Home

GeXP User Manual - Beckman Coulter

1. Figure 1 1 Instrument Hardware Overview 1 Sample Access Cover extended 2 Capillary Access Cover extended 3 Status Indicators 4 Plate Holders Sample Transport 5 Capillary Temperature Control Cover 6 Rubber Latches 901632L Al 7 Manifold Access Cover 8 Gel Waste Bottle 9 Power Switch 10 Gel Pump 11 Gel Pump Gel Cartridge Access Cover GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Getting Started System Overview Sample Access Cover Provides access to the buffer plate wetting tray and sample plate Capillary Access Cover Provides access to the capillary array through the capillary temperature control cover Capillary Temperature Control Cover Provides an enclosed environment for the capillary temperature control and allows access to the capillary array Capillary Array Used to produce raw data for sequencing and fragment analysis is 33 centimeters in length and has an i d of 75 micrometers The capillary array Figure 1 2 has three components electrode block inlet eight capillaries and the array fitting outlet The electrode block is the DNA sample inlet side of the array It holds eight hollow stainless steel electrodes Each stainless steel electrode holds a capillary in the center These electrodes are designed for immersion into an ent
2. Where X Microsoft Document Imaging Writer Port Comment Page Layout Portrait C Landscape Sample Elements Iw Header Analysis Log Raw Data Run Log w Result Data Method Summary Cancel w Result Output Analysis Parameters Curent Quality Parameters o Hep Voltage Trimming Lag Options Alignment Results Alignment Accuracy Figure 2 18 Report Format Options Specifying Sample Plate Export Options Exporting Sample Results To export sample results after separation ze Me ed des 6 Select the Export Data option in the Export section of the Analysis Tab Figure 2 17 Click on the Edit Export Options for Plate button Select the target folder Select the desired Sample Elements for the export format chosen Refer to the Online Help for a description of these parameters and the export formats Select the desired options for the chosen export format See Export Options on page 43 for descriptions of the export options used for exporting sample results Click OK NOTE The export formats selected will apply to all samples automatically exported during the plate run Export Options Removing CEQ Tracking Suffix Select this option to remove the appended sample plate position and time date stamp from the exported files GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 43 PN B40154AC Sample Setup Module Using th
3. M Header Save in lo E port amp t EJ Haw Data v Result Data DATS 100 D4 txt E DATS 93 D4 tet E DATS 101 D4 txt E DATS 94 D4 txt E DATS 102 D4 tect DATS 96 D4 txt LocusList txt Z DATS 97 D4 txt DATS 99 D4 txt Result Output Options I Remove CEG Tracking Suffix v Resolve Filename Conflicts File name DEFAU LT save as type Test Tab Delimited tst Cancel Figure 6 41 Fragment Analysis Export Dialog Box To export the results as a text file from the Export Results Options window l Click Save As Use the folder navigation options next to the Save in field to locate and select the folder in which you want to save the export file 2 Enter the desired file name in the File name field NOTE Do not use special characters in the file name 2V 5 l 3 Select Text Tab Delimited txt in the Save as type text box 4 Click Save The system returns to the Export Results Options screen displaying the file path to the specified text file in the Export results as field 5 If desired modify the fields that apply to the text file a Select Header and or Result Data in the Elements section Select Remove CEQ Tracking Suffix to automatically remove the plate position coordinates A01 BOI etc as well as the time date stamp from the sample name These are generated by the CE system software c Select Resolve Filename Conflicts to ena
4. Gel Hame r Date Installed p 27 2008 Time Installed inops ooo Haurs an Instrument Eo Butter Part Humber BO 2 OF Cancel Print Help didi Lat Humber CEG Sequencing Separation Buffer Figure 3 39 Gel Cartridge Buffer Information Dialog Box Viewing or Changing Buffer Information 1 Select Replenish Gel Cartridge Buffer Information from the Run Module menu bar 2 Use the Gel Cartridge Buffer Information dialog box see the figure above to view or change the buffer lot number NOTE The buffer lot number can only be changed when the instrument is not performing a separation GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 85 PN B40154AC Run Module Using Direct Control Removing and Replacing the Capillary Array CAUTION Be careful when installing or removing the capillary array to prevent damage and maintain low background signals Clean all gel residue thoroughly NOTE This procedure assumes that an expended capillary array is being replaced with a new capillary array l Select Replenish Release Capillary Array from the Run menu After the system prepares for release of the capillary array the Remove Capillary Array dialog Figure 3 40 is displayed Remove Capillary Array Ea Tou may now open sample capillaries access doors to change capillaries To replace the capillary array immediately select Replace capillary arra
5. 5 Set the Migration Variable fields to either migration time or mobility as the independent variable for the Model Size is the dependent variable Migration time Select this option to use the average migration times and sizes of the standard fragments to construct a size calibration Mobility Select this option to use fragment velocity cm s divided by the separation potential V cm with the sizes of the standard fragments to construct a size calibration GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Fragment Analysis Module Defining Fragment Analysis Parameters Quantitation Tab The Quantitation tab allows you to set the parameters for calculating the quantity of all peaks by comparing their heights or areas to a single peak of the same color whose quantity is known Edit Fragment Analysis Parameters Of xi Parameter Set Mame FAO Project Default Analysis Method STA Locus Tags SNE Locus Tags ID Standard Calculate Using Size Height v Time Area Quantitation V alues Time Window Amount pi fo mn n ep 4 pa fo mn n0 ep 4 EMO mn n efo pa n min oo p 3 Save As Cancel Figure 6 13 Fragment Analysis Parameters Window Quantitation Tab Once you have entered the information for the known peak into this window the system looks for the reference peak in each trace using the specified size or time Based on this information the
6. Enter the new User name required and edit the other fields as necessary Click Create Adding Groups To add a new group from the Windows desktop Select Start Settings Control Panel Administrative Tools Computer Management The Computer Management console opens In the left pane click on the symbol to next to the System Tools item to expand its contents Click on the symbol next to the Local Users and Groups item to expand its contents Right click Groups and select New Group The New Group dialog box opens Figure 8 12 335 Database Management Data Manager Procedures 5 Enter CEQUSERS in the new Group name field and if necessary enter a description in the Description field Mew Group Ei x Group name CEQUSERS Description Members Add Remove xe Figure 8 12 New Group Dialog Box 6 Click the Add button to add the users created as described in Adding Users on page 334 The Select Users or Groups dialog box opens The local computer appears as the default location in the Look in field If it isn t use the drop down list and select the local computer 7 Scroll down the Name list and select the user names created If you created more than one user click on the first name press and hold the Ctrl key then select any additional names to add to the group 8 Click Add and then click OK to add the selected users to the new group Select this object type
7. Selected Columns Possible Columns Result Name Data Exclusions dunes si Filter ID vdd Standard General Peak Classification Bises No fragment size estimate Estimated Sog MM Separation Method Peak Ansa L gt Date Method Modified Peak Height ee gt Quantitation Standard Dose i Length Attributes Edited sensus gt Mo confidence interval esl iarati i mE dris Average Migration Time y Allele ID gt Confidence Interval Lowe 2 i Allele Match Quality dis s Confidence Interval Upper Comment Locus Specific Information d s No Alleles Found cree gt Unknown allele ee s Too many alleles eee Stutter Peak ite s Spurious Peak si Minus A Figure 6 35 Column Selector window Selecting Columns for Display in the Table NOTE The application area in which you select the Column Selector window such as Result Set View Fragment List or AFLP Cluster Analysis determines which columns are available for display NOTE Refer to the online help for detailed descriptions of the available columns and their use Selecting Columns for Display Highlight the column selection in the Possible Columns area of the window and click the right arrow to move the selection to the Selected Columns area of the window To select all columns for display in the list click the double right arrow GenomeLab Genetic Analysis System
8. Table 3 5 Tools Menu Option Autoscroll Autoscale Pause Data Display Unzoom Unzoom All Display Options View Last Analysis 02 Description Toggles Autoscroll off and on When enabled Y the system will scale all data to the last 10 minutes of the run on the X axis and confine the display of data to the pane on the Y axis Selecting a checked option removes the check mark and disables the feature Toggles Autoscale off and on When enabled v the system automatically scales the data displayed on the window to the fit into the pane If autoscaling is disabled the data is scaled to its true values Selecting a checked option removes the check mark and disables the feature Pauses or resumes data display When enabled v this option pauses data display Pausing data does not stop the stream of data just the display of data Select Unzoom to undo one zoom level Select Unzoom All to undo all zoom levels Opens the Display Options dialog box which you can use to modify the parameters for currently displayed data including its title X axis Y axis dye traces current traces and colors For details see Setting or Changing Display Options on page T3 select View Last Analysis to open the Sequence or Fragment Analysis module and display the most recently analyzed sample set of a running sample plate For details see Viewing the Last Analysis Performed on page 75 GenomeLab Genetic Analysis System User s
9. When finished click Save As and save the edited method to an appropriate Project with the same method name as specified in the plate Import file Using a Sequence Reaction Separation l 2 3 4 Launch the Sequence Analysis module In the Sequence Analysis module select Analysis Working Analysis Parameters From the Working Parameters dialog select Use Stored parameters Confirm the presence of the appropriate pre selected analysis parameters in the Select Analysis Parameters popup window e If not present cancel the Select Analysis Parameters and click Edit in the Working Parameters dialog Select the desired tab and edit the parameters as appropriate in the Sequence Analysis Parameters Editor dialog box See Editing Sequence Analysis Parameters on page 124 for a description of the Sequence Analysis Parameters Editor and creating Analysis Parameters When finished click Save As and save the edited parameters to an appropriate Project with the same analysis parameters name as specified in the plate Import file Performing a Fragment Analysis Separation l PA 3 Launch the Fragment Analysis Module In the Fragment Analysis Module select Analysis Analysis Parameters From the Analysis Parameters dialog select the appropriate analysis parameters in the Select Analysis Parameters Set field If not present click Edit and modify the appropriate analysis parameters in the Edit Fragment Analysis Parameters dia
10. 03 02 06 00 32 354M Sequence TeshEOS_O60S012 03 02 06 O0 32 354M Sequence Test DOS_O603012 03 02 06 00 32 374M Sequence Test COS_O603012 03 02 06 00 32 364M Sequence Test B03_0603012 03 02 06 00 32 364M Sequence TestA 3 0603012 03 02 06 00 32 354M 03 01 06 22 43 44PM m k Project M ame Default Search Load List Save List UK Cancel Help ude Sequence Test B b O60302028P Sequence Test CO5 O60302028P Sequence Test 005_O60302028P Sequence Test E05 O60302028P Sequence Test F05 BU3O2028P Sequence Test G05_O60302028P Sequence Test HO5_O60302028P Select a project name from the Project drop down list at the bottom of the dialog box Select the appropriate tab Sample Data or Sample Plate Results Select Enable and enter a filtering start and stop date if desired Highlight a sample name and click the right arrow to move the sample name to the selected list box on the right Continue highlighting sample names and moving them to the selected list box until you have selected all the samples for analysis Click OK The Analysis Parameters Editor dialog box opens GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Sequence Analysis Using the Sequence Analysis Module 7 Select the appropriate analysis parameters or edit an existing parameter set and click OK The batch processing begins and a wind
11. 1 naX KKK 3B 33561 65 7 Figure 3 10 Data Monitor Window Run Module Table 3 15 Data Monitor Window Run Module ltem Description A Data Monitor Tab Displays the Data Monitor window Data Monitor Window Displays the data for the running sample plate for the selected capillary buttons C Capillary Buttons These buttons A through H represent the eight capillaries of the array 62 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Run Module Run Module Overview Direct Control Window This window contains selectable areas and function buttons that perform some of the distinct tasks listed in the Direct Control and Replenish drop down menus For details see Direct Control Menu on page 51 and Replenish Menu on page 54 Right click anywhere in the window to open a full menu Data Monitor Direct Control Log Instrument Data Access Plates Plate Position Capillary Temperature Denature Samples Optical Alignment Inject Separate Gel Capillary Fill Manifold Purge Capillary Information Install Gapillary Array Release Capillary Array Gel Buffer Information Install Gel Gartridge Release Gel Cartridge Replace Wetting Tray z nore 9249 S Z I Access Plates amp enarate Figure 3 11 Direct Control Window Run Module The example above identifies the selectable areas on the Direct Cont
12. 4 Grasp the wings of the gel cartridge gel pump plug and pull it out of the barrel NOTE Always note the lot number and the hours on the instrument for a gel cartridge if you are planning to use it for more than one session 5 If necessary use a tissue to wipe gel strands off of the instrument 368 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Maintenance and Diagnostics Direct Control and Replenishment 901603L Al Figure 9 40 Removing Replacing the Gel Cartridge Continued 9 1 Cartridge Wings 3 Cartridge Locking Lever open 2 Gel Cartridge or Gel Pump Plug 4 Cartridge Barrel Remove any air pockets from the gel cartridge by grasping the cartridge wings between your first two fingers and pressing the plunger with your thumb until a small amount of gel is pushed out of the cartridge tip Insert the new cartridge or the gel pump plug into the barrel and lock it into position by aligning the cartridge wings with the cartridge holder and pushing in Push the cartridge locking lever towards the back of the instrument approximately a 90 angle into its locked position Close the Gel Pump Gel Cartridge Access Cover 10 In the Remove Gel Cartridge dialog box Figure 9 41 Click Install Cartridge to indicate that a gel cartridge was installed OR e Click Install Plug to indicate that the gel pump plug or empty cartridge was installed GenomeLab Genetic Analysis System
13. Analyses Data Reports Ready Figure 6 20 Result Set View Window Second Level Filtering The Result Set View window provides three key elements Fragment Results table displays all analyzed samples both included and excluded that have been selected for the Study The displayed columns are user defined and can be modified to show a number of different system variables and information e Exclusion Filter Set area is where the user defined exclusion filters are selected and applied to the data Each column contains a menu of parameters to be applied as exclusion filters The system comes equipped with one pre defined sets of exclusion filters You can create modify and save additional filter sets e Summary area displays a table that identifies the number of analyses that have been affected by the application of exclusion filters As the result set is manipulated you can view the number of samples that have been excluded from your Study based on your filter set parameters GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 221 PN B40154AC Fragment Analysis Module Using the SNP Locus Tag Editor 220 NOTE The Filter Sets applied to the Result Set data 2nd Level Filtering are different from the Filter Sets applied to the Fragment List data 3rd Level Filtering In the Result Set you apply filters to an entire sample that might contain numerous fragments In the Fragment List you apply filters to indi
14. DNA Size Standard Kit 80 608395 1 Contains fragments of 13 and 88 nucleotides designed to accommodate a wide range of sizes for multiplexed and poolplexed SNP fragments DNA Size Standard Kit 400 608098 1 DNA size standard for analysis of fragments up to 400 nucleotides Includes e Mineral Oil e DNA fragments of the following sizes labeled with CE system WellRED fluorescent dye 60 70 80 90 100 120 140 160 180 190 200 220 240 260 280 300 320 340 360 380 400 and 420 nucleotides e Sufficient for 96 fragment analysis separations DNA Size Standard Kit 600 608095 DNA size standard for analysis of fragments up to 600 nucleotides Includes e Mineral Oil e DNA fragments of the following sizes labeled with CE system fluorescent dye 60 70 80 90 100 120 140 160 180 190 200 220 240 260 280 300 320 340 360 380 400 420 440 460 480 500 520 540 560 580 600 620 and 640 nucleotides sufficient for 96 fragment analysis separations SNPStart Kit A23201 Includes reagents for 100 SNP genotyping reactions e SNPStart Master Mix e Control e Mineral oil e Sample Loading Solution GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 381 PN B40154AC Maintenance and Diagnostics Consumable Items List Table 2 Required Consumables for Performing Fragment Analysis Item GenomeLab GeXP Start Kit A85017 A54657 a A85022 Ge
15. gt 22 t ria mm Vln m Q g id a Arial 10 Jj B z u jE BHIS S Ar As E fe Minimum difference in Allele Peak Height Ratios for Detecting LOH 1 100 a4 LOH Threshold Minimum difference in Allele Peak Height Ratios for Detecting Allelic Imbalance pee Al Threshold Al 1 to LOH threshold 0 means don t detect Characters embedded in sample names of Normal samples or loci L rr Check if Tumor and Normal in same well Start vr M 4 gt MN Instructions START ike Elm Ready Figure 6 34 Run LOH Analysis NOTE You must select Enable Macros to run the LOH Analysis otherwise a prompt reminds you to enable this feature 2 From the LOH xls START sheet set the LOH Threshold and the Al Threshold if desired 3 Specify the unique character combination used to identify Normal samples or loci i e Norm 4 Specify whether Normal and Tumor samples are in the same well e Ifyou are running Normal and Tumor samples are run in the same well select the corresponding check box f Normal and Tumor samples are in different wells clear this check box 5 Click Start NOTE Do not use the keyboard or the mouse during LOH analysis 6 If desired save the results when the processing is complete NOTE To save the data correctly you must save the LOH Analysis results as a Microsoft Excel Workbook xls file type You must also change the file name from the d
16. Click OK when prompted to verify this action Wait until the dialog box message displays GO with a green text message Open the sample access cover Figure 9 1 and lift to the vertical locking position With the gel waste bottle 80 9096 full remove the cap and pull the bottle out of the instrument Place the cap from the new bottle over the full waste bottle and secure GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Maintenance and Diagnostics Routine Maintenance 8 Thread the new bottle onto the cap attached to the instrument and set the bottle into position 9 Close the sample access cover 10 Click Done on the Replace Wetting Tray dialog box 11 Dispose of the full waste bottle according to procedures found in Disposal of the Gel Waste Bottle on page 379 Replacing the Wetting Tray Removing the Wetting Tray 1 Select Replenish Replace Wetting Tray 2 Click OK when prompted to verify this action 3 Wait until the dialog box message displays GO with a green text message 4 Open the sample access cover Figure 9 1 and lift to the vertical locking position 5 Remove the sample plate and set it aside 6 Rotate the wetting tray retainers outwards to release the wetting tray 7 Lift the wetting tray vertically Cleaning the Wetting Tray l Remove the wetting tray lid assembly from the wetting tray reservoir 2 Rinse the wetting tray lid and reservo
17. Current M Quality Parameters Voltage v Trimming Log Alignment Results Alignment Accuracy Figure 4 38 Report Format Dialog Box OF Cancel Help FREE Options To view the quality parameters of an analyzed data set prior to printing select File Print Preview e To exit the Print Preview option click Close To print the quality parameters for that data set select File Print Report GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Sequence Analysis Using the Sequence Analysis Module The system prints the Quality Values as numerical values as shown in the following example ra aa Project Default System CEQ 2UDOIXL Operator Manual analysis gt Sample 4 3 F01 010061605 Instrument Unity fo Result 43 F01_011029090F Quality Parameters A 3 F01 011029090F Number Base A C G T Callicore ualValue Migration DataPoint Insert Edit l G zz8 0 96 12 ele is 32 No No 2 T 3 250 0 66 lz 21 64 47 Mo No 3 C 0 247 0 62 10 21 84 68 No No 4 C 0 244 0 62 10 21 89 al Mo No 5 A 228 l 0 62 10 21 96 3 Mo No 6 A 246 4 0 97 l 22 02 110 No No T 253 l 0 238 20 22 09 la Mo No a G 2 252 0 99 20 22 14 154 Mo No q C 0 253 l 38 22 19 l No No l C l 249 1 00 3l a ab 192 No No ll A 252 0 96 1 fae dd a0 No No lz G 3 Oo 251 1 00 36
18. Displays the current data for the active sample Voltage Displays voltage data for the active sample Compare Data Compare the active analyzed data set against another analyzed data set Quality Parameters Displays a graphical representation of the quality values for the active sample sample Plate Enable the Sample Plate toolbar using the View Toolbars option shown as in Undocked mode Use this dialog box to select the samples to open or export Menu Bar Options The following example shows the Sequence Analysis modules menu bar File Edit View Tools Analysis Window Help The following topics describe each of these menus and their options GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 105 PN B40154AC Sequence Analysis Sequence Analysis Module Overview File Menu Click the File menu to display its drop down menu as shown in the following example Open Cro Save Ctri 5 Import Export Export from Plate Preferences Properties Report Format Print Preview Print Report Ctrl F Print Selected Pane Ckri P Print Desktop DATS 100 D2 F03_ 0106052260 139424sprot CD6 998121315XJ MySample D1 0109241066 MySample A1 0109241066 jo Ph Je IO DATS 100 D2 F03 0106052260 139424sprot CD6 DDD526143 MySample A1 0109241066 MySample B1_0109241066 4 2 amp Exit Use the File menu to open save import export and print data and to set prefere
