BD GenomeWalker Kits
Contents
1. BD GenomeWalker Kits User Manual BD GenomeWalker Kits provide researchers with ready access to a novel method for walking upstream i e towards promoters or downstream in ge nomic DNA from a known sequence such as a cDNA Siebert et al 1995a 1995b Each kit contains four libraries of uncloned adaptor ligated genomic DNA fragments These are not libraries in the conventional sense that is the DNA fragments are not ligated into a vector which is then propagated in E coli However like conventional libraries BD GenomeWalker Libraries are a pool of specially prepared DNA fragments from which researchers can identify isolate and clone specific pieces of DNA Construction of BD GenomeWalker Libraries begins with isolation of very clean genomic DNA that has a very high average molecular weight The starting DNA must be of considerably higher quality than the minimum suitable for Southern blotting or conventional PCR Four separate aliquots are then thoroughly digested with four different restriction enzymes that recognize a 6 base site leaving blunt ends Following digestion each pool of DNA fragments is ligated to the BD GenomeWalker Adaptor see Appendix B The BD GenomeWalker protocol takes just two days and consists of two PCR amplifications per library Figure 1 The first or primary PCR amplification uses the outer adaptor primer AP1 provided in the kit and an outer gene specific primer GSP1 provided by the resear2. 5 ACTATAGGGCACGCGTGGT 3 5 GTAATACGACTCACTATAGGGCACGCGTGGTCGACGGCCCGGGCTGGT 3 3 H2N CCCGACCA PO4 5 Adaptor Primer 1 AP1 22 mer Nested Adaptor Primer 2 AP2 19 mer BD GenomeWalker Adaptor Srf I Sma I Xma I Mlu I Sal I III Additional Materials Required The following reagents are required but not supplied BD Advantage 2 Polymerase Mix 50X You will need a Taq based 50X polymerase mix suitable for LD PCR Conventional PCR with a single polymerase will not produce a band in most BD GenomeWalker experiments The BD GenomeWalker protocol has been optimized with the BD Advantage 2 Polymerase Mix Cat No 639201 This enzyme mix was specifically developed for PCR amplifications of genomic DNA templates of all sizes This 50X mix contains BD TITANIUM Taq DNA Polymerase a nuclease deficient N terminal deletion of Taq DNA polymerase plus BD TaqStart Antibody to provide automatic hot start PCR Kellogg et al 1994 and a minor amount of a proofreading polymerase BD Advantage 2 Polymerase Mix is also available in the BD Advantage 2 PCR Kit Cat No 639206 BD TaqStart Antibody Cat No 639250 If you are not using BD Advantage 2 Polymerase Mix we strongly recom mend that you use some form of hot start in BD GenomeWalker PCR To do this simply include BD TaqStart Antibody in the 50X polymerase mix see PT1576 1 available at www bdbiosciences com clontech BD TaqStart Antibody is included
3. Kierzek R Jaeg er J A Sugimoto N Caruthers M H Neilson T and Tumer D H 1986 Improved free energy parameters for predictions of RNA duplex stability Proc Natl Acad Sci USA 83 9373 9377 Friezner Degen S J Rajput B amp Reich E 1986 Structure of the human tissue type plasminogen activator gene J Biol Chem 261 6972 6985 Hecker K H amp Roux K H 1996 High and low annealing temperatures increase both specificity and yield in touchdown and stepdown PCR BioTechniques 20 478 485 Kellogg D E Rybalkin I Chen S Mukhamedova N Vlasik T Siebert P amp Chenchik A 1994 TaqStart Antibody Hotstart PCR facilitated by a neutralizing monoclonal antibody directed against Taq DNA polymerase BioTechniques 16 1134 1137 Kitts P Adams M Kondepudi A Gallagher D amp Kain S January 1995 Green fluorescent protein A novel reporter for monitoring gene expression in living cells and organisms Clontechniques X 1 1 3 Nelson K Brannan J amp Kretz K 1995 The fidelity of TaqPlus DNA Polymerase in PCR Strategies in Mol Biol 8 24 25 Roux K H 1995 Optimization and troubleshooting in PCR PCR Methods amp Applications 4 5185 5194 Sambrook J Fritsch E F amp Maniatis T 1987 Molecular Cloning A Laboratory Manual Second Edition Cold Spring Harbor Laboratory Cold Spring Harbor NY Siebert P D Chenchik A Kellogg D E Lukyanov
4. fragment Amplify gene of interest from all four libraries AP1 GSP1 Primary PCR with BD Advantage 2 Polymerase Mix contains BD TaqStart Antibody Secondary or nested PCR with BD Advantage 2 Polymerase Mix Examine products on an agarose EtBr gel AP2 5 5 N No binding site for AP1 Binding site is created on template of interest by extension of GSP1 BD GenomeWalker Libraries 1 0 1 6 0 5 2 0 3 0 M 1 2 3 4 M Protocol No PT1116 1 www bdbiosciences com BD Biosciences Clontech Version No PR47603 5 BD GenomeWalker Kits User Manual I Introduction continued Figure 2 Map of the human tissue type plasminogen activator tPA locus Friezner Degen et al 1986 and results of primary and secondary BD GenomeWalker PCR using tPA primers Primary and secondary nested PCR was performed using BD Advantage 2 Polymerase Mix and the cycling parameters described in the protocol The tPA primers used in this experiment are the positive control primers PCP1 and PCP2 provided with the BD GenomeWalker Human Kit Lane 1 EcoR V Library Lane 2 Dra I Library Lane 3 Pvu II Library Lane 4 Ssp I Library Lane M 1 kb DNA ladder A 1 3 kb band is often observed in HDL Ssp 1 Map of tPA locus and expected PCR products Ssp I Pvu II EcoR V Dra I Presumed promoter tPA2 tPA1 Exon I Gel of primary PCR reaction products Ssp I Library EcoR V Library Pvu II Library Dra I
5. 2 Polymerase Mix 200 l 600 l 10X BD Advantage 2 PCR Buffer 200 l 600 l 10X BD Advantage 2 SA PCR Buffer 50 l 120 l 50X dNTP Mix 10 mM each 30 l 100 l Control DNA Template 100 ng l 30 l 100 l Control Primer Mix 10 M 2 5 ml 5 0 ml PCR Grade Water User Manual PT3281 1 Protocol at a Glance PT3281 2 BD Biosciences Clontech www bdbiosciences com Protocol No PT1116 1 10 Version No PR47603 BD GenomeWalker Kits User Manual IV BD GenomeWalker Protocol A Primer Design You will need to design two gene specific primers one for the primary PCR reaction GSP1 and one for the secondary PCR reaction GSP2 The nested PCR primer should anneal to sequences beyond the 3 end of the primary PCR primer i e upstream of the primary PCR primer when walking upstream and downstream of the primary primer when walking downstream Whenever possible the outer and nested primers should not overlap if overlapping primers must be used the 3 end of the nested primer should have as much unique sequence as possible In general the gene specific primers should be derived from sequences as close to the end of the known sequence as possible For walking upstream from cDNA sequence the primer should be as close to the 5 end as possible Ideally the primers should be derived from the first exon of the gene If primers are derived from downstream exons the resulting PCR products are less likely to contain th
