New quick method for isolating RNA from laser captured cells
Contents
1. aa Es 17 FFP HDB PH BHT SS BS SB 41 2 a Gyia Number Ue bal od il Ul bab H j aj ESA kemman keri JE Bihia Pictures 5ty GeneAmp 5 Fig 11 Sensitivity of the assay RNA from the equivalent of a single cell infected with RSV was analyzed for the presence of bRSV and ovine ribosomal S15 mRNA housekeeping gene From this recent result we now feel confident that the collection of 10 to 20 cells by LCM for the purposes of IF IHC LCM RT PCR is the optimal number not only to save time but also to avoid collecting cellular debris on unintended portions of the cell collection surfaces of the HS LCM caps resulting from picking up and setting down the caps on tissue samples multiple times in effort to collect 100 500 or 1000 cells or more We have shown this debris to inhibit real time RT PCR reactions The sensitivity of this assay will now allow us to avoid having to pick up the LCM caps multiple times We designed real time primers and probe to this ovRPS15 sequence using computer software from ABI Prism Primer Express v 2 0 Our sequences for the forward and reverse primers and fluorogenic probe for ovRPS15 are 5 CGAGATGGTGGGCAGCAT 3 5 GCTTGATTTCCACCTGGTTGA 3 and 5 VIC CCGGCGTCTACAACGGCAAGACC TAMRA 3 where VIC is a proprietary fluorescent reporter dye known only by its 3 letter acronym a trademark of Applera Corporation We also designed sequence specific oligonucleotide primers and2. a second plate is designed for each target to enable the testing of various concentrations of each probe ranging from 25 nM to 225 nM in the presence of optimal primer concentrations as established by plate 1 in each case For each probe in each well each 50 ul PCR reaction contained the identified optimal concentrations of each primer for each target which we found to be 300 nM and 300 nM for ovine SP A 300 nM and 300 nM for ovine SP D 300 nM and 900 nM for SBD 1 900nM and 400 nM for ovine MCP 1 1000 nM and 1000 nM for ovine bovine TLR4 and 1000 nM and 1000 nM for ovine RPS15 forward and reverse primer concentrations respectively 5 ul of 1 5 diluted Stock I cDNA 25 ul of the ABI commercial master mix mentioned above and nuclease free water Each separate primer probe study in each of these each optimization plates for target is run in quadruplicate replicates in order to enhance the statistical significance of each sample observation in all cases quadruplicate sample well signals agreed to within gt 0 01 lending high credence to the technique s stability This second probe optimization plate is run in the GeneAmp 5700 sequence data not shown detection system using the same thermocycler program as used for the first primer optimization test plate For the second plates for each target upon analysis of the resultant data the combination of reactants which yielded the lowest Cr the threshold cycle or the
3. Cr value is the cycle at which a significant increase in ARn is first detected where ARn is calculated from Rn and Rn where Rnt is the Rn value of a reaction containing all components Rn is the Rn value of an unreacted sample the baseline value or the value detected in the no template control NTC ARn is thus the difference between Rn and Rn and it is an indicator of the magnitude of the signal generated by the PCR see ABI literature for further information with the lowest probe concentration is chosen as the optimal fluorogenic probe concentration in each case which we found to be 50 nM 100 nM 150 nM 100 nM 100 nM and 150 nM for ovine SP A ovine SP D SBD 1 ovine MCP 1a ovine bovine Gallup et al New quick method for isolating RNA from laser captured cells stained by immunofluorescent immunohistochemistry RNA suitable for direct use in fluorogenic TaqMan one step real time RT PCR www biologicalprocedures com 81 TLR4 and ovine RPS15 probes respectively Next as a validation test that the target and endogenous reference cDNA amplification reactions are all proceeding at equal across a spectrum of Stock I cDNA concentrations a third plate the validation test plate is efficiency designed to enable the testing of various concentrations of cDNA ranging from full strength Stock I cDNA to a 1 15 625 i e attained by the seventh dilution in a series of progressive 1 5 dilutions dilution of Stock I cDNA In each
4. an appropriate one step master mix compatible with SuperScript II RT transcription enzyme for reverse Fig 6 IF IHC staining for bRSV antigen using Cy3 viewed on a regular fluorescence microscope Briefly 100 300 cells 100 laser shots of a particular cell type as identified during LCM either by IF IHC or morphology are laser captured onto HS LCM caps using a PixCell II laser capture microdissection microscope LCM Arcturus We have captured samples using 500 and 1000 laser shots in the past in order to increase the percentage of intended cell targets and minimize cross contaminating cell populations but it proved to be very time consuming and we frequently ran into the problem of depleting our intended cell types before capturing 500 or 1000 spots We subsequently found that 100 shot samples yielded the same results as 1000 shot samples and later found that 20 shot samples worked best In our studies cells that are CD208 Fig 7 CD208 bRSV Figs 6 and 8 or bRSV are considered to be type II Gallup et al New quick method for isolating RNA from laser captured cells stained by immunofluorescent immunohistochemistry RNA suitable for direct use in fluorogenic TaqMan one step real time RT PCR www biologicalprocedures com pneumocytes type I pneumocytes viral antigen containing or viral antigen non containing cells respectively Fig 7 IF IHC staining for alveolar type II cells marker CD208 us
5. fluorescent probes for our other real time targets of interest SBD 1 SP A SP D ovine MCP la and TLR4 using Primer Express v 2 0 in conjunction with the search tool BLAST Basic Local Search Tool Biotechnology Information Resultant probe sequences Alignment National Center for are checked for specificity by comparing them for similarity to all other available sequences in the database Only unique sequences and or sequences that spanned genomic introns are used for our SP A SP D SBD 1 MCP la and TLR4 primer and probe designs We identified ovine TLR4 real time primers and probe by trial and error using the bovine sequence for TLR4 accession number NM 174198 as a general ruminant Gallup et al New quick method for isolating RNA from laser captured cells stained by immunofluorescent immunohistochemistry RNA suitable for direct use in fluorogenic TaqMan one step real time RT PCR www biologicalprocedures com TLR4 template The second real time primer probe set we designed for ovine TLR4 and tested on ovine lung total cDNA worked beautifully The forward and reverse primers and fluorogenic probe for ovine TLR4 is as follows 5 GAGAAGACTCAGAAAAGCCTTGCT 3 y GCGGGTTGGTTTCTGCAT 3 and 5 6FAM TAAACCCCAGAGTCCAGAAGGAACAGCA 3 _ respectively The primer and probe sequences for our other targets are for SP A 5 TGACCCTTATGCTCCTCTGGAT 3 5 GGGCTTCCAAGACAAACTTCCT 3 and 5 6FAM TGGCTTCTGGCCTCGA
6. minutes at 25 C 45 minutes at 53 C 15 minutes at 70 C followed by a safety hold at 4 C Standard curves generated for each target had the following equations when plotted as log input cDNA vs Ct for SP A y 3 5491x 31 0207 R 0 9725 for SP D y 2 8747x 31 9853 R 0 9525 for SBD 1 y 4 5093x 35 2325 R 0 7713 for TLR4 y 4 2945x 33 7240 R 0 8068 for MCP 1 y 3 7496x 32 5020 R 0 9138 and for ovRPS15 y 3 8041x 27 8233 R 0 9881 It is important to note here however that running standards on all plates from which to generate standard curves for each target on each plate remains the most accurate approach toward attaining reliable real time quantitation data since standard and sample reactions for the same target on the same plate experience the same degree of reaction or indeed amplification efficiency inefficiency Normalization For the LCM RNA samples on which we used the optimal primer and probe conditions as established with cDNA in preliminary studies each target signal mRNA level is normalized to its respective ovRPS15 signal by dividing the target input amount quantity value of RNA by the ovRPS15 input amount quantity value of RNA for each This is followed by calculating the average and standard error of the mean for all replicates per each particular sample group For cell culture studies we have used 185 ribosomal RNA but samples are diluted 1 1000 bef
