RNNOTATOR USER`S MANUAL
Contents
1. facies dance Laveen get eege det eege degen dee EEN 5 4 3 3 Assembly Evaluation Optlons et eee eee edn ee edn eesaeeeaneeenies 5 4 3 4 Advanced Options NNN 5 5 Galaxy Te E 6 6 License and CIEATON EE 6 Tz e E et EEN 6 1 Introduction Comprehensive annotation and quantification of transcriptomes are outstanding problems in functional genomics Rnnotator is an automated software pipeline that generates transcript models by de novo assembly of RNA Seq data without the need for a reference genome The contigs produced by Rnnotator are highly accurate and reconstruct full length genes when transcripts are sequenced sufficiently deep roughly 30X for a given transcript Rnnotator was designed to assemble Illumina single or paired end reads Rnnotator is also able to incorporate strand specific RNA Seq reads into the assembly in order to further improve the assembly 2 Installation 2 1 Prerequisites Rnnotator must be run on a 64 bit Linux architecture Before running Rnnotator the following prerequisites must be installed e Blat v 34 http genome ucsc edu FAQ FA Qblat html blat3 e Velvet 1 0 15 http www ebi ac uk zerbino velvet e AMOS http sourceforge net apps mediawiki amos index php e Vmatch 2 0 http www vmatch de e bwa 0 5 8c http bio bwa sourceforge net e MUMmer http sourceforge net projects mummer e BioPer http www bioperlLorg e Perl modules Parallel ForkManager Tree http search cpan2. reads default on Low complexity repeats are defined as homopolymers di nucleotide repeats or tri nucleotide repeats that compose gt 80 of the read length adapter on off Remove adapter containing reads default on Reads are considered adapter reads if the share gt 90 identity with the Illumina adapter sequence derep on off Remove duplicate reads default on When detecting duplicate reads one mismatch is allowed in the 16 bp hash key Duplicates are consolidated into consensus reads kfilter on off Remove reads containing rare kmers default off Reads are considered to be containing a rare k mer any k mer within the read occurs less than min_kmer occur times using kmer_ length as the k mer length trim on off Trim reads to a given length or quality score cutoff default off trim len NNN Length to trim reads to when trim is on default auto Auto trimming uses quality scores to determine which length to use when trimming reads All reads are trimmed to the same length rRNA on off Remove rRNA reads default off Removes reads containing ribosomal RNA sequence e rRNA fa rDNA fa The ribosomal FASTA file to use when rRNA is on e rRNA gs Genus species If the rRNA FASTA is the silva database then Genus species is used to select sequences from the given Genus and species 4 3 2 Assembly Options e a assembler Assembler to use velvet oases
3. JGIS os DOE JOINT GENOME INSTITUTE oe MANUAL Version 2 3 U S Department of Energy Joint Genome Institute Lawrence Berkeley National Laboratory December 2010 Change Log Version No Date _ ___ Revision Description 12 8 2010 Rev 2 3 Sopra bambus and velvet added as scaffolding options Fixed bug during contig splitting when using paired end stranded reads Duplicate read removal and Velvet assembly on by default Rev 2 1 9 9 2010 Support for multiple library types Oases added as an optional assembler New artifact filtering options Rev 2 0 8 17 2010 Full support for paired end reads Modularization of the program Integration of accuracy completeness contiguity calculation Rev 1 1 4 30 2010 Quality based read trimming Better documentation Duplicate read removal before k mer filtering 3 3 2010 Developed the initial version TABLE OF CONTENTS 1 Introductio EE 1 2 TE a P A A A T 1 2 1 D ET 1 2 2 Installation Detale N5xsuoekeeuudegisgeksdeedukrek e teen cds aad WEN ee E NEeN E veneers eens 2 E Oe A EA a EE 2 4 User Manual E 3 4 1 Functionality Ottfered 2evsd geev kggsesgd See eE NNNNSNeEEEENRN ENNEN ENEE ENN ce 3 4 2 Input Formats Acceptede sssssssssssussuus00uuuunuuuuunnnnnnnunnnnnnnnnnnnnnnn 3 AZ Opti HS isdan adea aaa aa iaa a Naaa iE 4 4 3 1 Read Preprocessing Optlons eee eee esate ene ee ena eesaa ease nese esa eeaeeaaesaes 4 4 73 2 ASSEMDIY O PtlOnSes cc eegen fac ges
4. default velvet e s scaffolder Scaffolder to use sopra bambus velvet default none e min contig length NNN Minimum final contig length default 100 e scaffold on off Whether or not to scaffold contigs during velvetg default off 4 3 3 Assembly Evaluation Options e g genome 2bit Genome in FASTA or 2bit format used for reference based joining and accuracy e t transcripts fa Transcripts in FASTA format for checking completeness contiguity e ga genes tab Gene annotation in tabular format name chrom strand start end exonStarts exonEnds This is used to check of multigenes and gene fragments in the final contigs e max intron NNN Maximum intron length for completeness and contiguity assessment default 75000 4 3 4 Advanced Options e min mer occur NNN Minimum number of kmer occurrences for rare kmer filtering default 3 e kmer length NNN Kmer length for rare kmer filtering default 24 e split min cnt NNN Minimum depth for transcribed segments when splitting contigs default 3 5 Galaxy Support Galaxy is a platform for interactive large scale genome analysis It is convenient to use the Galaxy platform to create interactive web pages that enable web based analyses instead of using the command line options Tool configuration and wrapper files which quickly integrate Rnnotator into Galaxy are available upon request 6 License and Citation The source code for Rnno