6. PCR Step IV C 16 5 cycles 94 C 2 sec 72 C 3 min 20 cycles 94 C 2 sec 67 C 3 min 67 C for an additional 4 min Notes Length of denaturation time We have observed that differences of only a few seconds in the denaturation time at 94 C can dramatically affect results with the 2400 and 9600 systems For example positive control products larger than 2 3 kb were not detectable when the incubation time is increased from 2 to 5 sec The extremely short incubation time at 94 C may be necessary to preserve the integrity of the larger genomic DNA templates required for LD PCR in the BD GenomeWalker protocol Reaction volume Although the 2400 and 9600 systems allow you to reduce the reaction volumes in many applications we have not optimized the BD GenomeWalker protocol for lower reaction volumes BD Biosciences Clontech www bdbiosciences com Protocol No PT1116 1 28 Version No PR47603 BD GenomeWalker Kits User Manual Notes Protocol No PT1116 1 www bdbiosciences com BD Biosciences Clontech Version No PR47603 29 BD GenomeWalker Kits User Manual Notes BD Biosciences Clontech www bdbiosciences com Protocol No PT1116 1 30 Version No PR47603 BD GenomeWalker Kits User Manual Notes Protocol No PT1116 1 www bdbiosciences com BD Biosciences Clontech Version No PR47603 31 BD GenomeWalker Kits User Manual Notice to Purchaser This product is intended to be used for research pu
7. l of sterile H2O 11 Prepare a secondary PCR master mix by combining the following reagents in an 0 5 ml tube 6 rxns per rxn 240 l 40 l H2O 30 l 5 l 10X BD Advantage 2 PCR Buffer 6 l 1 l dNTP 10 mM each 6 l 1 l AP2 10 M 6 l 1 l GSP2 10 M 6 l 1 l BD Advantage 2 Polymerase Mix 50X 294 l 49 l Total volume GSP2 is your nested gene specific primer Mix well by vortexing without introducing bubbles and briefly spin the tube in a microcentrifuge Keep on ice until ready to use Protocol No PT1116 1 www bdbiosciences com BD Biosciences Clontech Version No PR47603 15 BD GenomeWalker Kits User Manual IV BD GenomeWalker Protocol continued 12 Add 49 l of the secondary PCR master mix to the appropriately labeled tubes and to the negative control Do not add master mix to the positive control 13 Prepare your secondary positive control by combining the following reagents in an 0 5 ml tube 40 l H2O 5 l 10X BD Advantage 2 PCR Buffer 1 l dNTP 10 mM each 1 l AP2 10 M 1 l PCP2 10 M 1 l BD Advantage 2 Polymerase Mix 50X 49 l Total volume 14 Add 1 l of each diluted primary PCR product to the appropriate tube Be sure to include both the positive and negative controls 15 Overlay the contents of each test tube with one drop of mineral oil and place caps firmly on each tube 16 Commence cycling in a DNA Thermal Cycler 480 PE Biosyst
8. than DNA purified from TAE gels Note on EtBr and UV damage to DNA Minimize the exposure of your DNA to UV light 2 Sequencing and scanning for regulatory elements Prior to testing BD GenomeWalker products for promoter activity most researchers will want to sequence at least part of their clones and look for common regulatory sequence motifs such as promoters enhanc ers etc 3 Testing for promoter activity BD GenomeWalker products can be cloned into a promoter reporter vector to test for the presence of a promoter Cloning in both orientations will provide a positive and negative control Suitable promoter cloning vectors from BD Biosciences Clontech include the following pSEAP2 Basic is sold separately Cat No 631715 and as a component in the chemiluminescent BD Great EscAPe SEAP Reporter System 3 Cat No 631706 Yang et al 1994 This kit also includes pSEAP2 Control and reagents necessary for 100 chemi luminescent assays The reporter molecule in the BD Great EscAPe system is a secreted form of alkaline phosphatase SEAP which can be conveniently measured directly in the culture medium using a sensitive chemiluminescent assay BD Biosciences Clontech www bdbiosciences com Protocol No PT1116 1 20 Version No PR47603 BD GenomeWalker Kits User Manual p gal Basic is sold separately Cat No 631707 and as a compo nent in the Luminescent gal Reporter System 3 Cat No 631713 Sinai et al 199
9. 4 This kit also includes p gal Control Vector and reagents necessary for 100 chemiluminescent assays pEGFP 1 Promoter Reporter Vector Cat No 632319 uses a bright codon optimized variant of the green fluorescent protein GFP to monitor promoter activity Cormack et al 1996 April 1996 Clontechniques Kitts et al 1995 Note on ATG start codon If your gene specific primer was down stream of the ATG start codon in your gene of interest then you may wish to eliminate the ATG from your promoter reporter construct s This may prevent a possible false negative result due to the expression of a bicistronic message See Section 4 b v below 4 Explanation of possible results of tests for promoter activity Some BD GenomeWalker products will have no promoter activity when cloned in both orientations in a promoter reporter vector There are several possible explanations a None of the fragments contain the promoter Your primer may be several kb from the promoter and or there may be intervening restriction sites between the primer and the pro moter This may also be an indication that the primer does not fall into the first exon or within a downstream exon that is within 6 kb of the promoter If this is the case you may need to obtain sequence data from closer to the 5 end of the transcript Alternatively you can walk another step by sequencing the distal end of the BD GenomeWalker product s designing a new gene specific primer