7. to be meaningful the threshold should be set when the product is in exponential phase Typically this is set at least 10 standard deviations from of the baseline The efficiency of the reaction can be calculated from signals generated from a target dilution series by the following equation amplification efficiency 10 slore this is not to be confused with exponential amplification which 10 1slope The efficiency of the PCR ideally should be 90 110 3 6 slope 3 1 A number of variables can affect the efficiency of the PCR length of the amplicon secondary template structure and primer design to name a few Although valid data can be obtained that fall outside of the efficiency range the quantitative RT PCR should be further optimized or alternative amplicons designed 3 For more extensive background on the principles of fluorogenic one step and two step real time RT PCR https www appliedbiosystems com or visit http www ambion com or http www invitrogen com Real time reagents parameters and considerations In the current communication master mix and reverse transcriptase RT enzyme are used as suggested and provided in a commercially available kit Cat No 4309169 TaqMan One Step RT PCR Master Mix ABI The Multiscribe MuLV RT enzyme 10 U ul included in the kit arrives already pre mixed with RNAse inhibitor 40 U ul ABI as a 40X solution The one step master mix which contains AmpliT
8. typical EXCEL spreadsheet we ve designed for calculating absolute or relative real time target quantities greets the strongest principal approach in qPCR which is to always run calibration Gallup et al New quick method for isolating RNA from laser captured cells stained by immunofluorescent immunohistochemistry RNA suitable for direct use in fluorogenic TaqMan one step real time RT PCR www biologicalprocedures com 92 curves for all targets multiple times to prove the consistency of the efficiency of amplification for each target and always include a standard curve for each target on every plate very rarely does one see two different target amplification reactions exhibit identical efficiencies Finally no template controls NTC and no reverse transcriptase controls NRC are run for all samples as well No amplification controls NAC which contain no Taq polymerase enzyme are run on separate plates by themselves for each RNA isolate Qty 100P C iwmatie your no expression cr 42_ k eT 15 irran im a j a ea serial 1 5 3 5491 mi Qty Oty Oty gtr curve 31 02071 b normnalisedto normalised to normalised to Name Cr Qty 515 185 Geolin 5 168195 1 38 23 000330463 1 2050 12 3513 3 8611 d 38 5 QOOTsOss05 1 0122 10 3750 3 24068 2 36 22 0034273025 95 6043 374 6072 189 2460 2 36 1 qosrossa7s 103 3449 404 937 204 5682 3 30 3 1 S5h81 30452 48 1048 1105812 1470 7293 4787 a 30 5 1401898879 4 2509 971245 5490 64
9. ug ul glycogen solution is added to each sample The concentration of glycogen stock solution will vary depending on what final sample volumes are to be prepared e g 36 ul final sample volumes are prepared here The goal is to have glycogen Gallup et al New quick method for isolating RNA from laser captured cells stained by immunofluorescent immunohistochemistry RNA suitable for direct use in fluorogenic TaqMan one step real time RT PCR www biologicalprocedures com 79 end up at the correct desired ug ul in each of the final LCM RNA sample preparations so that its final concentration during real time RT PCR never rises above 0 2 ug ul in each final reaction well an amount that is roughly equivalent to the suggested use of yeast tRNA in the same regard and which is safely below the 2 ug ul glycogen limit above which it has been reported to inhibit PCR reactions 4 After glycogen addition samples are gently vortexed and subsequently spun down to collect Sample extracts are then transferred to new nuclease free 0 2 ml microvials MidWest Scientific and the desired final volume of 36 ul for each sample is additionally ascertained during this final sample transfer or samples are used right away in the real time RT PCR application and not transferred Note when we opt to use the RNA samples right away i e without freezing at 80 C we take advantage of the last heating step at 75 C see above by letting it se
10. 05 9332 4 26 4 Sarsgogess 15931 4148 3440730500 74037 6287 4 28 11 BSG0RESSN8T 19229 3764 415299 5007 89364 1558 5 3934 DOSZ 0 5859 25389 9614 1220757 5 38 9 D0007 0 7809 33778 2491 162 4065 6 37 66 OMATT 41 8137 420 3075 132 5692 6 37 23 0017801687 51 7964 520 6531 164 2193 T 38 22 2 008365135 27 2499 5604 3724 350 7851 T 38 12 quonegseza34 29 0758 5980 0270 416 9822 Fig 26 Our typical relative quantitative real time qPCR EXCEL worksheet based on the strongest qPCR mathematical principals These values are then used to perform one or two tailed t tests on in accordance with the statistical guidelines as currently suggested by ABI 3 Gallup et al New quick method for isolating RNA from laser captured cells stained by immunofluorescent immunohistochemistry RNA suitable for direct use in fluorogenic TaqMan one step real time RT PCR www biologicalprocedures com
11. 2005 TA Be Ek Yew Setup drna Wik Hel SEIE nme zz TEE ELN 137 SF PM DBP BPH r BT Ws se a d Gyda Number i 2 3 4 E a 7 aoa a ee 37 a 41 43 45 47 4 Fleece Eel rere stan EBs A F Sparkman Gali Lani keri Fa GencAmp 5700505 er TERAM Fig 9 Bovine respiratory syncytial virus ORSV RNA signal The bRSV amplification plots here correspond to each of the samples in Figure 10 below analyzed for ovRS15 These signals were attained from the equivalent of RNA from about 21 cells in each case In addition Figure 11 shows that we have recently detected one step real time RT PCR signal in samples containing RNA from the equivalent of a single cell using the common assumption that one mammalian cell contains 10 30 pg of total RNA but upon isolation yields 10 pg of RNA Gallup et al New quick method for isolating RNA from laser captured cells stained by immunofluorescent immunohistochemistry RNA suitable for direct use in fluorogenic TaqMan one step real time RT PCR www biologicalprocedures com 77 fy GeneAmp 5700 S05 Software bASV FISTS 3 4 2005 ee EM Wew Saip drwyr arek Hei pja ab e ajz ejaj paea naus firey F paN Std Curve W Dersocation W Repat i Prive Cytles 13 8 F WW 1 1 17 1 21 2 BPW SS BW 41 4 2 a y Gyda Number 4 2 a 4 fi E T a F 16 ah 42 a E z ee ee EA Wst E By 9D aema keri Fig 10 Ovine Riboso
12. 94 mM KCI 5 71 mM MgCh 2 08 mM dNTP mix 2 6 uM random hexamers and 0 0222 ug ul TURBO DNase treated RNA is heated for 5 minutes at 65 C then snap cooled on ice for at least 1 minute Note We made our own 10X reverse transcription buffer 300 mM TRIS HCI 625 mM KCI pH 8 3 and used it in the master mix above Additionally our TURBO DNase treated RNAs are all pre diluted such that the addition of 36 ul to each final 100 ul reverse transcription reaction resulted in each reaction containing 2 1389 ug total RNA template and two to four such 100 ul reactions are created from the same original reverse transcription master mix for all samples Samples are spun down and RNAse inhibitor 20 U ul ABI and SuperScript III RT enzyme 200 U ul Invitrogen are finally added to each cooled sample reverse transcription mixture now 200 to 400 ul each The final concentrations attained of each reverse transcription component are 3 25 nuclease free water 30 mM TRIS 62 5 mM KCl 5 5 mM MgCh 2 mM dNTPs 0 5 mM each of dATP dCTP dTTP and dGTP 2 5 uM random hexamers 3 5 U ul SuperScript IM RT enzyme 0 4 U ul RNAse inhibitor and 0 021389 ug ul TURBO DNase treated RNA These vortexed gently split into 100 ul amounts into nuclease free 0 2 ml tubes MidWest Scientific and the tubes are placed into the GeneAmp 2400 thermocycler which only reagents are accepts samples of 100 ul or less Reverse transcription thermocycler conditions are 5
13. Biol Proced Online 2005 7 1 70 92 doi 10 1251 bpo0107 May 30 2005 New quick method for isolating RNA from laser captured cells stained by immunofluorescent immunohistochemistry RNA suitable for direct use in fluorogenic TaqMan one step real time RT PCR Jack M Gallup1 Kenji Kawashima2 Ginger Lucero and Mark R Ackermann 1Department of Veterinary Pathology College of Veterinary Medicine lowa State University Ames lowa 50011 1250 2Environmental Hygiene Section Shichinohe Research Unit National Institute of Animal Health 31 Uminai Shichinohe Aomori 039 2586 Japan 3Invitrogen R amp D Carlsbad CA 92008 Corresponding Author Jack M Gallup Department of Veterinary Pathology College of Veterinary Medicine lowa State University Ames lowa 50011 1250 Email eag iastate edu Submitted March 21 2005 Revised May 12 2005 Accepted May 12 2005 Indexing terms Immunohistochemistry Sheep Gene Expression Polymerase Chain Reaction ABSTRACT We describe a new approach for reliably isolating one step real time quantitative RT PCR quality RNA from laser captured cells retrieved from frozen sections previously subjected to immunofluorescent immunohistochemistry IF IHC and subsequently subjected to fluorogenic one step real time RT PCR analysis without the need for costly time consuming linear amplification One cell s worth of RNA can now be interrogated with confidence This approach represents an amalgam of te
