac System Using the Bac to Bac HBM TOPO Secreted Expression System to generate a recombinant baculovirus provides the following advantages over the traditional method using homologous recombination e Enables the cloning of the gene of interest as a blunt
27. Bac TOPO Cloning Kit manual is also available for downloading at www invitrogen com or from Technical Support see page 56 Continued on next page Description of the System Continued Important The Bac to Bac HBM TOPO Secreted Expression System is designed to help you create a recombinant baculovirus for high level secreted expression of your gene of interest in insect cells Although the system has been designed to help you to easily produce recombinant baculovirus and express your protein of interest use of the system is geared towards those users who are familiar with baculovirus biology and insect cell culture We highly recommend that users possess a working knowledge of viral and tissue culture techniques For more information about baculovirus biology refer to published reference sources King amp Possee 1992 Luckow 1991 O Reilly et al 1992 For more information about insect cell culture refer to the Guide to Baculovirus Expression Vector Systems BEVS and Insect Cell Culture Techniques available from Invitrogen at www invitrogen com or by contacting Technical Support see page 56 Bac to Bac HBM TOPO Secreted Expression System Components Components of The Bac to Bac HBM TOPO Secreted Expression System facilitates rapid and the Bac to Bac efficient generation of recombinant baculoviruses Ciccarone et al 1997 by HBM TOPO combining the ease of TOPO cloning with the efficiency of the Ba
28. III SFM or other appropriate complete growth medium see Note below Sf 900 Medium 1 3X 100 mL or other appropriate plaquing medium see Note below 4 Agarose Gel specifically formulated for optimal insect cell growth Sterile cell culture grade distilled water 100 mL sterile glass bottle 6 well tissue culture plates 2 plates for each viral stock to be titered Sterile hood Waters baths at 40 C and 70 C Microwave oven optional 27 C humidified incubator Neutral Red Sigma Cat no N7005 See page 54 for ordering information If you are culturing your Sf9 or Sf21 cells in serum supplemented media i e Note complete TNM FH you should have the following reagents on hand Grace s Insect Cell Culture Medium Supplemented Grace s Insect Cell Culture Medium 2X Fetal Bovine Serum FBS Qualified Heat Inactivated See page 54 for ordering information 26 Continued on next page Performing a Viral Plaque Assay Continued Preparing the Plaquing Medium Plaquing medium consists of a mixture of culture medium and agarose Plaquing medium is used to immobilize the infected cells for the plaque assay Prepare plaquing medium immediately before use following the procedure below If you are culturing the Sf9 cells in Sf 900 II SFM or Sf 900 III SFM prepare Sf 900 Plaquing Medium If you are culturing cells in TNM FH prepare Grace s Plaquing Medium Note Other Plaquing Media are suitable 1
29. Invitrogen Bac to Bac HBM TOPO Secreted Expression System An efficient site specific transposition system to generate recombinant baculovirus for high level secreted protein expression Catalog no A11339 Revision date 15 July 2009 Manual part no A11341 MANO001704 Contents Kit Contents and Storage eee dete te ete i idee re oid eren te Le iv Introduction E 1 Description of the Systems su ese eee e e m me dee ua ee oe T ee ee EE edd 1 Bac to Bac HBM TOPO Secreted Expression System Components sse 3 Exp riment Qutline aeter asee i eed Petre n eA EA BEE eee Po E EEEo Ea Ee eiie a EER 5 MOT OOS oq ideas eoim eee iab eui utt didi ME Mares 7 enn5gBlesel qt 7 General Guidelines 5 onte unda edel afi ep lili epe nire pe eod 7 Generating the Recombinant pFastBac HBM Vector eene 9 Generating the Recombinant Bacmid eese ener 10 Transforming DETIOBae Ec 60H ose eats tated eti talea tds t t e RU CI pu ues 10 Isolating Recombinant Bacmid DNA sess 13 Analyzing Recombinant Bacmid DNA by PCR cecscscesssesescececetetetesesesesnenesesesceceeenaneseseseseeceeeeenenenes 15 Producing Recombinant Baculovirus eeeeeeeeeeee eese enne nnne nnn 18 Tr nstectine Insect Cells ssi sect en Ge eiie ete eite Lae bes sa S HP us 18 Isolating P1 Viral Stock eee echte eee egent ire ese rne ee retire 21 Amplifying Your Baculo
30. Melt the 4 Agarose Gel by placing the bottle in a 70 C water bath for 20 to 30 minutes or heating the agarose in a microwave oven While the 4 agarose gel is melting place the following in the 40 C water bath e Empty sterile 100 mL bottle e Sf 900 Medium 1 3X or Grace s Insect Cell Culture Medium 2X as appropriate After the 4 agarose gel has liquefied move the agarose gel medium and empty 100 mL bottle to a sterile hood Working quickly prepare the plaquing medium as follows Sf 900 Plaquing Medium Combine 30 mL of Sf 900 Medium 1 3X and 10 mL of the melted 4 Agarose Gel in the empty 100 mL bottle and mix gently Grace s Plaquing Medium Add 20 mL of heat inactivated FBS to the 100 mL bottle of Grace s Insect Medium 2X and mix Combine 25 mL of the Grace s Insect Medium 2X containing serum with 12 5 mL of cell culture grade sterile distilled water and 12 5 mL of the melted 476 Agarose Gel in the empty 100 mL bottle and mix gently 4 Return the bottle of plaquing medium to the 40 C water bath until use Continued on next page 27 Performing a Viral Plaque Assay Continued Plaque Assay Procedure 28 Use the procedure below to perform a plaque assay in 6 well plate format to determine the titer of your pFastBac HBM baculoviral stock If you have generated a baculoviral stock of the expression control pFastBac Gus we recommend titering this stock as well Remember to include a negative co
31. ansformations Shake the tubes at 37 C at 225 rpm for 4 hours For pUC19 transformation Shake the tube at 37 C at 225 rpm for 1 hour 8 Foreach pFastBac transformation Prepare 10 fold serial dilutions of the cells 1071 102 102 with S O C Medium Plate 100 uL of each dilution on an LB agar plate containing 50 ug mL kanamycin 7 ng mL gentamicin 10 ug mL tetracycline 100 ug mL Bluo gal and 40 ug mL IPTG For the pUC19 transformation Dilute the cells 1 100 with S O C Medium Plate 100 uL of the dilution on an LB agar plate containing 100 ug mL ampicillin 9 Incubate the plates for 48 hours at 37 C Pick white colonies for analysis see the next page for recommendations Note We do not recommend picking colonies earlier than 48 hours Incubating the plates for less than 48 hours may create difficulty distinguishing between white and blue colonies Continued on next page 11 Transforming DH10Bac E coli Continued Important Verifying the Phenotype Note 12 Insertions of the mini Tn7 into the mini attTn7 attachment site on the bacmid disrupt the expression of the LacZa peptide so colonies containing the recombinant bacmid are white in a background of blue colonies that harbor the unaltered bacmid Select white colonies for analysis True white colonies tend to be large To avoid selecting false positives choose the largest most isolated white colonies Avoid picking colonies that appear gray or are dar
32. aques Plaques will appear as clear spots in a nearly clear gel against a red background Continued on next page 29 Performing a Viral Plaque Assay Continued Calculating the Titer Example What You Should See 30 Count the number of plaques present in each dilution then use the following formula to calculate the titer plaque forming units pfu mL of your viral stock Note that the optimal range to count is 3 to 20 plaques per well of a 6 well plate 1 titer pfu mL number of plaques x dilution factor x mL of inoculum well If you add 1 mL of inoculum and observe 20 plaques in the well containing the 10 viral dilution the titer of the viral stock is 1 1mL of inoculum well titer pfu mL 20 plaques x 10 x titer pfu mL 2 x 10 pfu mL When titering pFastBac HBM baculoviral stocks we generally obtain titers ranging from e 1x105to1x 107 pfu mL for P1 viral stocks e 1x10 to 1x 10 pfu mL for P2 viral stocks Note If the titer of your baculoviral stock is less than 1 x 10 pfu mL or 1 x 10 pfu mL for a P1 or P2 viral stock respectively we recommend producing a new baculoviral stock For tips and guidelines to optimize your viral yield see Factors Affecting Viral Titer page 25 and the Troubleshooting section page 47 Continued on next page Performing a Viral Plaque Assay Continued Plaque Purification You may generate a viral stock from a single
33. ble separately from Invitrogen See page 53 for ordering information Insect Cell Lines We recommend using Sf9 or Sf21 cells for transfection and identification of for Transfection recombinant plaques High Five and Mimic Sf9 cells are not recommended because they generally transfect less efficiently However once you have generated your baculovirus stock we recommend using High Five cells for TM secreted expression studies see Secretion in High Five Cells page 32 Media for For the highest transfection efficiency we recommend performing the Transfection transfection in Grace s Insect Cell Culture Medium Unsupplemented see page 54 for ordering information Note that the Grace s Insect Cell Culture Medium should not contain supplements or fetal bovine serum FBS because the supplements and the proteins in the FBS interferes with the Cellfectin II Reagent inhibiting the transfection TM Note If you are culturing Sf9 or Sf21 cells in Sf 900 II SEM or Sf 900 III SFM you can perform the transfection in unsupplemented Grace s Medium and then easily switch back to Sf 900 II SEM or Sf 900 III SFM after transfection TM Positive Control If you have generated a recombinant bacmid from the pFastBac Gus control plasmid we recommend including this positive control in your transfection and expression experiments to help you evaluate your results In this bacmid the gene encoding f glucuronidase is expressed under