10. Appendix B continued OR Anneal at 68 C Melt at 95 C DNA synthesis No primer binding panhandle structure suppresses PCR Even when the adaptor is extended very little full length amplification occurs Suppression PCR On rare occasions the 3 end of the BD GenomeWalker Adaptor is extended creating a template with the full adaptor sequence on both ends AP1 Protocol No PT1116 1 www bdbiosciences com BD Biosciences Clontech Version No PR47603 27 BD GenomeWalker Kits User Manual Appendix C Parameters for GeneAmp Systems 2400 amp 9600 As noted elsewhere in this manual cycling parameters may have to be optimized for different thermal cyclers For example the cycling parameters in this protocol which were developed on a PE Biosystems DNA Thermal Cycler 480 do not work with the PE Biosystems GeneAmp PCR Systems 2400 and 9600 Both the 2400 and 9600 systems use much shorter cycling parameters and smaller thin walled tubes 0 2 ml vs 0 5 ml These systems also eliminate the need to overlay the reaction with mineral oil The following parameters for primary and secondary BD GenomeWalker PCR give good results with the standard 50 l positive control reaction with no mineral oil overlay and the 2400 and 9600 thermal cyclers 1 Primary PCR Step IV C 8 7 cycles 94 C 2 sec 72 C 3 min 32 cycles 94 C 2 sec 67 C 3 min 67 C for an additional 4 min 2 Secondary
11. BD GenomeWalker Kits User Manual PT1116 1 PR47603 Published 23 August 2004 BD Biosciences Clontech www bdbiosciences com Protocol No PT1116 1 2 Version No PR47603 BD GenomeWalker Kits User Manual Table of Contents I Introduction 3 II List of Components 7 III Additional Materials Required 8 IV BD GenomeWalker Protocol 10 A Primer Design 10 B General Considerations 10 C Procedure for PCR based DNA Walking in BD GenomeWalker Libraries 12 V Expected Results and Troubleshooting Guide 16 VI Suggestions for Characterizing BD GenomeWalker Products 18 VII References 22 VIII Related Products 23 Appendix A Sequences of the Positive Control Primers 24 Appendix B Design of the BD GenomeWalker Adaptor 25 Appendix C Parameters for the GeneAmp Systems 2400 amp 9600 27 List of Figures Figure 1 Flow chart of the BD GenomeWalker protocol 4 Figure 2 Map of the human tissue type plasminogen activator tPA locus and results of primary and secondary BD GenomeWalker PCR using tPA primers 5 Figure 3 Positive control results with the Mouse and Rat BD GenomeWalker Kits 6 Figure 4 Structure of the BD GenomeWalker adaptor and adaptor primers 8 Figure 5 Simple restriction mapping of BD GenomeWalker PCR products from the human tPA locus 18 Figure 6 The suppression PCR effect 26 Protocol No PT1116 1 www bdbiosciences com BD Biosciences Clontech Version No PR47603 3
12. Biosciences Clontech Version No PR47603 25 BD GenomeWalker Kits User Manual Appendix B Design of the BD GenomeWalker Adaptor The BD GenomeWalker Adaptor has three design features that are critical to the success of BD GenomeWalker DNA walking These features which can be seen schematically in Figure 1 in the Introduction are as follows 1 The use of a 5 extended adaptor that has no binding site for the AP1 primer used in primary PCR An AP1 binding site can only be generated by extension of the gene specific primer 2 Blocking of the exposed 3 end of the adaptor with an amine group to prevent extension of the 3 end which would create an AP1 binding site 3 The use of an adaptor primer that is shorter than the adaptor itself suppression PCR As shown in Figure 6 the suppression PCR effect prevents amplification of templates where the 3 end has been extended to create an AP1 binding site Though rare such extension does occur presumably due to incomplete amine modification or incomplete adaptor ligation Given the exponential nature of PCR amplification such events would lead to nonspecific amplification and unacceptable backgrounds in the absence of suppression PCR Each of these features helps eliminate nonspecific amplification among the general population of DNA fragments In combination with touchdown PCR and nested PCR these innovations allow amplification of a specific target from a very complex mixture of
13. DNA fragments all of which have the same terminal structure using a single set of gene specific primers Of the three features suppression PCR is the most critical unpublished data BD Biosciences Clontech www bdbiosciences com Protocol No PT1116 1 26 Version No PR47603 BD GenomeWalker Kits User Manual Figure 6 The suppression PCR effect In rare cases the 3 end of the BD GenomeWalker Adaptor gets extended Though rare such extension does occur presumably due to incomplete amine modification during oligonucleotide synthesis or incomplete adaptor ligation This creates a molecule that has the full length adaptor sequence on both ends and can serve as a template for end to end amplification Without suppression PCR these rare events would lead to unacceptable backgrounds due to the exponential nature of PCR amplification However in suppression PCR the adaptor primer is much shorter than the adaptor itself Thus during subsequent thermal cycling nearly all the DNA strands will form the panhandle structure shown above which cannot be extended At the appropriate annealing extension temperature this intramolecular annealing event is strongly favored over and more stable than the intermolecular annealing of the much shorter adaptor primer to the adaptor The suppression PCR effect will be reduced or lost if you use an annealing temperature lower than 60 65 C The upper limit of the suppression PCR effect is about 6 kb
14. K A amp Lukyanov S A 1995a An improved method for walking in uncloned genomic DNA Nucleic Acids Res 23 1087 1088 Siebert P D Chen S amp Kellogg D E April 1995b The Human GenomeWalker DNA Walking Kit A new PCR method for walking in uncloned genomic DNA Clontechniques X II 1 3 Sinai P Kondepudi A Yang T Adams M Kitts P amp Kain S October 1994 The Luminescent Gal chemiluminescent assay for galactosidase Application to the analysis of cis regulatory elements Clontechniques IX 4 1 4 Yang T Kondepudi A Adams M Kitts P amp Kain S July 1994 Quantitative detection of specific gene regulation with the Great EscAPe secreted alkaline phosphatase Genetic Reporter System Clontechniques IX 3 1 5 Protocol No PT1116 1 www bdbiosciences com BD Biosciences Clontech Version No PR47603 23 BD GenomeWalker Kits User Manual For a complete listing of all BD Biosciences Clontech products please visit www bdbiosciences com clontech Cat No BD GenomeWalker Kits Human 638901 Mouse 638902 Rat 638903 BD GenomeWalker Universal Kit 638904 BD Advantage 2 PCR Kit 639206 639207 BD Advantage 2 Polymerase Mix 639201 BD TaqStart Antibody 639250 BD Great EscAPe SEAP2 Reporter System 3 631706 Includes two vectors listed below pSEAP2 Basic Vector 631715 pSEAP2 Control Vector 631717 Luminescent gal