19. Hours an Instrument 27 Figure 3 51 Install Gel Cartridge Dialog Box 12 Dispose of the used tissue and spent gel cartridge in accordance with the procedure Maintenance and Diagnostics on page 339 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 95 PN B40154AC Run Module Using Direct Control Removing and Replacing a Gel Cartridge Gel Pump Plug For Single Rail System CAUTION Care must be exercised when installing removing a gel cartridge due to the viscosity of the gel mixture NOTE This procedure assumes that an expended gel cartridge is being replaced with a fresh gel cartridge or that a used gel cartridge is being removed for storage purposes and being replaced with the gel pump plug 1 Select Replenish Release Gel Cartridge from the Run Module menu bar When the system is ready to release the gel cartridge the Release Gel Cartridge dialog box will be displayed Wait until the lead screw is completely disengaged 2 Open the Gel Pump Gel Cartridge Access Cover Figure 3 52 by gently pushing in on the top of the cover The cover is spring loaded and will pop open 3 Pull on the Cartridge Locking Lever The barrel will swing outwards to approximately a 90 angle from its locked position Figure 3 52 Removing Replacing the Gel Cartridge 1 Gel Pump Gel Cartridge Access Cover 4 Cartridge Locking Lever opened 2 Cartridge Locking Lever closed 5 Cartridge Barrel 3 Cartridge Ba
20. Replacing the Gel Waste Bottle For Dual Rail System on page 345 or Replacing the Gel Waste Bottle For Single Rail System on page 346 The Run module provides six toolbars Standard Direct Control Data Monitor Log Sequence Dye Colors and Fragment Dye Colors Each icon of the various toolbars corresponds to a commonly used menu item The following tables describe the function of each of the toolbar icons Standard Toolbar The following example shows the Sample Setup module Standard toolbar For descriptions of the actions that occur when you click a toolbar icon see Table 3 9 am 4 sj x Figure 3 2 Standard Toolbar Run Module Table 3 9 Standard Toolbar Run Module Icon m Description Restore Data Monitor Defaults Displays the default color selections at the time of installation Run Sample Plate Runs a sample plate Pause Pauses the currently running sample plate GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC 99 Run Module Run Module Overview 96 Table 3 9 Standard Toolbar Run Module Icon k Description Stop Stops the currently running sample plate or direct control process View Last Results Executes the Sequence or Fragment Analysis module with the analysis of the last sample set run Help Topics Displays the CE system online help By default the help system displays the Contents in the navigation pane
21. Sample Property Sets Detined Sets Properties PROPERTY 1 Template Source Create Delete Figure 2 14 Sample Property Sets Dialog Box 38 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Sample Setup Module Using the Sample Setup Module Creating and Storing a Custom Property set l Click the Create button in the Defined Sets portion of the Sample Property Sets dialog 2 Entera name in the Create Property Set dialog box Figure 2 15 3 Ifdesired use the Copy settings from drop down list to choose an existing property set to copy into the new one Create Property Set Ea Set Mame Copy setings fom NNNEEEEEIIIN ES Cancel Help Figure 2 15 Create Property Set Dialog Box 4 Click OK to save the new property set 5 Use the button to manually add properties to the new property set Using Methods A method is a program that includes a sequence of events that the system will use to collect the data The method controls the hardware the temperatures voltages and times which work together to gather data The system comes with several methods that are optimized for the different software applications Use the Frag methods to collect data for fragment analysis e Use the LFR methods to collect sequence data Use the SNP method to collect SNP primer extension data After creating a new sample plate the Method selection for each column
22. Std 031 25ng Std 125ng 5997 689 8091 165 3586 091 5758 315 2256 828 39 193 Figure 7 33 No Data In Gene Error Message If any gene name begins with a digit the entry in the Normalization gene list and the table heading for that gene will have an underscore character _ added as a prefix The table heading for that gene will be highlighted as a warning with a yellow background It will have a tool tip explaining the prefix to the gene name File C Projects Gene Expression Main GexXP Data Tool DataVBad Gene Name Test csv SEIN Sami The gene name must not with a digit so it has been prefixed with the underscore character _ Std 015 63ng Std 031 25ng 121208507460121 13610250 11063670 3208414 25000 Std 125ng 54700 770 47467 280 35539 640 45902 560 9675 922 21 079 Std 250na 465294 170178572 6101 ND 62433 390122824 300136 558 Figure 7 34 Gene Name Begins With Digit Error Message 304 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Gene Expression GeXP Quant Tool 7 7 GeXP Quant Tool The Quant Tool automates quantitative analysis of data from GeXP Data Tool It has functions of calculating the standard curve determining the Gene Expression Quantization normalizing the quantified gene expressions based on selection of one or more reference genes and creating an Excel workbook with one worksheet for each gene in the analysis Downloading GeXP Quant
23. WARNING After removing the expended capillary array from the instrument dispose of it in a solid hazardous waste container Disposal of the Gel Cartridge Table 9 3 10 WARNING After removing the expended gel cartridge from the instrument use a lab spatula or wooden dowel to push any remaining gel into a liquid hazardous waste container Dispose of the empty cartridge in a solid hazardous waste container Disposal of D I Water Gel Mixture from the Wetting Tray Table 9 3 11 WARNING When performing this procedure use an exhaust ventilation unit that meets TLV requirements l Pour the D I water gel mixture into a hazardous liquid organic waste container 2 Rinse the Wetting Tray with water and dispose of the rinse in the liquid waste container 3 8 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Maintenance and Diagnostics Biological Waste Disposal Table 9 3 12 WARNING Dispose of D I water gel mixture in accordance with all applicable federal state and local environmental regulations concerning hazardous liquid waste Disposal of the Gel Waste Bottle Table 9 3 13 WARNING When performing this procedure use an exhaust ventilation unit that meets TLV requirements Dispose of buffer gel mixture in accordance with all applicable federal state and local environmental regulations concerning hazardous liquid waste GenomeLab Genetic Analysis System U
24. 272 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Gene Expression Multiplex Primer Design using NCBI Primer BLAST 7 2 Multiplex Primer Design using NCBI Primer BLAST The NCBI Primer BLAST tool is used to design an initial or first pass multiplex using accession numbers of target and reference genes The primer and amplicon information for the multiplex are saved in a Microsoft Excel file The multiplex primer and amplicon sequences are evaluated using BLAST analysis If necessary individual primers can be re designed Finally the primer and amplicon information for the multiplex in the Microsoft Excel file is updated NOTE Add appropriate universal tag sequence at the 5 end of the primers before ordering primers IMPORTANT The information that is provided in the section and additional information can be found in the GeXP Chemistry Protocol 429143 Pre Design Considerations l Determine which genes to be included in the multiplex for your study 2 Selecta correct Accession Number for each of the targeting genes If possible always use reference sequence RefSeq NM XXXXXX NOTE The Accession Numbers can be found on the National Center for Biotechnology Information NCBI web site at http Avww ncbi nim nih gov Since the sequence represented by the accession number will be used to generate the multiplex primers certain considerations should be made when selecting accessio
25. 5 6 7 8 54 14 55 03 5465 014 3824 i 60 63 61 04 60 93 0 04 61 99 6252 6234 006 4200 MNT I 66 71 6715 67 00 004 7705 EM NY 76 92 7717 77 11 001 8534 EMO 78 62 7885 7878 O01 4957 8761 97 74 87 66 000 4291 90 24 90 24 9024 O00 929 91 45 9165 9153 001 7611 93 09 9407 9351 020 5101 94 23 94 23 9423 000 1186 96 39 9666 9647 001 68172 9737 97 62 97 45 001 6033 100 46 100 46 10046 0 00 1242 102 49 102 86 10263 0 02 4552 120 12 120 12 120 12 0 00 1306 125114 12601 125 33 0 12 12678 129 39 130 19 12953 0 07 5463 135 95 135 95 135 95 0600 300 139 45 139 45 13945 0 00 1470 141 78 14256 14217 015 3303 146 68 146 68 146 68 0 00 2009 14808 148 69 14820 004 7961 150 38 150 38 150 38 6 00 17729 156 09 156 57 156 21 0 02 21863 160 42 160 42 16042 0 00 1546 161 31 161 80 161 43 0 03 10588 162 16 162 63 16226 0 02 10067 17457 174 57 17457 0 00 3860 180 41 180 41 180 41 0 00 1610 190 41 190 41 190 41 0 00 200 39 200 39 200 39 0 00 20306 20343 20333 0 01 0 1 1 Enc RERR MESE ore ne i eee IST LED ee NEGET H 3 2 3 3 5 4 5 1 4 1 7 6 1 4 1 5 ri 1 1 2 1 7 1 7 1 ri 1 1 1 1 ri aO BEBE wimi A et wy ty i tp i te ts tn St on mo co iio Figure 6 33 New AFLP Analysis Window Viewing the Cluster Analysis After completing the clustering operation the system displays a table showing the results of the AFLP analysis You can format t
26. Accessing the Direct Control Window Launch the Run module to open the Direct Control window then select the Direct Control tab Data Monitor Direct Control Log Instrument Data l H LAM 3 a LA g ev a te et 8 eee 9 EZ Access Plates Inject Separate Figure 9 11 Direct Control Window GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 349 PN B40154AC Maintenance and Diagnostics Direct Control and Replenishment Loading the Sample Plate and Buffer Plate For Dual Rail System To load the sample plate or buffer plate l Select Direct Control Access Plates Access Plates Ea IF vau are going to load new plates please Stark prepare your plates before clicking on Start You have 15 minutes to change plates once vou click on Start This time limit is critical sa that the Help capillaries are not adversely affected by prolonged exposure to air Figure 9 12 Access Plates Dialog Box 2 Click Start The Capillaries Exposed dialog Figure 9 13 opens Capillaries Exposed x Capillaries Exposed i Do not open sample You may now open the sample door door and load plates PLEASE WAIT Capillaries exposed to air Load Capillaries exposed to air Load E Zarmel Cancel Alarm Off Alarm Off Time Remaining Time Remaining ur i min sec min Sec E E Help i3 p3 Help Left Plate Right Plate Plate Loaded Plate Loaded Immerse Capilla
27. Analyze active sample data or reanalyze existing sequence results Selecting this option opens the current Working Parameters dialog box Click OK to start the analysis Stop Terminates the analysis currently in progress Trim Based on Quality Performs a trim based on quality Trim Based on Sequence Performs a trim based on a sequence Restore Original Base Sequence Returns analyzed data display and base sequence text back to its original state losing all edits Third Party Analysis Opens the third party analysis package specified in the Third Party Analysis Setup dialog box Align Performs an alignment of the sequence against the current alignment settings Base Sequence Toolbar Displays the base sequence toolbar that allows you to search for text and ambiguity codes View Sample Plate Toolbar Displays the sample plate toolbar that allows you to select the Samples to open or export Heterozygote Backward Search Search backwards for heterozygotes in the base sequence text pane Heterozygote Forward Search Search forward for heterozygotes in the base sequence text pane Help Topics Displays the CE system online help By default the help system displays the Contents in the navigation pane located on the left and the introductory topic in the topic pane located on the right You can use the Contents to select and print specific help topics The navigation pane also provides a Search tab and an Index tab These t
28. Cancel Figure 6 27 New Binning Analysis Window Bin Parameters NOTE Bin Analysis requires a minimum of 10 samples Defining Parameters The first step in creating a new bin analysis is to set the bin analysis parameters These parameters identify the fragment list data you want to include in the bin analysis By setting these parameters you define the appearance of the view generated After they are set the system uses the information from the selected result set to generate a scatter plot The plot consists of all of the analyzed fragment data displayed as a function of the peak height y axis and fragment length x axis To set the bin analysis parameters l Select the dye used during the raw data analysis from the Dye drop down list NOTE You can examine only one dye at a time during each bin analysis 2 Enter the fragment range the minimum and maximum fragment size in the Fragment Range From and To fields 3 Enter the Maximum Bin Width maximum difference between the smallest and largest fragments within a bin in nucleotides 4 Enter the Minimum Data Points Per Bin the limiting number of points necessary to form a bin in the scatter plot 240 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Fragment Analysis Module Performing Bin Analysis Enter the length of the repeat unit of the allele in the Repeat Unit Length field Select the preferred allele naming convention se
29. Click OK on the Remove Manifold Plug dialog box 10 To install the capillary array see Removing and Replacing the Capillary Array on page 86 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 101 PN B40154AC Run Module Using Direct Control 102 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC 4 1 Sequence Analysis Sequence Analysis Module Overview sequence Analysis This chapter provides an overview of the Sequence Analysis module including its menu options toolbars and dialog boxes It shows you how to use this module to run a sequence analysis and to set up its parameters result properties and display options It also describes how to work with report and export sequence analysis results sequence Analysis Module Overview View analyze compare edit and print data of the following types Raw Data Current Data Voltage Data Analyzed Data Base Sequences Optical Scan Data Baseline Data Quality Parameters These types of data cannot be edited This module accepts raw data and analyzed data Editing and re analysis functions enable you to verify the accuracy of the base calls You can also export these data to third party packages for further analysis Main Window The following illustration identifies the areas on the Sequence Analysis module s main window that are described in Table 4 1 GenomeLab Genetic Analysis System User s
30. Computer Management Local Full Name Description fi System Tools BET Administrator Rf Event viewer F Shared Folders Built in account For administering EF ASP NET Machine Account Account used For running the 45P Built in account For quest access to BE Help ssistant Remote Desktop Help Assi Account For Providing Remote Assis GE SUPPORT 38 4 CN Microsoft Corporation This is a vendor s account For the F E Local Users and Groups sg Performance Logs and Alerts id a Device Manager S Storage t Hg Removable Storage Disk Defragmenter Disk Management res Services and Applicatians Figure 8 10 Computer Management Console Selecting Users 2 Intheleft pane click on the symbol next to the System Tools item to expand its contents GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC 3 4 Database Management Data Manager Procedures Click on the symbol next to the Local Users and Groups item to expand its contents Right click Users and select New User The New User dialog box opens Figure 8 11 User name Te stusert Full name Description Password Confirm password M User must change password at next logon User cannot change password Password neven expires Account is disabled xe Figure 8 11 New Users Dialog Box 5 6
31. D95938 0 2pmol D DXS7132 2pmol C04 GATA193AD7 0 25p D151679 at 0 25pmol C pull 0 25 primer 9 589 D1151984 0 1pmol D22S583 0 1pmol D D3S238 0 25pmol D952157 0 1pmol D NASAZ f 6 N Sample Data Sample Data Sample Data sample Data Sample Data sample Data Sample Data Sample Data Sample Data sample Data sample Data sample Data Sample Data sample Data Sample Data sample Data sample Data sample Data sample Data sample Data sample Data sample Data sample Data sample Data sample Data sample Data sample Data sample Data sample Data sample Data sample Data sample Data Qamnla Nata The following table describes the items called out in Figure 8 1 Table 8 1 Main Window Data Manager Module Opti A B Menu Bar 0 on Description Title Bar Shows the module name Data Manager 4 20 2001 11 35 2 4 20 2001 11 35 52 4 25 2001 17 23 53 4 16 2001 18 01 31 5 2 2001 09 33 22 5 17 2001 13 46 44 4 3 2001 18 44 22 4 3 2001 20 40 16 6 7 2001 10 25 34 4 26 2001 15 18 11 4 20 2001 12 36 30 4 25 2001 18 24 30 4 18 2001 19 00 02 5 2 2001 09 33 26 6 17 2001 15 20 04 4 3 2001 19 42 17 4 3 2001 21 38 12 6 7 2001 11 23 54 4 26 2001 17 16 37 4 20 2001 12 36 32 4 25 2001 18 24 31 4 18 2001 19 00 04 5 2 2001 09 33 27 5 17 2001 15 20 06 4 3 2001 19 42 18 4 3 2001 21 38 13 6 7 2001 11 23 56 4 26 2001 17 16 39 4 20 2001 12 36 34 4 25 2001 18 24 33 4 18 2001
32. Database Sample Rum History NOTE A VY next to an option indicates that the option is enabled Use the View menu to toggle the toolbar and status bar on and off or to manage the database view Table 8 4 View Menu Data Manager Module Option Description Toolbar Toggles between displaying or not displaying the toolbar otatus Bar Toggles between displaying or not displaying the status bar Refresh Rebuilds the window display to reflect the most recent changes Filter By Filter the list in the right hand side window by the dates modified Database Displays all items in the selected database sample Run History Displays a list of items that were run in a project during specified dates Tools Menu Click the Tools menu to display its drop down menu as shown in the following example Tools Backup Database Restore Database Shrink Database Associate Default Dye Spectra Convert Individual ID to Subject ID Administrative Tools k Use the Tools menu to back up restore and shrink a database and to perform other database management tasks Table 8 5 Tools Menu Data Manager Module Option Description Backup Creates a backup copy of the selected database Restore Restores a previously backed up copy of a database to the Data Manager shrink Database Reduces the size of the currently selected database Associate Default Dye Spectra Associates previously saved data with a new default dye spectra GenomeLab Genet
33. Dg Vs mE o os Analysis Parameters Result Set View Mew AFLP Analysis i ej Exclusion Filles Sel Binning Analysis Em e P Mew Result Files Sel 3 Run LOH Analysis capillaty a come analysis parameters LT J m 02 7234 z ue 184502 cselt L STD H07 _090227167x H pass Defui exPanshisParameters 23 U STD HOS_ 090223 DelaukG ex PAnalyi STD G04 090223187 L STD 3 1902231 860 L STD G02 0302231660 L STD GO1 0902231 66 EGG DEG C GC c cC E 02 23 2008 18 4550 23 2003 16 45 48 pais Del auk ex PnsbosPatameles z Iv Show Excluded Figure 7 4 New Binning Analysis Selection The Binning Analysis window with default Bin Parameters will be displayed GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Gene Expression Set up Locus Tag and Allele IDs Binning Analysis I c Steps Parameters Dye D4 2d Binning Fragment Range From 149 To 340 Bi i Locus Ta al nn ng g 1 Maxinum Bin Width Minimum Data Points Per Bin 2 Allele Naming Convention Repeat Unit Length 1 E C Mominal Size Alphabetic Stata aH Numeric Start At Source Data 333 953 1823 813 EN 225 250 Fragment Size nt Finish Cancel Figure 7 5 New Binning Analysis window with Default Bin Parameters 2 Modify the binning parameters For example for GeXP Human ReferencePlex use the following settings
34. GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 255 PN B40154AC Fragment Analysis Module Customizing the Results List Accessing the Column Sort Window To access the Column Sort window right click the column header area of the fragment list and select Sort Columns Column Sort Sort by Result Hame h Then by Sample Hame bd Ascending Descending C Ascending Descending Ascending f Descending PIS E3 Cancel Figure 6 36 Column Sort Window Sorting the Results List Data Columns To sort a column pe we qe qe Click OK to sort the list Select the column parameter you want to be sort from the drop down list Select the order in which you want the parameter sorted Ascending or Descending Repeat the first two steps for each additional columns that you want to sort NOTE See the online help for more information on these and other display modifications 296 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Fragment Analysis Module Reporting Results 6 13 Reporting Results The CE system software includes a powerful suite of utilities for creating reports It also allows you to export data and results to other third party software packages Fragment Analysis New Study a B x File View Analysis Reports Window Help Template Contest Type Contest Analyses Data Rep
35. LASER LIGHT IS EMITTED FROM THIS APERTURE approximate location e 60000000 AA DODUDDDL 080000000000 PRRBPEBBPEBE 600000000000 UJ 8000 approximate location Figure 1 Laser Label Locations 1 Capillary Access Cover extended 2 Laser Assembly Cover GenomeLab Genetic Analysis System User s Guide For In Vitro Diagnostic Use IX PN B40154AC Safety Information System Operation and Electromagnetic Interference NOTE The following information addresses the EMI effect on system performance and provides recommended mitigations Under the test conditions specified by the European normative electromagnetic compatibility standard EN 61326 1 the instrument may exhibit temporary degradations in performance in accordance with the table below Because the environmental circumstances contributing to the problem can vary several different mitigation techniques have been provided that should help eliminate or reduce the interferen
36. NOTE For details regarding the data analysis process see Analyzing the Data on page 204 7 Click Analyze During analysis the system activates a progress bar and displays an analysis log for each sample analyzed When finished the status column indicates if the re analysis passed or failed for each sample selected for re analysis NOTE To stop an analysis currently in progress click Stop The system stops the analysis after completing the sample in progress 8 Review the analysis log a Selecta sample in the upper samples list b Scroll through the analysis information in the lower analysis log area of the window 9 Click Finish to return to the Result Set View When finished re analyzing the data the system removes the initially selected results from the Study and replaces it with the re analyzed results The screen refreshes the Result Set View including the Summary area with the new data and reapplies the selected filters to the entire set of data NOTE Refer to the online help for detailed descriptions of the Re Analysis process 236 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Fragment Analysis Module Using Fragment Lists 6 7 Using Fragment Lists The Fragment List window allows you to view and modify the results of the fragment data identified in the Study You may perform a third level of filtering on this fragment list by applying additional exclusion filters Acces