34. btained Note Use Bluo gal instead of X gal for blue white selection Bluo gal generally produces a darker blue color than X gal Continued on next page 10 Transforming DH10Bac E coli Continued Preparing for Transformation Transformation Procedure For each transformation you will need one vial of competent cells and three selective plates e Equilibrate a water bath to 42 C e Warm selective plates at 37 C for 30 minutes e Warm the S O C Medium to room temperature Follow the procedure below to transform MAX Efficiency DH10Bac chemically competent E coli cells with your recombinant pFastBac HBM construct We recommend including positive controls for transposition i e pFastBac Gus and transformation i e pUC19 in your experiment to help you evaluate your results 1 Thaw on ice one vial of MAX Efficiency DH10Bac competent E coli cells for each transformation 2 For each transformation add the appropriate amount of plasmid DNA to 100 uL of DH10Bac cells and mix gently Do not pipet up and down to mix e Your recombinant pFastBac HBM construct 1 ng 5 uL e pFastBac Gus control plasmid 1 ng e pUC19 control 50 pg 5 uL Incubate the cells on ice for 30 minutes Heat shock the cells for 45 seconds at 42 C without shaking Immediately transfer the tubes to ice and chill for 2 minutes Add 900 uL of room temperature S O C Medium zo ONE OT e cs For pFastBac tr
35. c to Bac Secreted System Based on a method developed by Luckow et al Luckow et al 1993 the Expression Bac to Bac HBM TOPO Secreted Expression System takes advantage of the site System specific transposition properties of the Tn7 transposon to simplify and enhance the process of generating recombinant bacmid DNA The following major system components are described in detail below e pFastBac HBM TOPO plasmid allows the rapid generation of an expression construct containing the gene of interest under the control of a baculovirus specific strong polyhedrin Pu promoter and in frame with the Honey Bee Mellitin HBM secretion signal coding sequence One Shot Mach1 TIR Chemically Competent E coli enable same day isolation of TM recombinant pFastBac expression construct from the transformation mix e AnE coli host strain DH10Bac contains a baculovirus shuttle vector bacmid and a helper plasmid to facilitate the generation of a recombinant TM bacmid following transposition of the pFastBac expression construct e Cellfectin II Reagent for fast efficient transfection of insect cells to generate recombinant baculovirus particles Note A control expression plasmid pFastBac Gus allows production of a recombinant baculovirus which when used to infect insect cells constitutively expresses p glucuronidase pFastBac HBM The first major component of the System is the pFastBac HBM TOPO vector TOPO
36. creted Expression System are available separately from Invitrogen Ordering information for these reagents is provided below For more information refer to our website at www invitrogen com or contact Technical Support see page 56 Item Quantity Cat no Bac to Bac HBM TOPO Cloning Kit 1 kit 411338 MAX Efficiency DH10Bac Competent E coli 5 x 100 pL 10361 012 One Shot Mach1 T1 Chemically Competent 21 x 50 uL C8620 03 E coli Cellfectin II Reagent 1 mL 10362 100 Platinum Pfx DNA Polymerase 100 units 11708 013 AccuPrime Pfx DNA Polymerase 200 reactions 12344 024 Pfx50 DNA Polymerase 100 reactions 12355 012 Platinum Tag DNA Polymerase High Fidelity 100 reactions 11304 011 PureLink PCR Purification Kit 50 preps K3100 01 PureLink Quick Gel Extraction System 1 kit K2100 12 PureLink HiPure Plasmid Miniprep Kit 25 preps K2100 02 100 preps K2100 03 PureLink HiPure Plasmid Midiprep Kit 25 preps K2100 04 50 preps K2100 05 PureLink HiPure Plasmid Maxiprep Kit 10 preps K2100 06 25 preps K2100 07 Ampicillin Sodium Salt irradiated 200 mg 11593 027 Kanamycin Sulfate 5g 11815 024 25g 11815 032 Kanamycin Sulfate 100X liquid 100 mL 15160 054 Gentamicin Reagent Solution liquid 10mL 15750 060 50 mg mL 10 x 10 mL 15750 078 Bluo gal 1g 15519 028 Isopropylthio B galactoside IPTG 1g 15529 019 S O C Medium 10 x 10 mL 15544 034 Miller s LB Brot
37. ctive or controlled oxygenated systems require dissolved oxygen at 10 to 50 of air saturation Shear Fforces Suspension culture generates mechanical shear forces Growing insect cells in serum containing media 10 to 20 FBS generally provides adequate protection from cellular shear forces If you are growing insect cells in serum free conditions supplementation with a shear force protectant such as PLURONIC F 68 may be required Note Growing cells in Sf 900 II SFM or Sf 900 III SFM does not require addition of shear force protectants Cells for You need log phase Sf9 or Sf21 cells with gt 95 viability to perform a successful Transfection transfection Refer to page 19 to determine how many cells you will need for transfection Generating the Recombinant pFastBac HBM Vector Introduction Guidelines for Isolating DNA Important pFastBac HBM TOPO vector To generate a recombinant plasmid containing your gene of interest for use in the Bac to Bac HBM TOPO Secreted Expression System perform the following steps 1 Generate a blunt end PCR product containing your gene of interest with a thermostable proofreading DNA polymerase such as the Platinum Pfx or the AccuPrime Pfx DNA Polymerase 2 TOPO Clone your blunt end PCR product into the pFastBac HBM TOPO vector and use the reaction to transform One Shot Mach1 T1 Chemically Competent E coli Do not transform the ligation reaction into DH10Bac
38. delity for best results See page 53 for ordering information Continued on next page 15 Analyzing Recombinant Bacmid DNA by PCR Continued Generating the PCR Product 16 Use the procedure below to amplify your recombinant bacmid DNA using the pUC M13 Forward and Reverse primers and Platinum Taq polymerase If you are using a combination of the pUC M13 Forward or Reverse primers and a primer specific for your gene determine the amplification conditions to use If you are using another polymerase follow the manufacturer s recommendations for the polymerase you are using Note Amplification conditions may need to be optimized if your insert is gt 4 kb 1 For each sample set up the following 50 uL PCR reaction in a 0 5 mL microcentrifuge tube Recombinant bacmid DNA 100 ng 1pL 10X PCR Buffer appropriate for enzyme 5 pL 10 mM dNTP Mix 1 pL 50 mM MgCl 1 5 uL PCR Primers 1 25 uL each 10 uM stock 2 5 pL Sterile Water 38 5 pL Platinum Tag polymerase 5 units uL 0 5 uL Total Volume 50 mL 2 Amplify using the following cycling parameters Step Time Temperature Cycles Initial Denaturation 3 minutes 94 C 1X Denaturation 45 seconds 94 C Annealing 45 seconds 55 C 25 35X Extension 5 minutes 72 C Final Extension 7 minutes 72 C 1X 3 Remove 5 10 pL from the reaction and analyze by agarose gel electrophoresis Continued on next page Analyzing Recomb
39. e been lysed pellet cellular debris at 1 000 x g for 10 minutes at 4 C 9 Check for lysis efficiency To check for cell lysis take a 10 uL sample add 1 uL of Trypan Blue and load onto a hemacytometer See Growth and Maintenance of Insect Cell Lines manual for protocols All cells stain blue when lysis is complete 10 Transfer supernatant lysate to a new tube Keep on ice Proceed to Detecting Recombinant Protein below Note We recommend that you save the pellet from the lysate the insoluble portion because it may be useful for analysis if you cannot detect proteins in the lysate or the supernatant You may use any method of choice to detect your recombinant protein of interest including functional analysis or western blot If you perform western blot analysis you will need to have an antibody to your protein of interest The pFastBac HBM TOPO vector allows the expression of your recombinant protein of interest as a C terminal 6xHis fusion You can use the antibodies listed on page 55 to detect your recombinant protein If you are using polyacrylamide gel electrophoresis to detect your recombinant protein you should note that the presence of the C terminal 6xHis tag and the Tobacco Etch Virus TEV recognition site will increase the size of your protein by at least 3 kDa The HBM secretion signal coding sequence is cleaved upon secretion and thus does not change the size of your protein Continued on next page
40. e to determine if all of your protein is being secreted Analyzing cell lysate can assist you in optimizing your MOI and time course for expression see Optimizing Protein Expression page 41 After you determine the optimal experimental parameters for secreted expression you may proceed with Large Scale Expression page 42 We recommend that you add one or more protease inhibitors to each of the lysis buffers that are described in the protocol below The following table summarizes recommended protease inhibitors their method of action and working concentrations Protease Method of Action Stock Solution Working Inhibitor Concentration PMSF Serine protease inhibitor 10 mg mL in 100 pg mL isopropanol Leupeptin Serine and thiol protease 50 pg mL in 0 5 pg mL inhibitor deionized water Aprotinin Serine protease inhibitor 50 pg mL in 0 5 pg mL deionized water Pepstatin A Acid protease inhibitor 100 ug mL in lug mL methanol You can store all of the above protease inhibitor solutions at 20 C except for PMSF Store PMSF at room temperature in isopropanol PMSF is not stable in aqueous solution add it to the lysis buffer just before use PMSF phenylmethylsulfonylfluoride is very harmful if inhaled swallowed or contacted by the skin Wear protective clothing and gloves when handling You may use any method to prepare cell lysates for analysis including detergent lysis sonication or freeze t