15. L Dra I RDL Dra I HDL Pvu II MDL Pvu II RDL Pvu II HDL Ssp I MDL Ssp I RDL Ssp I The BD GenomeWalker mouse libraries MDL and rat libraries RDL were constructed from the genomic DNA of ICR Swiss mice and Sprague Dawley rats respectively 150 l Adaptor Primer 1 AP1 10 M 300 l Nested Adaptor Primer 2 AP2 10 M See Figure 4 on the next page for the sequences of AP1 and AP2 25 l Positive Control Primer 1 PCP1 10 M 25 l Positive Control Nested Primer 2 PCP2 10 M See Appendix A for the sequences of the positive control primers supplied with each BD GenomeWalker Kit BD Biosciences Clontech www bdbiosciences com Protocol No PT1116 1 8 Version No PR47603 BD GenomeWalker Kits User Manual II List of Components continued Figure 4 Structure of the BD GenomeWalker adaptor and adaptor primers The adaptor has been ligated to both ends of the genomic DNA fragments in all four BD GenomeWalker Libraries supplied with each kit The amine group on the lower strand of the adaptor blocks extension of the 3 end of the adaptor ligated genomic fragments and thus prevents formation of an AP1 binding site on the general population of fragments The design of the adaptor and adaptor primers is critical for the suppression PCR effect Figure 6 The Tm s of AP1 and AP2 are 59 C and 71 C determined by nearest neighbor analysis Freier et al 1986 5 GTAATACGACTCACTATAGGGC 3
16. Library 1 8 kb 0 9 kb 1 5 kb 3 9 kb Gel of secondary PCR reaction products M 1 2 3 4 M 1 2 3 4 4 0 3 0 2 0 1 6 1 0 0 5 4 0 3 0 2 0 1 6 1 0 0 5 BD Biosciences Clontech www bdbiosciences com Protocol No PT1116 1 6 Version No PR47603 BD GenomeWalker Kits User Manual I Introduction continued In the BD GenomeWalker protocol the use of LD PCR extends the range of possible PCR products to about 6 kb The precise reason for the upper limit on BD GenomeWalker products is not clear It may be due to the loss of the suppression PCR effect see Appendix B As discussed in Section III we recommend our BD Advantage 2 Polymerase Mix Cat No 639201 BD Advantage 2 Polymerase Mix is available separately and in the BD Advan tage 2 PCR Kit Cat No 639206 Applications The primary application of BD GenomeWalker Kits is the rapid cloning of the promoters and other upstream regulatory elements in genes for which only cDNA sequence was previously available In addition to obtaining promoters BD GenomeWalker DNA walking can also be used to map intron exon junctions and to walk bidirectionally from any sequence tagged site STS or expressed sequence tag EST Although individual steps are limited to about 6 kb multiple steps can be strung together to create longer walks Consequently this method is useful for filling in gaps in genome maps particularly when the missing clones have be
17. Reporter System 3 631713 Includes two vectors listed below p gal Basic Vector 631707 p gal Control Vector 631709 pEGFP 1 Promoter Reporter Vector 632319 BD SMART RACE cDNA Amplification Kit 634914 NucleoTrap Gel Extraction Kit 636018 NucleoSpin Extract Kit 635960 635961 VIII Related Products BD Biosciences Clontech www bdbiosciences com Protocol No PT1116 1 24 Version No PR47603 BD GenomeWalker Kits User Manual The positive control primers in the BD GenomeWalker Human Kit Cat No 638901 are derived from exon 1 of the tissue type plasminogen activator tPA cDNA PCP1 Primer tPA1 5 AGA AAC CCG ACC TAC CAC GGC TTG CTC CTT 3 PCP2 Primer tPA2 5 CCC TTT CCT CGC AGA GGT TTT CTC TCC AGC 3 The positive control primers in the BD GenomeWalker Mouse Kit Cat No 638902 are derived from intron 6 of the interleukin 1 IL1 gene PCP1 Primer IL1 2 5 TCC GTG TGC ATG TTG CAT GTA TGA CAG AAA GG 3 PCP2 Primer IL1 1 5 TAC CAC GGT AGA CAT ATT CTC AGG GCT GCT GG 3 The positive control primers in the BD GenomeWalker Rat Kit Cat No 638903 are derived from exon 5 of the interleukin 6 IL6 gene PCP1 Primer IL61 5 CCA CAG TGA GGA ATG TCC ACA AAC TGA TAT GC 3 PCP2 Primer IL62 5 ACT AGG TTT GCC GAG TAG ACC TCA TAG TGA CC 3 Appendix A Sequence of the Positive Control Primers Protocol No PT1116 1 www bdbiosciences com BD
18. Version No PR47603 13 BD GenomeWalker Kits User Manual 2 Prepare the primary PCR master mix by combining the following reagents in an 0 5 ml tube 6 rxns per rxn 240 l 40 l H2O 30 l 5 l 10X BD Advantage 2 PCR Buffer 6 l 1 l dNTP 10 mM each 6 l 1 l AP1 10 M 6 l 1 l GSP1 10 M 6 l 1 l BD Advantage 2 Polymerase Mix 50X 294 l 49 l Total volume GSP1 is your outer gene specific primer Mix well by vortexing without introducing bubbles and briefly spin the tube in a microcentrifuge 3 Add 49 l of the primary PCR master mix to the appropriately labeled tubes and to the negative control Do not add master mix to the positive control see Step 6 4 Add 1 l of each DNA library i e HDL EcoR V etc to the appropri ately labeled tubes including the positive control Do not add any library DNA to the negative control 5 Add 1 l of H2O to the negative control 6 Prepare your positive control by combining the following reagents in a 0 5 ml tube 40 l H2O 5 l 10X BD Advantage 2 PCR Buffer 1 l dNTP 10 mM each 1 l AP1 10 M 1 l PCP1 10 M 1 l DL EcoR V or DL Dra I etc 1 l BD Advantage 2 Polymerase Mix 50X 50 l Total volume 7 Overlay the contents of each test tube with one drop of mineral oil and place caps firmly on each tube IV BD GenomeWalker Protocol continued BD Biosciences Clontech www bdbiosciences com Protoco
19. and repeating the amplification protocol b The promoter is present but the reporter is not expressed There are several possible reasons why you might not detect promoter activity even if your promoter reporter construct contains the promoter i The fragment is cloned in the wrong orientation Reclone and test in the opposite orientation ii The promoter is too weak to be detected in your assay If this is the case it may be possible to add an enhancer to your construct or reclone your fragment s in a vector that has an enhancer iii The promoter needs to be induced and you do not have the means to induce it VI Suggestions for Characterizing Products continued Protocol No PT1116 1 www bdbiosciences com BD Biosciences Clontech Version No PR47603 21 BD GenomeWalker Kits User Manual Again recloning into a vector that has a strong enhancer may allow you to detect promoter activity iv The promoter is tissue or stage specific Again recloning into a vector that has a strong enhancer may allow you to detect promoter activity Alternatively it may be possible to demonstrate the presence of a promoter by testing the construct in another host cell or in the whole organism v Reporter construct makes a bicistronic message The cloned fragment contains the ATG and some portion of the open reading frame from the gene of interest This results in a bicistronic message in which two ORFs may compete for trans lation the downst