14. GTGCG TAMRA 3 for SP D 5 ACGTTCTGCAGCTGAGAAT 3 y TCGGTCATGCTCAGGAAAGC 3 and 5 6FAM TTGACTCAGCTGGCCACAGCCCAGAACA TAMRA 3 for SBD 1 5 CCATAGGAATAAAGGCGTCTGTGT 3 5 CGCGACAGGTGCCAATCT 3 and 5 6FAM CCGAGCAGGTGCCCTAGACACATGA TAMRA 3 and for ovine MCP 1la the sequence used for ovine MCP la primer and probe design g GAGAGGGGCCAATCCAGAGGCCAACAGCTCCCAC GCTGAAGCTTGAATCCTCT CGCTGCAACATGA AGTTCTCCGCTGCTCTCCTCTGCCTGCTACTCACAG TAGCTGCCTTCAGCACCGAGGTGCTCGCTCAGCCA GATGCAATTAACTCCCAAATTGCCTGCTGCTATAA ATTCAATAAGAAGATCCCCATACAGAGGCTGACA AACTACAGAAGAGTCACCACCAGCAAGTGTCCCA AAGAAGCTGTGATTTTCAAGACCATCCTGGGCAAA GAGTTTTGTGCAGACCCCAACCTGAAATGGGTCCA GGACGCCATAAACCATCTCAACAAGAAAAACCAA ACTCCGAAGCCTTGA 3 was provided in a recent publication 5 5 GCTGTGATTTTCAAGACCATCCT 3 5y GGCGTCCTGGACCCATTT 3 and 5 6FAM AAAGAGTTTTGTGCAGACCCCAACC TAMRA 3 where 6FAM is 6 carboxyfluorescein the fluorescent reporter dye and TAMRA is 6 carboxytetra methylrhodamine the fluorescent quencher dye We determined our optimal real time concentrations for target and endogenous reference forward and reverse primers using the standard grid testing method as suggested by ABI see Additional Details Regarding Optimizing Real Time Primers and Fluorogenic Probes Before their use with Experimental Samples Optimization and validation tests performed on cDNA section below for more 78 details Our optimal co
15. al time RT PCR www biologicalprocedures com concentrations of primers and probes to use for each target as well as the optimal useful dilution of cDNA template found to be 1 5 for our purposes to use that would allow each PCR to proceed with optimal efficiency To accomplish this two separate optimization plates are set up for each target the second of which can only be set up after results from the first plate are obtained in each case In other words each target required one plate to optimize primer concentrations and another plate to optimize probe concentration The first plate in each case is designed to enable the testing of various combinations and concentrations of the forward and reverse primers ranging from 50 nM to 900 nM while the probe amount remained fixed In each well the 50 ul PCR mixtures contained a constant concentration of target probe 200 nM 5 ul of 1 5 diluted target inclusive Stock I cDNA footnote at end of section 25 ul of a commercial master mix Cat No 4304437 TaqMan Universal PCR Master Mix 2X ABI and nuclease free water which is used to adjust each final volume to 50 ul after the desired primer and probe amounts are added For all optimization trials each sample is analyzed in quadruplicate so each final sample preparation is 200 ul in each case We create and use master mixes whenever it is beneficial logical and appropriate to do so throughout each real time procedure Each primer opti
16. aq Gold hot start DNA Polymerase 5 5 mM MgCl 10 mM of each A C and G dNTP s and 20 mM dUTP ROX passive internal reference molecule a PCR Reagents Kit product carryover correction component other ABI proprietary buffer components but no AmpErase UNG enzyme arrives as a separate 2X solution 5 ml total in the kit Each of our 30 ul one step real time RT PCR reactions contain 15 ul one step Master Mix 0 25 U ul Multiscribe RT enzyme 0 4 U ul RNAse inhibitor 76 optimal forward and reverse primer and fluorogenic probe concentrations previously established for each target using two step real time RT PCR according to classic ABI protocol see below nuclease free water and 7 8 ul of each LCM RNA template cell extract isolate Before use all solutions are gently vortexed and spun down Our thermocycling conditions for fluorogenic one step RI PCR are 35 minutes at 48 C for reverse transcription normally 30 minutes ABI 10 minutes at 95 C for AmpliTaq Gold DNA polymerase hot start activation and 50 cycles of 15 seconds at 95 C for duplex melting 1 minute at 58 C for annealing and extension normally 60 C ABI Note we altered the ABI suggested thermocycling conditions for their one step master mix in favor of what we found to be more optimal for our particular targets For recent real time results using this IF HC LCM RT PCR method see Figures 9 10 ia GeneAmp S700 SOS Software BS SIS J a
17. aser power settings on the PixCell I LCM system Arcturus Figs 3 5 we use for cell capture typically start at 80 milliwatts mW for a duration of 800 usec giving us a calculated spot size of 10 um but these settings are frequently adjusted in order to address each slide individually to optimize cell pick up up to 100 mW for 1 msec A il il s i pE zag n Fig 4 Another view of the PixCell Il LCM system TE So Most single laser shots exacted on our ovine lung sections result in the capture of 1 to 3 cells at a time even when the laser spot is adjusted to its smallest possible diameter so great care is taken to make sure only specifically intended cells and or groups of cells are accurately retrieved ows i Fig 5 Using fluorescence for IF IHC stained sections during LCM For lung tissue we typically use an objective lens setting of 20X to inspect our IF IHC stained sections during laser capture the field images are clear and identifying different cell types is relatively easy Figs 6 8 After all cells of interest are harvested onto HS LCM caps Cat No LCM 0214 Arcturus total RNA is isolated from captured cells using our own method Figs 17 22 which represents a combination of Arcturus Invitrogen 2 and Applied Biosystems ABI Foster City CA reagents products and procedures a method which is currently being optimized by Invitrogen in collaboration with us to form
18. ble base molds disposable base molds Cat No 03040 Surgipath Medical Industries Richmond IL containing OCT Cat No 25608 930 Tissue Tek OCT VWR International Batavia IL more OCT is applied over the tissues and these are then placed onto blocks of dry ice until the tissues and OCT are frozen to a solid white All samples are then transferred immediately to 80 C for storage LCM tissues are cut with a cryostat Leica CM 1900 into 6 um LCM sections and sections are placed onto precleaned superfrost plus 25 x 75 x Imm glass slides Cat No 48311 703 VWR Scientific West Chester PA at 25 C see Fig 15 This procedure is considered a standard Leica microtome procedure see with Arcturus Arcturus Mountain View CA protocol http www hbu de range htm In accordance suggestions we did not dry the sections after cutting we instead stored them directly after cutting onto slides first at 20 C in a box inside the cryostat itself then at 80 C for durations of anywhere from 0 to 8 days with no additional OCT applied without noticeable loss of immunofluorescence or real time signals from all such sections After 8 days real time signals started showing a severe decline Upon retrieval from 80 C for use in IF IHC LCM slides are either treated as in Figure 16 in cases where no IF IHC procedure is to precede LCM or they are quickly transferred into cold nuclease free PBS made with HPLC grade water Fisher Scie
19. bobAmp HS RNA Amplification Kit costs 695 minimum and 3 Any tampering with RNA samples in effort to amplify or reverse transcribe into cDNA invites the risk of skewing original RNA profiles and this in turn can compromise real time qPCR results when such manipulated nucleic acid species are used as templates Real time TaqMan assay principle The principle of the TaqMan reaction is based on the use of fluorogenic probes designed to hybridize to the gene target sequence of two PCR primers Each probe contains a 5 fluorescent reporter dye and a 3 quencher dye In the intact probe the presence of the 3 quencher inhibits the 5 reporter emission by quenching its energy emission During the extension phase of PCR cycling the annealed probe is cleaved by the 5 3 exonuclease activity of Taq polymerase This cleavage produces an increase in fluorescence emission of the reporter dye This event occurs each PCR cycle only if the probe has annealed to the target sequence which leads to an increase of fluorescence proportional to the initial concentration of target sequences in the sample Such real time fluorescence detection is performed by the ABI PRISM 7700 Sequence Detector Applied Biosystems Inc In this instrument a 96 well thermal cycler is connected by fiber optic cables to a CCD camera detector Laser excitation 488 nm and fluorescence detection between 520 and 660 nm are performed every 7 seconds during the
20. calprocedures com 18 19 20 2A 22 2O 24 Ackermann MR Gallup JM Zabner J Evans RB Brockus CW Meyerholz DK Grubor B Brogden KA Differential expression of sheep beta defensin 1 and 2 and interleukin 8 during acute Mannheimia haemolytica pneumonia Microbial Pathogenesis 2004 37 21 27 Grubor B Gallup JM Ramirez Romero R Bailey TB Crouch EC Brogden KA Ackermann MR Surfactant Protein D expression in normal and pneumonic ovine lung Vet Immunology amp Immunopathology 2004 101 235 242 Meyerholz DK Grubor B Fach SJ Sacco RE Lehmkuhl HD Gallup JM Ackermann MR Reduced Clearance of Respiratory Syncytial Virus in a Preterm Lamb Model Microbes amp Infection 2004 6 14 1312 1319 Meyerholz DK Grubor B Gallup JM Lehmkuhl HD Anderson RD Lazic T Ackermann MR Adenovirus Mediated Gene Therapy Enhances Parainfluenza Virus 3 Infection in Neonatal Lambs J Clin Micro 2004 42 10 4780 4787 Broackes Carter F Mouchel N Gill D Hyde S Bassett J Harris A Quantitative CFTR transcript analysis by TaqMan Temporal regulation of CFTR expression during ovine lung development implications for CF gene therapy Hum Mol Genet 2002 11 125 131 Swillens S Goffard J C Marechal Y de Kerchove d Exaerde A Housni EH Instant evaluation of the absolute initial number of cDNA copies from a single real time PCR curve Nuc Acids Res 2004 32 6 e53 Peirson SN Butler JN Foster RG Experimental validat