41. e up to 1 liter 3 Autoclave on liquid cycle for 20 minutes Allow solution to cool to 55 C and add antibiotic if needed 4 Store at room temperature or at 4 C Follow the procedure below to prepare LB agar plates 1 2 3 4 Prepare LB medium as above but add 15 g L agar before autoclaving Autoclave on liquid cycle for 20 minutes After autoclaving cool to 55 C add antibiotic s and pour into 10 cm plates Let harden then invert and store at 4 C in the dark Plates containing antibiotics are stable for up to 4 weeks TM LB agar selective plates for DH10Bac transformation 1 2 Follow Steps 1 2 in the procedure above After autoclaving cool to 55 C and add the following e 50 ug mL kanamycin e 7 ug mL gentamicin e 10 ug mL tetracycline e 100 pg mL Bluo gal e 40 pg mL IPTG Let harden then invert and store at 4 C in the dark Tetracycline and Bluo gal are light sensitive so make sure that plates are stored protected from light Map of pFastBac HBM TOPO Description The map below shows the elements of pFastBac HBM TOPO vector The vector sequence is available for downloading from www invitrogen com or by contacting Technical Support page 56 CCCTT AAGGG HBM CCCTIT breee TEV 6xHis pFastBac HBM TOPO Comments for pFastBac H BM TOPO vector 4824 nucleotides Polyhedrin promoter Ppp bases 1 129 Honey Bee Mellitin HBM secretion signal 141 210 TOPO cloni
42. efore use and dilute 8 uL in 100 mL Grace s Medium Unsupplemented without antibiotics and serum Vortex briefly to mix Note You may leave this mixture at room temperature for up to 30 minutes Dilute 1 ug baculovirus DNA in 100 uL Grace s Medium Unsupplemented without antibiotics and serum Mix gently Combine the diluted DNA with diluted Cellfectin II total volume 210 uL Mix gently and incubate for 15 30 minutes at room temperature 4 Add 210 uL DNA lipid mixture or transfection mixture Step 3c dropwise onto the cells from Step 2a or 2c Incubate cells at 27 C for 3 5 hours 5 Remove the transfection mixture and replace it with 2 mL of complete growth medium e g Grace s Insect Medium Supplemented and 10 FBS Using antibiotics is optional 6 Incubate the cells at 27 C for 72 hours or until you see signs of viral infection Isolating P1 Viral Stock Introduction Characteristics of Infected Cells Budded virus should be released into the medium 72 hours after transfection However if your transfection efficiency was not optimal cells may not show all of the signs of viral infection until 4 or 5 days post transfection Beginning at 72 hours after transfection visually inspect the cells daily for signs of infection see below Insect cells infected with baculovirus typically display the following characteristics when visually observed using an inverted phase microscope at 250 400X magnification
43. ertion of the mini attTn7 attachment site does not disrupt the reading frame of the LacZa peptide The bacmid propagates in E coli DH10Bac as a large plasmid that confers resistance to kanamycin This bacmid can complement a lacZ deletion present on the chromosome to form colonies that are blue Lac in the presence of a chromogenic substrate such as Bluo gal or X gal and the inducer IPTG Recombinant bacmids composite bacmids are generated by transposing a mini Tn7 element from a pFastBac donor plasmid to the mini attTn7 attachment site on the bacmid The Tn7 transposition functions are provided by a helper plasmid see below DH10Bac E coli also contain the helper plasmid pMON7124 13 2 kb which encodes the transposase and confers resistance to tetracycline The helper plasmid provides the Tn7 transposition function in trans Barry 1988 Cellfectin II Reagent is a proprietary cationic lipid formulation that offers the highest transfection efficiencies and protein expression levels on the widest variety of adherent and suspension insect cell lines including Sf9 and Sf21 cells Experiment Outline Diagram of the Bac to Bac System pFastBac HBM TOPO donor plasmid Clone gene of interest b Gene f Inter t nteres A E Tn7R X Tn7L Transformation Recombinant donor plasmid Expression System Bacmid Competent DH10Bac E coli cells Transposition Antibiotic selection
44. f interest DH10Bac cells contain a baculovirus shuttle vector bacmid with a mini attTn7 target site and a helper plasmid see the next page for details After the pFastBac HBM expression plasmid the donor plasmid is transformed into DH10Bac cells transposition occurs between the mini Tn7 element on the pFastBac HBM vector and the mini attTn7 target site on the bacmid to generate a recombinant bacmid This transposition reaction occurs in the presence of transposition proteins supplied by the helper plasmid After you have performed the transposition reaction you isolate the high molecular weight recombinant bacmid DNA and transfect the bacmid DNA into insect cells using the Cellfectin II reagent to generate a recombinant baculovirus that can be used for preliminary expression experiments After the baculoviral stock is amplified and titered this high titer stock can be used to infect insect cells for large scale expression of the recombinant protein of interest For a schematic representation of the Bac to Bac HBM TOPO Secreted Expression System see the diagram on page 5 The baculovirus shuttle vector bacmid DbMON14272 136 kb present in DH10Bac E coli contains e Alow copy number mini F replicon e Kanamycin resistance marker e Asegment of DNA encoding the LacZa peptide from a pUC based cloning vector into which the attachment site for the bacterial transposon Tn7 mini attTn7 has been inserted Ins
45. h Base Luria Broth Base 500g 12795 027 powder Water distilled cell culture grade 500 mL 15230 162 4 Agarose gel optimal for insect cell growth 40 mL 18300 012 Fetal Bovine Serum FBS Qualified Heat 100 mL 16140 063 Activated Continued on next page Accessory Products Continued Insect Cell Culture A variety of insect cell lines and GIBCO cell culture products are available from Products Invitrogen to facilitate baculovirus mediated expression of your recombinant protein in insect cells For more information about the insect cell lines and GIBCO cell culture products refer to www invitrogen com or contact Technical Support see page 56 Note Reagents are also available in other sizes TM Item Quantity Cat no High Five Cells SFM adapted 3 x 10 cells B855 02 Sf9 Cells SFM Adapted 1 5 x 107 cells 11496 015 Sf21 Cells SFM Adapted 1 5 x 107 cells 11497 013 Mimic Sf9 Insect Cells 1 x 10 cells 12552 014 Sf 900 II SFM 500 mL 10902 096 Sf 900 III SFM 500 mL 12658 019 Sf 900 Medium 1 3X 100 mL 10967 032 Express Five SFM 1 liter 10486 025 Grace s Insect Cell Culture Medium 500 mL 11595 030 Unsupplemented Grace s Insect Cell Culture Medium 500 mL 11605 094 Supplemented Grace s Insect Cell Culture Medium 2X 100 mL 11667 037 Penicillin Streptomycin 100 mL 15070 063 PLURONIC F 68 10 100X 100 mL 24040 032 PLURONIC is a reg
46. haw lysis The protocol on the next page Detergent Lysis provides a quick procedure for preparing lysates suitable for analyzing the secretion level of your recombinant protein If you do not want to use detergent to lyse your cell samples e g your protein is sensitive to detergent lyse your cells by sonication and or freeze thawing Continued on next page 37 Analyzing Recombinant Protein Continued Detergent Lysis Detecting Recombinant Protein Note 38 Detergent lysis is a quick and efficient way to lyse cells and extract intracellular protein The protocol below uses Triton X 100 but you may also use Nonidet P 40 NP 40 1 Place all cell pellets from the time course on ice Be sure to include the control sample 2 Make up 2 5 mL of lysis buffer 0 1 Triton X 100 in PBS or TBS Use 100 uL of lysis buffer for each 10 cells 3 Add each of the protease inhibitors Leupeptin Aprotinin and Pepstatin A at the working concentrations described on the previous page Perform this step on ice Add PMSF just after adding the lysis buffer to the cell pellet Step 5 Add 100 pL of lysis buffer for each 10 cells in the pellet Add PMSF to each sample to a final concentration of 100 pg mL Vortex each cell sample to break up the cell pellet and begin lysis NOS B Lysis Incubation Incubate all samples on ice for 30 45 minutes then vortex them at 10 minute intervals to assist lysis 8 Afterall samples hav
47. id Prep Kits available separately from Invitrogen allow the purification of all types and sizes of plasmid DNA including BAC bacmids and ssM13 DNAs PureLink HiPure Plasmid Prep Kits are ideally suited for bacmid purification see page 53 for ordering information Isolating Recombinant Bacmid DNA Introduction Before Starting Equilibrating the Column Preparing the Cell Lysate Binding and Washing the DNA The PureLink HiPure Plasmid DNA Miniprep Kit allows you to purify high quality bacmid DNA from DH10Bac E coli see page 53 for ordering information The isolated bacmid DNA is suitable for use in insect cell transfections Note We do not recommend the PureLink HiPure Precipitator Module or the PureLink HiPure Plasmid Filter Mini Midi Maxiprep Kits for isolating bacmid DNA e noculate a single white bacterial colony into 2 mL LB medium with 50 ug mL kanamycin 7 ug mL gentamicin and 10 ug mL tetracycline Incubate the culture at 37 C in a shaking water bath at 250 rpm overnight e Verify that RNase A is added to the Resuspension Buffer R3 and that the Lysis Buffer L7 contains no precipitates TM TM Place the PureLink HiPure Mini column on the PureLink Nucleic Acid Purification Rack see the manual supplied with the rack for more details Apply 2 mL Equilibration Buffer EQ1 to the column Allow the solution in the column to drain by gravity flow 1 Harvest 1 5 mL bacterial cells