20. aries with each set of GSPs To maximize your chances of success in finding a promoter or taking the largest possible step in a genomic walk we recommend that you amplify all four libraries with each new gene specific primer 6 Use the recommended amounts of enzymes The enzyme amounts have been carefully optimized for the BD GenomeWalker amplification protocol and reagents C Procedure for PCR based DNA Walking in BD GenomeWalker Libraries BD GenomeWalker PCR has been optimized with our BD Advantage 2 Polymerase Mix which includes BD TaqStart Antibody for automatic hot start PCR 1 Label the 0 5 ml PCR tubes At BD Biosciences Clontech we use the following system GSP1 and GSP2 indicate your gene specific primers TABLE I SUGGESTED LABELING PLAN DNA 1 PCR 2 PCR Library DL Tube No Primers Tube No Primers DL EcoR V 1A GSP1 amp AP1 A 1B GSP2 amp AP2 B DL Dra I 2A 2B DL Pvu II 3A 3B DL Ssp I 4A 4B Negative control None 5A 5B Positive control DL EcoR V C 6A PCP1 amp AP1 6B PCP2 amp AP2 A Primers contained in primary master mix B Primers contained in secondary master mix C Any of the libraries can be used for the positive control To prevent running out of any one library prematurely use a different library as the positive control for each experiment IV BD GenomeWalker Protocol continued Protocol No PT1116 1 www bdbiosciences com BD Biosciences Clontech
21. ary polymerase provides the critical 3 5 exonuclease or editing function that corrects misincorporated nucleotides I Introduction BD Biosciences Clontech www bdbiosciences com Protocol No PT1116 1 4 Version No PR47603 BD GenomeWalker Kits User Manual I Introduction continued Figure 1 Flow chart of the BD GenomeWalker protocol The gel shows typical results generated by nested PCR with the BD GenomeWalker human libraries and gene specific primers Primary and secondary nested PCR was performed using BD Advantage 2 Polymerase Mix and the cycling parameters described in the protocol Lane 1 EcoR V Library Lane 2 Dra I Library Lane 3 Pvu II Library Lane 4 Ssp I Library Lane M DNA size markers The absence of a major product in one of the libraries is not unusual In our experience there is no major band in one or more lanes in approximately half of the BD GenomeWalker experiments As explained in the Expected Results and Troubleshooting Guide Section V this is usually because the distance between the primer and the upstream restriction site is greater than the capability of the system N Amine group that blocks extension of the 3 end of the adaptor ligated genomic fragments AP Adaptor primers GSP Gene specific primers GSP2 AP2 AP1 GSP1 GSP2 Clone amp characterize major PCR products Test for promoter activity by cloning into reporter vector N BD GenomeWalker Adaptor Genomic DNA
22. cher The primary PCR mixture is then diluted and used as a template for a secondary or nested PCR amplification using the nested adaptor primer AP2 and a nested gene specific primer GSP2 This generally produces a single major PCR product from at least three of the four libraries and often in all four Each of the DNA fragments which begin in known sequence at the 5 end of GSP2 and extend into the unknown adjacent genomic DNA can then be cloned and further analyzed Figure 2 shows sample results of primary and secondary BD GenomeWalker PCR Amplification of each of the BD GenomeWalker human libraries with the adaptor primers and primers derived from exon 1 of the human tissue type plasminogen activator tPA gene generated single major products of the size expected based on the map of the tPA locus Each kit also includes positive control primers PCP1 and PCP2 which generate a single major product from each library Thermostable DNA polymerase s are not included in the kit see next paragraph Long distance PCR with the BD Advantage 2 PCR Kit BD GenomeWalker reactions should be performed with a 50X polymerase mix containing a combination of DNA polymerases suitable for long distance PCR LD PCR Barnes 1994 Cheng et al 1994 In LD PCR a combination of two thermostable DNA polymerases is used to increase the range and accuracy of PCR amplification Most of the extension is carried out by a primary polymerase while a second
23. clone full length cDNAs and the surrounding genomic sequences without ever screening a library using both our BD SMART RACE cDNA Amplification Kit and the BD GenomeWalker Kit VI Suggestions for Characterizing Products continued BD Biosciences Clontech www bdbiosciences com Protocol No PT1116 1 22 Version No PR47603 BD GenomeWalker Kits User Manual VII References Barnes W M 1994 PCR amplification of up to 35 kb DNA with high fidelity and high yield from bacteriophage templates Proc Natl Acad Sci USA 91 2216 2220 Cheng S Fockler C Barnes W M amp Higuchi R 1994 Effective amplification of long targets from cloned inserts and human genomic DNA Proc Natl Acad Sci USA 91 5695 5699 Chou Q Russell M Birch D Raymond J amp Bloch W 1992 Prevention of pre PCR mispriming and primer dimerization improves low copy number amplifications Nucleic Acids Res 20 1717 1723 Cormack B P Valdivia R amp Falkow S 1996 FACS optimized variants of the green fluorescent protein Gene 173 33 38 D aquila R T Bechtel L J Videler J A Eron J J Gorczyca amp Kaplan J C 1991 Maximizing sensitivity and specificity by preamplification heating Nucleic Acids Res 19 3749 Don R H Cox P T Wainwright B J Baker K amp Mattick J S 1991 Touchdown PCR to circumvent spurious priming during gene amplification Nucleic Acids Res 19 4008 Freier S M
24. e promoter particularly if the interven ing intron s and exon s comprise more than a few kb see Figure 2 Gene specific primers should be 25 28 nucleotides in length and have a GC content of 40 60 This will ensure that the primers will effectively anneal to the template at the recommended annealing and extension temperature of 67 C Primers should not be able to fold back and form intramolecular hydrogen bonds and sequences at the 3 end of your primers should not be able to anneal to the 3 end of the adaptor primers There should be no more than three G s and C s in the last six positions at the 3 end of the primer Five restriction sites have been incorporated into the BD GenomeWalker Adaptor Sal I cohesive ends Mlu I cohesive ends and overlapping Srf I cohesive ends Sma I blunt ends and Xma I cohesive ends sites If you wish to use restriction sites to clone the resulting PCR products suitable sites should also be designed into the 5 end of GSP2 i e the nested gene specific primer used for the secondary PCR reaction The sites in the Adaptor Primer allow easy insertion of PCR products into commonly used promoter reporter vectors Alternatively BD GenomeWalker products can be cloned into a general purpose cloning vector using restriction sites or into a TA type cloning vector using the A overhang left byTaq DNA polymerase See Section VI B 3 for a discussion of our various promoter cloning reporter vector