37. Sequence Analysis Module Description Magnifies a specific area of data in the display Moves analyzed data in the X and Y direction Visually align bases and peaks in the analyzed data pane Insert change and or delete bases Undoes one zoom level Undoes all zoom levels scales data to the confines of the pane If autoscaling is disabled the system scales the data to their true values Use this item to turn autoscaling on or off Sets the space between base sequence text in groups of 0 3 5 or 10 With both the analyzed data and base sequence panes open synchronizes the analyzed data display with the highlighted base sequence text showing the corresponding peak or peaks between two hairlines for the selected base Toggles the base sequence text between displaying on the top or bottom in the analyzed data pane selects an analyzed data set to compare to the current analyzed data set GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Sequence Analysis Sequence Analysis Module Overview Table 4 5 Tools Menu Sequence Analysis Module Option Description Compare Synch synchronizes scaling zooming and panning of two analyzed data sets while in the Compare mode Align Compare Aligns selected points of each of the displayed analyzed data sets while in the Views Compare mode Display Options Opens the Display Options dialog box which provides tabs used to modify any or all of the fo
38. Sequence Tesk C 3 6Dn3012z25z Faska Ej Sequence Test F03 0603012257 fF es Sequence Tesk CO4 O6030200L2 fasta E Sequence Tesk F 4 O6030200L2 f Save as lupe FASTA FASTA and QUAL fasta Cancel File name Figure 4 24 Export Options Editing Bases You can edit bases displayed in the analyzed and bases data panes using the Sequence Analysis module s Tools menu The system identifies edited bases by showing them in lower case letters Inserting Bases in the Analyzed Data Pane To insert bases in the analyzed data pane A A oa Select Tools Edit Click OK Click on an area between two bases The Insert Base dialog box opens Select the desired base GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC 143 Sequence Analysis Using the Sequence Analysis Module 144 The screen inserts the base as a lower case letter in both the analyzed data and the base sequence panes Inserting Bases in the Base Sequence Pane To insert bases in the base sequence pane l Select Tools Edit 2 Place the mouse cursor between the two bases where you want to insert the base 3 Type in the new base The screen inserts the base as a lower case letter in both the analyzed data and the base sequence panes Changing Bases in the Analyzed Data Pane To change bases in the analyzed data pane 1 Select Tools Edit 2 Click on a base in the analyzed data pane The C
39. Startup mm GexP Quant Tool Internet Explorer mw msn ab Mobepen H Outlook Express Remote Assistance i Windows Media Player 2 Windows Messenger A Windows Movie Maker Pl Log OFF o Turn OFF computer e CUCEQ SystemiRepa Main Menu Version All Programs Figure 7 35 Launching the GeXP Quant Tool GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 305 PN B40154AC Gene Expression GeXP Quant Tool Once launched the main GeXP Quant Tool window similar to the one shown in Figure 7 36 below will be displayed E GeXP Quant Tool File Wormalize Analyze Help ww Files Standards file Samples file Processing Status Number of Genes 0 Number of Normalization Genes 0 Status Ready Figure 7 36 Main GeXP Quant Tool Window Performing Quantitative Analysis with GeXP Quant Tool Perform the following steps l From the File menu select Open Standards to select and import Standard curve data for analysis Refer to Figure 7 37 E GeXP Quant Tool Normalize Analyze Help J Open Standards Samples file Processing Status Number of Genes 0 Number of Normalization Genes 0 Status Ready Figure 7 37 Selecting Open Standards 306 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Gene Expression GeXP Quant Tool 2 Click on Open Samples to select and import an experi
40. Toggles base numbering off or on Toggles codon numbering off or on Toggles between showing and hiding the sequences Toggles between showing and hiding the reference amino acid translation Toggles between showing and hiding the consensus amino acid translation Toggles the sequence differences off or on Toggles color used for text and background Displays the active database GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 175 Sequence Investigator Module Sequence Investigator Module Overview Window Menu Click the Window menu to display its drop down menu as shown in the following example Window Cascade Tile Horizontally Tile Vertically Close All Arrange Icons w 1 lt Untitled gt Use the Window menu to display data as desired The following table describes the Sequence Investigator module s Window menu options Table 5 5 Window Menu Sequence Investigator Module Option Description Cascade Cascades the open windows Tile Horizontally Tiles the windows in a horizontal orientation Tile Vertically Tiles the windows in a vertical orientation Close All Closes all open windows Arrange Icons Arranges all icons on the desktop Open file list Displays a list of all open documents Help Menu Click the Help menu to display its drop down menu as shown in the following example Help Help Topics Using Help About GenomeLab System Beckman Coulter
41. calls attention to important information to read or is accompanied by another symbol indicating a particular safety hazard The information is located either on the label with the symbol or in the GeXP documentation BIOHAZARD Paragraphs marked by this symbol indicate that a potential hazard to your personal safety exists from a biological source 456162 B IVD This label indicates an In Vitro diagnostic medical device LASER LIGHT Paragraphs marked by this symbol indicate that a potential hazard to your personal safety exists from a laser source SHARP OBJECTS Paragraphs marked by this symbol indicate that a potential hazard to your personal safety exists from unblunted corners or other appendages on the outside or inside of the equipment HOT SURFACE Paragraphs marked by this symbol indicate that a potential hazard to your personal safety exists from heated surfaces or other appendages on the outside or inside of the equipment PROTECTIVE EARTH OR GROUND TERMINAL This symbol identifies the location of the protective earth or ground terminal plug on the equipment CAUTION SHARP OBJECTS REFER SERVICING AND MAINTENANCE TO QUALIFIED SERVICE PERSONNEL 456853 AB p vi GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Safety Information OFF POSITION OF PRINCIPAL POWER SWITCH This symbol graphically represents the equipment main power push button switch when
42. click on Select Item under Device System Values to select Left Barcode and Right Barcode from the Available Information List Move them to the Display Information list and then click the OK button Load the sample plates with barcode by using the Direct Control Access Plates function The barcode will be displayed in Run Control Monitor within the Device System Values section Viewing Optical Scan Data To view the optical scan data in either the Sequence Analysis or Fragment Analysis module l Select File Open from the desired analysis module The Open dialog box opens 2 Select the Optical Scan Data tab highlight the desired sample name then click OK 3 Verify that the Optical Scan window is displayed GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 385 PN B40154AC Maintenance and Diagnostics Diagnostics Monitoring the Baseline 386 To ensure that the optics are working correctly and that the capillaries are clean view the baseline after installing a new capillary array filling with gel for the first time or performing an optical alignment The baseline trace should be low and relatively flat NOTE You must perform the optical alignment procedures prior to monitoring the baseline Performing an Optical Alignment on page 358 To monitor the baseline 1 Select Run Monitor Baseline The Monitor Baseline dialog box opens Monitor Baseline Ea Enable Mon
43. complete and any errors that may occur Exclusion Filter Set New Fiezuk Filter Set 3 G10_090223138R GeXP Transfer Status G03 0902231360 308 0902231882 Transfer complete 51D 601_0902231366 A Figure 7 20 Export Completed Successfully D 294 iw Show Excluded If no error observed click the OK button to complete the export process GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Gene Expression GeXP Data Tool 1 6 GeXP Data Tool The GeXP Data Tool is a software application that converts GeXP exported data into a format compatible with the GeXP Quant Tool or Microsoft Excel The GeXP Data Tool replaces the eXpress Profiler software application that was previously used with GenomeLab GeXP Downloading GeXP Data Tool The GeXP Data Tool can be downloaded from the Beckman Coulter web site Perform the following steps l Launch the Internet Explorer browser and go the Beckman Coulter web site The Beckman Coulter web site is http www beckmancoulter com Click on Support and then select Software Downloads Select search by Software Name and then type in GeXP All available software for GeXP will be displayed 4 Select the GeXP Data Tool Click on Download To verify a successful download check the download location to make sure the file is where you intended it to be placed 5 Follow the instructions
44. i5 Sequence Test E03 06042416KS Sequence Test F03_06042416KU Sequence Test G03_06042416K Y Sequence Test HO3_06042416kKx Figure 4 36 Sequence Analysis Batch Processing Reanalyzing a Batch To reanalyze a batch After performing a batch analysis select Analysis Reanalyze Batch 2 Select a new parameter set or edit the currently selected set from the Working Analysis Parameters dialog box to obtain different results 3 Click OK to start the reanalysis NOTE To keep the results from the previous analysis pin the results tab by clicking on the pin icon pz Otherwise the system overwrites the results with any subsequent reanalyses Viewing the Selected Batch Result To view the selected batch result after performing a batch analysis l Click the desired sample in the upper pane of the batch analysis window 2 Select Analysis View Selected Batch Sample Result Skipping the Current Sample Analysis in a Batch To skip the current sample during a batch analysis select Analysis Skip Current Sample Skipping the Current Sample Set Analysis in a Batch To skip the sample set during a batch analysis select Analysis Skip Current Sample Set GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 157 PN B40154AC Sequence Analysis Using the Sequence Analysis Module 158 Skipping the Current Sample Plate Analysis i
45. os NNI E gt Study W Result Set View AFLPs Binnings r Results r Exclusion Filter Set Peak Ratios ult dat analysis New Result Filter Set 2 Apply e res ate nape DATS 93 D4 401_060425122M 04 25 2006 12 59 56 i PCE aoe DATS 94 D4 B01_060425122k 04 25 2006 12 59 50 lt select DATS 96 D4 C01_ 0604251221 04 25 2006 12 59 44 DATS 97 D4 D01_060425122F 1 04 25 2006 12 59 36 DATS 99 D4 E01_060425122C 04 25 2006 12 59 26 DATS 100 D4 F01_0604251229 04 25 2006 12 53 20 DATS 101 D4 G01 0504251226 04 25 2006 12 59 12 DATS 102 D4 HO1_0604251224 04 25 2006 12 53 06 v Show Excluded Analyses Data Reports Ready Figure 6 3 Fragment Analysis New Study Window Performance Safeguards Controller Resources The system checks the available controller resources before it starts processing results If the system determines that the resources needed to complete the analysis are not available it displays a warning message see Figure 6 5 If this occurs close all applications re start the Fragment Analysis module and attempt the analysis again Memory Usage Warning E D The system available memory is getting low IF the next study is likely to contain more than 200 analyzed results then it is recommended to terminate any other applications that are currently running and restart the Fragment Analvsis application Do vou want to continue opening the next study Figure 6 4 Controller Resources Warning 1 98
46. recommended number of days on the instrument has been exceeded Advanced Displays the Capillary Advanced Information dialog box This dialog box displays the length and diameter of the installed capillary array based on the part number entered in the New Capillary Array dialog box The fields are read only and cannot be edited Click OK to enter the information and close the dialog box 4 When finished click OK to close the dialog box 84 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Run Module Using Direct Control Viewing Gel Information l Select Replenish Gel Cartridge Buffer Information from the Run Module menu bar 2 Use the Gel Cartridge Buffer Information dialog box Figure 3 39 to view the following information e Part Number Displays the part number of the installed gel cartridge e Lot Number Displays the lot number of the installed gel cartridge The lot number is used to track the gel lot along with the separations that have used the gel e Gel Name The name of the gel e Date Installed Displays the date the gel cartridge was installed Time Installed Displays the time the gel cartridge was installed Hours on Instrument Displays the number of hours that the gel cartridge has remained on the instrument 3 When finished select OK to close the dialog box Gel Cartridge Buffer Information Gel Part Number 38 138 Lat Number SE0208E68
47. rename database items view properties import export database items and set the working database Table 8 2 File Menu Data Manager Module Option Description New Create a new Project or Standard in a database New Database Create a new database Open Edit Fragment Results Optical Scan Data Sample Data Sequence Results sample Plate Results or Standards Print Prints a report of the selected item Print Setup Define printer properties Print Screen Send an image of the computer desktop or application window to the printer Delete Deletes items projects and databases NOTE The working database cannot be deleted Rename Rename items projects and databases Properties Displays the current database and modification date as well as other sample data collection information concerning the selected item in the same format as Sequence Result Properties See Sequence Result Properties on page 146 Import Import a file in one of the following formats Standard Chromatogram Format v2 10 and v3 00 scf ESD ESD CEQ cq NOTE You must select a project in which to import the items GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 317 PN B40154AC Database Management Data Manager Module Overview 318 Table 8 2 File Menu Data Manager Module Option Export Description Export a file in one of the following formats Standard Chromatogram Format v2 10 and v3 00 scf CE
48. then click Open The desired samples open Displays the Sequence Analysis Parameters saved in the project The sequence Analysis Parameter Set determines the start and end times for the analysis of raw data the threshold above which data are considered peaks the data start criteria the heterozygote detection parameters and the alignment template and parameters You may also edit sequence analysis parameters under the Analysis tab in the Sample Setup module Lists the alignment optical scan data available in the selected project Optical scan data are the result of the two lasers scanning the capillaries to determine the position of the capillary windows where the lasers focus when collecting data If the scan is successful eight peaks appear for each laser denoting that all eight capillary windows were established See Table 4 11 Sample View Toolbar Sequence Analysis Module for more information on the Sample View Toolbar descriptions GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 123 PN B40154AC Sequence Analysis Using the Sequence Analysis Module 124 Editing Sequence Analysis Parameters The Sequence Analysis Parameters Editor dialog box consists of six tabs General Initial Data Detection Heterozygote Detection Quality based Trimming Sequence based Trimming and Alignment Reference To edit the Sequence Analysis Parameters l Select Analysis Working Analysis Parameters to open the Work
49. users or Built in security principale Object Types From this locations JEC WINXP TEST Locations Enter the object names to select examples Check Mames EL w IMEP TESTATestLlserl Figure 8 13 Select Users to the New Group OF Cancel E 336 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Database Management Data Manager Procedures 9 Click Create to save the new group New Group E x Group name CEQUSERS Description P Members TestU ser Renove Figure 8 14 New Group Dialog Box Activating the CEQUSERS Group After creating the CEQUSERS group and adding users to the group you must activate the group within the Data Manager module This is done only once and users can be added removed at any time thereafter To activate the CEQUSERS group 1 Open the Data Manager module 2 Select Tools Administrative Tools Add CeqUsers Group to SQL Login All users added to the group CEQUSERS now have access to the database GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 337 PN B40154AC Database Management Data Manager Procedures 338 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Maintenance and Diagnostics Routine Maintenance Maintenance and Diagnostics This chapter provides routine maintenance replenishment and biological waste disposal
50. 06 3 53 08AM mpe Test FOS Denn 2967 Sequence Test E05 03 0206 03 53 134M Sequence Test G03 060301 2257 Sequence Test FOS 03 02 06 03 52 794M Sequence Test HOF 0603012757 Sequence Test 03 02 06 03 53 244M Sequence TestAQd OB030200L2 Sequence Test H0S 03 02 06 3 53 304M Sequence Test 604 O8030200L7 Sequencing A02 Ob 04 24 05 15 19 30PM Sequence Test C04 O6030200L2 Sequencing 407 Db 04 24 16 15 13 42PM Sequence Test O04 O6030200L2 Sequence Test E04 O6US0200L2 Sequence Test FO4 O6US0200L4 Sequence Test G04 O6030200L2 Sequence Test HU4 O6030200L2 Cancel Help ddi 1 i E pe Project Mame Default Search Load List Save List Figure 4 23 Batch Trimming Result Selection Click OK Verify that the required analysis parameters are selected in the Working Parameters dialog box If not click Use Stored Parameters and select the appropriate analysis parameters 8 Ifnecessary select the Export Results check box M to export the results to files The Edit Export Options button becomes available For details see Export Options on page 143 9 Click OK GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 141 PN B40154AC Sequence Analysis Using the Sequence Analysis Module 142 Trimming Report Exporting results creates a Trimming Report which you can view and print To view the Trimming Report select View Trimming Report The new pane opens at the b
51. 259 19 278 37 a n 22 53 h 1 149 43 159 22 171 49 135 65 200 1 2128 2 932 N 231 98 npe 276 29 30440 31304 ww h Fog Ai a 1708s j wess j TL pa NN J TP 28h02 27534 28914 1 7 I 3 annie cL AL d L4 Pun Speeches Se E eU hel Vel VU kt VL p id usu ia Poo bp LULA LU 150 175 200 225 250 275 300 325 Size nt Figure 7 2 All gene peaks in the multiplex in zoomed in view 6 Click on Raw Data tab review the raw data trace to ensure there is no separation anomalies such as split peaks or poor resolution 7 Click on the Current tab to review the separation current trace If there is current dip or crash present this data file should be excluded form further analysis 8 Click on Inject Current to review the injection current trace The injection current values should be in the range of 1 to 5 microA Some fluctuation is normal 9 Remove data files that are unsuitable for the study Refer to Figure 7 3 Data files can be removed by right clicking on the specific file and then clicking on Exclude Results Data files contain the following situations should be removed a Over range peaks that are split into two called peaks b Data with abnormal current c Data with separation anomalies such as split peaks or poor resolution of fragments d Negative controls NTC and RTminus 280 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B401
52. 34 Selecting Non Contiguous Cells 1 Click the first cell 2 Use the Ctrl Click function to select each additional cell PITT LEE SEE roo1a02 0 r802403 793404 Ercccanenonconenoonennencnocneenoonosieienenonenmiesoenoneonenoeeencenciesenian r2glBO1 ri g2602 rBg3BO4 Peenrssresessrusssazrsunusuususseushocnsscuosnssssusuusussasusesensoocuusoe Rresnnssosnnosenususuussenscosnssosuuoss r3 qi r2 g2 C02 r1 a3 cu3 r g1DO1 r3g2D02 SPPE rt g4 D04 TII M nitpLLLILLILLLDR DD D DD PPP Figure 2 11 Selecting Non contiguous Cells Viewing a Sample Plate by Sample Name Subject ID Use the View View by Subject ID option to toggle the sample plate view between Sample Name and Subject ID This works in conjunction with the options found next to the Sample Name and Subject ID fields as shown in the following example View wv Toolbar w Status Bar w Cell Coordinates Sample Property Sets Summary View by Subject ID Working Database g Sample Mame Ii Subiect ID 7 Figure 2 12 View by Subject ID Sample Name Toggle GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Sample Setup Module Using the Sample Setup Module Naming Samples and Assigning Subject IDs The sample plate window appends the plate location to each Sample Name entered in a sample cell For example enter MySample as the name of the cell at position A
53. 9 Wildcard Characters Wildcard Description The asterisk specifies to search for any letters before or after the entered text The question mark represents any single letter The exclamation point within brackets makes the query negative Enter the letter following the within the brackets if you want the system to find anything that is not the entered text For example entering A finds any string that does not start with A NOTE The system supports the following wildcard combinations and The system does not support the combination 3 Click Find Next to find the next occurrence of the entered text Search for and Replacing Text in the Sample Plate l 2 Select Edit Replace Use the Replace options to specify your search and replace settings Enter the desired text in the Find what text field Select the Match whole word only check box MI to locate text that is flanked by spaces If Match whole word only is not selected the system will find the text even if it is part of another word Select the Match case check box M to find the entered text exactly the way you type it into the field If you do not select Match case the system finds all occurrences of the text regardless of case GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Sample Setup Module Using the Sample Setup Module e Select the Use wildcards c
54. ANC RETIRER DETERIUS 114 4 2 Using the Sequence Analysis Module 0 0 0 122 Viewing sample Dali ererat starting wearer acest arg whale hint UR CERE Ben ratae de un eee 122 Editing Sequence Analysis Parameters 0 00 00 ccc cece eee een 124 Performing Quality based Trimming 0 0 0 ccc cece eee IR 135 Performing Sequence based Trimming 0 0 0 0 eee eee 137 EANO Ba o aae bios occa but ele crise udi em eae eee iot etm E an 143 sequence Result Properties iisllessee eee 146 setting or Changing Display Options 0 0 0 0 0c RR RR 153 Ghanging Display COS e sepeiidsr p pReR T EPELIM NE DReREeba wi reu ness 155 sme sisi H EERERDTEmM 156 Performing a Batch ANASI S oe drei una vara dre i ee he ote arce sete ne er cen rare 156 USN Compare MOG eerren og tt aces reaps theca ee RE ane bed nbn ed Gee ett nae eee 158 Sequence Result Report usa utto x acted oeeskedeedal RER Geek Meiee dat acdeeea sew 159 xii GenomeLab Genetic Analysis System User s Guide For In Vitro Diagnostic Use PN B40154AC Section 5 Sequence Investigator Module 171 5 1 Sequence Investigator Module Overview issssess RR 171 MATANA OWN NOR TEETH CETERIS 171 Menu Bar ODHOFS cuore Io cided edu e E bedebindeeixbeiMenueedd Snuid 173 deserto RE TI TE LUE ee Re Ere Te eC a 177 5 2 Sequence Investigator Procedures iiissesee eR 179 Cheating a Reference ple ss oec tr obe a bre on wate acne ela ena