21. centrations Ct values are inspected during probe optimizations and the lowest Ct threshold cycle value with the lowest probe concentration is the criteria by which one chooses the optimal probe concentration Once the Ct value no longer decreases with increasing probe concentration one has attained the useful optimal probe concentration Little known is the fact that all real time target signals can be found with greater than 50 amplification efficiency simply using 1000 nM primers and 150 nM probe unpublished observations from our lab Gallup et al New quick method for isolating RNA from laser captured cells stained by immunofluorescent immunohistochemistry RNA suitable for direct use in fluorogenic TaqMan one step real time RT PCR www biologicalprocedures com 89 Appendix B Processing the Ain Values from the 6700 looking for highest An value with lowest primer concentration Dont Use SPA Use These Numbers Not in use For and Rev Primer tested Quadruplioates Hine Hila Pili Tube Primer Optiniization Test 1 triplicate samples Prim r Optimization Test 1 quadruplicate samples Well iG Fig 23 Typical EXCEL file set up for primer probe optimizations and validations Gallup et al New quick method for isolating RNA from laser captured cells stained by immunofluorescent immunohistochemistry RNA suitable for direct use in fluorogenic TaqMan one step real time RT PCR www biologicalprocedures com 90 Appe
22. chnologies already offered commercially by Applied Biosystems Arcturus and Invitrogen It is the primary focus of this communication to expose the details and execution of an important new LCM RNA isolation technique but also provide a detailed account of the IF IHC procedure preceding RNA isolation and provide information regarding our approach to fluorogenic one step real time RT PCR in general Experimental results shown here are meant to supplement the primary aim and are not intended to represent a complete scientific study It is important to mention that since LCM RT PCR is still far less expensive than micro array analysis we feel this approach to isolating RNA from LCM samples will be of continuing use to many researchers with limited budgets in the years ahead INTRODUCTION samples and to achieve accurate molecular analyses in such samples By using a low power infrared laser to About 9 years ago in 1997 Lance Liotta M D Ph D chief of capture individual cells or pure cell populations LCM the Laboratory of Pathology at the National Cancer Institute ensures that RNA and DNA remain undamaged during and his laboratory published an article in Science that described the microdissection process To study the genetic the process of laser capture microdissection LCM This changes that occur in transition from a normal to an invention was driven by the need to isolate pure pre invasive cell cell subpopulations sometimes malignant cel
23. ct use in fluorogenic TaqMan one step real time RT PCR www biologicalprocedures com 86 RNA isolation from Laser captured cells for One Step samples pats am 3 eStore at 4 C once prepared Resus pe s part 55636 invitrogen kit 11732 010 Lysis enhances parbi S5827 Invitrogen kit 11732 010 40 U uLl pati S5407 from invitragen kit 1080 200 110 00 uL Ola YSIS Sutter prepared For all 10 samples Ha LOM Capa from ARCTURIUS Cat Mo LEM IGDa 0 5 mL tubes Cells laser shots per HS cap 20 ABI Cat Na nen ser captured cells on an HS Desired final sample volumes 36 uL fil alp eh avaseia Manu from the cap Ginger Lucero suggestion on March 230d 2005 peel tabs off and incubate at 60 C for 10 min then 75 C for 6 min Peel cell tabs off caps and place in Lysis buffer After laser capture remove polymer tabs from HS Caps with nuclease free forceps and put them in Lysis Buffer in the bottom of ABI 0 5 mL tubes and incubate tubes at 50 C for 10 min spin samples down then pipette the liquid samples leaving tabs behind into new tubes then incubate these sample solutions at 75 C for 5 minutes DNase Treatment of Extracts Spin down extracts after the 75 C incubation then to each add Ginger Lucero suggestions on March Jrd 2005 use 1 6 ul 10 DNase Butter and 6 ul DNase per typical sample 1 6uL of 10X DNase buffer from Cells Direct kit art 55605 Invitrogen k 18080 200 and 5 0uL ofDNase amplification grade 1 U
24. e targets of interest generated by reverse transcription with SuperScript II RT enzyme as follows Total RNA is isolated from 0 3 grams of sheep lung tissue using our own optimized procedure 6 All total RNA isolates are assessed for quantity and purity by examining 1 50 dilutions of each by spectrophotometry at 260nm and 280nm and DNase treatment is performed using the TURBO DNA free kit from Ambion DNase treatment mixtures are vortexed gently then incubated in a 2400 thermocycler Perkin Elmer ABI for 30 minutes at 37 C 1 ul DNase Inactivation Reagent per 10 ul solution is added to each tube The tubes are incubated for 2 minutes at room temperature with intermittent vortexing every 10 to 15 seconds then centrifuged at 10 000 x g for 1 5 minutes to pellet the Inactivation Reagent The upper transparent layer containing the RNA is transferred to a new tube care is taken to avoid Gallup et al New quick method for isolating RNA from laser captured cells stained by immunofluorescent immunohistochemistry RNA suitable for direct use in fluorogenic TaqMan one step real time RT PCR www biologicalprocedures com 79 15 25 of the solution on the bottom of each tube which is the pelleted Ambion DNase Inactivation inhibit PCR reactions Next complementary deoxyribonucleic acid Reagent polymer complex that can CDNA synthesis is performed Reverse transcription master mix containing 3 38 nuclease free water 31 17 mM TRIS 64
25. e the RT step in a One Step procedure is prone to variable degrees of efficiency or one should assume it to be recent seminars on real time qPCR have stressed this and the reverse primer is used up to an unknown extent during 1 strand synthesis For validation Turbo DNase treated total RNAs are first converted to total cDNAs using SuperScript HI RT enzyme Invitrogen in a tightly controlled RT reaction using 2 ug RNA per each 100 uL RT reaction To assess concentration of each RNA isolate before DNase treatment spectrophotometer readings of 1 50 dilutions of each are taken at 260 nm 280 nm and 230 nm to check for RNA concentration 260 nm RNA purity 260 280 our RNA ratios are typically gt 1 92 and GIT EDTA and or TRIS contamination 230 nm 260 230 ratios are acceptable if gt 2 0 here ours are consistently gt 2 0 Appendix F We no longer use the ABI primer probe set for 185 ribosomal RNA for assessing RIBO 185 as a housekeeping gene because of its faulty design 22 Our newly designed set for RIBO 18S will help us establish a consistent RIBO 185 signal in our LCM samples we believe In addition we also use ovine RPS15 as a second housekeeper Appendix G We haven t had the need to generate dose dependent line graphs for our qPCR studies Our mathematical approach already takes into account the Pfaffl approach and is aware of the theoretical ramifications of equations offered by Swillens et al and Foster et al 23 24 The
26. each re ii THIS FILE REPRESENTS ALL THE OPTIMIZED PARAMETERS FOR LCM AND THE RNA ISOLATION WE USE Fig 17 EXCEL file layout detailing RNA extraction isolation procedure where polymer tabs with laser captured cells are first peeled off the HS LCM caps and then processed 10 ul of Resuspension buffer and 1 ul Polymer Peel of Lysis Method Enhancer forceps polymer a _ Polymer 10 ul of cells Resuspension Transfer aqueous to a new tube Cells embeded ere ul and incubate at 75 C for 5 min in polymer or Lys mins Enhancer Proceed with protocol Heat at 50 C 10 min Luce Fig 18 EXCEL file layout detailing RNA extraction isolation procedure where polymer tabs with laser captured cells are first peeled off the HS LCM caps and then processed Gallup et al New quick method for isolating RNA from laser captured cells stained by immunofluorescent immunohistochemistry RNA suitable for direct use in fluorogenic TaqMan one step real time RT PCR www biologicalprocedures com 87 Gallup et al New quick method for isolating RNA from laser captured cells stained by immunofluorescent immunohistochemistry RNA suitable for direct Fig 19 An Arcturus HS LCM Cap gt a Pia Fig 20 The removable polymer tab onto which cells are laser captured being lifted by forceps Fig 21 The removed polymer tab if desired one can additionally trim the tabs closer to the central region where the captured cells are u