25. ems using the following two step cycle parameters 5 cycles 94 C 25 sec 72 C 4 min 18 22 cycles 94 C 25 sec 67 C 4 min 67 C for an additional 4 min after the final cycle Note Do not use a three step cycling program e g 95 C melting 60 C annealing 68 C extension See Appendix C for cycling parameters for the GeneAmp PCR Systems 2400 and 9600 17 Analyze 5 l of the secondary PCR products on a 1 2 agarose EtBr gel along with DNA size markers such as a 1 kb DNA ladder or Hind III digest As discussed in the Troubleshooting Section Section V A 2 more than one band may occasionally be observed after secondary PCR Store the unused portion of the secondary PCR samples at 4 C until you have confirmed that the procedure has been successful At that point proceed with analyzing and cloning the fragments of interest e g putative promoter fragments as described in Section VI BD Biosciences Clontech www bdbiosciences com Protocol No PT1116 1 16 Version No PR47603 BD GenomeWalker Kits User Manual A Expected Results 1 Primary PCR Figure 2 Section I shows a typical result after primary BD GenomeWalker PCR In general primary PCR should produce multiple fragments ranging in size from about 500 bp to 5 kb in all four lanes There may be some smearing in some lanes In general you should continue with secondary PCR if you obtain any bands or smearing with your gene specific prime
26. en difficult to obtain by conventional library screening methods In all applications the PCR products are generally pure enough to allow restriction mapping without cloning A discussion of cloning BD GenomeWalker PCR products and testing them for promoter activity is included at the end of this manual Figure 3 Positive control results obtained with the Mouse and Rat BD GenomeWalker Kits see Figure 2 for the human positive control results Primary and secondary nested PCR was performed using BD Advantage 2 Polymerase Mix and the cycling parameters described in the protocol Lane 1 EcoR V Library Lane 2 Dra I Library Lane 3 Pvu II Library Lane 4 Ssp I Library Lane M 1 kb DNA ladder Mouse Positive Rat Positive Control Results Control Results M 1 2 3 4 M 1 2 3 4 4 0 3 0 2 0 1 6 1 0 0 5 4 0 3 0 2 0 1 6 1 0 0 5 Protocol No PT1116 1 www bdbiosciences com BD Biosciences Clontech Version No PR47603 7 BD GenomeWalker Kits User Manual II List of Components Store all components at 20 C Note These reagents are sufficient for 20 reactions consisting of a primary and a secondary PCR with each library Enough primers are provided for 150 primary PCR and 300 secondary PCR amplifications 5 x 20 l BD GenomeWalker DNA Libraries 100 ng each Human Kit Mouse Kit Rat Kit Cat No 638901 Cat No 638902 Cat No 638903 HDL EcoR V MDL EcoR V RDL EcoR V HDL Dra I MD
27. ic primers still generate a smear after secondary PCR try repeating your experiment using 5 DMSO as discussed above However in most cases it will be necessary to redesign your gene specific primers if you get smears after the secondary PCR BD Biosciences Clontech www bdbiosciences com Protocol No PT1116 1 18 Version No PR47603 BD GenomeWalker Kits User Manual VI Suggestions for Characterizing BD GenomeWalker Products A Restriction Mapping of BD GenomeWalker PCR Products BD GenomeWalker PCR products are generally clean enough to allow simple restriction mapping without cloning An example of such an experi ment is shown in Figure 5 Figure 5 Simple restriction mapping of BD GenomeWalker PCR products from the human tPA locus The map shows the positions of the relevant restriction sites in the genomic DNA and in the predicted PCR products The gel on the left shows the products of BD GenomeWalker PCR The gel on the right shows the pattern of restriction fragments generated by digestions of each PCR product with either BamH I or Pvu II Lane M DNA size markers Ssp I Pvu II EcoR V Dra I tPA2 tPA1 Exon I PCR products Ssp I Library EcoR V Library Pvu II Library Dra I Library 1 8 kb 0 9 kb 1 5 kb 3 9 kb Restriction digests M M M M 1 0 2 0 3 0 1 6 0 5 Pvu II Dra I Ssp I EcoR V 4 0 Pvu II BamH I 1 0 2 0 3 0 1 6 0 5 4 0 Pvu II Dra I S
28. in BD Advantage 2 Polymerase Mix This antibody is an effective method for hot start PCR that is simpler and more convenient than wax based or manual methods The BD TaqStart Antibody binds to and inactivates Taq DNA polymerase and thus eliminates DNA synthesis from nonspecifically bound primers while reactions are being assembled PCR Protocol No PT1116 1 www bdbiosciences com BD Biosciences Clontech Version No PR47603 9 BD GenomeWalker Kits User Manual III Additional Materials Required continued amplification proceeds efficiently after an initial 1 min incubation at 94 C which irreversibly inactivates the BD TaqStart Antibody See Kellogg et al 1994 for a discussion of hot start PCR with inactivating antibodies Hot start with wax beads Chou et al 1992 or manual hot start D aquila et al 1991 can also be used 10X PCR Reaction Buffer If you are using a DNA polymerase mix other than BD Advantage 2 Polymerase Mix use the PCR reaction buffer provided with the enzyme mix dNTP mix 10 mM each of dATP dCTP dGTP and dTTP Store at 20 C 0 5 ml PCR reaction tubes We recommend using GeneAmp 0 5 ml PCR Reaction Tubes PE Biosystems Cat No N801 0737 or N801 0180 Deionized H2O Milli Q filtered or equivalent 1 kb DNA ladder The following product is not required but recommended BD Advantage 2 PCR Kit Cat No 639206 or 639207 30 rxns 100 rxns 30 l 100 l 50X BD Advantage