55. Analysis Using the Sequence Analysis Module 134 Contaminant trimming can be based on any combination of the following e Vector sequences such as plasmid BAC PAC and cosmids e Primer sequences e Restriction enzyme sites NOTE If you opened this dialog box by selecting View Parameters Used to Compute Sequence this dialog box displays the analysis values but disables the fields described below The following table describes the options available on the Sequence Analysis Parameters Sequence based Trimming tab Table 4 24 Sequence based Trimming Tab Option Perform Sequence based Trimming Vector Other Sequence Files Max of Vector Other Sequences Min Substring Length Distance from End Enable Internal Matches Description Select this check box 1 to enable sequence based trimming e Click i i to select a reference sequence It must be in the fasta format and stored in an accessible folder e Click X to remove a previously selected reference sequence NOTE There is no practical limit on the number of fasta reference sequences used however larger files greater than 200 Kbase increase processing time set the number of sequences to appear in the result This number is determined by the goodness of alignment by scoring the found subsequences and displaying only the top number selected The trimming log details all vectors other sequences found regardless of the score Set the minimum
56. Array life exceeded Direct Control stage Load Gel Cartridge starts Capillary Array life exceeded y Direct Control stage Load Capillaries starts Direct Control stage Detecting Array starts Sample Plate Default5 amplePlate begins Estimated sample plate end time 10 12 01 16 22 21 Begin Sample Set Startup Sample Set DefaultStartupM ethad begins Method stage Purge Manifold starts Method stage Fill Capillaries starts Sample Set DefaultStartupMethod ends Begin Sample Set 1 Sample Set LFH 1 begins Method stage Temperature Ramping starts Method stage Temperature Ramping starts Method stage Denature Sample starts Current capillary temperature is 34 degree C Method stage Optical Alignment starts Method stage Optical Alignment starts Method stage Sample Set Pause starts Method stage Inject Sample starts Scan Data MySample A01 01101212N5 stored Method stage Separate starts Figure 3 12 Log Window Run Module Table 3 17 Log Window Run Module ltem Description Window Selection Tab Select this tab to access the Log window Freeze Log Freezes the display in the Log window Freezing the log data does not Stop the collection of data just the display of data Display Area Provides the list of logged events GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC 65 Run Module Run Module Overview Instrument Data Window View th
57. BAK Save as type Database Backup Files bak Cancel Figure 8 6 Backup Database Dialog Box E 326 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Database Management Data Manager Procedures 6 Accept the file name or rename it as necessary NOTE Since databases are backed up frequently you might want to add the date as part of the name to prevent overwriting valuable backups and to ensure accurate database recovery 7 Click Save Restoring the Database Recover a database that was previously saved using the backup procedure WARNING If you are restoring a database that has the same name as one already residing in the Database Manager you must either restore it with a new name or delete the existing database before restoring It THIS Option IS NOT Recommended 1 Open Data Manager 2 Select Tools Restore Database 3 Browse to the location on the local disk where the backup file was saved Restore Database iE XI Look in G D base t t CEQ 2006 4 29 BAK Filename CEQ 2006 4 29 BAK Files of type Database Backup Files bak Cancel Database To Restore CE HU 2005 4 23 Figure 8 7 Restore Database Dialog Box 4 Select and highlight the file to restore and click Restore NOTE If a database with the same name exists a warning will appear Figure 8 8 Data Manager Ea Database To Restore name already exists Please enter 4 new da
58. Barcode field Select File Save As Enter a name for the sample plate Select the project you just created from the Project Name drop down menu and click OK GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 15 PN B40154AC Getting Started Operating the System 16 Running a Sample Starting the Run Module From the Main Menu click the Run icon r and verify that the Run window is displayed Checking the Capillary Array Check the capillary life and usage on the life tab and if necessary perform the procedure Removing and Replacing the Capillary Array on page 360 and then return here Installing a Gel Cartridge Check the gel life and usage on the life tab and if necessary perform the procedure Removing and Replacing a Gel Cartridge Gel Pump Plug For Dual Rail System on page 367 and then return here Installing the Gel Waste Bottle If necessary perform the procedure Replacing the Gel Waste Bottle For Dual Rail System on page 345 and then return here Preparing Plates for a Run l Load samples into the sample plate and cover with mineral oil 2 Load buffer 250 300 pL into the buffer plate 3 Fill the wetting tray with D I water to the level indicator marker IMPORTANT No more than one 96 well plate should be processed for each wetting tray without replenishing the wetting tray NOTE Periodically check the liquid level in the wetting tray CAUTION NEVER allow the liquid le
59. Control and Replenishment 0 000000 ccc nn RR 349 Accessing the Direct Control Window 0 0 0 0 ccc eee ees 349 Loading the Sample Plate and Buffer Plate For Dual Rail System 390 Loading the Sample Plate and Buffer Plate For Single Rail System 004 393 specifying Capillary Temperature 0 0 een 356 Denaturmu gSalrplez ice cane ott reip EI awe am ae nwa tae a ei 356 CC UIMG cay ANI D Cie tera vases anes ratur unio ae sane ho SA eee eee 356 Performing a Separation eene eost a dale ate acme RORGCESCEG Amie ae ade ae CER YR ER dae A cen 357 Replenishing the Capillaries with Gel sss RR RR 357 PUGIN Hie MANNO ocior do oet En EE Pet Bare EEEE ah N 390 Performing an Optical Alignment slsessseee RR eee ees 358 Viewing Capillary Information 0 0 0 0 n 358 Viewing Gel Information 0 0 0 0 ccc RRRRRRRRRRRRRRRRRRRRRRIRRR I 360 Viewing or Changing Buffer Information lisse RR 360 Removing and Replacing the Capillary Array lisse RRRIR 360 Removing and Replacing a Gel Cartridge Gel Pump Plug For Dual Rail System 367 Removing and Replacing a Gel Cartridge Gel Pump Plug For Single Rail System 371 Removing the Manifold Plug 0 0 ccc eee ees 3 74 9 3 Biological Waste Disposal ssssesseen RR RRhsRRVMMRRRRRRRRRRRRRIRRRI 3 6 Disposal of Formamide from the Sample Plate 0 0 0 3 6 Disposal of Buffer Gel
60. DEFAULT GeXP ANALYSIS PARAMETERS Used for the Gene Expression application e DEFAULT SNP ANALYSIS PARAMETERS Used for the SNP application Selecting a Saved Analysis Parameter Set In the Select Analysis Parameter Set area of the window select the parameter set from the drop down list The Parameter Set Summary area of the window displays summary information about the selected analysis parameter set These include Date and time the analysis parameter set was created or last modified e Selected size calibration standard calibration curve and optional dye mobility correction e Currently assigned locus tags that have been selected for this Study Click Next to proceed to the Analyze Data window NOTE f the available parameter sets do not apply to your Study you can create a new set of analysis parameters or edit an existing set to meet the requirements of your Study Refer to Defining Fragment Analysis Parameters on page 206 or the online help for more information Analyzing the Data With the new data selected and the analysis method defined the third step in creating the Study is to analyze the data The Analyze Data window displays all samples selected for analysis the date each was collected the status unanalyzed of each sample and the parameter set being applied to the Study see Figures 6 10 e To begin the analysis click Analyze As the system proceeds with the analysis the progress bar becomes active and the
61. DNA section is composed of the base call always lower case PHRED Quality Value and the Peak Index data point of the analyzed data contained within the associated SCF file Values are separated by spaces GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Database Management Data Manager Procedures Table 8 9 Data Manager Export Options Format Description ESD esd The ESD electropherogram sample data format exports raw data from the CE system to a third party software package for analysis This option exports only raw data and does not include any other information SEQ seq The SEQ format only applies to the sequence results portion such as text bases of analyzed data You would use this format for instance to export data into Lasergene s SeqMan from DNASTAR Inc FASTA fasta The FASTA format only applies to the sequence results portion such as text bases of analyzed data and contains a comment line that is used to identify the data Along with the text file a quality values file is also generated FASTA QUAL which lists the quality value for each base Quality values correspond to 10 logtO error rate The range for the quality values is 1 to 99 Edited and inserted bases have a value of 99 You would use this format for instance to export data into PHRAP For instance in PHRED a quality value of 10 means 1 error in 10 A quality value of 20 means an error rate of 1 err
62. Data Manager Tab Delimited Text txt The Tab delimited format is valid for raw data sequence results and fragment results Select the Raw Data check box 11 to include raw data as well as current and voltage data Select the Results Data and Results Output check boxes MJ to include the sequence results The data points are expressed as text values which can be viewed in any text editor or in Excel SEQ seq The Seq format only applies to the sequence results portion such as text bases of analyzed sequence data This format is used for instance to export data into Lasergene s SegMan from DNASTAR Inc Selecting the SEQ format exports the Result Output Base Sequence automatically if the sample has been analyzed with a sequence analysis parameter set If the sample has been analyzed with a fragment analysis parameter set nothing is exported GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 167 PN B40154AC Sequence Analysis Using the Sequence Analysis Module Table 4 29 Sequence Export Options Option FASTA fasta PHRED scf phd 1 ESD esd 168 Description The FASTA format only applies to the sequence results portion such as text bases of analyzed data and contains a comment line that is used to identify the data Along with the text file a quality values file is also generated FASTA QUAL which lists the quality value for each base Quality values correspond to 10 log10
63. Data Manager Module Overview Table 8 8 Toolbar Data Manager Module Description Icon x Delete Deletes selected items projects and databases Properties Displays the current database and modification date and other information concerning the selected data file Restore Restores the database with the backup Ei lel Backup Database Creates a backup of the database Help Topics Displays the CE Instrument System Help By default the help system displays the Contents in the navigation pane located on the left and the introductory topic in the topic pane located on the right You can use the Contents to select and print specific topics in CE Instrument System Help The navigation pane also provides a Search tab and an Index tab These tabs let you search for information by topic index entry and or keyword Context Sensitive Help Click this icon and then on a menu item to open the Help file related to the selection 322 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Database Management Data Manager Procedures 8 2 Data Manager Procedures Storing Methods and Parameters The USERTEMPLATE database stores newly created methods and parameters This database is added when the during software installation These methods and parameters are then included in all subsequently created databases Use the Cut Copy and Paste functions to add methods and parameters to the
64. Diagnostic Use PN B40154AC Database Management Data Manager Module Overview Database Management 315 Database Management Data Manager Module Overview Main Window The main window of the Data Manager module is shown in Figure 8 1 and described in Table 8 1 Data File Edit View Tools Window Help Manager BEIE amp n e sele amp E Q GENOMELAB DBASE IN Ready E T Default E CEQBAK1 E CEQBAK2 D1151984 D145599 D151679 D225683 D352387 0952157 D95938 Default DXS7132 GATA193AD7 Test project USERTEMPLATE D Os g D D D Os Os Os C E E Name _ Type Modifie Project me f o o oe 1 10 10 10 10 10 10 10 10 10 11 11 11 11 11 11 11 11 11 12 12 12 12 1 Figure 8 1 Main Window Data Manager Module D1181984 0 1pmol D D1181984 0 1pmol D 0225683 0 1pmol AD D38238 0 25pmol A 0952157 0 1pmol AD D95938 0 2pmol 0 2 DXS7132 2pmol AD3 GATA193AD7 0 25pm 1 D151679 at D 25pmol AD 1 pull 0 25 primer 9 599 D1151984 0 1pmol D225683 0 1pmol B D3S238 0 25pmol D982157 0 1pmol B D95938 0 2pmol D DXS7132 2pmol B04 GATA193AD 0 25p D151679 at 0 25pmol B pull 0 25 primer 9 589 D1181984 0 1pmol D225583 0 1pmol C D38238 0 25pmol 0952157 0 1pmol C
65. Display Options dialog box X Axis Options Tab Define the X Axis properties of the displayed data panels l Inthe Display Options dialog box select the X Axis Options tab 2 Change any item as necessary 3 Click Apply to continue or OK to close the Display Options dialog box Y Axis Options Tab Define the Y Axis properties of the displayed data panels l Inthe Display Options dialog box select the Y Axis Options tab 2 Change any item as necessary 3 Click Apply to continue or OK to close the Display Options dialog box Colors Tab Define the color options of the window the current traces the voltage trace or the optical scan trace l Inthe Display Options dialog box select the Colors tab 2 Change any item as desired 3 Click Apply to continue or OK to close the Display Options dialog box Dye Traces Tab Set or change the dye trace properties l Inthe Display Options dialog box select the Dye Traces tab 2 Select the traces to display or not display under Show Dye Traces 74 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Run Module Using the Run Module 3 To change a color of any dye trace click on the appropriate Dye Colors dye select a color from the Color dialog box then click OK 4 When finished with Dye Traces click Apply to continue or OK to close the Display Options dialog box Current Trace Tab Set or change the current trace options
66. Edge Free vT and or Right Edge Free 1 e o specify a minimum length for detected substrings enter the number of bases needed to constitute a substring in the Minimum substring length text box The range is 5 to 2000 The default value is 30 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 131 PN B40154AC Sequence Analysis Using the Sequence Analysis Module Quality based Trimming Tab Use quality based trimming to trim poor quality data from the ends of the sequence The resulting base sequence and trace views display the base letters of the poor quality data as strike through Sequence Analysis Parameters Editor DefaultSequenceAnalysisPar Fa General Initial Data Detection Heterozygote Detection Quality based Trimming Sequence based Trimming Alignment Reference Ends To Be Trimmed None BothEnds C Left 5 End Right 3 End PODEGOGOGORER Trimming Stringency Low Medium Save As Prnt Cancel Help Figure 4 15 Quality based Trimming Tab The following table describes the options available on the Sequence Analysis Parameters Quality based Trimming tab Table 4 23 Quality based Trimming Tab Option Description Ends To Be Trimmed Click the radio button to select the ends to be trimmed e Select Both Ends to trim outside the 5 and 3 coding region e Select Left 5 End to trim to the left of the 5 end e Select Right 3 End to
67. Fragment Analysis module s Window menu options Table 6 8 Window Menu Fragment Analysis Module Option Description Cascade Cascades the open windows Tile Horizontally Tiles the windows in a horizontal orientation Tile Vertically Tiles the windows in a vertical orientation Close All Closes all currently active windows Arrange Icons Automatically arranges the icons v1 Brings the selected window 1 to the foreground Help Menu Click the Help menu to display its drop down menu as shown in the following example Help Help Topics Using Help About Genomelab System Beckman Coulter Home Page GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 195 PN B40154AC Fragment Analysis Module Fragment Analysis Module Overview The following table describes the Help menu options Table 6 9 Help Menu Fragment Analysis Module Option Description Help Topics select this option to display the CE system online help By default the help system displays the Contents in the navigation pane located on the left and the introductory topic in the topic pane located on the right You can use the Contents to select and print specific help topics The navigation pane also provides a Search tab and an Index tab These tabs let you search for information by topic index entry and or keyword Using Help select this option to display the Contents window on how to use the Windows Help system Abou
68. Grasp the Manifold Plug tab Figure 9 48 and then a Pull the plug approximately one inch out of the manifold b Touch the tip of the plug to the bottom of the Optics Base Plate c Hold and wait five seconds for the gel strand to dry d Pull the plug out and set it aside for future use e Wipe gel strands off of the instrument using a damp tissue 901597L Al Figure 9 48 Removing the Manifold Plug 1 Guide Pins 4 Gel Strand 2 Eject Lever 5 Optics Base Plate 3 Array Fitting 6 Array Fitting 9 Click OK on the Remove Manifold Plug dialog box 10 To install the capillary array see Removing and Replacing the Capillary Array on page 360 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 375 PN B40154AC Maintenance and Diagnostics Biological Waste Disposal 9 3 Biological Waste Disposal WARNING The GenomeLab Genetic Analysis system has been designed to minimize exposure to hazardous chemicals and biological waste However care must still be exercised when removing used chemicals and biological samples from the instrument The information below provides the minimum protocols to use when handling hazardous chemicals and biological waste Disposal of Formamide from the Sample Plate Multi Channel Pipettor Table 9 3 1 WARNING When performing this procedure use an exhaust ventilation unit that meets TLV requirements Aspirate 40 pL of formamide from the thermo cyclin
69. Guide For n Vitro Diagnostic Use PN B40154AC Run Module Run Module Overview Run Menu Click the Run menu to display its drop down menu as shown in the following example Run Start Sample Plate Pause Pause to load Stop System Monitor Baseline Diagnostics Reset The following table describes the Run module s Run menu options Table 3 6 Run Menu Option Description Start Sample Plate Opens the Sample Plate Run Confirmation dialog box Pause Pauses a running sample plate Pause to Load Load a second plate while a plate is running For details see Pause to Load on page 71 stop System Stop a running sample plate or direct control process For details see Stopping a Sample Plate Run on page 72 Monitor Baseline oet the desired parameters For details see Monitoring the Baseline on page 306 Diagnostics View the instrument version laser power PC Settings monitor status and to home the plates and or the gel pump For details see Diagnostics on page 385 Reset Re synchronizes system hardware with the firmware and to reset the system log GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 53 PN B40154AC Run Module Run Module Overview 94 Log Options Menu Click the Log Options menu to display its drop down menu as shown in the following example Log Options Errors Only w All Detail Sample Plate only Freeze Lag NOTE A 7 next to an
70. Guide For n Vitro Diagnostic Use PN B40154AC Sequence Analysis Sequence Analysis Module Overview Window Menu Click the Window menu to display its drop down menu as shown in the following example Window Cascade Tile Horizontally Tile Vertically Close All Arrange Icons 1 row 402 Sn32908PE wf 2 fowl 401 D5032907Ml 3 results Az The following table describes the Sequence Analysis module s Window menu options Table 4 7 Window Menu Sequence Analysis Module Option Description Cascade Cascades the open windows Tile Horizontally Tiles the windows in a horizontal orientation Tile Vertically Tiles the windows in a vertical orientation Close All Closes any currently active windows Arrange Icons Automatically arranges the icons Help Menu Click the Help menu to display its drop down menu as shown in the following example Help Help Topics Using Help About Genomelab System Beckman Coulter Home Page The following table describes the Help menu options Table 4 8 Help Menu Sequence Analysis Module Option Description Help Topics select this option to display the CE system online help By default the help system displays the Contents in the navigation pane located on the left and the introductory topic in the topic pane located on the right You can use the Contents to select and print specific help topics The navigation pane also provides a Search tab and an Index tab These tabs
71. Guide For n Vitro Diagnostic Use 103 PN B40154AC Sequence Analysis Sequence Analysis Module Overview gt Sequence Analysis Sequencing A01_06037313BS imd xi File Edit View Tools Analysis Window Help a alel alale siTe ACG 11i Sequencing A01_06032313BS ig Sequencing A01 06042415BP 2191 87 3 87 Analyzed Data 1 GGC CAG TGC CAA GCT TGC ATG CCT GTC AGG TCG ACT CTA GAG GAT CCC CGG GTA CCG AGC TCG AAT TCG TAA TCA 76 TGT CAT AGC TGT TTC CTG TGT GAA ATT GTI ATC CGC TCA CAA TTC CAC ACA ACA TAC GAG CCG GAA GCA TAA AGT 151 GTA AAG CCT GGG GTG CCT AAT GAG TGA GCT AAC TCA CAT TAA TTG CGT TGC GCT CAC TGC CCG CTT TCC AGT CGG AGC TGC ATT AAT GAA TCG GCC AAC GCG CGG GGA GAG GCG GTT TGC GTA TTG GGC GCT CTT G CTG ACT CGC TGC GCT CGG TCG TTC GGC TGC GGC GAG CGG TAT CAG CTC ACT CAA AGG CGG amen CAG AAT CAG GGG ATA ACG CAG GAA AGA ACA TGT GAG CAA AAG GCC AGC AAA AGG CCA GGA TEE TERCET TT TCC ATA 26S Wy OBS REN HT MR hel Re ied eal Ba AC AGC 2B aes 2 A TE A IT x 4E M a gt Plate U33 001 Test 030106_0603012 Sampe i stst lt is sSCS Reut i pats Pointe Befresh Export Help E GCA TGC CTG CAG GTC GAC TCT AGA GGA TCC CCG GGT ACC GAG CTC GAA TTC GTA ATC ATG 76 TCA TAG CTG TTT CCT GTG TGA AAT TGT TAT CCG CTC ACA ATT CCA CAC AAC ATA CGA GCC GGA AGC ATA AAG TGT 151 AAA GCC TGG GGT GCC TAA TGA GTG AGC TAA CTC ACA TTA ATT GCG TTG CGC TCA CTG CCC GCT TTC CAG TCG
72. Guide For n Vitro Diagnostic Use 211 PN B40154AC Gene Expression Gene Expression Overview Multiplex Design eT gt Chemistry Design Custom Multiplexes GenomeLab CT 4 RNA RT PCR Analyze Raw Data l GenomeLab GeXP Review Data in Result Set View Dilute and Prepare Samples Set up and Apply Locus Tag and Allele IDs Load onto GeXP J l Set up and Apply Exclusion Filters in Perform Capillary Electrophoresis Fragment List i Export GeXP Data NS Further Data Analysis Recommended J Use 3rd Party Analysis Software Tools such as Microsoft Excel i Perform Normalization against Reference Gene s GeXP Data Tool Select Open and Choose Data File M l Calculate Fold Change Perform Normalization against Kan r i Export Data as a txt File bij Further Data Analysis Recommended J nu Use 3rd Party Analysis Software Tools such as Microsoft Excel i GeXP Quant Tool Analysis Import Standard Curve File i Import Experimental Samples File l Choose Reference Gene s i Perform Normalization against Reference Gene s i Calculate Fold Change Run Quantative Analysis i Review Excel File for Out of Range Data and Normalized Gene Expression Values GEQ Normalized i Calculate Fold Change between Samples with the GEQ Normalized Values The PCR process is covered by patents owned by Roche Molecular Systems Inc and E Hoffman La Roche Ltd