27. entire PCR cycling The signal attributable to the 5 nuclease reaction is expressed as Rn values which represent reporter signal normalized against the emission of a passive reference ROX minus the baseline signal established in the first cycles of PCR conventionally collected from cycles 3 10 on ABI 7300 7500 and 7700 machines or from cycles 6 15 on the GeneAmp 5700 machine This range can also be increased up to the cycle immediately prior the appearance of the fluorescent signal of more concentrated templates according to the different kinetics of amplification This value increases during PCR because the amplicon copy number increases until the reaction approaches a plateau At the same time the algorithm determines the threshold cycle Cr which represents the PCR cycle at which an increase in reporter fluorescence above a baseline signal can first be detected The sequence detection software generates a calibration curve of Cr vs quantity of reference template and then Gallup et al New quick method for isolating RNA from laser captured cells stained by immunofluorescent immunohistochemistry RNA suitable for direct use in fluorogenic TaqMan one step real time RT PCR www biologicalprocedures com determines unknowns quantities by interpolation To obtain accurate Cr values the baseline needs to be set at least two cycles earlier than the Cr value for the most abundant sample For real time quantitative RT PCR data
28. ession of Tracheal Antimicrobial Peptide and Inflammatory Response Elements in the Lungs of Neonatal Calves and with Acute Bacterial Pneumonia Inf Immun 2003 71 5 2950 2955 Opriessnig T Yu S Gallup JM Evans RB Fenaux M Pallares FJ Thacker EL Brockus CW Ackermann MR Thomas P Meng XJ Halbur PG Effect of Vaccination with selective Bacterins on conventional Pigs infected with Type 2 Porcine Circovirus Vet Pathol 2003 40 6 521 529 Opriessnig T Fenaux M Yu S Evans RB Cavanaugh D Gallup JM Ackermann MR Pallares FJ Thacker EL Lager KM Meng XJ Halbur PG Effect of Porcine Parvovirus Vaccination on the Development of PMWS in Segregated Early Weaned Pigs Coinfected with Type 2 Porcine Circovirus and Porcine Parvovirus Veterinary Microbiology 2004 98 3 4 209 220 Meyerholz DK Gallup JM Grubor BM Evans RB Tack BF McCray Jr PB Ackermann MR Developmental expression and distribution of sheep b defensin 2 Dev Comp Immun 2004 28 171 178 Grubor BM Gallup JM Meyerholz DK Crouch EC Evans RB Brogden KA Lehmkuhl HD Ackermann MR Enhanced Surfactant Protein and Defensin mRNA Levels and Reduced Viral Replication during Parainfluenza Virus Type 3 Pneumonia in Neonatal Lambs CDLI 2004 11 3 599 607 Gallup et al New quick method for isolating RNA from laser captured cells stained by immunofluorescent immunohistochemistry RNA suitable for direct use in fluorogenic TaqMan one step real time RT PCR www biologi
29. eyerholz DK Crouch EC Evans RB Brogden KA Lehmkuhl HD Ackermann MR Enhanced surfactant protein and defensin mRNA levels and reduced viral replication during parainfluenza virus type 3 pneumonia in neonatal lambs Clin Diagn Lab Immunol 2004 11 3 599 607 7 Applied Biosystems User Bulletin 2 ABI PRISM 7700 Sequence Detection System SUBJECT Relative Quantitation of Gene Expression Calculating the Input Amount 2001 p 8 8 Pfaffl MW A new mathematical model for relative quantification in real time RT PCR Nucleic Acids Res 2001 29 9 e45 10 11 12 13 14 I5 16 17 Bustin SA A Z of Quantitative PCR Bustin SA editor IUL Biotechnology No 5 Ist ed International University Line August 2004 882 pages Mocellin S Rossi CR Pilati P Nitti D Marincola FM Quantitative real time PCR a powerful ally in cancer research Trends Mol Med 2003 9 5 189 195 Wang E Miller LD Ohnmacht GA Liu ET Marincola FM High fidelity mRNA amplification for gene profiling Nat Biotechnol 2000 18 4 457 459 Gallup JM Grubor B Barua AB Mohammadi G Brogden KA Olson JA Mark R Ackermann MR Repeated intravenous doses of all trans retinoyl B D glucuronide is not effective in the treatment of bacterial bronchopneumonia in lambs but is devoid of gross and acute toxicity Med Sci Monit 2002 8 9 BR345 BR353 Caverly JM Diamond G Gallup JM Brogden KA Dixon RAF Ackermann MR Coordinated Expr
30. groups differences between groups are determined using the between treatment Significant appropriate two tailed homoscedastic t test or one tailed t test as suggested by ABI when appropriate also see Appendix G But again it is important to note here that running standards on all plates from which to generate standard curves for each target on each plate remains the most accurate approach toward attaining reliable real time quantitation data since standard and sample reactions for the same target on the same plate will both invariably experience the same degree of amplification reaction efficiency or indeed inefficiency Standard curves are prepared for each gene under study for RNA quantitation absolute or relative quantitation or for verification of the efficiencies of the reactions for comparative quantitation using the AACr method which is only valid when target and reference standard curve slopes are within 0 1 units of one other a seldom useful Standard constructed to extend above and below the expected approach in practice curves are all abundance of each target Sometimes especially during target primer and probe validation runs additional input quantities are included such as the minimum and maximum RNA amounts above and below the limit of detection to help differentiate between specific and non specific products Target inclusive Stock I cDNA refers to a pre selected sheep cDNA from which it i
31. h debris Gallup et al New quick method for isolating RNA from laser captured cells stained by immunofluorescent immunohistochemistry RNA suitable for direct use in fluorogenic TaqMan one step real time RT PCR www biologicalprocedures com exhibit significantly poorer signals during one step real time RT PCR unpublished observations Since we now have improved the sensitivity of the assay by employing this new approach to RNA isolation the need to pick up the HS LCM caps multiple times in order to collect enough cells for ample real time signal has been effectively eliminated It is additionally important to note here that the maximum volume of RNA isolate sample per each 30 ul reaction is 7 8 ul The RNA sample can not exceed 26 of the total reaction volume or the master mix components themselves begin to incur dilution by sample beyond their suggested optimal real time concentrations This is why we use 7 8 ul size samples per each 30 ul reaction In addition eliminating EDTA addition after DNAse I treatment 1 ul of 25 mM is normally added to each sample before denaturing DNase I at 75 C as suggested in the SuperScript II CellsDirect cDNA Synthesis System protocol by Invitrogen is key to maximizing the signal magnitude of our target amplifications We found the ABI one step master mix TaqMan One Step RT PCR Master Mix Reagents Kit Cat No 4309169 ABI to be susceptible to additional EDTA whereas other master mixes Inv
32. ing Cy3 viewed on a regular fluorescence microscope Other captured populations include cells adjacent to or nearby bRSV antigen containing cells while bronchiolar epithelial cells were identified and captured solely on the basis of morphology Laser shots to bRSV cells The cells captured by LCM The lung tissue after LCM Fig 8 IF IHC images obtained during LCM Cy3 appears as a yellowish fluorescence bRSV IF IHC on infected lung New approach to LCM RNA isolation This new approach to RNA isolation from laser captured cells involves the removal of the small round polymer tab from each HS LCM cap onto which the cells have 74 been melted by the laser during capture and processing them directly If one looks closely one will see that this laser meltable polymer surface is actually applied to each cap as a small round sticker on the laser capture surface Immediately post capture these tab polymer stickers are peeled away from each cap with a nuclease free instrument e g forceps pre treated by baking at 180 C for 6 hours and then sprayed with Ambion s RNAse ZAP then rinsed with nuclease free water and each is placed into a separate 0 5 ml nuclease free microfuge tube Product N8010611 GeneAmp Tube ABI already containing 10 ul of Lysis Buffer made up of Invitrogen s Resuspension Buffer Lysis enhancer and RNAseOUT reagents mixed 10 to 1 1 to 1 e g 10 1 1 1 respectively The tubes are incubated a
33. ion of novel and conventional approaches to quantitative real time PCR data analysis Nuc Acids Res 2003 31 14 e73 84 Gallup et al New quick method for isolating RNA from laser captured cells stained by immunofluorescent immunohistochemistry RNA suitable for direct use in fluorogenic TaqMan one step real time RT PCR www biologicalprocedures com 85 APPENDICES AND ADDITIONAL FIGURES Fix amp Hydrate Shake 5 g Stain Acridine Orange or Cresyl Violet Wash Ethanol Dehydrate 100 100 Ethanol xylene SLIDES ARE SUBJECTED TO EACH SOLUTION SHOWN ABOVE FOR 30 SECONDS Fig 16 To process and use tissues we first fill a plastic cryo mold half way with OCT then we freeze the OCT partially just the edges place the tissue in center cover tissue with OCT freeze until opaque this is most quickly performed in a dry ice ethanol bath but we have successfully performed this on dry ice alone as well We cut sections on a cryostat after cleaning cryostat with ethanol and then we store the resulting slides 80 C and never let them thaw Upon use we take slides from 80 C fridge and place them either directly into 95 ethanol with no PBS or water exposure at all or if pursuing IF IHC before LCM slides are placed directly into cold nuclease free PBS 0 1 Tween 20 Gallup et al New quick method for isolating RNA from laser captured cells stained by immunofluorescent immunohistochemistry RNA suitable for dire