29. is several degrees higher than the Tm of the primers during the initial PCR cycles Although primer annealing and amplification is less efficient at this higher temperature it is also much more specific The higher temperature also enhances the suppression PCR effect with AP1 see Appendix B This allows a critical amount of gene specific product to accumulate The annealing extension temperature is then reduced to slightly below the primer Tm for the remaining PCR cycles permitting efficient exponential amplification of the gene specific template As noted above we recommend using primers with Tm s greater than 68 C to allow you to use the touchdown cycling programs in the protocol 4 Use of the positive controls In each experiment we suggest that you include a positive control in which you amplify one of the libraries using the positive control PCP primers This will confirm that your DNA polymerase mix is functional and thermal cycling parameters are compatible with this protocol To ensure that you do not run out of any one library prematurely use a different library as the positive control for each experiment Note You may wish to perform an initial experiment using all four libraries with the positive control primers prior to using the kit with their gene specific primers BD Biosciences Clontech www bdbiosciences com Protocol No PT1116 1 12 Version No PR47603 BD GenomeWalker Kits User Manual 5 Amplify all four libr
30. l No PT1116 1 14 Version No PR47603 BD GenomeWalker Kits User Manual IV BD GenomeWalker Protocol continued 8 Commence cycling in a DNA Thermal Cycler 480 PE Biosystems using the following two step cycle parameters 7 cycles 94 C 25 sec 72 C 4 min 32 cycles 94 C 25 sec 67 C 4 min 67 C for an additional 4 min after the final cycle Notes Do not use a three step cycling program e g 95 C melting 60 C annealing 68 C extension See Appendix C for cycling parameters for GeneAmp PCR Systems 2400 and 9600 9 Analyze 5 l of the primary PCR products on a 1 5 agarose EtBr gel along with DNA size markers such as a 1 kb ladder If you do not see any product perform five additional cycles Expected results of primary PCR You should observe multiple frag ments ranging in size from about 500 bp to 5 kb in all four lanes There may be some smearing in some lanes See Figure 2 in the Introduction Section I for a sample gel showing products of primary PCR If you obtain any bands or smearing with your gene specific primer continue with secondary PCR as described in Steps 10 17 even if your products are weaker than the positive control or the bands in Figure 2 If you do not observe any product with your gene specific primers consult the Troubleshooting Guide 10 Using a clean 0 5 ml tube for each sample dilute 1 l of each primary PCR including positive and negative controls into 49
31. n the capability of the system 6 kb This limit reflects the diminished suppression PCR effect as template size increases Targets greater than 6 kb often become indistinguishable in a smear of high molecular weight material Such smearing may also occur in lanes that do contain major bands but should not affect the major bands The absence of a major band in one or more of the libraries does not mean that products obtained with other libraries are not correct V Expected Results and Troubleshooting Guide Protocol No PT1116 1 www bdbiosciences com BD Biosciences Clontech Version No PR47603 17 BD GenomeWalker Kits User Manual V Expected Results and Troubleshooting Guide continued B Troubleshooting Guide 1 No products with the positive control primers even after increasing the number of primary cycles from 32 to 37 a Reduce all annealing extension temperatures by 2 C i e 72 C to 70 C and 67 C to 65 C b Reduce the length of the incubation at 94 C c Check your 50X polymerase mix by PCR using two specific primers and a 1 10 kb template that works in your hands 2 Expected products observed with positive control primer but no product observed with your gene specific primers a Check the design of your primers If the positive control PCP primers produce the expected PCR products but your gene specific primers do not produce major PCR products with any of the libraries there is probably a problem with your
32. primers If your primer sequence was derived from cDNA sequence information the primary or secondary PCR primer may cross an exon intron junction If this is the case it will be necessary to redesign one or both gene specific primers Remember that all primers should be able to anneal efficiently at 67 C i e have a Tm 67 C If you are sure your primers do not cross intron exon boundaries recheck the sequence of your primers In some instances primers will fail to produce any products due to a mistake in primer design or synthesis b Your target template may have a high GC content Such templates are difficult to amplify Repeat your experiment using a final concen tration of 5 DMSO in your primary and secondary PCR For each PCR add 2 5 l of DMSO and only 37 5 l of H2O to the Master Mix Step IV C 2 amp 11 Add the DMSO to the Master Mix last Note You will need to perform more cycles in the presence of DMSO For the primary PCR perform 36 cycles instead of 32 for the secondary PCR perform 24 cycles If this fails repeat again using a final concentration of 6 DMSO and 3 glycerol in your primary and secondary PCR If neither DMSO concentration solves the problem try increasing the temperature to 99 C for 5 seconds at the beginning of the first cycle 3 Smears or multiple major bands observed in positive control and gene specific primers If the positive control primers give the expected pattern but your gene specif
33. r 2 Secondary PCR a Positive control PCP primers Positive control secondary PCR should produce major bands of the following sizes BD GenomeWalker Human Mouse Rat DNA Libraries HDLs MDLs RDLs EcoR V 1 8 kb 1 5 kb 1 5 kb Dra I 0 9 kb 1 3 kb 1 2 kb Pvu II 1 5 kb 0 6 kb 0 7 kb Ssp I 3 9 kb 3 2 kb 1 0 kb a 1 3 kb band is often observed in HDL Ssp I See the Introduction for gels showing the expected results following the secondary PCR amplification with the human Figure 2 and mouse and rat Figure 3 positive control primers b Experimental PCR primers In approximately half the cases single major bands will be ob served with each of the four libraries On rare occasions more than one band may be observed The exact size of the major bands will depend on the positions of restriction sites in your gene Typically secondary PCR products will range from 0 2 to 6 kb Fragments generated from nested gene specific primers that are less than 0 4 kb from one of the restriction sites represented in the BD GenomeWalker libraries may appear as a low molecular weight smear on a 1 2 agarose EtBr gel If this is the case with one or more of the BD GenomeWalker libraries run this particular PCR product s on a 2 agarose EtBr gel In our experience no product is observed in one or more of the libraries in approximately half the cases This is usually because the distance from the primer to the restriction site is greater tha