48. inant Bacmid DNA by PCR Continued What You Should If transposition has occurred and you have used the pUC M13 Forward and See Reverse primers for amplification you should see a PCR product of the following size on the agarose gel Bacmid transposed with Size of PCR Product Bacmid alone 300 bp pFastBac HBM TOPO 2 500 bp size of your insert pFastBac Gus 4 200 bp If you have used a combination of the pUC M13 Forward or Reverse primer and a gene specific primer for amplification determine the expected size of your PCR product Refer to the diagram on page 15 to help you calculate the expected size of your PCR product 17 Producing Recombinant Baculovirus Transfecting Insect Cells Introduction After you have confirmed that your recombinant bacmid contains the gene of interest you are ready to transfect insect cells to produce recombinant baculovirus This section provides guidelines and instructions for transfecting insect cells Cellfectin Il We recommend using a cationic lipid such as Cellfectin II Reagent for Reagent transfection Cellfectin II Reagent is a proprietary cationic lipid formulation that offers the highest transfection efficiencies and protein expression levels on the widest variety of adherent and suspension insect cell lines including Sf9 and Sf21 cells Cellfectin II Reagent is supplied with the Bac to Bac HBM TOPO Secreted Expression System and is also availa
49. ion Problem Reason Solution Bacmid DNA is DNA stored improperly e Store purified bacmid DNA in degraded aliquots at 4 C for no more than 2 weeks e Do not freeze thaw the bacmid DNA e For long term storage of bacmid DNA prepare glycerol stocks of DH10Bac E coli containing the verified bacmid DNA High molecular weight bacmid e When isolating bacmid DNA do DNA handled improperly not vortex the DNA solution e Do not resuspend DNA pellets mechanically allow the solution to sit in the tube with occasional gentle tapping of the bottom of the tube Poor yield Used incorrect antibiotic Grow transformed DH10Bac cells in concentrations LB medium containing 50 ug mL kanamycin 7 ug mL gentamicin and 10 pg mL tetracycline Bacmid DNA contains a Picked a colony that was gray or Analyze more white DH10Bac mixture of recombinant dark in the center transformants and choose one that bacmid and empty contains recombinant bacmid DNA bacmid only 46 Continued on next page Troubleshooting Continued Transfecting Insect Cells The table below lists some potential problems and possible solutions that may help you troubleshoot insect cell transfection Problem Reason Solution Low yield of virus Low transfection efficiency e Use Invitrogen s Cellfectin II Reagent for transfection e Perform transfection in unsupplemented Grace s Medium make sure that no supplements FBS o
50. ion to determine the titer of your P2 viral stock After you have generated a high titer P2 baculoviral stock you may scale up the amplification procedure to any volume of your choice To produce this high titer P3 stock scale up the amount of cells and volume of virus used appropriately and follow the guidelines and procedure outlined in this section If you have stored your viral master stock at 80 C we recommend amplifying this stock to generate another high titer stock for use in expression experiments Viral titers generally decrease over time when virus is stored at 80 C Follow the guidelines and amplification procedure detailed in this section Performing a Viral Plaque Assay Introduction We recommend you perform a plaque assay to determine the titer of your viral stock You may also perform a plaque assay to purify a single viral clone if desired In this procedure you infect cells with dilutions of your viral stock and identify focal points of infection plaques on an agarose overlay You may also titer your viral stock by the end point dilution method described in O Reilly et al 1992 Experimental To determine the titer of a baculoviral stock Outline 1 Plate Sf9 or Sf21 cells in 6 well plates 2 Prepare 10 fold serial dilutions of your baculoviral stock 3 Add the different dilutions of baculovirus to Sf9 cells and infect cells for 1 hour Remove the virus and overlay the cell monolayer with Plaq
51. istered trademark of BASF Corporation Continued on next page 54 Accessory Products Continued Detecting Recombinant Fusion Protein Purifying Recombinant Fusion Proteins If you have cloned your gene of interest in frame with C terminal polyhistidine tag of the pFastBac HBM TOPO vector you may detect expression of your recombinant fusion protein using the following antibodies The amount of antibody supplied is sufficient for 25 western blots Product Epitope Cat no Anti His C term Antibody Detects the C terminal R930 25 Anti His C term HRP Antibody Polyhistidine 6xHis tag R931 25 E HHHHHH COOH Anti His C term AP Antibody requires the free carboxyl R932 25 group for detection Lindner et al 1997 Penta His mouse IgG Detects both N and P21315 monoclonal Antibody C terminal polyhistidine 6xHis tag If you express your gene of interest as a fusion with the polyhistidine tag from the pFastBac HBM TOPO vector you may use ProBond or Ni NTA resins to purify your recombinant fusion protein See the table below for ordering information Item Quantity Cat no ProBond Nickel chelating Resin 50 mL R801 01 150 mL R801 15 ProBond Purification System 6 purifications K850 01 Ni NTA Agarose 10 mL R901 01 25 mL R901 15 100 mL R901 10 Ni NTA Purification System 6 purifications K950 01 Purification Columns 50 columns R640 50 10
52. k to infect High Five insect cells and assay for expression of your recombinant protein The following guidelines and recommendations are provided for your convenience If you need more details about the techniques discussed refer to Current Protocols in Molecular Biology Unit 16 9 16 11 Ausubel et al 1994 The Baculovirus Expression System A Laboratory Guide King and Possee 1992 or Baculovirus Expression Vectors A Laboratory Manual O Reilly et al 1992 We recommend that you e Use High Five cells adapted to suspension culture in serum free medium for expression of secreted proteins e Perform a time course of expression to determine the maximum point of expression e Have a detection method for your protein High Five cells see page 54 for ordering information are particularly well suited for expression of secreted recombinant proteins This cell line BT1 TN 5B1 4 was originally developed by the Boyce Thompson Institute Ithaca NY and originated from the egg cells of the cabbage looper Trichoplusia ni the native host of AcMNPV Davis et al 1992 This cell line has the following characteristics e Grows well in monolayer and doubles in less than 24 hours for ease of use e Adaptable to suspension culture and serum free medium for high level protein expression and purification e Provides 5 10 fold higher secreted expression than Sf9 cells Davis et al 1993 For more information about High Five cells or
53. ker in the center because they can contain a mixture of cells with empty bacmid and recombinant bacmid 1 Pick 10 white colonies and restreak them on fresh LB agar plates containing 50 pg mL kanamycin 7 ug mL gentamicin 10 ug mL tetracycline 100 ug mL Bluo gal and 40 g mL IPTG Incubate the plates overnight at 37 C 2 Froma single colony confirmed to have a white phenotype on restreaked plates containing Bluo gal and IPTG inoculate a liquid culture containing 50 pg mL kanamycin 7 ug mL gentamicin and 10 pg mL tetracycline 3 Isolate recombinant bacmid DNA for analysis using the procedure provided on the next page 4 Analyze the recombinant bacmid DNA to verify successful transposition to the bacmid We recommend using PCR to analyze your bacmid DNA see Analyzing Recombinant Bacmid DNA by PCR page 15 Note It is possible to verify successful transposition to the bacmid by using agarose gel electrophoresis to look for the presence of high molecular weight DNA This method is less reliable than performing PCR analysis because high molecular weight DNA can be difficult to visualize You may also use other methods to prepare purified recombinant bacmid DNA for analysis and transfection However bacmid DNA must be clean and free from phenol and sodium chloride because contaminants may kill the insect cells and salt interferes with lipid complexing decreasing the transfection efficiency TM The PureLink HiPure Plasm
54. llow the solution to drain by gravity flow Do not force out any remaining solution The elution tube contains the purified DNA Discard the column 3 Add 0 63 mL isopropanol to the elution tube Mix then place the tube on ice for 10 minutes 4 Centrifuge the mixture at gt 15 000 x g at 4 C for 20 minutes Carefully remove and discard the supernatant Resuspend the DNA pellet in 1 mL 70 ethanol Centrifuge at gt 15 000 x g at 4 C for 5 minutes Carefully remove and discard the supernatant 7 Air dry the pellet for 10 minutes Resuspend the DNA pellet in 40 uL TE Buffer TE Allow the pellet to dissolve for at least 10 minutes on ice To avoid shearing the DNA pipet only 1 or 2 times to resuspend 9 Store the bacmid DNA at 4 C You may store your bacmid DNA at 20 C if you avoid frequent freeze thaw Important cycles which decrease the transfection efficiency To store your purified bacmid DNA at 20 C aliquot the bacmid DNA into separate tubes in TE Buffer pH 8 0 to avoid more than one freeze thaw cycle Do not store the bacmid DNA in a frost free freezer You may also store the purified bacmid DNA for up to 2 weeks at 4 C in TE Buffer pH 8 0 TM You may prepare glycerol stocks of DH10Bac E coli containing the bacmid DNA from mid logarithmic phase culture grown from white colonies picked during the blue white screening and store the glycerol stocks at 80 C for future bacmid DNA isolation 14 Analyzi
55. mL polypropylene columns AcTEV Protease 1 000 Units 12575 015 10 000 Units 12575 023 55 Technical Support Web Resources Visit the Invitrogen website at www invitrogen com for e Technical resources including manuals vector maps and sequences application notes MSDSs FAQs formulations citations handbooks etc e Complete technical support contact information e Access to the Invitrogen Online Catalog e Additional product information and special offers Contact Us For more information or technical assistance call write fax or email Additional international offices are listed on our website www invitrogen com Corporate Headquarters Japanese Headquarters European Headquarters 5791 Van Allen Way LOOP X Bldg 6F Inchinnan Business Park Carlsbad CA 92008 USA 3 9 15 Kaigan 3 Fountain Drive Tel 1 760 603 7200 Minato ku Tokyo 108 0022 Paisley PA4 9RF UK Tel Toll Free 1 800 955 6288 Tel 81 3 5730 6509 Tel 44 0 141 814 6100 Fax 1 760 602 6500 Fax 81 3 5730 6519 Tech Fax 44 0 141 814 6117 E mail techsupport invitrogen com E mail jpinfo invitrogen com E mail eurotech invitrogen com MSDS Certificate of Analysis Limited Warranty 56 Material Safety Data Sheets MSDSs are available on our website at www invitrogen com msds The Certificate of Analysis CofA provides detailed quality control information for each product and is searchable by product lot n