34. itrogen may withstand higher amounts Conceivably additional Mg could be added to the ABI master mix to help restore its activity if indeed EDTA addition during DNase I denaturation is needed in some cases but we have not tried that approach presently Our RT NRC controls consistently show very little DNA contamination see Figures 12 14 Ginger Lucero M F S Invitrogen Invitrogen LCM samples 2 2 05 life technologies LCM samples 100 ovine cells 2 2 06J CCAM Iragan iss 12a Sa cDNA pep gS bial TITFA LI MEEN ME E ECE AE EE e LRT RT 40 ng cDNA NTC 26 05 _uncet__ ample 2 2513 undt ret 43 22 26 05 no amp 9 06 18S LUX Fig 12 Results from Invitrogen show that our typical RT controls are valid 82 Further addition of glycogen to our isolates appears to have no effect positive or negative on our ability to detect real time signals Fig 13 so researchers may consider eliminating glycogen from this procedure without consequence Invitrogen LCM glycogen 2 28 05 fife technologies nn 2 28 05 LCM Samples Ovine ICAM TaqMan Enna 100 ovine cells cap 50 reaction i bese pygeeen arin alyeogen t glycogen 20ng cDNA 300 Iysate f NTC re 2809 det bait a a Fz eit j f NTC tysale stored at 80 for 1 month Glycogen added i l 30 ug glycogen was added during the DNAse I ait treatment s iy The addition of glycogen is not nece
35. ls from the native surrounding tissue to representing lt 5 of the total tissue need to be isolated to facilitate the study of molecular events leading to reduce contamination from other cell types Before LCM invasive cancer and has helped to advance science in the process of isolating specific cell populations from many ways LCM has enabled researchers to analyze tissue was extremely difficult To perform LCM a slide purified populations of cells directly from patient tissue containing tissue of interest is placed under a microscope 2005 by the author s This paper is Open Access and is published in Biological Procedures Online under license from the author s Copying printing redistribution and storage permitted Journal 1997 2005 Biological Procedures Online 71 and the image is brought up on a computer screen Cells of interest are selected with a joystick and atthe push of a button an infrared laser melts a special film above the targeted cells The film then sets and the user pulls the chosen cells away from the tissue slide These selected cells are ready for molecular analysis i e RNA isolation real time RT PCR The remaining tissue on the slide is still intact and can be and one step fluorogenic subjected to further dissection if the tissue is still sufficiently dehydrated It has been observed that microdissected cells display very different genetic profiles when compared to cultured cells Many new genes ha
36. mal S15 m mRNA TTN The ovRS15 aRplHICatlen plots below correspond to each of the samples in Figure 9 analyzed for bRSV above These signals were attained from the equivalent of RNA from about 21 cells in each case We abandoned the use of 18S Ribosomal RNA as housekeeper see also Appendix A item 6 since the primers and probe provided as part of an ABI RNA control reagents kit were of a faulty design 22 Instead we used ovine ribosomal protein 515 ovRPS15 as the housekeeping endogenous reference gene the sequence of which we received from Dr Sean Limesand Department of Pediatrics University of Colorado Health Sciences Center Perinatal Research Center PO Box 6508 F441 Colorado 80045 which he had successfully cloned into a pCRII plasmid and used as a Aurora housekeeping gene with conventional PCR work in sheep pancreas ovRPS15 in pCRII as read from the T7 promoter 5 TTCCGCAAGTTCACCTACCGCGGCGTAGACCTCGA CCAGCTGCTGGACATGTCCTATGAGCAACTGATGC AGCTATACAGCGCGCGCCAGCGACGGCGGCTGAA CCGCGGCCTGCGGA GGA AGCAGCACTCGTTGCTG AAGCGGCTGCGCAAGGCCAAGAAAGATGCGCCGC CCATGGAGAAGCCCGAGGTGGTGAAGACGCACCT GCGCGACATGATCATTCTGCCCGAGATGGTGGGCA GCATGGCCGGCGTCTACAACGGCAAGACCTTCAA CCAGGTGGAAATCAAGCCTGAGATGATTGGCCACT ACCTAGGCGAGTTCTCCATCACCTACAAGCCCGTA AAGCATGGCCGGCCCG 3 7 GeneAmp 5700 S05 Software bVSV AS15 Plate 3 3 20 G Eia Ei Wew Selupe drspat Wireless Hels BEI jej alt plat gamy Mrs HET PTA Std curve Y Dereocatien
37. mization plate is run in a GeneAmp 5700 real time PCR machine GeneAmp 5700 Sequence Detection System ABI using the following thermocycler conditions which is used for all two step fluorogenic real time qPCR runs in this study it is a specific thermocylcer program created and optimized by ABI to be used specifically with cat no 4304437 TaqMan Universal PCR Master Mix 2X and two or three other related ABI 2X Master Mix reagents Hold for 2 minutes at 50 C to activate the AmpErase UNG enzyme which destroys any dUTP containing PCR carryover products left over in the PCR room from previous runs that may have drifted into your tubes during set up Hold for 10 minutes at 95 C to hot start activate the AmpliTaq Gold DNA polymerase and then 50 cycles of 15 seconds at 95 C followed by 1 minute at 60 C to accomplish the annealing and extension phases of the PCR Each 50 cycle run lasted 2 hours and 14 minutes after which the GeneAmp 5700 sequence detection system software and Microsoft EXCEL are used in conjunction with one another to analyze the resultant fluorogenic PCR amplification data 80 For the first optimization plate for each target primer amounts that upon analysis provided the highest Rn with the lowest identified as the concentrations for each primer pair for each of the see below concentration s are value primer optimal respective targets of interest To test each probe for optimal efficiency
38. ncentrations were 300 and 300 nM for ovine SP A 300 and 300 nM for ovine SP D 300 and 900 nM for SBD 1 forward and reverse primers 6 900 and 400 nM for ovine MCP 1 and 1000 and 1000 nM both for ovine TLR4 and ovRPS15 forward and reverse primers respectively Similarly optimal concentrations of fluorogenic probes are found to be 50 nM for SP A 100 nM for SP D 150 nM for SBD 1 100 nM for TLR4 100 nM for ovine MCP 1x and 150 nM for ovRPS15 Each plate contained both target and endogenous references for all samples present on that plate and a negative no template control NTC nuclease free water for each target and endogenous reference No transcriptase controls or NRC one step reactions containing everything except reverse reverse transcriptase enzyme to test for genomic DNA contamination are run on each RNA sample in separate plates prior the actual sample plates Duplicate replicates are run for each of these time intensive LCM samples Preparation of cDNAs for calibration standard curve runs preliminary target Using the GeneAmp 5700 software and EXCEL relative quantities of each target are calculated from all real time Cr values crossing a threshold of 0 1 using 5 point serial progressive 1 3 standard curves generated months beforehand specifically for each target SP A SP D SBD 1 TLR4 MCP 1la and ovRPS15 using cDNAs made from a mixture of 7 different sheep lung total cDNAs bearing all real tim
39. ndix C Process Cle For Tripicates TEST 2 RESULTS Probe Optimization For Quadruplets Bont Use SP A Use These Numbers Nat in use Quadruplicates WINNER Probe Optemization Test 2 tiplicate samples Fig 24 Real Time probe optimization test following primer optimization Gallup et al New quick method for isolating RNA from laser captured cells stained by immunofluorescent immunohistochemistry RNA suitable for direct use in fluorogenic TaqMan one step real time RT PCR www biologicalprocedures com 91 Appendix D ct xe 0 000 90 600 me e m ome 0 699 33 656 be 31020 784 40 83 ET 41 390 95 066 Biia E mi 2053 dw 2097 39 016 44 Hdd reo 2 786 41 675 HE KATT an ope a E 3 895 22 750 aus 45 4 Cem 158 45 000 iig 45 65 i 4 26 1 ee og sa 41 55 T S 780 41 6 Wesel a OOOO 418 45 72 B iis ig er 35 3 0 2 5 20 14 10 O05 LOG of relate cOMA standard concentrations predecied y s oldys L 0 000 54 024 30 800 0 699 53 504 35 555 of avg d points 41 390 35 902 55 065 2 087 30 463 30 015 2 796 40 088 41575 3 0865 43 424 42 750 4 104 45 905 45 000 Fig 25 Typical Validation run result for testing optimal primer and probe optimizations note these validation curves additionally serve as target standard curves as well Appendix E Our validation tests are never performed on RNA only on cDNA and for obvious reasons it is not valid to optimize real time PCR using RNA sinc