73. Label Optional The Primer Label area of the window allows you to indicate for supplementary reporting purposes on which strand the primer is labeled with the dye You may choose one of these options e Forward Select this option if the primer is dye labeled on the forward strand e Reverse Select this option if the primer is dye labeled on the reverse strand e None Select this option if you do not want to indicate which strand the primer is dye labeled GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 219 PN B40154AC Fragment Analysis Module Using the STR Locus Tag Editor 220 Primer Sequence Optional The Primer Sequence area of the window allows you to indicate for supplementary reporting purposes the specific sequence of the primer used This can be up to 128 characters Forward If you labeled the primer on the forward strand enter the sequence of the primer in the 5 to 3 direction Reverse If you labeled the primer on the reverse strand enter the sequence of the primer in the 5 to 3 direction Generating an Allele List After setting the locus values click Generate Allele List to begin creating the allele list The system generates an allele list from the information provided The allele list starts at the low end of the fragment length range It creates an allele at each perfect repeat length until it reaches the end of the fragment length range The Allele List defines ea
74. Lancel E Please check the waste bottle ta Help ensure that the bottle will not overflow inv future runs Figure 3 50 Remove Gel Cartridge Dialog Box 11 If Install Plug was selected in step 10 proceed to step 12 If Install Cartridge was selected in step 10 use the Install Gel Cartridge dialog box Figure 3 51 to enter the following information a If you are installing a new gel cartridge click New The system will automatically update the date and time installed and set the Hours on Instrument to 0 b Next enter the lot number c If you are installing a used Gel Cartridge select Used e If you are installing the previous used gel cartridge do not change the lot number or the hours on the instrument as they will be correct e If you are installing a previously used gel cartridge but it was not the last one on the instrument enter its part number and or lot number and adjust the hours to properly reflect the hours this cartridge has been on the instrument d Click Done on the Install Gel Cartridge dialog NOTE Always note the lot number and the hours on the instrument for a gel cartridge if you are planning to use it for more than one session The lot number is an alphanumeric text box for your own identification purposes Install Gel Cartridge Gel Cartridge Part Number 331438 m LPa 04 27 2006 17 15 00 Lot Number Gel N ame Date Installed Time Installed C New Used
75. Mixture from the Buffer Plate 3 1 Disposal of the Capillary Array isslsse RR RRRRRRRRRRRRR RII 378 Disposal of the Gel Garteldi6 s sueco recette rm PER dea eee Lacktlaa E Ram deo Sk elena 378 Disposal of D I Water Gel Mixture from the Wetting Tray 0 0 0 378 Disposal of the Gel Waste Bottle 00 0 0 een 379 9 4 Consumable Items List ionic bs vac dodi herd Gata aed SRRR OL Gaabe rd Rc et Sees 300 SAD OSUCS ws nai oct eels shank acide ek eR E E EEE T EA E A EE E 385 Re Initializing the System 1 RR RRRRRRRRRRRRRRRRRIRRIRSR II 385 Homing the Plates and or Gel Pump iissssssss RR een 385 VIGWING PO OCHO S ive ere Sites we oe whe ated etude bed wee aise adie rb uade 385 Viewing Instrument Status scc Rs pede ence Rhe Behan hee e wee ea aoa Sk eae ees 385 Viewing Optical Scan Data 0 ne eee eee eens 385 VIOHMORING tie BaSelllle s ios sweetest asada eae at thru s ac eee sew eee 386 XVI GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Foreword About this Guide Foreword About this Guide This guide is intended for use with the GenomeLab Genetic Analysis System referred to as the CE system in this guide This guide is divided into the following sections Foreword this section describes the purpose of this guide provides a list of its contents discusses the use of the notes used in the document tells how to get online Help and provides
76. Options Option Description Header Contains summary information for the sample such as sample name position the method under which it was run the sample plate name the analysis parameter set name and capillary serial number In addition the sample note property set and consumables information associated with the sample will be printed NOTE This is the same information found on the General Note Property Set and Consumables tabs in the Properties dialog box Raw Data Includes the unanalyzed data from the sample run Result Data Displays data that has undergone final processing to produce result data If the data has been analyzed using a sequence analysis parameter set the data with each peak assigned a base is printed Result Output Displays the final output in text form If the data has been analyzed using a sequence analysis parameter set the called sequence will be printed in text form This section of the report corresponds to the base sequence text Current Includes the trace associated with the current output of each capillary or the total current of the sample set run GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 159 PN B40154AC Sequence Analysis Using the Sequence Analysis Module Table 4 27 Sequence Result Report Options Option Voltage Analysis Log Run Log Method Summary Analysis Parameters Quality Parameters Trimming Log Alignment Results Alignment Accurac
77. ReferencePlex a total of twenty five alleles or gene peaks should be called with the correct allele IDs locus tag and labeled with the correct fragment size 292 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Gene Expression Apply Exclusion Filter and Export Fragment Results 7 9 Apply Exclusion Filter and Export Fragment Results After gene peaks are labeled with locus tag and allele IDs there may be some untagged shoulder peaks or small noise peaks present These untagged peaks can be excluded from further data analysis by applying an exclusion filter in Fragment List view The fragment results can then be exported for downstream gene expression analysis Apply Exclusion Filter Use the following Exclusion Filter in the Study Data Fragments List view to exclude untagged fragments from the sample results Table 7 1 Exclusion Filter Table 1 Allele ID Return to Result Set View to review the analyzed data Export Fragment Results l From the File menu select Transfer Fragments for GeXP to export fragment results Fragment Analysis New Study Result Set View Q File View Results Analysis Reports Window Help O New Study D1 Open Study e Close Study Manage Studies l Save Study Exclusion Filter Set Save Study As result date capillary annyi analysis parameters New Result Fiter Set 3 z c LJ Ad
78. Sample Plate Module Item Description A Title Bar Shows the module name Sample Setup and the active sample plate DefaultSamplePlate Menu Bar See Menu Bar Options on page 24 Toolbar See Toolbar Icons on page 29 Legend Shows the color coding information Saved or Edited of the individual cells mI OO cd W Sample Name and Subject ID of the currently active cell The radio button toggles the sample plate cell labels between Sample Name and Subject ID Use the Barcode field to enter the barcode for the current plate F sample Plate Displays 96 cells that correspond to a 96 well sample plate Sample plate columns are numbered 1 through 12 and Rows are labeled A through H This naming convention uniquely identifies each sample location G Currently active selected method Use this drop down list to select a pre defined method to the corresponding samples in the column above Selecting a method assigns it to all samples in a column sample set e Frag methods are used for all fragment analysis applications other than SNP primer extension e LFR method is used for long fast read sequencing on the 33 cm array e SNP method is used for the SNP primer extension application H e Note tab Displays the Note sub window that can be used to describe or apply a property set to single or multiple samples e Method tab Displays the Method sub window that shows the parameters defined for the selected method and allows you
79. Sequence based Trimming Alignment Reference General Initial Data Detection Heterozugote Detection Threshald m Delay 0 75 min p Signal to Marge zo E Minimum Duration 5 00 E min Save s Print Cancel Help Figure 4 11 Initial Data Detection Tab NOTE If you opened this dialog box by selecting View Parameters Used to Compute Sequence this dialog box displays the analysis values but disables the fields described below NOTE Set the Initial Data Detection parameters based on the sample cleanup method used If the cleanup method leaves large peaks due to unincorporated dye at the beginning of data set the parameters to avoid these blobs This makes it difficult to read to the end of the primer however the basecall accuracy improves since dye peaks do not interfere with early mobility correction If the cleanup method tends to leave dye peaks at the beginning of data set the Threshold to 30 or 35 and set the Delay to 0 75 If there are still fat peaks at the start of analyzed data make this a larger delay NOTE If the cleanup eliminates dye peaks you can read closer to the end of the primer by setting the Threshold to 20 and the Delay to 0 6 126 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Sequence Analysis Using the Sequence Analysis Module The following table describes the options available on the Sequence Analysis Parameters Initial Data Detection
80. Tools Display Options While viewing a graph display of sequence data right click the graph and select Display Options The Display Options screen opens as shown in Figure 4 53 Dye Traces Current Traces Quality Parameters Title Aus Options Y Axis Options Colors Title Property Title Title Color MI Tithe Font Arial Em W Save Customized Setting Save Setting Now Cancel Apply Help Figure 4 33 Display Options Dialog Box 2 Select the tab that identifies the type of display options you want to change For details see the following topics Title Properties Tab on page 154 X Axis Options Tab on page 154 e Y Axis Options Tab on page 154 Colors Tab on page 154 e Dye Traces Tab on page 154 e Current Trace Tab on page 154 NOTE To view detailed descriptions while using this dialog box click Help GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 153 PN B40154AC Sequence Analysis Using the Sequence Analysis Module 154 Title Properties Tab To set or change the title of the displayed data panel l Inthe Display Options dialog box select the Title tab 2 Change any item as necessary 3 Click Apply to continue or OK to close the Display Options dialog box X Axis Options Tab To define the X Axis properties of the displayed data panels l Inthe Display Options dialog box select the X Axis Options tab 2 Change any item as necessa
81. Untreated 30470 600 46521 250 49207 030 42066 290 10131 560 24 085 TNFa Figure 7 23 Opened Input Data File The data tables include the sample name the columns of the values from replicate runs of the samples and the mean standard deviation and 96CV of the data generated from the replicated runs Other characteristics of an opened input data file are as follows e All detected Sample names appear as a row in each Genes table of data even if there were no fragments associated with that Gene in a given sample e If there is no data for a cell in the table that cell will contain ND i e No Data e fno normalization is performed the other values are as exported from GeXP e No user editing of data occurs within the GeXP Data Tool Characteristics of the data tables that are displayed refer to Figure 7 23 are as follows The background color differences of the borders around each genes table of data are to enhance readability It has no other significance e The check box adjacent to the gene name allows collapsing the display of individual Genes table of data The data that is displayed within a data table is associated with initial input data source in the following ways e The data in the summary table is associated with the source Sample and Well When the mouse cursor hovers over a cell with data refer to Figure 7 24 a pop up will occur that provides the following information GenomeLab Genetic Analysis
82. User s Guide For n Vitro Diagnostic Use 293 PN B40154AC Gene Expression Apply Exclusion Filter and Export Fragment Results Exclusion Filter Set 04 75 2014 17 45 05 4 25 2014 17 45 05 04 25 2014 17 45 02 pass bate pass rr rr Locus inio modified Delatge PnalysisParameters Locus nio modified DeladtG axPnalyiiPaametes Locus nfo modified Delauiltl e F ralysisParameterz i aina eT O New Resub Fiter Set 3 Aaah La ID Name M 1 eec Search Export JO OSDisk C CEQ System Export New folder Organze z Desktop Name B Downloads amp Recent Places Date madified HL Human Ref_GeXP csv fl HuMe GeXP1 csv De Libraries Documents ad Music i Pictures BI Video L STO G01_0902231 966 Computer B OSDisk C cs My Passport D C Local Disk Q 7 m File name Human Ref_GeXP csv Save as type GeXP csv 4 25 2014 5 50PM Microsoft Ex 4 24 2044 5 20 PM Mice ES Type soft Ex RM ShowEsclided Figure 7 19 Select File Path and File Format 3 Click the Save button From the drop down list next to Save as type select csv as the export file format The status of the data file exporting along with a processing log is displayed in a status window The Transfer fragments for GeXP widow indicates when the export procedure is
83. User s Guide For n Vitro Diagnostic Use 369 PN B40154AC Maintenance and Diagnostics Direct Control and Replenishment Remove Gel Cartridge Ea Do not open gel access door PLEASE WAIT Releasing gel cartridge H Time Elapse mun sec EB Remove Gel Cartridge You may now open gel access door and change gel cartridge IF you are not going to install a working gel cartridge please insert the gel pump plug ar clean empty Install Plug cartridge ta prevent any remaining gel from drying in the system Then click an Install Plug is Please check the waste battle to Help ensure that the battle wall mot overflow in future runs Figure 9 41 Remove Gel Cartridge Dialog Box 11 IfInstall Plug was selected in step 10 proceed to step 12 If Install Cartridge was selected in step 10 use the Install Gel Cartridge dialog box Figure 9 42 to enter the following information a If you are installing a new gel cartridge click New The system will automatically update the date and time installed and set the Hours on Instrument to 0 b Next enter the lot number c Ifyou are installing a used Gel Cartridge select Used Ifyou are installing the previous gel cartridge do not change the lot number or the hours on the instrument as they will be correct e Ifyou are installing a previously used gel cartridge but it was not the last one on the instrument enter its part number and
84. Using Fragment Lists Applying Exclusion Filters to the Fragment List Use the exclusion filter set is to exclude any fragments that do not meet the criteria of the Study and to include fragments that do NOTE Refer to the online help for information and examples regarding the application of various filters to the Fragment List The system provides many filters which you can apply using an operator and a value You can apply any number of filters to a result set and save it for future use You can assign filter sets to filter out fragments in which no confidence interval was estimated those with asymmetric peaks stutter peaks etc This third level filtering keeps only the sample data with fragments that you are certain of which saves you the time of weeding out inaccurate fragment data later in the analysis Available Exclusion Filters You can find all of the exclusion filters using the drop down list available in the Name column of the Filter Set area After selecting the name of the filter to use you must select an operator usually lt gt etc and a value to apply to the filter NOTE For details on using the Column Selector window the Column Sort window and other display parameters see Customizing the Results List on page 254 Customizing the Fragment List You can define and modify the Fragment List components using the right click menus These commands allow you to select specific columns for display in the
85. Vitro Diagnostic Use 97 PN B40154AC Run Module Using Direct Control Remove Gel Cartridge X Tou may now open the gel pump gel cartridge access cover and remove the gel Peeper cartridge g Cancel IF vau are not going to install a working gel cartridge please insert the gel pump plug ar Help clean empty cartridge to prevent any remaining gel fram drying in the system Then click an Install Plug Please check the waste bottle ta ensure that the battle wall not exerfow in Future runs Figure 3 54 Remove Gel Cartridge Dialog Box 11 IfInstall Plug was selected in step 10 proceed to step 12 If Install Cartridge was selected in step 10 use the Install Gel Cartridge dialog box Figure 3 55 to enter the following information a If you are installing a new gel cartridge click the Set to New button select the part number from the drop down menu enter the lot number and then click OK The system will automatically update the date and time installed and set the Hours on Instrument to 0 b Ifyou are installing the previous gel cartridge do not change the lot number or the hours on the instrument as they will be correct c Ifyou are installing a previously used gel cartridge but it was not the last one on the instrument enter its part number and or lot number and adjust the hours to properly reflect the hours this cartridge has been on the instrument d Click Done on the Install Gel Cartridg
86. You can save new or edited locus tags to a selected project for use in additional analyses Locus Tab Use the Locus Tag tab to define the general locus and supplementary reporting information These parameters include the fragment size range repeat unit length and the dye to be used This is the minimum amount of information necessary to generate an allele list Locus Information The Locus Information area of the window contains parameters used to generate a list of expected alleles in your analysis Locus Information includes the following fields e Locus Name Enter a locus identification in this field This is an optional field e Dye Select the dye to be used for the locus from the drop down list 218 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Fragment Analysis Module Using the STR Locus Tag Editor Fragment length range between Enter the fragment length range the minimum and maximum fragment size associated with the locus in these two fields This defines the range in which the system searches for the particular fragment e Repeat unit length Enter the length of the repeat unit that represents the allele e of repeats in shortest Allele Select the number of repeats in the shortest allele from the drop down list Variant alleles that contain a particular repeat are designated by a decimal followed by the number of bases in the partial repeat For example a variant allele wit
87. active sample plate P Select All Highlights selects all cells in the sample plate Clear All Removes all cell properties in the sample plate View Summary Displays a summary of a specific sample plate To use this open the desired sample plate then click this icon The Sample Plate Summary spreadsheet appears with a summary of each sample in the plate This is a read only spreadsheet and cannot be edited Help Topics Displays the CE system online help By default the help system displays the Contents in the navigation pane located on the left and the introductory topic in the topic pane located on the right You can use the Contents to select and print specific help topics The navigation pane also provides a Search tab and an Index tab These tabs let you search for information by topic index entry and or keyword Context Sensitive Help Click this icon and then on a menu item to open the Help file related to the selection GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 20 PN B40154AC Sample Setup Module Using the Sample Setup Module 2 2 Using the Sample Setup Module Open set up import and export sample plates To open the Sample Setup module click the Sample Setup icon on the Main Menu Opening a Sample Plate Open an existing sample plate or create a new one l Getto this location in the software 2 Step instructions The Sample Plate Selec
88. allele in the allele table Fragments without A if any are identified as unknown alleles or Spurious peaks All fragments assumed not to be A Any fragments without A are identified as the allele in the allele table Fragments with A are identified as unknown alleles or spurious peaks Use the SNP Locus Tag Editor to create a new SNP locus tag or edit an existing one to be used for SNP analysis You can access this editor from the SNP Locus Tag tab of the Analysis Parameters window see SNP Locus Tags Tab on page 214 Biel Es SNP Locus Tag Editor Locus Tag SMP 1 Save As Project ddSNP Allele ID Locus Name SNPI Apparent Fragment 18 47 Gi Ze Ploidy Allele ID s For Accession H Primer Sequence Figure 6 19 SNP Locus Tag Editor Window Creating a New Locus Tag GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC 229 Fragment Analysis Module Using the SNP Locus Tag Editor The Locus Tag Editor provides the following fields e Locus Tag Enter or edit the name of the locus tag in this field e Project Select the project to which the new or edited locus should be saved e Locus Name Enter the identification of the locus in the field This is the locus tag name that appears in the fragment list for all fragments that belong to this locus e Apparent Fragment Size Enter a real number greater than 0 and less than or equal to 150
89. already exists a dialog will be presented asking if the user wishes the existing file should be overwritten Loading Additional Sample Data Files Additional data file can be loaded onto the GeXP Data Tool that already has a data file imported See Figure 7 22 NOTE The initial and additional data files are not combined IMPORTANT Any previously processed data is replaced by the data in the additional data file GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 301 PN B40154AC Gene Expression GeXP Data Tool Additional Features of the GeXP Data Tool About Button The About button displays software version Refer to Figure 7 29 E Normalization File C Projects Gene Expression Main GexXP Data Tool Data Clean Data Test csv Gene ACTb CYP1A1 Sample Name Rep 1 Rep 2 Rep 3 Mean Std Dev 96CV seii Std 015 68ng 4180s6 1110745 1414 286 981029 510 625 pem Std 031 25ng 668650 5686791 3594996 5322646 1577422 29 636 2n Std 125ng 31045 240 32983 160 27151 440 30393 280 2970 022 9 372 IL 12p40 Std 250ng 33592 630 51007 920 ND 42300 270 12314 470 29 312 IL 2 IL 4 0947 400 IL 6 GeXP Data Tool Bio19 c60 7624473 24958 m Version 1 0 7076 830 2841 720 10 495 23 Kanr PPla TNFa lean Std Dev CV 1936 662 2776 998 2852 805 2522 155 508 467 Sid 031 25ng 135354 10861 800 7232097 9076417 1815569 20 003 Sta 250ng 36525070 58108 720 ND___ 4731