56. n System For more information refer to www invitrogen com or contact Technical Support see page 56 For guidelines and detailed information on insect cell culture refer to the Guide to Baculovirus Expression Vector Systems BEVS and Insect Cell Culture Techniques available for downloading at www invitrogen com or by contacting Technical Support see page 56 This guide contains information on e Maintaining and passaging insect cells in adherent and suspension culture e Freezing cells e Using serum free medium includes protocols to adapt cells to serum free medium e Scaling up cell culture Continued on next page General Guidelines Continued General Insect cells are very sensitive to environmental factors In addition to chemical and Guidelines nutritional culture factors physical factors can also affect insect cell growth therefore optimization is required to maximize cell growth Consider the following when culturing insect cells Temperature The optimal range to grow and infect cultured insect cells is 27 C to 28 C pH A range of 6 1 to 6 4 works well for most culture systems Sf 900 II SFM will maintain a pH in this range under conditions of normal air and open capped culture systems Osmolality The optimal osmolality of medium for use with lepidopteran cell lines is 345 to 380 mOsm kg Aeration Insect cells require passive oxygen diffusion for optimal growth and recombinant protein expression A
57. ng Recombinant Bacmid DNA by PCR Introduction Recombinant bacmid DNA is greater than 135 kb in size Since restriction analysis is difficult to perform with DNA of this size we recommend using PCR analysis to verify the presence of your gene of interest in the recombinant bacmid Use the pUC M13 Forward and Reverse primers sequences given below that hybridize to sites flanking the mini attTn7 site see figure below This section provides guidelines and instructions for performing PCR using the pUC M13 Forward and Reverse primers Transposed pFastBac HBM Gene of interest sequence Bacmid DNA mini atfTn7 pUC M13 pUC M13 Forward Reverse PCR Analysis with To verify the presence of your gene of interest in the recombinant bacmid using pUC M13 Primers DNA Polymerase PCR you may e Use the pUC M13 Forward and Reverse primers see sequences below e Use a combination of the pUC M13 Forward or Reverse primer and a primer that hybridizes within your insert Invitrogen does not supply the pUC M13 Forward and Reverse primers you must have these primers custom synthesized Primer Sequence pUC M13 Forward 5 CCCAGTCACGACGTTGTAAAACG 3 pUC M13 Reverse 5 AGCGGATAACAATTTCACACAGG 3 You may use any DNA polymerase of your choice for PCR including Platinum Taq DNA Polymerase If the expected PCR product is gt 4 kb we recommend using a polymerase mixture such as Platinum Tag DNA Polymerase High Fi
58. ng forces and it allows you to increase the impellar speed to 120 rpm for larger cultures Increasing the impeller speed increases aeration of the culture for better growth Continued on next page 42 Large Scale Expression of Recombinant Protein Continued Large Scale The following table summarizes other methods requirements benefits and Expression references for scale up production of recombinant protein using the baculovirus Options expression system Method Requirements Benefits References Stirred For a 5 liter Bioreactor Addresses increased oxygen Tom et al Bioreactor HEU needs of large scale culture 1995 Sterilized tubing Controlled growthand Murhammer amp NN optimization of variables in Goochee 1988 e Microbial air filters the culture Maiorella et al is purity nitrogen oxygen Increased cell densities 1988 and air n Elevated protein production O Reilly et al e pH dissolved oxygen and 1992 temperature probes Reproducible results for batch production of protein e External dissolved oxygen controller e External pH controller e Peristaltic pump for acid base lines e Linear recorder to monitor dissolved oxygen and pH control e Laminar flow hood in close proximity to the bioreactor Airlift For a 5 liter Airlift Fermentor Addresses increased oxygen Maiorella et al Fermentor needs of large scale culture 1988 e 5 liter airlift fermentor
59. ng site bases 215 216 TEV recognition site bases 222 242 6xHis tag bases 243 260 SV40 polyadenylation signal bases 305 545 Tn7L bases 574 739 f1 origin bases 923 1377 Ampicillin resistance gene bases 1508 2368 pUC origin bases 2513 3186 Tn7R bases 3432 3656 Gentamicin resistance gene bases 3723 4256 complementary strand 51 Map of pFastBac Gus Control Plasmid Description 52 TM pFastBac Gus is a 6 661 bp control vector that contains the Arabidopsis thaliana gene for B glucuronidase Gus Kertbundit et al 1991 The molecular weight of B glucuronidase is 68 5 kDa The map below shows the elements of pFastBac Gus control plasmid The vector sequence is available for downloading from www invitrogen com or by contacting Technical Support page 56 I E G ea EcoR Hind III Spe Xba Xho Sph Kpn Comments for pFastBac Gus vector 6661 nucleotides f1 origin bases 2 457 Ampicillin resistance gene bases 589 1449 pUC origin bases 1594 2267 Tn7R bases 2511 2735 Gentamicin resistance gene bases 2802 3335 complementary strand Polyhedrin promoter Ppp bases 3904 4032 GUS ORF bases 4081 5892 SV40 polyadenylation signal bases 6047 6287 Tn7L bases 6315 6480 Accessory Products Additional Products All of the reagents supplied in the Bac to Bac HBM TOPO Secreted Expression System and other products suitable for use with the Bac to Bac HBM TOPO Se
60. nly Not intended for any animal or human therapeutic or diagnostic use 60 invitrogen Corporate Headquarters Invitrogen Corporation 5791 Van Allen Way Carlsbad CA 92008 T 1 760 603 7200 F 1 760 602 6500 E tech_support invitrogen com For country specific contact information visit our web site at www invitrogen com
61. nt protein as many proteins may be degraded by cellular proteases released in cell culture Maximum expression of secreted proteins is generally observed between 30 and 72 hours If you have generated a high titer viral stock from pFastBac Gus control plasmid include this recombinant baculovirus in your experiments for use as an expression control After you have infected cells with the control virus the gene encoding B glucuronidase is constitutively expressed The molecular weight of B glucuronidase is 68 5 kDa For a rapid but qualitative assay for B glucuronidase expression see page 39 Continued on next page 33 Expressing Your Recombinant Protein Continued Seeding Densities and Volumes for Infections Calculating Virus Volumes 34 The table below gives approximate seeding densities and volumes for typical vessel sizes Infection at these densities in the minimal volumes listed yields optimal infection Minimal Volumes The total volumes used are lower than those used in general cell culture and maintenance so that the virus added is concentrated and can infect cells more readily Cell Density Cell density in adherent culture is approximately 50 confluent to allow maximal cell surface area for contact with virus and subsequent infection However to maximize the infection efficiency we recommend that you determine the optimal cell density for the specific cell type you are using MOI Use an MOI of 5 10 f
62. ntrol no virus in your experiment Note The amounts provided in this procedure are suitable to titer one baculoviral stock two 6 well plates per viral stock To titer more than one baculoviral stock scale up the reagent quantities accordingly 1 On the day of infection harvest Sf9 or Sf21 cells and prepare a 30 mL cell suspension at 5 x 10 cells mL in Sf 900 II SFM or other complete growth medium Aliquot 2 mL of cell suspension into each well of two 6 well plates If you are including a negative control you need another 6 well plate 2 Allow the cells to settle to the bottom of the plate and incubate covered at room temperature for 1 hour 3 Following the 1 hour incubation observe the cell monolayers using an inverted microscope Sf9 cells should be attached and at 50 confluence 4 Prepare an 8 log serial dilution 107 to 10 of the clarified baculoviral stock in Sf 900 II SFM or Grace s Insect Cell Culture Medium Supplemented without FBS as appropriate Sequentially dilute 0 5 mL of the baculoviral stock or previous dilution in 4 5 mL of medium in 12 mL disposable tubes finishing with 8 tubes of diluted viral stock i e 107 102 105 10 10 10 107 105 Use the dilutions 107 to 10 in your assay 5 Move the 6 well plates containing Sf9 cells and the tubes of diluted virus to the sterile hood Label the plates in columns of 2 1 sample well plus 1 duplicate as follows no virus negative control 10 1
63. o see some blue colonies Blue colonies contain non recombinant bacmids Insufficient time for color development Wait at least 48 hours before identifying colony phenotypes Used X gal instead of Bluo gal in agar plates Use Bluo gal in selective plates to increase the contrast between blue and white colonies Insufficient growth after transposition Grow transformed cells in S O C Medium for a minimum of 4 hours before plating Bluo gal and IPTG omitted from plates Prepare fresh selective plates containing 50 ug mL kanamycin 7 ug mL gentamicin 10 ug mL tetracycline 100 pg mL Bluo gal and 40 ug mL IPTG Too many colonies on the plate e Serially dilute the transformation mixture and plate to give well separated colonies e Adjust the serial dilutions of cells 10 to 10 to obtain well spaced colonies Plates too old or stored in light e Donot use plates that are more than 4 weeks old e Store plates protected from light Incubation period too short or temperature too low Wait at least 48 hours before picking colonies Incubate plates at 37 C Continued on next page Troubleshooting Continued Generating Recombinant Bacmid DNA continued Problem Reason Solution All colonies are blue DNA from your pFastBac HBM TOPO construct used for transformation was of poor quality e Use purified plasmid DNA for transformation