5. ed paired end insert size 200 bp rnnotator pl strP 200 sampleA fq sampleB fq e Non stranded paired end insert size 200 bp rnnotator pl nonP 200 sampleA fq sampleB fq e Mixed library types rnnotator pl nonS sampleA fq sampleB fq strP 150 sample Co 4 User Manual 4 1 Functionality Offered The Rnnotator pipeline was designed to take advantage of the strengths of existing assemblers while providing additional functionality to further improve transcriptome assemblies Rnnotator takes short read sequences as input and outputs assembled transcript contigs It consists of three major components preprocessing of reads assembly and post processing of contigs The read preprocessing step may optionally perform several tasks including removing low quality reads low complexity reads adapter containing reads duplicate reads reads containing rare k mers rRNA containing reads and read trimming After read preprocessing Rnnotator performs eight assemblies using the assembler of your choice Velvet Oases etc Each assembly uses a different hash length for the De Bruijn graph The assemblies will be run either sequentially or in parallel depending upon the n parameter setting After performing multiple assemblies Rnnotator removes redundant contigs and further assembles the contigs where significant overlaps are found 4 2 Input Formats Accepted Rnnotator accepts FASTQ formatted read files as input For paired e
6. nd reads it is expected that read 1 and read 2 are in the same file and follow one after another in pairs An example is shown below 1044 5 1 1071 20262 1 GGTCAATCTCACGATTTGATGGAANAGCTCGCCACCGGGGCAGAGTTCGAGGATGATATAGTAGTATTGACGTGCC i bbbbbbbbbbb a bbbbbbbbb BZY U bbbbbbbbbab bab a b b _bb aa XT Z_ _ _K_BB 1044 5 1 1071 20262 2 GCAACCAGCGTGCCAACATCCTGAAAGAAGT GCAGATCATGCGCAATCTCGATCACCCCAATATCGTCAAGATGAT bbbabbb_bba bbbbb bbbc_b b ab_aaaaa bcacac_c aa ac a aZ a BBBBBBBBBB Any read length produced by Illumina instruments is acceptable for input to Rnnotator However 150 bp is the longest read length that has been tested with Rnnotator Four library types are supported by Rnnotator nonS nonP strS and strP meaning non strand specific single end non strand specific paired end strand specific single end and strand specific paired end At least one library must be given as input to Rnnotator Multiple FASTQ files can be given for a single library For example rnnotator pl nonS sampleA fq sampleB fq sampleC fq Also the same library type may be used multiple times For example if you have different insert sizes 4 3 Options rnnotator pl strP 200 sampleA fgq strP 500 sampleB fq 4 3 1 Read Preprocessing Options low qual on off Remove low quality reads default on Reads are considered low quality if gt 80 of the read length has a quality scores lt 20 low comp on off Remove low complexity
7. org Optional prerequisites are e Oases 0 1 18 http www ebi ac uk zerbino oases e Bambus 2 33 http www cbcb umd edu software bambus e Sopra 1 0 dayarian physics rutgers edu x1 x4 scripts 2 2 Installation Details To install Rnnotator type the following commands into your shell It will install version 2 3 of the rnnotator package 1 Gunzip the file and un tar the file wherever you want the software to reside gzip cd path to Rnnotator 2 3 tar gz tar xf 2 Once the installation is finished move to the Rnnotator 2 3 directory cd Rnnotator 2 3 perl Makefile PL PREFIX path to installation dir make amp amp make test amp amp make install 3 All scripts or programs 64 bit binaries for x86_64 chips for Linux are in the scripts directory Prior to running Rnnotator add the scripts directory to the PATH variable e g PATH path to Rnnotator scripts PATH When compiling Velvet and or Oases it is important to set the CATEGORIES and MAXKMERLENGTH directives appropriately for your datasets The CATEGORIES parameter should be gt the number of libraries types you have The MAXKMERLENGTH should be proportionally large enough to cover your read length In other words if the read length is 75 MAXKMERLENGTH should be at least 69 or so If you are in doubt simply set MAXKMERLENGTH to the largest read length when you are compiling Velvet and Oases 3 Quick Start e Strand
8. tator is available from Lawrence Berkeley National Laboratory under an End User License Agreement for academic collaborators and under a commercial license for for profit entities If you would like to receive this code please contact Virginia de la Puente at vtdelapuente I bl gov for details If you use Rnnotator please cite the following paper Martin J Bruno VM Fang Z Meng X Blow M Zhang T Sherlock G Snyder M Wang Z Rnnotator an automated de novo transcriptome assembly pipeline from stranded RNA Seq reads BMC Genomics 2010 11 663 7 Contacts If you have any questions about Rnnotator please contact the development team Zhong Wang ZhongWang lbl gov Jeffrey Martin JAMartin lbl gov Xiandong Meng XiandongMeng lbl gov
Download Pdf Manuals
Related Search