90. assigned alleles Also available are Current Data and Voltage Data These types of data cannot be edited GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 189 PN B40154AC Fragment Analysis Module Fragment Analysis Module Overview Main Window The following illustration identifies the areas on the Fragment Analysis module s main window that are described in Table 6 1 A B C Fragment Analysis D1151984 test Result Set Viev lm xi Fie View Results Analysis Reports Window Help m al xj D D m a 4 LII To I fos I os E om x amp Study Results Exclusion Filter Set Fragments List analysis New Result Filter Set 2 Apply Results Set result date outcom 2 ID Name Operator Values 3 1 selecb 29 D1151984 0 1pmol 0 25uIDN A02 050327114 03 27 2006 11 17 36 D1151384 1pmol 0 25ulDNA H 1 060327114 03 27 2006 11 17 40 D1151384 1pmol 0 25uIDN4 G01_060327114 03 27 2006 11 17 44 D1151384 1pmol 0 25ulDNA FO1 060327114 03 27 2006 11 17 46 D1151384 1pmol 0 25ulDNA E 1 060327114 03 27 2006 11 17 50 D1151384 0 1 pmol 0 25uIDNA DO1 060327114 03 27 2006 11 17 54 D1151384 1pmol 0 25ulDNA CO1 060327114 03 27 2006 11 17 56 D1151384 0 1 pmol 0 25uIDNA B 1 060327114 03 27 2006 11 18 00 10 D1151984 0 1pmol 0 25uIDNA BO02 06032711 03 27 2006 11 17 32 1 D1151984 0 1pmol 0 25uDNA
91. boxes It shows you how to use this module to work with Studies to run a fragment analysis and to set up its parameters result properties and display options It also describes how to work with report and export fragment analysis results Gene Expression describes how to use the GenomeLab GeXP Genetic Analysis System and the associated softwares to perform gene expressing analysis Database Management provides an overview of the module including its menu options toolbars and dialog boxes It provides procedures for database activities such as setting up and managing databases exporting importing data and managing user accounts Maintenance and Diagnostics provides routine maintenance replenishment diagnostic and biological waste disposal procedures It also lists the consumable materials used in the system GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 1 PN B40154AC Foreword Technical Support Technical Support If you encounter a problem that is not discussed in this guide and you need technical support contact your local dealer the provider of this product or contact AB SCIEX directly using the information below NOTE Whenever you call your local dealer or AB SCIEX be sure to have your registration material instrument serial number and software version number available For future reference record this information here Instrument Serial Number Software Ver
92. changes to the method 6 Select Inject from the Event list a Enter an injection voltage between 0 1 and 12 0 kV Enter a time duration in seconds c Click OK to exit the Method dialog box or continue with step 7 to make additional changes to the method 7 Select Separate from the Event list a Enter the separation voltage between 0 1 and 12 0 kV b Entera time duration in minutes c Click Advanced to specify the two separation phases for the method d Click OK to return to the Method dialog box The first phase is to coax the sample into the capillaries The second phase is to perform the normal separation of the samples 8 Click OK to exit the Method dialog box or continue to make additional changes to the method 9 Inthe Save As dialog box a Selecta Project Name from the drop down list b Enter a name in the name field c Click OK Defining Data Processing Conditions Analysis parameter sets define the conditions specific to an experiment used in data processing Modification of the Sequence or Fragment Analysis Parameters can only be performed in their respective analysis modules Sequence Analysis Parameter Sets define the start and end times for the analysis of raw data the threshold below which bases are called as N s and the information necessary to detect the start of data to be analyzed including the delay between the detected start of data and the start of data analysis the signal to noise ratio
93. cover and lift it to the vertical locking position 6 Loosen the manifold access cover captive screw Figure 9 2 remove the cover and set it aside 340 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Maintenance and Diagnostics Routine Maintenance t o o 2 I J E Figure 9 2 Manifold Access Cover 1 Capillary Temperature Control Cover 4 Captive Screw open 2 Plenum Assembly 5 Manifold Access Cover removed 3 Manifold Access Cover Lift the eject lever Figure 9 3 to release the array fitting Grasp the array fitting tab Figure 9 3 and then a Pull the fitting approximately one inch away from the manifold b Touch the tip of the fitting to the bottom of the optics base plate c Hold this position and wait five seconds for the gel strand to dry d Pull the fitting away from the instrument e Use a tissue to wipe gel strands off of the instrument GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 341 PN B40154AC Maintenance and Diagnostics Routine Maintenance 901597L Al Figure 9 3 Removing Replacing the Array Fitting 1 Guide Pins 4 Gel Strand 2 Eject Lever 5 Optics Base Plate bottom 3 Array Fitting 6 Array Fitting 9 With the array fitting in hand blow dust and debris off
94. file must have only one locus name per line The order of the loci included in this file determines the order of the loci in the Pedin file The Pedin export also requires that every result in the Study includes the pedigree information at least the individual ID It also requires that at least one result per individual has a complete pedigree Pedigree ID Individual ID Father ID Mother ID and Gender Pedigree information is associated with samples through the sample plate editor using the sample property sets Pedigree template As an alternative you can associate the pedigree information with results using the single result view s property sets tab Discovery Manager DMPopulation txt Contains the export parameters of a Study s pedigrees and genotypes The DMPopulation file is designed to be imported into Genomica s Discovery Manager application The DMPopulation file can also be imported into Discovery Manager as a DMFastPopulation file The pedigree and genotype information from each result in the Study is included in the DMPopulation file The DMPopulation export produces two files e txt the DMPopulation file log a list of processing steps and errors encountered during the export GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 267 PN B40154AC Fragment Analysis Module Exporting Results 268 The DMPopulation export requires a list of locus names in a file named LocusList t
95. for the chosen primer pair Save this file with the name of the multiplex Include primers that were previously validated for a gene target or a reference gene Record primer and amplicon information as in step 1 For the remaining gene targets in the multiplex design amplicons with smaller sizes first then work toward larger amplicon sizes To ensure a desired amplicon size is assigned for a particular gene target set the minimum and the maximum PCR product size at the same value For example if 133 nt is the desired amplicon size enter 133 both as the minimum PCR product size and as the maximum PCR product size during primer design Record primer and amplicon information as in step 1 for each gene target Ensure the amplicons are at least 5 nt apart In addition due to the presence of the internal control peak Kan peak at 325 nt do not design any gene peak with an amplicon size including tags in the range of 320 to 330 nt In the Microsoft Excel worksheet create a new column named Amplicon size with Universal tags The amplicon size with universal tags is calculated by adding 37 nt to the amplicon size without universal tags In the Microsoft Excel worksheet create a column named reverse primer with tag copy and paste the reverse universal tag sequence at the 5 end of gene specific reverse primer sequence In the Microsoft Excel worksheet create a column named forward primer with tag copy and paste the f
96. fragment list customize the arrangement of fragment list information and modify several other parameters of the fragment list For details regarding the Column Selector window the Column Sort window and other display parameters see Customizing the Fragment List sections of the online help Manually Selecting Peaks for the Fragment List Manually select peaks you want to add to or clear from a fragment list or building a new one from scratch To access this function right click within the fragment list and select Manually Select Peak When selected the system asks if you want to clear the existing fragment list Choose one of the following Click No if you want to keep the list but add or remove peaks from it Click Yes if you want to discard the system generated list and start over Exporting a Fragment List to CSV File You can export the fragment list to other third party spreadsheet programs To export the fragment list l Right click the selected samples from any of the data or fragment lists 2 Select Export to CSV File The Export window opens 238 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Fragment Analysis Module Performing Bin Analysis 3 Select a name and location to save the file NOTE See Exporting Fragment Lists or Genotypes from a Study on page 265 for more information regarding data export Showing a Stacked Graph The Stacked Graph function al
97. it is in the off position ON POSITION OF PRINCIPAL POWER SWITCH This symbol graphically represents the equipment main power push button switch when it is in the on position Bp RELEASE CAPILLARY ARRAY COMMAND Carefully follow the instructions for releasing the CAUTION N TO PREVENT POSSIBLE SYSTEM DAMAGE ALWAYS EXECUTE RELEASE CAPILLARY ARRAY COMMAND PRIOR TO capillary array before removing the array fitting REMOVING ARRAY FITTING INSTALL ARRAY FITTING WITH FINGER GRIP POINTING DOWNWARD 7 PRINTED IN U S A 607783 AA Chemical and Biological Safety WARNING Normal operation of the system can involve the use of solvents and reagents that are toxic flammable or biologically harmful WARNING e Observe all precautionary information printed on the original solution containers e Operate the system in the appropriate environment e Take all necessary precautions when using pathology or toxic materials to prevent the generation of aerosols e Observe all applicable precautionary procedures when using flammable solvents in or near the instrument e Wear appropriate laboratory attire for example safety glasses gloves lab coat and breathing apparatus when working with hazardous materials e Dispose of all waste solutions in a proper manner Electrical Safety To reduce risk of electrical shock all devices employ a three wire electrical cable and plug to connect the equipment to earth ground e Ens
98. its check box See Toolbar Icons on page 55 otatus Bar Toggles between showing and hiding the status bar Select this option to show the status bar To hide the status bar select this option again to clear the check mark Status Monitor Select this option to activate or deactivate the Status Monitor window displays The default setting is activated See Status Monitor on page 60 Working Displays the name of the database currently in use Database GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Run Module Run Module Overview Direct Control Menu Manage separation functions conditions or system components These capabilities serve in both method development and diagnostic tools Direct Control Access Plates Plate Position Capillary Temperature Denature Samples Optical Alignment Inject Separate el Capillary Fill Manifold Purge The table lists the Direct Control menu options Table 3 4 Direct Control Menu Option Unload Plates Plate Position Capillary Temperature Denature Samples Optical Alignment Inject Separate Gel Capillary Fill Manifold Purge Description Move the plate holder to the position at the front of the instrument to load or unload plates See Loading the Sample Plate on page 350 Graphically select the well location where the capillaries will be immersed set the capillary holding temperature
99. l Inthe Display Options dialog box select the Current Traces tab 2 Select the radio button for the current type to display under Data 3 Click OK Viewing the Last Analysis Performed View the last analysis performed on the CE system l With a sample plate running and with Automatic Analysis selected select Tools View Last Analysis The Sequence Analysis Module dialog box opens and displays the last row of sample analyzed along with the Sample Plate toolbar 2 To view additional samples select the appropriate sample positions in the sample plate toolbar and click Open If the last analysis was a sequence analysis result the Sequence Analysis module opens displaying the analyzed sequence data If a Fragment Analysis separation was performed the raw data will be displayed in the Sequence Analysis module GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 15 PN B40154AC Run Module Using Direct Control 3 3 76 Using Direct Control Click on the Direct Control icon NOTE Use Figure 3 27 User Accessible Hardware Components to locate hardware components referenced in this section 901632L Al Figure 3 27 User Accessible Hardware Components 1 Sample Access Cover extended 7 Manifold Access Cover 2 Capillary Access Cover extended 8 Gel Waste Bottle 3 Status Indicators 9 Power Switch 4 Plate Holders Sample Transport 10 Gel Pump 5 Capillary Temperature Contr
100. lower dialog box displays the analysis log for each sample as it is analyzed 204 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Fragment Analysis Module Working with Studies in the Fragment Analysis Module e To stop the analysis while it is in progress click Stop The system stops the analysis when it has finished with the sample in progress K Analyze Data Ea Steps Raw Data Analysis Parameter FA600 Time started 4 25 2006 12 58 58 PM Analysis Parameters Analyze Data Result Data L Status DateAnalzed DATS 102 D4 H01 1050518 Y 6 5 2001 8 24 03 PM 4 25 2005 12 53 07 PM DATS 101 D4 G 1 1050518 Y 6 5 2001 8 24 01 PM 4 25 2006 12 59 14 PM DATS 100 D4 F 1 1050518QY 6 5 2001 8 24 00 PM 4 25 2006 12 53 21 PM DATS 99 D4 E01_010605180 6 5 2001 8 23 59 PM 4 25 2006 12 59 30 PM DATS 37 D4 D01 01050518Q Y 6 5 2001 8 23 57 PM X Unanalyzed DATS 96 D4 C01_010605180 6 5 2001 8 23 56 PM Unanalyzed DATS 34 D4 B 1 1050518 6 5 2001 8 23 54 PM Unanalyzed DATS 93 D4 401_010605180 7 6 5 2001 8 23 53 PM Unanalyzed PreProcessing channel 3 raw data RMS noise RFU 31 617333 PreProcessing Estimating baseline for channel 4 PreProcessing channel 4 average baseline level RFU 2077 442146 PreProcessing channel 4 raw data RMS noise RFU 46 558699 PreProcessing Finished baseline estimation Total Samples 8 Analyzed 4 Passed 4 Failed 0 Figure 6 10 A
101. multiple dye labeled fragments pooled in a sample or multiple samples with single dye labeled fragments in each sample you can select the appropriate dyes to be exported 6 11 Performing LOH Analysis The Fragment Analysis module comes equipped with a macro that is intended to detect Loss of Heterozygosity LOH between alleles from Normal reference samples and those from other samples In LOH Analysis pairs of samples to be compared must have the same root names followed by characters that allow the distinction between reference and test samples or loci All data to be analyzed reside in a temporary file created by the System Fragment Analysis application The macro scans the fragment results contained in the Study to determine the loci to include in the LOH analysis For each result in the Study a list of alleles is then generated at each locus The peak heights of alleles identified in similarly named samples are then compared and their status determined LOH AI MI Homozygous NoNorm Alleles 252 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Fragment Analysis Module Performing LOH Analysis To start LOH Analysis 1 Select Analysis Run LOH Analysis to launch Microsoft ExcelTM The LOH xml file opens displaying the START sheet EJ Microsoft Excel LOH xls Read Only IDE XI Ed File Edit View Insert Format Tools Data Window Help Type a question for help amp X
102. not correspond to an error probability estimated from actual data but is still a useful relative indicator of the goodness of the match If would like to overwrite the confidence interval value generated by automatic binning select Overwrite system interval value check box e Ifyou are overwriting the system generated value specify a confidence interval number of nucleotides in the field provided GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 221 PN B40154AC Fragment Analysis Module Using the STR Locus Tag Editor Aa Locus Tag Editor Locus Tag GATAIS340 Project 3A TA 183AL Stutter Definition W Search for Stutter Stutter detection window width hd aximum relative stutter peak height o y Detect stutter shorter than alelle Detect stutter longer than allele Confidence Interval System generated allele confidence interval vw Overwrite system confidence interval Biel Es Save As Date last modified 4 19 2001 3 22 05 PM Spurious Peak Detection Detect spurious peaks I4 asinum height for spurious peaks 30 EM x amp Detection Apparent size includes 24 Detect Use 4 peak to call Allele Comment Cancel Figure 6 18 Locus Tag Editor Window Allele ID Criteria Tab Stutter Definition Stutter consists of small peaks generally DNA amplification artifacts that form as a result of halted polymerase activity When this happ
103. o 0771 3 GATA183A07 0 25pmoLAO6 060327110R N A 8 GATA183A07 0 25pmolH05_0603271105 N A a 10000 2 GATAIS3A07 7500 357 25 GATA19340 0 25pmol G05_060327110T i N A 6 GATA19340 0 25pmol F 5 060327110U N A 5 G TA193A07 0 25pmol E05_060327110 i N A 4 RATATQ3ATIT fl nmal NMG MMII 0147 RIDA 5000 2500 Dye Signal Meana 1 12 2 A o 0 50 100 150 200 250 300 350 400 of Data Points 1 1 Size nt Standard Deviation NAA N 4 hiv Ready Figure 6 31 New Peak Ratio Window The Peak Ratios window displays all of the result data and the selected parameters used to quantify the amount of DNA present in your sample Reference Result Peaks This area shows the selected reference and test peak information You select the reference result which contains the best reference and test peaks for the system to use for a relative analytical comparison of trace peaks You may select any number of test peaks but only one reference peak for each Peak Ratio Analysis Analysis Parameters e Use Peak Height Select this option to perform a quantitation based on peak height Relative Fluorescence Units RFU GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 245 PN B40154AC Fragment Analysis Module Calculating Peak Ratios 246 Use Peak Area Select this option to perform a quantitation based on peak area mm x RFU Reference Peak Know
104. o d complete with electrode block and detector array fitting Ready for installation into CE system Buffer Plates 609844 Box Package of 100 flat bottom polystyrene plates non sterile without lids Required for use as the separation buffer plate sample Plates 609801 Box Package of 25 V bottom thermal cycler compatible polypropylene plates with 200 uL volume capacity Required for use as the CE system sample plate 25 Plates Box 380 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Maintenance and Diagnostics Consumable Items List Table 2 provides a list of the required consumable items for the Fragment Analysis system Table 2 Required Consumables for Performing Fragment Analysis Item P N QTY Description DNA Separation Capillary Array 608087 1 Eight capillaries 75 um i d 33 cm long 200 o d complete with 33 5B electrode block and detector array fitting Ready for installation into the GenomeLab GeXP Separation Gel LPA 391438 1 20 mL of gel in CE system compatible container Sufficient to run two 96 well plates Separation Gel LPA 608010 1 10 mL gel that is used for GeXP single rail systems Sufficient to run one 96 well plate separation Buffer 608012 1 Each container has a screw top and pour tip The container has enough buffer 30 mL to fill a CE System 96 well flat bottom Buffer Plate Each well being 4 full 4 Pack
105. of the separation event Displays a graph of the injection current versus time for the duration of the injection event Displays a graph of the separation voltage versus time for the duration of the separation event GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Fragment Analysis Module Using the SNP Locus Tag Editor Table 6 15 Information Available in the Single Result View Tab Analysis Log Run Log Analysis Parameters Quantitation STR Locus Tags SNP Locus Tags Size Calibration Dye Matrices General Notes Property Set Method Consumables Description Displays the list of messages generated by the primary analysis program during the analysis of the selected result The analysis log contains information that can help determine the cause of an analysis failure Displays the list of messages generated by the instrument during the pre separation and separation events of the eight samples that include the individual selected result Use the Run Log to troubleshoot the data in the case of a run failure Displays a summary of the fragment analysis parameters applied to the raw data in the selected result Displays a summary of the peak information used to estimate fragment amounts within the selected result Displays a list of STR locus tags that have been applied to the raw data in the selected result Displays a list of SNP locus tags that have been applied to the raw d
106. of the left arrow buttons to remove them from your parameter set e To edit a locus tag select it and click Edit Locus to display the SNP Locus Tag Editor window e To create a new locus tag click New Locus to display the SNP Locus Tag Editor window NOTE See Using the SNP Locus Tag Editor on page 225 for information about creating or editing locus tags Running a SNP Analysis The following list identifies the three tasks you must complete before running an SNP analysis 1 Select the SNP Locus Tags as part of the analysis in the SNP Locus Tags tab of the Analysis Parameters window see SNP Locus Tags Tab on page 214 2 Select SNP Analysis in the General tab of the Analysis Parameters window see General Tab on page 207 3 Select an appropriate SNP Size Standard Size Standard 80 in the Analysis Method tab of the Analysis Parameters window see Analysis Method Tab on page 208 e A size standard with exactly two fragments must be selected for SNP analysis to succeed e The size standards must bracket all expected SNP fragments Both of these fragments must be selected The only valid model for a two fragment standard is the Linear model These three requirements enable you to successfully run the SNP analysis even if you do not select the mobility calibration but the values obtained might vary slightly If you want to correct for the mobility differences between the reference fragments and each of the four
107. on different lines The following example compares the differences between condensed and expanded protein formats KVS IM LPLVILP K Condensed or KVSILPLVLK KVSMLPLVPK Expanded KVSMLPLVLK KVSILPLVPK To export the active compared sequence 1 Select File Export 2 Choose the desired format as described in Table 5 9 3 Click OK to export the data NOTE Ifa file with the same name exists in the selected directory the system prompts you to rename the new file or confirm that you want to overwrite the existing file The system displays an hourglass while exporting the data Saving the Data To save a new document l Select File Save A Save As dialog box opens prompting you to enter a file name and folder location 2 Select the folder location and enter a file name 3 Click Save The system saves the data to the file for later retrieval NOTE Ifthe document has previously been saved select File Save to save the document immediately To change the name or location of an existing file l Select File Save As A Save As dialog box opens prompting you to enter a file name and folder location Select the folder location and enter a file name Click Save GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC 6 1 Fragment Analysis Module Fragment Analysis Module Overview Fragment Analysis Module The analysis of fragment or allele data is performed with the CE