64. on Using Serum Free Medium Insect Cell Culture Reference Guide We recommend using Spodoptera frugiperda Sf9 or Sf21 insect cells as the host for your baculovirus transfer vector when you produce your recombinant bacmid We recommend using High Five cells for secreted expression of your protein from the recombinant bacmid because they are particularly well suited for expression of secreted recombinant proteins Before you start your transfection and expression experiments be sure to have cultures of Sf9 or Sf21 and High Five cells growing and have frozen master stocks available Sf9 Sf21 and High Five cells and cell culture reagents are available separately from Invitrogen see page 54 for ordering information Note High Five and Mimic Sf9 insect cells are suitable for use for expression only Insect cells may be cultured under serum free conditions We recommend using Sf 900 II SFM or Sf 900 III SFM available from Invitrogen see page 54 for culturing Sf9 and Sf21 cells Sf 900 II SFM and Sf 900 III SFM are protein free media optimized for the growth and maintenance of Sf9 and Sf21 cells For culturing High Five cells under serum free conditions use Express Five SFM see page 54 for ordering Express Five SFM is optimized for the growth and maintenance of High Five cells as well as for the large scale production and secretion of recombinant proteins expressed using the Bac to Bac HBM TOPO Secreted Expressio
65. on step if desired Continued on next page 21 Isolating P1 Viral Stock Continued Storing Viral Stocks The Next Step Note 22 Store viral stock at 4 C protected from light If medium is serum free e g Sf 900 II SFM Sf 900 III SFM add fetal bovine serum to a final concentration of 2 Serum proteins act as substrates for proteases For long term storage store an aliquot of the viral stock at 80 C for later reamplification Do not store routinely used viral stocks at temperatures below 4 C Repeated freeze thaw cycles can result in a 10 to 100 fold decrease in virus titer Once you have obtained your clarified P1 baculoviral stock you may Amplify the viral stock see the next section for details This procedure is recommended to obtain the highest viral titers and optimal results in your expression studies Determine the titer of your viral stock see Performing a Viral Plaque Assay page 25 Plaque purify your recombinant baculovirus if desired see Performing a Viral Plaque Assay page 25 Use the P1 viral stock to infect your Sf9 or Sf21 cells for preliminary expression experiments see below To perform small scale or preliminary expression experiments it is possible to proceed directly to expression studies by using the P1 viral stock to infect your cells Note that the MOI is unknown if viral titer is not determined and the amount of viral stock is limited without viral am
66. oncentration Storage Ampicillin 50 mg mL in water filter sterilize 20 C protected from light Kanamycin 10 mg mL in water filter sterilize 20 C protected from light Tetracycline 10 mg mL in 100 ethanol filter 20 C protected from light sterilize Gentamicin 7 mg mL in water filter sterilize 20 C protected from light Follow the procedure below to prepare a 200 mg mL stock solution of IPTG 1 Dissolve 2 g of IPTG in 8 mL of sterile water 2 Adjust the volume of the solution to 10 mL with sterile water 3 Filter sterilize through a 0 22 micron filter 4 Dispense the stock solution into 1 mL aliquots 5 Store at 20 C Follow the guidelines below to prepare a 20 mg mL stock solution of Bluo gal 1 Dissolve the Bluo gal in dimethylformamide or dimethylsulfoxide DMSO to make a 20 mg mL stock solution Use a glass or polypropylene tube Important Exercise caution when working with dimethylformamide Dispense solutions in a vented chemical hood only Do not filter the stock solution Store at 20 C protected from light Continued on next page 49 Recipes Continued LB Luria Bertani Medium LB Luria Bertani Plates 50 Composition 1 0 Tryptone casein peptone 0 5 Yeast Extract 1 0 NaCl pH 7 0 1 For 1 liter dissolve 10 g tryptone 5 g yeast extract and 10 g NaCl in 950 mL deionized water 2 Adjust the pH of the solution to 7 0 with NaOH and bring the volum
67. or a time course of protein expression or a large scale protein preparation Amount of Virus to Add The amount of virus to add depends on MOI Type of Vessel Cell Density Final Volume culture medium added virus 96 well plate 3 0 x 104 cells well 100 pL 24 well plate 2 0 x 10 cells well 500 pL 12 well plate 4 0 x 10 cells well 750 pL 6 well plate 1 0 x 10 cells well 1mL 60 mm plate 2 5 x 10 cells plate 3mL 25 cm flask 2 0 x 106 cells flask 5mL 75 cm flask 6 0 x 10 cells flask 10 mL 150 cm flask 1 2 x 10 cells flask 15 20 mL spinners all 2 0 x 1062 5 x 106 cells mL no more than half of the total volume of the flask To calculate the volume of viral stock needed to achieve a given MOI MOI desired Total number of cells Titer of viral stock Volume of virus For example to infect a spinner with 50 mL of culture at a cell density of 2 x 10 cells mL i e a total of 1 x 10 cells at an MOI of 5 using a high titer virus stock at 1 x 10 pfu virions mL you need 5 virions cell 1 x 10 cells 1 x 10 virions mL 5 mL of your viral stock Continued on next page Expressing Your Recombinant Protein Continued Determining Time When expressing a secreted protein analyze the supernatant for the presence of Points for Optimal secreted recombinant protein and the lysates from the cell pellet for the Secreted Protein presence of
68. or agrees in writing a not to transfer such materials to any third party and b to use such transferred materials and or information solely for research and not for Commercial Purposes Commercial Purposes means any activity by a party for consideration and may include but is not limited to 1 use of the product or its components in manufacturing 2 use of the product or its components to provide a service information or data 3 use of the product or its components for therapeutic diagnostic or prophylactic purposes or 4 resale of the product or its components whether or not such product or its components are resold for use in research For products that are subject to multiple limited use label licenses the terms of the most restrictive limited use label license shall control Life Technologies Corporation will not assert a claim against the buyer of infringement of patents owned or controlled by Life Technologies Corporation which cover this product based upon the manufacture use or sale of a therapeutic clinical diagnostic vaccine or prophylactic product developed in research by the buyer in which this product or its components was employed provided that neither this product nor any of its components was used in the manufacture of such product If the purchaser is not willing to accept the limitations of this limited use statement Life Technologies is willing to accept return of the product with a full refund For information about
69. page 56 TM If you include the pFastBac Gus baculoviral control construct in your expression experiment you may assay for B glucuronidase expression To assess P glucuronidase expression in a rapid manner mix a small amount of media from the infected cells with the chromogenic indicator X glucuronide and observe development of blue color 1 Mix5gL of 20 mg mL X glucuronide solution in DMSO or dimethylformamide with 50 uL of cell free medium 2 Monitor for development of blue color within 2 hours Note Other methods are also suitable 39 Expected Results Introduction In the following experiments see figures below the relative secretion efficiency of proteins fused to the HBM signal sequence was compared to two ordinarily secreted proteins human coagulation factor IX F9 and erythropoietin EPO To asses the relative secretion efficiency SF21 and High Five cells were infected with recombinant viruses coding for EPO and F9 fused to their own or to HBM signal sequences as indicated The culture media were collected at the indicated time points Proteins were detected by Western blots using anti his antibody Protein yield mg L was estimated by enzyme linked immunosorbent assays using VisuLize Factor IX Antigen Kit Affinity Biologicals Inc Ancaster Ontario Canada and Quantikine IVD R amp D Systems Minneapolis MN EPO F9 Mock Mock Infection EPOss HBMss Infection F9ss HBMss Days Pos
70. plification therefore expression conditions may not be reproducible Amplifying Your Baculoviral Stock Introduction Materials Needed Important Multiplicity of Infection MOI Example The P1 viral stock is a small scale low titer stock You may use this stock to infect cells to generate a high titer P2 stock The titer of the initial viral stock obtained from transfecting Sf9 or Sf21 cells generally ranges from 1 x 10 to 1 x 107 plaque forming units pfu mL Because amplification allows production of a P2 viral stock with a titer ranging from 1 x 10 to 1 x 10 pfu mL we generally recommend it This section provides guidelines and protocols for amplifying the recombinant baculovirus to prepare a P2 viral stock e Sf9 or Sf21 cells cultured in the appropriate growth medium e P1 baculoviral stock e Any appropriate tissue culture vessel see Important Note below e Tissue culture reagents e 27 C humidified incubator To amplify your P1 viral stock you may infect Sf9 or Sf21 cells growing in suspension or monolayer culture Depending on your needs you may amplify your P1 viral stock at any scale but remember that you may be limited by the amount of P1 viral stock available We generally amplify our P1 viral stock in a 10 mL suspension culture at 2 x 10 cells mL or in 6 well tissue culture plates at 2 x 10 cells well Calculate the number of Sf9 or Sf21 cells that you need for infection and expand cell