40. ntific Hanover IL PBS tablets and 0 1 Tween 20 Sigma St Louis MO within 30 seconds of their removal from the freezer apparently RNA degradation sets in very rapidly if this particular maneuver is not performed quickly according to an Arcturus field technician The PBS is inside 5 slide plastic mailers Cat No 240 3074 030 Evergreen Scientific Los Angeles CA After 1 minute in cold PBS slides are moved into a fresh cold 4 8 C PBS bath for 5 minutes Carefully a small region above and below each tissue is dried off with a clean absorbent Terri cloth and a PAP pen liquid wax pen from BioGenex San Ramon CA is used to draw a line above and below each tissue section on each slide care is taken to avoid flooding liquid wax over the sections by pressing down too hard on the PAP pen during use these pens are not certified to be nuclease free so be extra careful where their contents end up Next an IF HC procedure is carried out as follows after all IF IHC reagents are pre cooled to 4 C blocking solution comprised of 1 normal goat serum NGS Sigma and 1 normal swine serum NSS Invitrogen Grand Island NY added to Common Antibody Diluent BioGenex is added to the sections for 5 minutes Then in Gallup et al New quick method for isolating RNA from laser captured cells stained by immunofluorescent immunohistochemistry RNA suitable for direct use in fluorogenic TaqMan one step real time RT PCR ww
41. ore use because of its hyper abundance in comparison to mRNA targets as a housekeeper in addition to ovRPS15 in which case we use the geometric mean of the ribosomal protein 515 and 18S ribosomal RNA values to normalize our target signals Other researchers have suggested using up to 10 different housekeeping genes for each experiment which is too costly and impractical for most We now avoid the use of f actin tubulin and GA3PDH as housekeeping genes since their stability and therefore usefulness has come under extensive fire recently and over the past few years Additional details regarding optimizing real time primers and fluorogenic probes before their use with experimental samples Optimization and validation tests performed on cDNA Weeks and months prior to final sample RNA analyses by one step fluorogenic real time RT PCR each primer probe set with the exception of the ABI pre optimized 18S ribosomal RNA primer probe set first had to be evaluated with cDNA for optimal primer and probe that fluorogenic PCR kinetics is obtained in each case see concentrations to ensure maximal real time Appendix A E These optimization and validation experiments are performed on cDNA exactly as suggested by ABI in order to find the correct Gallup et al New quick method for isolating RNA from laser captured cells stained by immunofluorescent immunohistochemistry RNA suitable for direct use in fluorogenic TaqMan one step re
42. rve not only as the DNase I denaturing step but also as the template linearization step so samples are placed on ice for at least 1 minute after this step and then considered ready for real time RT PCR at that point Before use isolates that were stored at 80 C are heated for 5 minutes at 65 C in a GeneAmp 2400 Perkin Elmer ABI followed by snap cooling on ice for at least 1 minute to thermocycler ensure template linearity before use as templates for fluorogenic one step real time RI PCR Samples are spun down and 7 8 ul of each is used as RNA template in 30 ul fluorogenic one step real time RT PCR reactions as carried out in 96 well PCR reaction plates ABI using a GeneAmp 5700 Sequence Detection System ABI for detection and relative quantification of five mRNA targets of interest to us ovine surfactant protein A SP A ovine surfactant protein D SP D sheep beta defensin 1 SBD 1 bovine ovine toll like receptor 4 TLR4 and ovine monocyte chemoattractant protein 1 alpha MCP 1a For a detailed EXCEL file look at this particular RNA sample isolation approach refer to Figure 17 which represents all optimized of the LCM RNA isolations Linear amplification is not pursued in our mathematical aspects sample approach for a number of reasons 1 It defeats the purpose of a quick method linear amplification of LCM RNA can take up to three days in practice 2 It is costly e g a commercial amplification kit Ri
43. s are put through a series of solvents also contained in nuclease free 5 slide plastic mailers First sections are placed into nuclease free 75 ethanol for 30 seconds 95 nuclease free 72 ethanol for 30 seconds twice into extra dry or very fresh 100 ethanol for 30 seconds ultra fresh xylene for 5 minutes then again into ultra fresh xylene for 10 minutes up to 2 hours this parameter is left adjustable depending on how many slides one is handling i ff a J lt 5 i j mS lt gt gt P q e P EO J T f t Fig 2 For immunofluorescence immunohistochemistry IF IHC procedure Humidified chamber containing the slides on the metal slide rack being placed inside a cold room at 4 C Notice the small leveling device atop the container to ensure that reagent run off is not allowed Laser capture microdissection LCM Just before LCM slides are dried for 15 minutes under a laminar flow hood and immediately placed inside a desiccator with fresh desiccant until subjected to LCM LCM is routinely performed on each section within 40 20 minutes of their removal from ultra fresh xylene LO Ss a fw Fig 3 The Arcturus PixCell Il LCM System Gallup et al New quick method for isolating RNA from laser captured cells stained by immunofluorescent immunohistochemistry RNA suitable for direct use in fluorogenic TaqMan one step real time RT PCR www biologicalprocedures com 73 The LCM l
44. s shown by preliminary non optimized real time test plates to express positively for all targets of interest to the study The 1 5 dilution refers to the dilution of full strength Stock I cDNA or any other sample cDNA whose original concentration is that which is obtained directly from each RT reaction which is theoretically 0 02 ug ul cDNA assuming 100 efficiency of each reverse transcription as described here CONCLUSIONS We report here a very fast fail safe way to isolate one step real time quantitative RT PCR quality RNA from LCM samples using the combined technologies of Invitrogen Arcturus and Applied Biosystems Our work has revealed that RNA extracted in this way is stable for weeks when stored at 80 C but RNA isolated from slides older than 8 days slides stored at 80 C start to show weaker real time signals from all targets investigated Peeling the polymer tab off of the Arcturus HS LCM caps immediately post capture and extracting the RNA directly off the polymer tabs has proven to us to be the easiest and most efficient approach to isolate RNA from LCM samples Minimizing the number of times one picks up the HS LCM caps during LCM is also crucial since cellular debris collected on the capture surface builds up the more one picks up and sets down the caps to find new collection areas Subsequently this debris also gets extracted during RNA isolation as well and we have observed that RNA samples containing suc
45. sing a nuclease free pair of scissors use in fluorogenic TaqMan one step real time RT PCR www biologicalprocedures com 88 Fig 22 The ABI 0 5 mL GeneAmp tube containing 10 uL Lysis Buffer Appendix A All primers and probes were optimized and validated strictly according to ABI procedural guidelines using all target inclusive cDNA prepared from Turbo DNase treated total RNA isolated using Trizol from whole sheep lung homogenates Our optimization approach is a very common well known procedure whereby one studies combinations of primer concentrations in the range of 50 nM 900 nM while keeping the probe at a constant 200 nM then the probe is challenged from 25 nM to 225 nM at the optimal primer concentrations established above All samples are performed in quadruplicate during these procedures After optimization the validation runs are performed on seven serial 1 5 dilutions of the same cDNA starting with full strength cDNA being assigned the relative strength of 1 using the optimal primer and probe concentrations established during optimization The highest Rn normalized reporter fluorescence value with the lowest primer concentrations is the indicator by which one selects the appropriate optimal primer concentrations in each case The higher the Rn the higher the magnitude of real time fluorescent signal Once the Rn value no longer increases with increasing primer concentrations one has attained the useful optimal primer con
46. ssary but does i Wiid not inhibit the reaction ah Fig 13 Results from Invitrogen show results from 50 cell samples Finally using the approach laid out in this communication we can now consistently detect one step fluorogenic real time RT PCR targets in single cell RNA Fig 11 For an comprehensive review on all possible aspects of amounts of excellent quantitative real time PCR qPCR see works by Stephen A Bustin 9 Mocellin et al 10 and for RNA amplification see Wang et al 11 Our lab has published several papers which describe in depth the nature and quality of our qPCR approach To check the quality of our real time qPCR protocols in greater detail please review our previous publications in their entirety 12 21 e Invitrogen LCM 3 3 05 life technologies 3 3 05 LCM Ovine cells SP A TaqMan Amplification looks good except that 100 cells and 10 cells samples are coming up at the same CT No RT controls come up much later and are therefore 100 cells 3cells cDNA Ena ETE LRT oe RT ee RT RT 38 rae emg Aa pha ee EAH not a concern 3 cell sample comes up around 4 cycles after 10 cell sample as expected Perhaps the 100 cell sample is inhibitory due to debris However ICAM 1 samples previous experiment come up earlier although the target is slightly less abundant than SP A Perhaps some degradation of RNA in these samples TL Fig 14 Real time resul