108. option indicates that the option is enabled The Log Options menu options are available when displaying the Log tab The following table describes the Run module s Log menu options Table 3 7 Log Options Menu Option Description Errors Only Toggles this option off and on When enabled v the Log window lists only errors All Detail Toggles this option off and on When enabled Y the Log window includes all messages and system activity sample Plate Toggles this option off and on When enabled v the Log window displays only the Only items related to a running sample plate Freeze Log Toggles this option off and on Select this option to freeze or resume the display in the Log window Freezing the log data does not stop the run just the display of log data Replenish Menu Click the Replenish menu to display its drop down menu as shown in the following example Replenish Capillary Information Install capillary Array Release Capillary Array el Cartridge Buffer Information Install Gel Cartridge Release Gel Cartridge Replace Wetting Trav Empty Waste Bottle The following table describes the Run module s Replenish menu options Table 3 8 Replenish Menu Option Description Capillary Opens the Capillary Information dialog box Use this dialog box to enter information Information that applies to your capillary array For details see Viewing Capillary Information on page 358 Install Capil
109. represents either the size or time per pane depending on the XScaleType The graph is broken into MaxX MinX PaneWidth full sized panes as well as one additional pane if required for the remaining data PaneWidth is a float In the DisplayOptions section of the Alternative text box enter the desired number of panes to distribute the X axis range of data over as follows 260 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Fragment Analysis Module Reporting Results DisplayOptions XScaleType BySize MinX 100 MaxX 300 MinY 0 MaxY 10000 PaneCount 3 Dyes Displayed on the Graph SelectedDyes are dye selection options It allows the e gram graph to select which dye to report The Fragment Analysis view dye visibility does not affect this option The possible value for SelectedDyes are all 1 2 3 4 or combination of 1 2 3 4 All displays all four dyes By default the display for the four dyes is 1 2 D1 2 2 D2 etc In the DisplayOptions section of the alternative text box enter the desired dyes as follows DisplayOptions XScaleType BySize MinX 100 MaxX 300 MinY 0 MaxY 10000 PaneCount 3 SelectedDyes 1 4 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 261 PN B40154AC Fragment Analysis Module Exporting Results 6 14 Exporting Results When exporting a fragment result in text format you can includ
110. s Guide For n Vitro Diagnostic Use PN B40154AC Export Options Sequence Analysis Using the Sequence Analysis Module The Export dialog box provides two options you can choose when exporting sequence data as described in the following table Table 4 26 Export Options Option Apply Trimming Description If you selected the Export option during sample setup or batch analysis selecting the Apply Trimming option removes the trims from the sequence before it is exported The exported file replaces all internal trims with the letter x Export Only If Sequence X nt The resulting sequence after trimming may be too small to be useful Use the Export Only If Sequence X nt option to specify a minimum size that the sequence must be when exporting This exports only those sequences greater than the set number of nucleotides Export Sample Elements Header Raw Data Result Data y Result Output Guality Parameters Alignment Results Alignment Accuracy Options i Remove CEG Tracking Suffix v Resolve Filename Conflicts Savein QEot sti O m fal Sequence Test D03 60301225z F Ej Sequence Test D04_06030200L7 f fal Sequence Test A03_0603012275Z fasta Ej Sequence Test A04 O6030200L7 Fasta Sequence Test BOS 0603012252 fasta Ej Sequence Tesk E03_060301225Z f E Sequence Tesk BO4 D6030200Lz Fasta E Sequence Tesk E04_06030200LZ F es
111. sample plate now to load plate This option breaks the plate run before the next sample If selected the Save Collected Data option become available allowing the previously collected data to be saved 3 Click OK Stopping a Sample Plate Run To stop the currently executing sample plate 1 Select Run Stop System or click the Stop System uj toolbar icon The the Stop System dialog box opens as shown in the following example Stop System x ie St le plat All Plat op sample plate E ates p C Skip current sample set Help Stop after current sample set completes W Save Collected Data Perform Shutdown Method Figure 3 25 Stop System Dialog Box 2 Select the desired Stop Options radio button 72 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Run Module Using the Run Module e Stop sample plate Stops the currently running sample plate immediately e All Plates Check this box to make the Stop sample plate selection apply to both sample plates e Skip current sample set Skips the currently running sample set e Stop after current sample set completes Stops the run after the currently running sample set has been completed e Save Collected Data Saves data already collected for the currently executing sample set e Perform Shutdown Method Purges the system of any remaining DNA fragments and refills the capillaries with fresh gel after the sample plate h
112. service contact information Getting Started discusses the purpose and functional description of the system provides an overview of the three main components chemistry hardware and software comprising the system and details the safety features relevant to the system It also provides step by step procedures for operating the system Sample Setup Module provides an overview of the module including its menu options toolbars and dialog boxes It also shows you how to work with sample plates using this module such as opening setting up exporting and importing sample plates Run Module provides an overview of the Run module including its menu options toolbars and dialog boxes It also shows you how to run sample plates and set the display options using this module Sequence Analysis provides an overview of the module including its menu options toolbars and dialog boxes It shows you how to use this module to run a sequence analysis and to set up its parameters result properties and display options It also describes how to work with report and export sequence analysis results Sequence Investigator Module provides an overview of the module including its menu options toolbars and dialog boxes It also shows you how to use this module to investigate and compare sequence analysis results Fragment Analysis Module provides an overview of the module including its menu options toolbars and dialog
113. shown in Figure 7 47 below the Description worksheet explains how each set of data for a gene in the multiplex is organized and displayed 2 Standards 9 Concentration ng Mean Std Dev CV Statistical mean standard names 42 Curve Fit R2 13 replicates The R2 value for the standard curve for this gene 14 Samples 15 Statistical mean 16 standard deviation 17 Sample names and percent 18 coefficient of variation 19 for the sample 20 replicates 21 22 GEQs 23 Statistical mean 24 standard deviation 25 Sample names and percent 26 coefficient of variation 127 for the GEQ 28 replicates 29 30 GEOs Normalized to Gene s aL Statictical mean Replicate 1 Replicate 2 Replicate 3 Replicate 4 Replicate 5 The relative signal level of each sample The GEQ values derived from the sample re Figure 7 47 Description Worksheet in the Excel Workbook Least Squares Fit 3rd order polynomial Coeff3 Coeff2 Coeffi Coeff 4 Standard 5 standard deviation XXX XXX XXX XXX concentrations in 6 and percent R2 XXX XXX XXX nanograms The relative signal level of each standard 7 coefficient of variation XXX XXX XXX XXX decoded from the 8 for the standard XXX XXX XXX XXX 9 10 Standard Curve Equation LINEST y Coeff3 x 3 Coeff2 x 2 Coeffl x Coeff 311 Gene Expression GeXP Quant Tool 312 For example as shown in Figure 7 48 results f
114. tab Table 4 18 Initial Data Detection Tab Sequence Analysis Parameters Editor Option Description Threshold Enter the maximum ratio value of all the data in the energy profile above which the signal must rise before the analysis starts detecting data The data must stay above this threshold for the minimum duration without gaps for more than 21 seconds The range is 0 to 100 The default is 40 Delay Enter a value for the delay between the detected start of data when the data that will be analyzed The range is 0 00 to 180 00 minutes e f 200 Bases is not checked on the General tab the default value is 0 75 minutes e f 200 Bases is checked the default value is 0 20 minutes oignal to Noise Enter the Signal to Noise value to specify the signal to noise ratio for significant data The range is 3 00 to 1000 00 The default value is 7 00 Minimum Duration Enter the value at which the signal to noise threshold must exceed with no gaps greater than 21 seconds The range is 2 00 to 50 00 minutes e f 200 Bases is not checked on the General tab the default value is 5 00 minutes e f 200 Bases is checked the default value is 2 00 minutes Heterozygote Detection Tab Use the Heterozygote Detection tab of the Sequence Analysis Parameters dialog box to enable Heterozygote detection and to specify the parameters for detecting heterozygotes If you enable this feature the next analysis run detects heterozygotes and displa
115. the Available list then click the right arrow gt to move the selection to the Selected list e To select all available locus tags click the double right arrow gt gt to move the selections to the Selected list e To remove locus tags from your parameter set select the locus tag in the Selected list and click either of the left arrow buttons to remove them from your parameter set e To edit a locus tag highlight the selection and click Edit Locus to display the STR Locus Tag Editor window e To create a new locus tag click New Locus to display the STR Locus Tag Editor window NOTE See Using the STR Locus Tag Editor on page 218 for information about creating or editing locus tags GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 213 PN B40154AC Fragment Analysis Module Defining Fragment Analysis Parameters 214 SNP Locus Tags Tab The SNP Locus Tags tab allows you to select the locus tags used for SNP analysis with the current parameter set Use SNP locus tags to detect the presence of specific Single Nucleotide Polymorphisms SNPs in the group of sample data selected for the Study SNP locus tags are much the same in many respects as STR locus tags Each SNP locus tag is configured with a specific set of parameters that tell the system what fragment size to look for and to assign an allele name based on the color dye label of the identified fragment The results produced from a SNP a
116. the Context Type for your selection 3 Select the report template from the Template drop down menu The selections available depend on the Context Type 4 Click OK to display the new report containing the selected information Using Report Templates There are several types of elements in each report template e Header text for data tables or graphs For example Bin Scatter plot e Regular Data Objects For example Context Locus Name Locus Loop Delimiters For example BeginLoop Allele 2 Context Locus Alleles ID Allele ID Nominal Size FormatNumber Allele TrueSize 0 Apparent Size FormatNumber Allele ApparentSize 2 standard Deviation FormatNumber Sqr Allele FragmentSizeVariance Number of Data Points Allele FragmentCount Comment Allele Comment EndLoop Allele Context Locus Alleles e Table Delimiters TableLoop Allele Context Locus Alleles ID Nominal Size nt Apparent Size nt Standard Num Points Comments Deviation nt Allele D FormatNumber FormatNumber FormatNumber Allele Fragment Count Allele Comment Allele TrueSize Allele Apparent Sqr Allele Frag m 0 Size 2 entSizeVariance Graph Objects For example Graph Service BinGraph Context Site DisplayOptions 258 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Fragment Analysis Module Reporting Results e Graph Placeholder pictures as shown in the following example Bin View 382
117. the analysis log For example the system logs a message when it is unable to find the end of PCR product data You may view the analysis log to see if the system was unable to find the end of PCR data The following message appears in the analysis log Analyzed Data Cannot compute stop time Using data stop time of xxx xx minutes as shown in the following example 03 28 00 10 28 34 03 28 00 10 28 34 03 28 00 10 28 34 03 28 00 10 28 34 03 28 00 10 28 34 03 28 00 10 28 34 03 28 00 10 28 34 03 28 00 10 28 34 03 28 00 10 28 34 03 28 00 10 28 34 03 28 00 10 28 34 03 28 00 10 28 35 Analyzed Data Analyzed Data Analyzed Data Analyzed Data Analyzed Data Analyzed Data Analyzed Data Analyzed Data Analyzed Data Analyzed Data Analyzed Data Analyzed Data Estimate Noise Variance Warning Excessive noise in channel 4 at time 2228 392857 DeSpike Deadtime Correct Correct for Data Truncation Align Time Base Find Start Find End Cannot compute stop time Using data stop time of 103 99 minutag opike Analysis omooth Compute Color Calibration Figure 4 25 Analysis Log Occasionally the system cannot find the end of PCR product data even if the PCR Product option is selected To determine if this is the case review the analysis log and use this information in future analysis of the same sample To view the analysis log l Open the sequence results you would like to review NOTE Ifthe sample data has not
118. the electrode block may disengage from its mounting posts and become damaged GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 87 PN B40154AC Run Module Using Direct Control 901713L Al Figure 3 42 Plenum Assembly Removal 1 Captive Screw 3 Plenum Assembly 2 Rubber Latch 4 Captive Screw Lift the Eject Lever Figure 3 43 to release the Array Fitting Grasp the Array Fitting tab Figure 3 43 and then a Pull the fitting approximately one inch out of the manifold b Touch the tip of the fitting to the bottom of the Optics Base Plate c Hold and wait five seconds for the gel strand to dry d Pull the fitting away from the instrument e Wipe gel strands off of the instrument using a damp tissue NOTE Note the number of runs and days on the instrument for this capillary array for reference If this capillary array is to be re installed this information is necessary A label has been provided on the back of the array packaging container so that this information may be recorded 08 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Run Module Using Direct Control 901597L Al Figure 3 43 Removing Replacing the Array Fitting 1 Guide Pins 4 Gel Strand 2 Eject Lever 5 Optics Base Plate bottom 3 Array Fitting 6 Array Fitting 9 Grasp the Electrode Block tab Figure 3 44 and pull the block out and away from the instrume
119. the guide block pins Figure 3 44 CAUTION AN USE THIS FRONT PLENUM ONLY WITH A 38 CM CAPILLARY ARRAY 900697L Al Figure 3 46 Plenum Assembly Capillary Routing Hole NOTE When reinstalling the Plenum Assembly gently gather the capillaries between your thumb and forefinger to make sure they pass through the hole in the Plenum Assembly without any constriction 14 15 16 17 Replace the Plenum Assembly and tighten the two captive screws Figure 3 42 Replace the Manifold Access Cover and tighten the captive screw Figure 3 41 Lower the Capillary Temperature Control Cover and secure the two rubber latches Lower the Capillary Access Cover and Sample Access Cover to their locking positions e Ifyou are installing a new capillary array in the Install Capillary Array dialog box Figure 3 47 select the correct part number enter the serial number click Set to New then click Done The number of runs and days on instrument will revert to 0 e If you are installing the previous capillary array do not change the serial number number of runs or the number of days on the instrument as they will be correct e If you are installing a capillary array that was previously used but not the last capillary array on the instrument enter its part number if applicable serial GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 91 PN B40154AC Run Module Using Direct Control 92 number and ad
120. the position from which the plates were loaded left or right 5 Click Load on the Capillaries Exposed dialog box Figure 9 15 352 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Maintenance and Diagnostics Direct Control and Replenishment Loading the Sample Plate and Buffer Plate For Single Rail System To load the sample plate or buffer plate l Select Direct Control Unload Plates from the menu Unload Plates q X Please prepare your plates before clicking on Unload You have 15 minutes to change plates once you click on Unload This time limit iz critical so that the Cancel capillaries are not adversely affacted by prolonged exposure to air Help The capillaries will automatically be immersed in the Wetting Tray after the plates are loaded Figure 9 17 Unload Plates Dialog Box 2 Click Unload The Capillaries Exposed dialog Figure 9 18 opens Capillaries Exposed q X You may now open the sample access cover to load plates Capilares exposed to air H E Cancel Alarm OFF Help Time Remaining min Sec pa er Figure 9 18 Capillaries Exposed Dialog Box 3 Open the sample access cover and lift to the vertical locking position f Sample Plate was selected skip to Loading the Sample Plate e If Buffer Plate was selected skip to Loading the Buffer Plate and Evaporation Cover Loading the Sample P
121. the proper plate Find Barcode Figure 2 6 Find Barcode Dialog Box NOTE To search all projects for the sample name select none from the Project Name drop down list before clicking Find Barcode NOTE Ifthe sample plate does not appear in the list of available items it may be residing in another project To select the project where the sample plate resides select the project from the Project Name drop down list NOTE If the sample plate exists in a different database you can reset the working database For details see setting the Working Database on page 324 Other Ways to Open a Sample Plate You can also open a new or existing sample plate at any time while using the Sample Setup module e Toopena new sample plate from the File menu select File New e To open a new sample plate using the toolbar click j e To open an existing sample plate from the File menu select File Open Use the Sample Plate Selection dialog box to select your sample plate e To open an existing sample plate using the toolbar click Bl Use the Sample Plate Selection dialog box to select your sample plate GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 31 PN B40154AC Sample Setup Module Using the Sample Setup Module Creating a New Sample Plate To create a new sample plate Click j A blank sample plate opens Select and highlight the cell or cells where the samples will reside Enter the
122. the two re estimation message boxes before running the sample plate GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 69 PN B40154AC Run Module Using the Run Module 70 In the first step the system homes the gel pump and displays the Gel Volume Re estimation message as shown in Figure 3 19 Gel Volume Re estimation Step 1 The gel volume needed to process this samole plate is close to the amount available Gel volume re estimation is required Please wait while the system homes the gel pump E Figure 3 19 Gel Volume Re estimation Step 1 Message Box In the second step the system engages the gel pump plunger and accurately determines the gel volume See Figure 3 20 Gel Volume Re estimation Step Z x He pasitianing the gel cartridge plunger Far gel volume re estimation Please wait BEEN Figure 3 20 Gel Volume Re estimation Step 2 Message Box If the actual volume re estimated by the system is less than 1 0 mL more than the total volume to run the plate the Sample Plate Gel Usage dialog box opens as shown in Figure 3 21 Sample Plate Gel Usage Confirmation Ea The total available gel is sufficient to run 3 sample sets Lett Flate Right Flate Total sample sets 4 Total sample sets 4 Run the first E sample sets Run the first 3 sample sets Replace Gel Cartridge Cancel Figure 3 21 Gel Usage Confirmation Dialog Box 11 Click Accept to pr
123. their respective owners AB SCIEX is being used under license A p View SCIEX products at www sciex com AB SCIEX Headquarters C l EX i Find your local office at www sciex com offices 500 Old Connecticut Path Framingham MA 01701 USA Phone 508 383 7700 www sciex com ce www absciex com
124. to edit or create separation methods e Analysis tab Display the Analysis sub window that can be used to Enable or disable the automatic analysis mode Select and edit a Sequence Analysis or Fragment Analysis parameter set Enable or disable automatic report printing and edit print report options Enable or disable automatic exporting of data and change export options 22 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Sample Setup Module Overview Editing Property Values Attach information and a property set to the highlighted samples This informational note will accompany the sample throughout its lifetime modity the property sets Note Method Analysis Figure 2 2 Note Sub Window Editing Sample Properties Sort and remove sample properties To select a field in an existing property set left click the cell 2 Next use the Tab key to move your selection from cell to cell The Tab key moves the focus from property to value and then to the next row and the arrow keys to move in the direction selected 3 Press Enter to move the focus down the table one cell at a time within the same column e To select an entire column for sorting click its header The selected column is highlighted To select a row click its number As with the column selection the selected row is highlighted e To select consecutive rows left click and drag the cursor through the b
125. trim to the right of the 3 end e Select None if you do not want to perform quality based trimming Trimming Stringency Click and drag the slider control to set the quality values from low to high There are five possible selections ranging from Low to High that correspond to error rate of 0 07 0 06 0 05 0 03 0 01 The default value is Medium 5 132 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Sequence Analysis Using the Sequence Analysis Module Using Sequence based Trimming Apply contaminant sequence based trimming This can be done in batch analysis mode or in sequence analysis mode The resulting base sequence and trace views display the base letters of the vector and other subsequences as underlined If multiple vector or subsequences matched they appear as multiple underlined in the Trace View Sequence Analysis Parameters Editor DefaultSequenceAnalysisPar General Initial Data Detection Heterozygote Detection Qualty based Trimming sequence based Trimming Alignment Reference VectorOther Sequence Files es Distance fram End Left 5 25 Mas H of Vector Other Sequences 2 zl Min Substring Length E H Enable Internal Matches Right 37 25 EX Save As Print Cancel Help Figure 4 16 Sequence based Trimming Tab GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 133 PN B40154AC Sequence