71. r antibiotics are present during transfection e Harvest viral supernatant when signs of infection are visible i e gt 72 hours post transfection Cells plated too sparsely Plate insect cells at the recommended cell density Used too much or too little Cellfectin II or other lipid reagent Optimize the amount of Cellfectin II or other lipid reagent used Time of incubation with DNA lipid complexes too short or too long Optimize the incubation time e g 3 to 8 hours Recombinant bacmid DNA is degraded e Check the quality of your recombinant DNA by agarose gel electrophoresis prior to transfection e Prepare bacmid DNA using Invitrogen s PureLink HiPure Miniprep or Maxiprep Kit see page 53 for ordering information e Store purified bacmid at 4 C do not freeze because freezing the baculovirus decreases transfection efficiency Bacmid DNA is not pure i e contains recombinant bacmid and empty bacmid e Screen other DH10Bac transformants and choose one that contains only recombinant bacmid e Perform plaque purification to isolate recombinant baculovirus Continued on next page 47 Troubleshooting Continued Expressing Your Protein 48 The table below lists some potential problems and possible solutions that may help you troubleshoot your expression experiments Problem Reason Solution Low protein expression Viral
72. refore a true time zero is established Achieving synchronous infection results in the maximum amount of protein being harvested at a given time point post infection because all cells in the culture are expressing protein at the same time You must determine the maximum time point for each protein and for each cell line used You may test different MOIs after the initial time course to achieve synchronous infection Infect a population of cells at varying MOIS e g 1 2 5 10 20 and assay for protein expression Use the MOI that provides the optimal level of recombinant protein expression For example if an MOI of 5 gives you protein over a wide range of times but an MOI of 10 lyses all infected cells before sufficient protein can accumulate try an MOI of 6 and or an MOI of 8 The objective in trying different MOIs is to find the MOI that yields the highest protein levels and the least loss due to lysis and proteolysis The use of suspension culture spinner or shake flask versus adherent culture can increase the cell density per mL of culture and therefore can potentially increase the relative yield of protein per mL of culture 41 Large Scale Expression of Recombinant Protein Introduction After successfully optimizing expression and secretion levels you may proceed to large scale expression of your recombinant protein You may move up to larger vessels 1 liter or more or go larger still and use airlift bioreactor
73. s To calculate the amount of virus to add see Calculating Virus Volumes page 34 Incubate spinners at 27 C with a spin rate of 80 to 90 rpm Remove 1 mL aliquots of cells at designated time point s see Determining Time Points for Optimal Secreted Protein Expression above and transfer each sample to a microcentrifuge tube 4 Pellet cells at 800 x g for 10 minutes at 4 C Keep samples at 4 C or on ice to prevent proteolysis 5 Transfer supernatant to a new tube Do not discard the cell pellet Label each tube containing the supernatant and cell pellet 6 Proceed to Analyzing Recombinant Protein page 37 or store the cell pellet and the supernatant at 80 C for analysis at a later time Note Storage at 80 C will reduce proteolysis of the recombinant protein If you are performing a time course lyse the cell pellet later when you have collected all time points Continued on next page 35 Expressing Your Recombinant Protein Continued Protocol for Adherent Cells 36 The following procedure adapted from Luckow and Summers is designed to allow expression analysis in a 24 well format from recombinant baculovirus infected adherent cells harvested 24 to 96 hours post infection For other plate and or flask sizes adjust the cell seeding densities and volumes Other protocols are also suitable Materials needed High titer pFastBac HBM baculoviral stock of known titer 2 10 pfu mL High Five cells
74. s accordingly Make sure that the cells are healthy of low passage 5 20 and have gt 95 viability before proceeding to infection To amplify your viral stock infect cells at a multiplicity of infection MOI ranging from 0 05 to 0 1 MOI is defined as the number of virus particles per cell Use the following formula to calculate how much viral stock to add to obtain a specific MOI MOI pfu cell x number of cells titer of viral stock pfu mL Inoculum required mL Note If you have not determined the titer of your P1 viral stock you may assume that the titer ranges from 1 x 10 to 1 x 10 pfu mL To infect a 10 mL culture at 2 x 10 cells mL with an MOI of 0 1 using a P1 viral stock at 5 x 10 pfu mL 0 1 pfu cell x 2x107 cells Inoculum required mL 7 5x10 pfu mL Inoculum required mL 0 4 mL Continued on next page 23 Amplifying Your Baculoviral Stock Continued Important considerations Amplification Procedure Scaling Up the Amplification Procedure Generating High Titer Stocks From Frozen Master Stock 24 For successful amplification of your baculovirus pay attention to several key points e Use Sf9 or Sf21 cells that are in excellent health low passage 5 20 log phase growth and have gt 95 viability e Use sterile P1 baculoviral stock that is free of contaminants e Use alow MOI between 0 05 0 1 Higher MOI reduces baculovirus quality e Harvest the
75. s and or fermenters This section summarizes the requirements and options that exist for large scale secreted expression of protein using the baculovirus expression system Large Scale If you are scaling up your suspension culture up to 1 liter spinner flasks see the Expression in sections on Suspension Cell Culture in the Growth and Maintenance of Insect Spinner Flasks Cell Lines manual This manual provides information on how to adapt Sf9 Sf21 TM or High Five insect cell lines to suspension culture and protocols for maintaining and scaling up suspension cultures It is available for downloading at www invitrogen com or by contacting Technical Support see page 56 To scale up your culture to 1 liter spinner flasks 500 mL total culture volume we recommend the following 1 Generate a large scale high titer stock of the desired recombinant virus see page 23 This stock will allow you to infect many large scale cultures and ensure consistency in protein expression 2 Start with 100 or 250 mL spinner flasks 50 125 mL of insect cell culture and scale up to 1 liter spinners with 500 mL of cell suspension 3 Seed cultures at 1 x 10 cells mL and subculture cell suspension when the density reaches 2 0 x 10 2 5 x 10 cells mL Check cell viability daily to ensure the culture is gt 95 viable 5 Add Pluronic F 68 to a final concentration of 0 1 in your spinner culture Adding Pluronic F 68 protects the cells from sheari
76. sing the following transfection conditions Use these conditions as a starting point for your transfection To obtain the highest transfection efficiency and low non specific effects optimize transfection conditions by varying DNA and Cellfectin II Reagent concentrations and cell density Condition Amount Tissue culture plate size 6 well 35 mm plate one well bacmid Number of Sf9 or Sf21 cells to transfect 8 x 10 cells Amount of bacmid DNA 1 ug can vary from 1 to 2 ug Amount of Cellfectin II Reagent 8 pL can vary from 1 5 to 9 uL Note This procedure is for insect cells in a 6 well format All amounts and volumes are given on a per well basis e Use Grace s Insect Cell Culture Medium Unsupplemented to seed all cells in plate for Sf9 and Sf21 cells grown in Grace s Insect Cell Culture Medium Supplemented with 10 FBS e With Cellfectin II you do not have to remove the medium from cells and wash cells prior to adding the DNA lipid complex to cells e The DNA lipid complex formation time is shorter 15 30 minutes when using Cellfectin II as compared to Cellfectin reagent e Do not add antibiotics during transfection Adding antibiotics during transfection causes cell death Continued on next page 19 Transfecting Insect Cells Continued Transfection Procedure 20 For Sf9 or Sf21 insect cells cultured in Supplemented Grace s Insect Medium containing 10 FBS use
77. t 42 7 2 eS T7 2 Medo 1 23 12 3 12 3 38 pae 188 d 96 SF21 2 e EPO mg L 040 0 00 0 00 0 08 2 07 6 92 0 14 6 18 7 00 F9 mgl 0 00 0 11 0 05 0 01 045 0 96 0 01 045 1 66 188 38 High 98 Five 28 62 EPO mg L 0 00 0 00 0 00 1 51 8 36 8 14 1 39 7 63 8 24 F9 mg L 0 00 0 10 0 05 0 05 1 69 2 94 0 04 1 20 2 02 40 Optimizing Protein Expression Introduction Time Course Synchronous Infection Multiplicity of Infection MOI Using Suspension Culture vs Adherent Culture A number of factors can influence determination of optimal expression conditions including the cell line MOI your application of interest and the nature of your gene of interest Use the following guidelines to determine the optimal conditions for expressing your recombinant protein of interest Infect cells at a constant MOI and assay for recombinant protein expression at different time points post infection e g 24 48 72 96 hours We recommend that you assay for protein expression at 24 hour intervals initially to get a general idea of when the protein is being expressed Once you have determined a time frame where optimal protein expression occurs e g between 48 and 72 hours perform a second time course with selected intermediate time points e g 52 60 and 68 hours to further optimize your expression levels Synchronous infection is defined as the infection of all cells in a culture at the same time point The