34. ream ORF i e the reporter may not be efficiently translated If you suspect this to be the case test for promoter activity at the RNA level by performing RT PCR Reporter expression can be assayed by Northern blot however RT PCR is much faster and more sensitive if suitable primers are available vi The cloned fragment s contains a strong negative enhancer There are numerous instances of so called negative enhanc ers that prevent transcription of a functional promoter If you suspect this to be the case try recloning in the presence of a known strong enhancer or testing subclones in which upstream sequences have been deleted 5 Deletion analysis of promoters After finding fragments that have promoter activity many researchers will want to perform a deletion analysis to define the minimal promoter Any standard nested deletion method is compatible with this system C Other Applications of BD GenomeWalker Other possible applications of the BD GenomeWalker DNA walking method include the following Mapping intron exon boundaries Walking short distances upstream or downstream in genomic DNA from known sequences e g expressed sequence tags EST or other sequence tagged sites STS Although individual steps are limited to 6 kb multiple steps can be strung together to create longer walks Walking from 5 or 3 ends generated by RACE using the BD SMART RACE cDNA Amplification Kit Cat No 634914 You can also
35. rposes only It is not to be used for drug or diagnostic purposes nor is it intended for human use BD Biosciences Clontech products may not be resold modified for resale or used to manufacture commercial products without written approval of BD Biosciences Clontech Suppression PCR is covered by U S Patent No 5 565 340 A license under U S Patent Nos 4 683 202 4 683 195 4 965 188 and 5 075 216 or their foreign counterparts owned by Roche Molecular Systems Inc and F Hoffmann La Roche Ltd Roche has an up front fee component and a running royalty component The purchase price of this product includes limited nontransferable rights under the running royalty component to use only this amount of the product to practice the Polymerase Chain Reaction PCR and related processes described in said patents solely for the research and development activities of the purchaser when this product is used in conjunction with a thermal cycler whose use is covered by the up front fee component Rights to the up front fee component must be obtained by the end user in order to have a complete license to use this product in the PCR process These rights under the up front fee component may be purchased from Applied Biosystems or obtained by purchasing an Authorized Thermal Cycler No right to perform of offer commercial services of any kind using PCR including without limitation reporting the results of purchaser s activities for a fee or other commercial con
36. s and reporter assay systems B General Considerations 1 Cycling parameters The cycling parameters in this protocol have been optimized using the PE Biosystems DNA Thermal Cycler 480 BD Advantage 2 Polymerase Mix and the reagents and positive control primers provided in the BD GenomeWalker Kit The optimal cycling parameters may vary with Protocol No PT1116 1 www bdbiosciences com BD Biosciences Clontech Version No PR47603 11 BD GenomeWalker Kits User Manual IV BD GenomeWalker Protocol continued different polymerase mixes gene specific primers and thermal cy clers Recommended cycling parameters for the PE Biosystems GeneAmp PCR Systems 2400 and 9600 are provided in Appendix C Please refer to the Troubleshooting Guide Section V for suggestions on optimizing PCR conditions 2 Use some form of hot start PCR It is advantageous to use some form of hot start and the protocol assumes that BD TaqStart Antibody has been included in the 50X polymerase mix see Section III Additional Materials Hot start can also be performed using wax beads Chou et al 1992 or manually D Aquila et al 1991 If you use a manual or wax based hot start you will need to adapt the protocol to these particular methods 3 Touchdown PCR The PCR cycling parameters in Steps IV C 8 and IV C 16 are for touchdown PCR Don et al 1991 Roux 1995 Hecker and Roux 1996 Touchdown PCR involves using an annealing extension tem perature that
37. sideration is hereby granted by implication or estoppel Further information on purchasing licenses to practice the PCR Process may be obtained by contacting the Director of Licensing at Applied Biosystems 850 Lincoln Centre Drive Foster City California 94404 or the Licensing Department at Roche Molecular Systems Inc 1145 Atlantic Avenue Alameda California 94501 NucleoTrap and NucleoSpin are registered trademarks of MACHEREY NAGEL GmbH and Co GeneAmp and AmpliTaq are registered trademarks of Roche Molecular Systems Inc licensed to the Perkin Elmer Corporation BD BD Logo and all other trademarks are property of Becton Dickinson and Company 2004 BD Notes
38. sp I EcoR V Pvu II Dra I Ssp I EcoR V BamH I Pvu II Protocol No PT1116 1 www bdbiosciences com BD Biosciences Clontech Version No PR47603 19 BD GenomeWalker Kits User Manual VI Suggestions for Characterizing Products continued B Cloning BD GenomeWalker Products and Testing for Promoter Activity 1 Cloning BD GenomeWalker products Once you have obtained major bands using your gene specific primer you will usually want to clone the fragments into a general purpose cloning vector using restriction sites or into a TA type cloning vector using the A overhang left by the DNA polymerase In some cases you may wish to clone directly into a promoter reporter vector See Section B 3 below If your secondary PCR produces a single major band with little background and no minor bands you may be able to clone the fragment directly If the product of your secondary reaction has significant background you will need to gel purify the desired band There are several options for gel purifying DNA fragments We recommend either the NucleoSpin Extract Kit Cat No 635960 or 635961 or the NucleoTrap Gel Extraction Kit Cat No 636018 for gel purifying PCR products Note on TAE vs TBE gels We recommend that you use Tris Acetate EDTA TAE buffer instead of Tris Borate EDTA TBE buffer in your agarose gels when purifying DNA fragments for cloning In our expe rience DNA purified from TBE gels is more difficult to clone
Download Pdf Manuals
Related Search