47. t 50 C for 10 minutes in a thermocycler briefly spun down and the samples are transferred to new 0 5 ml tubes leaving polymer tabs and attached cytoskeletal husks behind in the old tubes and incubated in a thermocycler at 75 C for 5 minutes 1 6 ul 10X DNase I buffer 200 mM TRIS HCI pH 84 40 mM MgCl 500 mM KCI Invitrogen and 5 ul of DNase I Amplification Grade DNase I Invitrogen are added and vortexed gently into each sample each is briefly spun down and this is followed by a room temperature incubation of 5 minutes to allow the Amp Grade DNase I to degrade genomic DNA and samples are again incubated at 75 C either in the Arcturus Incubation Block for 5 minutes or in a regular tube rack for 15 minutes to heat denature DNase I enzyme without adding EDTA we found that adding EDTA here severely inhibited all real time reactions using the ABI one step Master Mix used in this study Next to minimize non specific adhesion of RNA to positively charged plastic surfaces in tubes and plates we add glycogen Ultrapure Glycogen 20 wug ul Invitrogen to each sample far in excess gt 27 000 times that of the RNA in each sample so it will most likely bind the preferentially over the RNA in each sample 3 The positively charged plastic surfaces glycogen stock solution is made by diluting Ultrapure Glycogen Invitrogen with nuclease free water Molecular Grade Water Cat No E476 5 MidWest Scientific and 19 4 ul of a 1 4274
48. ts from Invitrogen using 3 10 and 100 laser captured cells Gallup et al New quick method for isolating RNA from laser captured cells stained by immunofluorescent immunohistochemistry RNA suitable for direct use in fluorogenic TaqMan one step real time RT PCR www biologicalprocedures com 83 SUPPLEMENTAL INFORMATION EXCEL files for processing any part of these experiments are available from the corresponding author Jack M Gallup eag iastate edu upon request ACKNOWLEDGMENTS The authors wish to thank Travis and Lisa Engelhaupt for taking the photos in Figures 15 19 22 REFERENCES 1 Webb T Laser Capture Microdissection Comes Into Mainstream Use J Natl Cancer Inst 2000 92 21 1710 1711 2 Invitrogen Life Technologies Instruction Manual SuperScript II CellsDirect cDNA Synthesis System for Catalog Nos 18080 200 and 18080 300 Version A 25 0731 14 May 2004 Version A 1 5 3 Use of glycogen or tRNA for reducing non specific adherence of templates to Plastic Applied Biosystems Incorporated 5700 User Manual 2000 Section 5 p 14 4 Lee J Duncan A Warrick S Techniques for Optimizing RT PCR Reactions PharmaGenomics 2003 pp 54 55 5 Dunphy J Horvath A Barcham G Balic A Bischof R Meeusen E Isolation characterisation and expression of mRNAs encoding the ovine CC chemokines monocyte chemoattractant protein MCP 1 and 2 Vet Immunol Immunopathol 2001 82 3 4 153 164 6 Grubor B Gallup JM M
49. uL from CellsDirect kit pari 55803 Invitrogen kt 16080 200 Mix gently by vortexing microfuge briefly to collect contents incubate at room temperature for no longer than 5 minutes then Vortex gently microfuge briefly incubate 75 C for 15 min in a tube rack then put on ice for the duration of the protocol if running real time plates right away to keep transcripts linear es Btore at 4 C once prepared Mix 198 2 uL nuclease free H20 15 2 uL gt 20 ug uL glycogen solution and add 19 4 uL of this mix to each sample vortex and spin down 3 SS Se ee are Then transfer each sample to new 0 2 mL tubes to store 80 C While transfering check final volumes of each sample to be sure desired final volumes have been attained q s winuc tree H0 When using 80 C RNA sam ples these 0 2 mL tubes are incubated in a thermocycler at 65 C for 5 minutes then put on ice for 1 minute just prior to being used as templates for One Step real time RT PCR yb UL containing 0 7692 ug uL glycogen and 0 56 cells worth of RNA uL from 20 cells or shots cap sample T 40ul contains about 4 43 cells worth of RNA the suggested minimum RNA well is RMA from 10 20 cells 7 8 uL of each RNA sample ends up in a final reaction volume of 30 ul for real time LCM RT PCR 10 pg RNA cell thus 7 80 ul RNA sample should contain roughly 43 pg RNA each real time ran wall Targets to be investigated SP AD 580 1 TLR4 MCP ia ovRPS15 1 44 pg uL in
50. ve been identified in microdissected cells In contrast to cells in culture cells obtained by LCM are in their natural environment and express their true set of genes and are therefore thought to be better suited for molecular analysis 1 LCM technology is applied using the AutoPix and PixCell I LCM instruments available exclusively from Arcturus please see the following link to Arcturus for more details on the history application and other LCM related information http www arctur com lab_portal support faq Extraction of RNA from LCM samples for use in one step real time RT PCR has been approached several ways over the past few years and this publication describes for the first time the shortest most fail safe method for LCM sample RNA extraction which combines the use of technologies developed by three major Applied Biosystems Inc and Arcturus Our direct work companies Invitrogen with Invitrogen on this procedure we feel represents a major breakthrough since we have identified the crucial points during LCM RNA isolation which most affect the usability of the resulting LCM sample isolates in the one step consistently detect our one step real time qRT PCR real time RI PCR application We can now targets of interest within single cell amounts of total LCM cell RNA isolate EXPERIMENTAL PROCEDURES Immunofluorescence immunohistochemistry Freshly necropsied lung tissues from sheep are placed into plastic disposa
51. w biologicalprocedures com a cold room at 4 C Figs 1 and 2 sections are incubated for 10 minutes with a primary biotinylated secondary antibody complex prepared by mixing equal volumes of primary mouse monoclonal anti human CD208 IgG Cat No IM3448 anti human CD208 DC LAMP purified 0 2 mg ml Beckman Coulter Miami FL or mouse monoclonal anti bRSV 4 IgG Dr Kenneth Platt CVM ISU Ames IA and a 1 mg ml solution of biotinylated goat anti mouse secondary IgG in 50 glycerol Kirkegaard amp Perry Gaithersburg MD with an additional amount of BioGenex Common Antibody Diluent comprising 28 of the biotinylated secondary mixture volume see Figs 1 and final primary 2 for set up depictions Fig 1 2 slides being stained by IF IHC preceding LCM are shown in the middle of a metal slide rack within a larger humidified and sealable container This mixture is vortexed gently then incubated for 45 minutes to 1 hour at 37 C this is routinely performed a day prior to the IF IHC LCM procedure Slides are subsequently washed three times with cold nuclease free PBS 0 1 Tween 20 within 2 minutes then Cy3 streptavidin reagent Rockland Inc Gilbertsville PA diluted 1 300 with BioGenex Common Antibody Diluent containing 1 NGS and 1 NSS is added to the sections for 10 minutes followed again by three washes with cold nuclease free PBS 0 1 Tween 20 within 2 minutes For dehydration prior to LCM section
52. well constant optimal concentrations of forward and reverse primers and constant optimal concentrations of probe are used along with 25 ul of ABI Cat No 4304437 master mix 5 ul of sequentially diluted Stock I cDNA and nuclease free water Also included on this plate are wells identical to the ones just described but instead of ovine target primers and probe they contained the endogenous reference human 185 ribosomal RNA forward and reverse primers and probe at their ABI established concentrations 50 nM primers and 200 nM probe This optimal real time plate included all samples in triplicate and was run in the GeneAmp 5700 sequence detection system using the same universal thermocycler protocol as used for the preceding tests and the data is subsequently analyzed Real time quantitation An additional result of running validation plates is that they provide the researcher the characteristic standard curves also referred to as calibration or dilution curves for each target Using standard curve y intercepts and slopes in the following apparently unpublished equation real time relative target quantity or Qty 10 Ctb m as indirectly alluded to in ABI s Technical Bulletin 2 7 much in the same way the Pfaffl equation is utilized or approached 8 we calculate all normalized relative mRNA expressions for each target of interest and compare fold differences in normalized target expression different
Download Pdf Manuals
Related Search