78. tion Bio Technology 10 1148 1150 Davis T R Wickham T J McKenna K A Granados R R Shuler M L and Wood H A 1993 Comparative Recombinant Protein Production of Eight Insect Cell Lines In Vitro Cell Dev Biol 29A 388 390 Kertbundit S Greve H d Deboeck F Montagu M V and Hernalsteens J P 1991 In vivo Random b glucuronidase Gene Fusions in Arabidopsis thaliana Proc Natl Acad Sci USA 88 5212 5216 King L A and Possee R D 1992 The Baculovirus Expression System A Laboratory Guide Chapman and Hall New York NY Lindner P Bauer K Krebber A Nieba L Kremmer E Krebber C Honegger A Klinger B Mocikat R and Pluckthun A 1997 Specific Detection of His tagged Proteins With Recombinant Anti His Tag scFv Phosphatase or scFv Phage Fusions BioTechniques 22 140 149 Luckow V A 1991 in Recombinant DNA Technology and Applications Prokop A Bajpai R K and Ho C eds McGraw Hill New York Luckow V A Lee C S Barry G F and Olins P O 1993 Efficient Generation of Infectious Recombinant Baculoviruses by Site Specific Transposon Mediated Insertion of Foreign Genes into a Baculovirus Genome Propagated in Escherichia coli J Virol 67 4566 4579 Luckow V A and Summers M D 1988 Signals Important for High Level Expression of Foreign Genes in Autographa californica Nuclear Polyhedrosis Virus Expression Vectors Virology 167 56 71 Maiorella B
79. uing Medium Incubate the cells for 7 10 days stain if desired and count the number of plaques in each dilution Factors Affecting A number of factors can influence viral titers including Viral Titer e The size of your gene of interest Titers generally decrease as the size of the insert increases e The transfection efficiency For the highest transfection efficiency we recommend transfecting Sf9 or Sf21 cells using Cellfectin II Reagent Prepare DNA lipid complexes in Grace s Insect Medium Unsupplemented see pages 18 20 for details e The age of your baculoviral stock Viral titers may decrease with long term storage at 4 C or 80 C If your baculoviral stock has been stored for 6 months to 1 year we recommend titering or re titering your baculoviral stock prior to use in an expression experiment e The number of freeze thaw cycles If you are storing your viral stock at 80 C viral titers can decrease as much as 10 with each freeze thaw cycle e Improper storage of your baculoviral stock For routine use baculoviral stocks should be aliquoted and stored at 4 C protected from light Continued on next page 25 Performing a Viral Plaque Assay Continued Materials Needed e Your clarified baculoviral stock store at 4 C until use Sf9 or Sf21 cells cultured in the appropriate medium 30 mL of log phase cells at 5 x 10 cells mL for each baculoviral stock to be titered Sf 900 II SFM Sf 900
80. umber which is printed on each box CofAs are available on our website at www invitrogen com support Invitrogen a part of Life Technologies Corporation is committed to providing our customers with high quality goods and services Our goal is to ensure that every customer is 100 satisfied with our products and our service If you should have any questions or concerns about an Invitrogen product or service contact our Technical Support Representatives All Invitrogen products are warranted to perform according to specifications stated on the certificate of analysis The Company will replace free of charge any product that does not meet those specifications This warranty limits the Company s liability to only the price of the product No warranty is granted for products beyond their listed expiration date No warranty is applicable unless all product components are stored in accordance with instructions The Company reserves the right to select the method s used to analyze a product unless the Company agrees to a specified method in writing prior to acceptance of the order Invitrogen makes every effort to ensure the accuracy of its publications but realizes that the occasional typographical or other error is inevitable Therefore the Company makes no warranty of any kind regarding the contents of any publications or documentation If you discover an error in any of our publications please report it to our Technical Support Representatives
81. unprocessed recombinant protein Compare the supernatant sample Expression and the lysate sample to determine if recombinant protein is being secreted how much protein has been secreted and how much protein remains intracellular at different times during secretion Using this data optimize your time points for maximal secreted protein expression levels see Optimizing Protein Expression page 41 Note B glucuronidase expression from the pFastBac Gus positive control baculovirus is intracellular i e not secreted because the gene product lacks the HBM secretion signal sequence Protocol for Cells The following procedure is designed to allow expression analysis from 50 mL of in Suspension High Five cells at a density of 2 x 106 cells mL cultured in a 100 mL spinner Culture flask Note Use cells with a doubling time of 18 24 hours and a viability of 95 Cells should be at a passage number less than 30 and they should not have been in spinner culture for more than 2 months Materials needed e High titer pFastBac HBM baculoviral stock of known titer 2 10 pfu mL e High Five cells e Express Five SFM e One 100 mL spinner flask per sample e Microcentrifuge tubes Protocol 1 Add the pFastBac HBM baculoviral stock to the spinner flask at the desired MOL Include the appropriate controls mock infected uninfected cells pFastBac Gus positive control baculovirus previously characterized recombinant baculoviruse
82. utral Red solution and add it to plates for 1 2 hours just prior to counting plaques 7 10 days post infection Important If you plan to plaque purify your baculovirus do not stain plaques because Neutral Red is a known mutagen that can alter your recombinant virus Neutral Red Preparing a Neutral Red Agarose Overlay for use on Day 4 Staining 1 Prepare a 1 mg mL Neutral Red solution in Sf 900 II SFM or other Procedure appropriate complete growth medium Filter sterilize 2 Combine the reagents below in a 50 mL tube and place in a 40 C water bath 1 mg mL Neutral Red solution 1 5 mL Sf 900 II SFM 16 5 mL 3 Microwave 4 Agarose Gel until melted then place it in a 40 C water bath for 5 minutes 4 Move the 50 mL tube of Neutral Red solution and the 4 agarose gel to a sterile hood Add 6 mL of 4 agarose gel to the Neutral Red solution 5 Add 1 mL ofthe Neutral Red overlay to each well containing plaquing overlay Once the agarose has hardened return plates to a 27 C humidified incubator until plaques are ready to count Plaques appear as clear spots on a red monolayer Preparing a Neutral Red Stain for use on Day 7 10 prior to counting plaques 1 2 Prepare a 1 mg mL Neutral Red solution in cell culture grade distilled water Add 0 5 mL of Neutral Red solution to each well containing plaquing overlay Incubate for 1 to 2 hours at room temperature Gently remove excess stain with a pipette or blotter and count the pl
83. vector into which your gene of interest is cloned After you amplify your gene of interest using a proofreading polymerase and clone it into the pFastBac HBM TOPO vector as a blunt end PCR product you transform One Shot Mach1 T1 Chemically Competent E coli You then select and analyze transformants for the correct insertion of your blunt end PCR products and use the recombinant vector as a donor plasmid to generate a recombinant baculovirus The expression of the gene of interest is controlled by the Autographa californica multiple nuclear polyhedrosis virus AcMNPV polyhedrin Pu promoter for high level expression in insect cells This expression cassette is flanked by the left and right arms of Tn7 The cassette also contains a gentamicin resistance gene and an SV40 polyadenylation signal to form a mini Tn7 The presence of the N terminal Honey Bee Mellitin HBM secretion signal coding sequence on the plasmid facilitates the secretion of the cloned gene product into the extracellular medium the C terminal polyhistidine tag allows easy purification of the secreted protein Continued on next page Bac to Bac HBM TOPO Secreted Expression System Components Continued DH10Bac E coli Baculovirus Shuttle Vector Helper Plasmid Cellfectin Reagent 9 1 The second major component of the System is the DH10Bac E coli strain that is used as the host for the pFastBac HBM construct containing your gene o
84. viral Stock nennen 23 Performing a Viral Plaque Assay siio E e Ea eE eE 25 Expressing Your Recombinant Protein tenente 32 Analyzing Recombinant Protein sessssssssseeeeeeerennenet enne tenete tenente 37 Expected Results inie otc pter tede denied re Atrei tani didam ite toit nU 40 Optimizing Protein Expression y i oret e aie ere et aaea eaa Eiro eaa ea asea AE AAEE se eea aiaa 41 Large Scale Expression of Recombinant Protein 42 Tro bleshootlhg c nac cran phonon anaa a e Y aa papa n tua Co Dax ag quan oa EE Uu enda Dn TERRA Ion omae 44 Appendix srnu EET IT T TQ I I 49 RECIP OS fc shies 49 Map of pFastbac ZEBMSTOPO S ittm dU RR eae st UU RE 51 Map of pFastBac Gus Control Plasmid ssssssssssssssssisesssttssssrsisssntssssntesssnsnsssninsnreesnnrttsnrreesntreesntreens 52 Accessory Products opes eed ed Ue AE edet diti E ie Saas eee et RR 53 Technical SuppOLt ied ia piedi edit dive eed aeo ced bh Seren reri Ies 56 Purchaser Notification e teen dere tea re aee ei o CR eave ated 57 References USER ERR e t a e iude EE ERE aA ES aee SOE oe EO 59 iii Kit Contents and Storage System Each Bac to Bac HBM TOPO Secreted Expression System contains the Components components listed below See the next page for a detailed description of other reagents supplied with each system Component Amount Bac to Bac HBM TOPO Cloning Kit 1 kit

pBAD/Thio His TOPO manual - Thermo Fisher Scientific

Contents

Download Pdf Manuals

Related Search

Related Contents