126. values for the active sample Dye Colors Toolbar The following example shows the Sequence Analysis modules Dye Colors toolbar For descriptions of the actions that occur when you click a toolbar icon see Table 4 12 AHRC HEGE EH E Figure 4 5 Sequence Analysis Module Dye Colors Toolbar GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 117 PN B40154AC Sequence Analysis Sequence Analysis Module Overview 118 Table 4 12 Dye Colors Toolbar Sequence Analysis Module Icon Description A Red is the default color assigned to the Adenine A nucleotide bases in the analyzed data red pane C Black is the default indicator assigned to the Cytosine C nucleotide bases in the analyzed black data pane G Green is the default color assigned to the Guanine G nucleotide bases in the analyzed green data pane T Blue is the default color assigned to the Thymine T nucleotide bases in the analyzed data blue pane N Gray is the default color assigned to ambiguous nucleotide bases in the analyzed data gray pane Batch Control Toolbar The following example shows the Sequence Analysis module s Batch Control toolbar For descriptions of the actions that occur when you click a toolbar icon see Table 4 13 lajm m Figure 4 6 Sequence Analysis Module Batch Control Toolbar Table 4 13 Batch Control Toolbar Sequence Analysis Module Icon Description Batch Analysis Analyze mu
127. with the product Table 3 Materials Required but not Supplied Sequence Fragment Analysis Analysis Refrigerated microfuge A Molecular Biology Grade sterile dH5O 95 v v ethanol dH50 70 v v ethanol dH50 oterile tubes 0 5 mL microfuge tubes 0 2 mL thin wall thermal cycling tubes or plates L 100mM Na EDTA pH8 0 500 mM Sigma Cat E7889 PCR enzyme and buffer Labeled primers available from Sigma and IDT or Integrated DNA Technologies Nuclease Free H20 non DEPC Treated Affymetrix 71786 or Thermo Fisher 10977 015 1M Tris HCI pH 8 0 Affymetrix 22638 for gene expression analysis The RNA Storage Solution Thermo Fisher AM7000 for gene expression analysis AmpliTaq Gold Thermo Fisher 4311806 for Human STR analysis Interrogation primers Purified PCR products Shrimp Alkaline Phosphatase and Exonuclease for SNP genotyping GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 383 PN B40154AC Maintenance and Diagnostics Consumable Items List The following table identifies additional equipment and supplies needed Table 4 Equipment and Supplies ltem Part Number GenomeLab GeXP Genetic Analysis System B31021 or B31022 Aluminum Foil Seal 538619 8 Well Cap Strips BioRad TCS 0803 or Corning 3742 3743 Pipettors P10 P20 P100 P200 and P1000 Aerosol Resistant Tips for P10 P20 P100 P200 and P1000 Microtube Centrifuge 365603 Microplate Centrifuge Thermocycler with H
128. yet been analyzed analyze the sample data set using the desired analysis parameters Select the PCR Product check box 1 and enter 0 0 for both the Analysis Start and Stop times 2 Select View Analysis Log to view the analysis log for the sequence result The analysis log appears in a pane at the bottom of the window GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC 145 Sequence Analysis Using the Sequence Analysis Module 146 Sequence Result Properties View method analysis alignment consumable general notes and property set information To view these properties l Select File Properties when a sequence result is open The Properties dialog box opens NOTE The Alignment tab appears in this dialog box only if you have performed an alignment on the open sequence result 2 Select the tab that displays the type of properties you want to view For details see the following topics General Tab on page 146 e Notes Tab on page 147 Property Set Tab on page 148 Method Tab on page 149 Analysis Tab on page 150 Alignment Tab on page 151 e Consumables Tab on page 152 NOTE To view detailed descriptions while using this dialog box click Help 3 When finished reviewing the properties click Close General Tab Use the General tab to view the general properties of the currently selected sequence result Analysis Alignment Consumables General
129. 0 880 9226 279 28 249 U 50ng ConA IND 3264122 ND ND USOnglPS 35586030 ND ND 35586050ND ND U 50ng PI 23761 700 30033 160 35436 450 29743 770 5842 752 19 644 U 50ng Untreated 20945 320 31767 760 34766 840 29159 970 7270420 24 933 Figure 7 27 Horizontal scroll bars appear as needed Exporting A Data File to the GeXP Quant Tool Perform the following steps to export a Data File to the GeXP Quant Tool l 300 Click the Export button Refer to Figure 7 27 A window similar to that shown in Figure 7 28 will be displayed GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Gene Expression GeXP Data Tool 8 GeXP Data Tool Save As CU Jo Main gt GexP Data Tool gt Data t4 Search Data Organize New folder di ConsoleApplication2 di CsvReader Ji Feasibility No items match your search di Gene Expression n ExportFormat di Main di ControlTemplateExamples dJi GeXP Data Tool i Data J Output Name Filename SIT BEANS Save as type GeXP Quant Tool input txt txt Hide Folders Std250ng 513633 10338 ND 11986 2330 19 440 Figure 7 28 Window displayed when Export button is clicked The file extension default is txt which is expected by the GeXP Quant Tool The txt file can also be opened in Microsoft Excel for further data analysis NOTE f the specified export file
130. 0 AEN 24933 n L Figure 7 26 Normalization of genes disabled The area of the window Figure 7 27 showing the list of gene names for normalization can be expanded to the width necessary to display the longest name GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 299 PN B40154AC Gene Expression GeXP Data Tool The width allocation for the two regions of the display can be adjusted using the adjusting control i e Splitter bar between the regions Horizontal scroll bars appear as necessary to enable viewing all of the data E Normalization Gene A Long Gene Name A Very Very Long G J CYP1A1 IFNb IFNg IL 10 IL 12p40 IL 2 IL 4 IL 6 IL 8 3 Kanr PPla TNFa Sample Name Rep 1 Rep 2 Rep 3 Mean Std Dev CV Std 015 63ng 1418056 1110 745 1414 286 981 029 510 625 152 050 Std 031 25ng 3594 996 5322 646 1577422 23 686 Std 125ng 27151 440 30393 28012970022 9772 USOngiPS 1799474001ND 79947400ND ND 37349 800 30549 660 7624473 24958 i U 50ng PI U 50ng Untreated 24062 680 27460 720 29707 090 27076 830 2841 720 10 495 A Very Very Long Gene Name Sample Name Rep 1 Rep 2 Rep 3 Mean Std Dev CV Std 015 63ng 1595 355 2904 941 3083 294 2527 863 812 485 32 141 Std 031 25ng 4644494 874559 18830 Stdi25ng 23847 070 29420 020 23402 250 25556 450 3353 336 13 121 Std 250ng 26136 910 39184840 ND 3266
131. 00 0 cece eee ee 205 6 4 Defining Fragment Analysis Parameters 0 0 2 0 0 0 m IIR 206 GONE teree ci eos dx ericisiueUPtbsdselu Ltcedeecubedudeddadu eie 207 PilatysiS VIC TOU TaD ds at Sono est tica ctus iot rice oim od e E ea e Hit ess taa eSI e SE Ed 208 Quantitation TaD ieu rares ugar iota clin ratos dnte opus dads ipie iri uad d E did 211 STR LOCUS TdS dD ucciso rc etc e teri o o mici RU ur a atrio eir 212 SNP LOCUS TAGS TaD edens mais unine a beim ode ete bubus oU Dd px tb EE 214 PO VAN COC r c ee tes ev ie oS dd dax eU tx doit oo eee a ae eas EE 216 6 5 Using the STR Locus Tag Editor 0 0 ccc ce RR IR 218 Nona Mp ae dein eames tie 2G edd date ee kate E ded tected averted ates Bade E 218 PCIE ID CAEI soso ne aet oit catre ade tbutaq as aceon eee are eS ara Ed ded 221 6 6 Using the SNP Locus Tag Editor ilis 225 Result SBLTIEGFITIQ ase dort Boedo eremo dec RE Dam E Pim ier Rod domed 226 Accessing the Result Set View 0 0 0 0 0 ccc RR RR 221 Applying Exclusion Filters to the Result Set Data 0 0 ccc ee 228 EIFE EXCISION FIO 5 arironti dered dota dnte dii aab Bb br Boedo Grand laedat arti ir eas 220 Viewing the SU Tie aacra m ertt eie dedos oet d t eru adotta ok ead etaed 229 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use xiii PN B40154AC XIV Customizing the Result Set View 0 00 000 229 VIEWING Electropner gram Dalai iua te rco ERE E da EA REEXEUR RET
132. 001 0 015 Ba 0025 Relative Signal Strength e D e an BB eo E c UM io SD nuo FOO 200 400 Fragment Size ri Figure 6 38 Placeholder Pictures You can edit or remove header text at will Use the header text provided in the Report Templates to identify the data objects that follow You can remove but should not edit the data object descriptions highlighted in gray because they are specifically coded to extract data from the database Do not overwrite the original report template doc files They contain a compilation of all available data objects for reporting Use loop delimiters or table iterations of similar data While the data object names may appear squashed in the report template if the data fits in the space provided the tables should look normal in the report Graph objects and graph placeholders must remain together for proper graph display Editing Graph Displays You can edit five features of the graph displays 1 X scale type 2 X axis scale 3 Y axis scale 4 Pane Count or Pane Width and 5 Dyes displayed To edit the graph l Right click the graph placeholder and select Format Object 2 Select the Web tab and create the following text DisplayOptions Your commands will go here X Scale Type The possible values for XScaleType are Default BySize and ByTime XscaleType only applies to electropherogram view Default allows the graph type t
133. 02231866 n 02 28 2009 18 45 48 00 pass i Default exPAnalysis Parameter 4 HI k Summary lt r Show Excluded Figure 7 1 Data files selected for the new study 2 3 Check if all the size standard peaks are called correctly All designed gene peaks in the multiplex should be present and called appropriately 279 Gene Expression Run Samples and Review Results in Fragment Analysis Result Set View 4 Deselect D1 D2 and D3 traces and show only D4 trace for a simple view of the data 5 Zoom in inside the Fragment Data window to view all the peaks generated from the GeXP multiplex Fragment D ata Raw Data Fragment List Current Inject Current Voltage Analysis Log Run Log Analysis Parameters Quantitation STR Locus Tags SNP Locus Tags Size Calibration Dye Matrices General Notes Property Set Method l4 k 245 697 76427 269 90000 4 E 325 82 80000 4 70000 60000 50000 4 Iz 2 F o L 291 05 Eaj A 40000 4 220 80 L 214 17 L 266 96 i 188 68 ii 212 97 om 84 59 P d 30000 1 172 52 is B 237 25 L 160 24 I 3214 08 20000 4 330 63 L 201 16 5 ii 281 22 198 97 10000 E 22447 Ji 20519 293 43 ll 90 24 163 56 1724 ze 16 222 66 236 18 253 22
134. 1 Selecting this option removes the trims from the sequence before you export it and replaces internal trims with the letter x Customizing Filename Extension To supply your own custom filename extension or none at all to exported files modify the CEQ ini file as follows GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 169 PN B40154AC Sequence Analysis Using the Sequence Analysis Module 170 NOTE If there is no Export section in the CEQ ini file export any sample file to generate the Export section then modify as needed Find the section EXPORT and add modity the appropriate entry TXT EXT for Text files default is txt SEQ EXT for SEQ files default is seq FASTA EXT for FASTA files default is fasta SCF EXT for SCF files default is scf PHD EXT for PHRED files default is scf phd 1 To have no file extension added set the entry to nothing make sure there are no spaces after the SCF_EXT Example Output FileName SpaSample To use a unique file extension add or modify the entry with the desired file extension do not place the leading dot the system will add it SCF_EXT scf v3 Output FileName SpaSample scf v3 To hide an entry and make the system use the default either delete or place an before it SCF_EXT SCFV3 Output FileName SpaSample scf Exporting Data to a Third Party Package CAUTION Verify that the third
135. 1 Lons nfo mojet Dniie Pinger Parameter LL A 17 401 G pars Locus nio modified Donki elapsum Parsrneters III A17 401 6 pass Lons rfc modd Defui Pinson Pasmens B 41750 G pass Locus nfo modied Donii ei Plralpsn Famoes sl 426 201 4 17 45 01 G Locus no modified Donki e Pluralpsn Parameters M 25 2014 17 400 Lons n o modied Defui eines Pasmens 425 201 4 17 85 00 Lacus nio modded Dalai e Pinspos Pasmans 04 25 2014 17 45 00 G pass Locus info modihed Daakia Panalpse Parameters 4 m 4 Show Escluded Figure 7 16 Selecting Reanalyzed Sample File for Review GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 291 PN B40154AC Gene Expression Set up Locus Tag and Allele IDs Review the electropherogram of the selected sample file to ensure that correct allele ID gene name and locus tag Multiplex name are tagged for each gene peak in the multiplex 347 232 88279 369 90000 errs err tet fei 50000 T Dye Signal A 3 H T Figure 7 17 Electropherogram after Reanalysis to Apply Allele IDs and Locus Tag 22 H am Re 258 11 TF2D Human Ref Fragment Data Raw Data Fragment List Curent Inject Current Voltage Analysis Log l Run Log Anales Parameters Quertitation STR Locus Tags SNP Locus Tags Size Calbrabon Dye Malnces General Notes Property Set Methodi For example for GeXP Human
136. 1 iow sr a we UY Es 9 NOTE When performing quality based and sequence based trimming quality based trimming is always performed first Open the Sequence Analysis module Open a result and select Analysis Working Analysis Parameters Click the Edit button to open the Sequence Analysis Parameters Editor Select the Sequence based Trimming tab Select the Perform Sequence based Trimming check box M and select the desired options Click Save As and save the new parameters Click OK Select Edit Trim Based on Sequence The analysis parameters created in the steps above should be listed If not click Use Stored Parameters and select the appropriate analysis parameters Click OK The following example shows the resulting base sequence and trace view after performing a sequence based trim Q9 CD04A G01 02091814NX 14235 52 4 03 Analyzed Data Fluorescence 13000 13250 13500 13750 14000 14250 14500 14750 15000 Data Points CTGATAACGACATCCTCAGTGATATCTACCAGCAAACGATCAATTATGTGGTCAGTGGCCAGCACCCTACGCTTTAAGGTGCTA TGCTTGATCGGCAACCTAATTTAGGGGTTTAGCACGTGTTTCTTCGCTACGGCGATGTTGTCCTTAAAACTAGCTACAGGATTG AGGAGTTAAAATGAAATCGAACCGTCAGGCACGTCA TATTCTTGGACTGGACCATAAARATTTCTAACCAGCGCAAAATAGTTAC CGAAGGTGACAAATCCAGCGTAGTAAATAACCCAACCGGCAGAAAACGCCCCGCTGAAAAGTAATTCATAACCATCAGTCCTCA ATGACGATTAAACACCATTGCCTGCGCAATGGTGTTTTTGTTTTTATCTGCTTTATACTTGAGGCCGACGCCCTGGCGGTAAAG CAAAGACGATAAAAGCCCCCCAGGGATGGATATTCAAAAAAGAGTGAGTGACATGGAACCAAAAACAAAAAAACA
137. 14 4 27 22 6 11 2014 4 27 22 6 11 2014 4 26 00 6 11 2014 4 26 00 6 11 2014 4 26 00 8 12 2014 7 28 46 7 24 2014 2 41 48 7 24 2014 1 26 52 8 24 2014 11 490 Figure 7 13 Select Allele Identification Type and STR Locus Tag GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 289 PN B40154AC Gene Expression Set up Locus Tag and Allele IDs 290 19 Select STR as the Allele Identification Type This will activate the STR Locus Tags tab 20 On the STR Locus Tags tab select Human Ref from the Available list as the STR locus tag for Human ReferencePlex Move it to the Selected area using the gt button 21 Click on Next button to continue Result Set View Results Excluston Filter Set L5TD GOT 050223186G L STD GEZ 0902231860 L STD GO4 0502231873 L STD G05_090223187G L STD G06_ 0802231876 L STD GO _ 0902231671 L STD G08_ 0902231882 L 5TD GOS 0602231 68c L STD G10_ 0902231 Ba LS TD G11 0302231582 2 2 27242009 6 45 4B PH 2 23 2003 64550 PM Date 2009 6 4552 PM 6 2008 6 46 02 Ph 2009 6 4604 Pra 6 4606 PM 646 10 PM amp 4614PM Pending 3 2009 46 16 PM Pending Date Analyzed Summary xv psp epos ar ee a Se pna Included 0 0 D 10 B Excluded 0 0 0 0 2 1 Total 0 0 0 12 7 Figure 7 14 List of Sample Files Selected for Re analysis 22 Click on the Analyze b
138. 19 00 05 5 2 2001 09 33 28 amp 17 nn1 1 5 n no D1181984 Default D228583 382387 D982157 D95938 DXS7132 GATA193AD7 D1S1679 D148599 D1181984 D228583 D382387 D982157 D95938 DXS7132 GATA193AD7 D1S1679 D148599 D1181984 D228583 D382387 D982157 D95938 Dx57132 GATA193AD7 D1S1679 D148599 D1181984 D228583 D382387 D982157 nacaaaoa Filter off NUM Menu Bar Provides access to all drop down menus Menu Bar Options on page 316 Toolbar Contains the icons that execute pre defined functions Toolbar Icons on page 321 Display Area Lists the files contained in the selected node otatus Bar Displays information concerning the current selection ptions The following example shows the Data Manager module s menu bar options File Edit 316 view Tools window Help GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Database Management Data Manager Module Overview The following topics describe each of these menus and their options File Menu Click the File menu to display its drop down menu as shown in the following example Eile Mew Ctrl M Mew Database Ctri B Open Ctri o Print Ctrl F Frink Setup Frink Screen j Delete Rename Properties Import Export Seb 4s working Database Exit Use the File menu to create a new project or database open a selected database delete a project or database
139. 2 Run Quantitative Analysis 8 The GeXP Quant Tool will generate the standard curve for each gene in the multiplex and calculate Gene Expression Values GEQs and Normalized Gene Expression Values GEQ Norm for each gene in the unknown samples During the analysis process the status of the analysis will be indicated by the status bar at the bottom of the window as well as green colored text inside the Processing Status box as shown in Figure 7 43 E GeXP Quant Tool l x Ein Ld lalyze 2 d Figure 7 43 Quantitative Analysis is in process 9 When the analysis is completed the status of the analysis will be changed from Processing to Success Refer to Figure 7 44 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 309 PN B40154AC Gene Expression GeXP Quant Tool FFA GeXP Quant Tool Fie Normale Analyze Help EIE Ai AE Files Standards file C iHumanBC txt Samples file CAHumanBC t Processing Status Number of Genes z5 Number of Normalization Genes 2 Status Success Figure 7 44 Analysis completed successfully 10 If any errors occurred open Help as shown in Figure 7 45 to determine the possible root cause of the errors H GeXP Quant Tool Fie Mormake Analyze Hep Files Standards filo CAiHumanBC td Samples fade C VumanBC bd Processing Status Number of Genes 25 Number of Normalization Ge
140. 2008 184602 H amp pass Default eXP nalysisParameters neos STD HOs O90222187F 02 29 2008154600 7H pes efaultG eXPAnalysisParameters LST Dee ei gets Dou else aramea EST 02231867 M NOMEN D8faultheXPAnalysisParameters L STD HO2 O90223186N i DetaultG e amp PAnalysisParameters L STD HO1_O90223186F 2 23 200318 45 48 1 pass DefaultGeXPAnalysisParameters L STD G12 0902231898 1 02 23720081 amp 45 20 G pass DefaultGeXPAnalysisParameters L STD G11_090223188 amp 2 sisi si F221 15 46 16 5 i DefaultGeXPAnalysisParameters L STD G10_090223188P 0 02723 2009 18 46 14 Default amp eXPAnalysisParameters L STD G09 0902231860 1 OR 2009 1 l i Default eXPAnalysisParameters L STD GO8 0902291 882 4 ees LUEAZA 2003 18 46 06 G eB LLL Deu er Anay saamaan L STD GUF 30223187T1 02 2372 a pass DefaultheXPAnalysisParameter L STD GO6_O90223187N 1 02722 pass DefaultGePAnalysisParameters L STD GOS_O90223187G 02 23 2009 18 46 00 G pass DefaultGeXPAnalysisParameters L STD G04 0902231873 1 02 2320 Default eXPAnalysisParameters L STD GO3_090223186U 02 23 2009 18 45 52 G pass DefaultGeXPa nalysisParameters L STD GO2_0902231860 1 0272372009 18 45 50 G pass peau e nsu ne arametere L STD G01_ 09
141. 22 39 aa Mo No 13 A 254 1 00 36 22 46 250 No No 14 G l 253 1 00 36 22 54 aie No No 15 254 l 36 22 63 295 Mo No l A 249 l 1 00 d 22 70 314 No No 17 A 211 4 1 00 dq a2 15 331 No No l8 A 251 1 00 q7 aa ul 347 No No 13 G l 251 1 00 d 22 85 366 No No 20 A 252 1 00 36 22 493 384 No No al A 246 Z 0 959 Ep 23 00 403 No No aa 233 a 0 959 aa 23 06 421 No No 23 A 234 l 0 95 l4 23 l 438 Mo No ad C 246 4 0 52 lz 23 14 451 Mo No ab T 252 0 97 Le 23 26 Ars No No 26 G 0 z53 0 38 l 23 29 495 No No 27 254 0 97 l 23 37 513 Mo No G l aoa a 3l amp 3 44 537 No No Figure 4 39 Quality Parameters Report The following table describes the categories on the quality parameters report Table 4 28 Quality Parameters Report Categories Number Number of the Called Base Base single letter designation of the called base A C G T or other IUB code A Base identity score assigned by the base caller ranging from 0 255 C Base identity score assigned by the base caller ranging from 0 255 G Base identity score assigned by the base caller ranging from 0 255 T Base identity score assigned by the base caller ranging from 0 255 Call Score Calculated probability of correctness indicated on a linear 0 00 1 00 scale Quality Value Probability of correctness presented on a logarithmic 1 100 scale Migration Actual migrat
142. 24 Opened Input Data File Normalization of Genes The GeXP Data Tool will display a list of Genes included in the source data file and will also allow selection of one gene from the list as the normalization gene The normalization is correlated by Sample name and Replicate To enable Normalization perform the following steps l Select the check box next to Normalization Refer to Figure 7 25 298 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC ACTb CYP1A1L GAPDH IFNb IFNg IL 10 IL 12p40 IL 2 IL 4 IL 6 Sample Name Std 015 63ng Std 031 25ng Std 125ng Std 250ng U 50ng ConA U 50ng LPS U 50ng PI Rep 1 Rep 2 Rep 3 Mean Std Dev 96CV 0 135 0 162 0 029 30 618 12539 9075 ND 10807 2449 2305 ND ND 2305 ND 20356 ND ND 20356 ND 11329 7891 14198 11139 3158 283460 Gene Expression GeXP Data Tool er USOngUntreated 14 794 6517 6 002 9105 4934 s4194 Kanr PPla TNFa CYP1A1 Sample Name Rep 1 Rep 2 Rep 3 Mean Std Dev CV Std 015 63ng 0 893 0 393 0 272 0 519 0 329 63 395 Std03125ng 1612 1373 1207 1397 0204 14567 Stdl25ng 6595 5271 9871 7 246 2368 32684 Std 250ng 13633 10 338 no 11986 2330 19440 U 50ng ConA i USOnglPS 18444 ND ND 18444 ND 1710 29 143 U 50ng PI 1 Figure 7 25 Gene election for Normal
143. 3 in the plate The sample plate view identifies the sample as MySample A3 NOTE Position the mouse pointer over a named cell to display a tool tip that identifies both the sample name and Subject ID If you enter a Subject ID before entering a sample name the system automatically populates the Sample Name field which you can change at any time To name a single sample l Select the cell where the sample resides in the plate 2 Enter the name of the sample in the Sample Name text box and press the Enter key 3 Enter the Subject ID in the Subject ID text box and press Enter To name contiguous samples 1 Select the cells where the samples reside in the plate by clicking and dragging the mouse cursor Enter the name of the samples in the Sample Name text box and press the Enter key Enter the Subject ID in the Subject ID text box and press Enter Naming all Wells To name all wells in the plate l Click Select All 2 Enter the name of the samples in the Sample Name field and press Enter 3 Enter the Subject ID data and press Enter To name multiple non contiguous samples that are not within the same sample set Click on the first cell Press and hold the Ctrl key while selecting the additional samples Enter the name of the samples in the Sample Name text box and press the Enter key pude Meo Enter the Subject ID in the Subject ID text box and press Enter The plate editor displays each edited cell with a
144. 4 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Getting Started Operating the System Creating a Database and Project Folder Opening the Data Manager Module From the Main Menu click on the DATABASE icon and verify that the Data Manager window is displayed Creating a Database To create a database l In the Data Manager window select File New Database The New Database dialog box opens Enter the name for this new database Select Set as Working Database Click OK Creating and Naming a Project Folder To create and name a project folder In the Data Manager window highlight the database where the project will reside and select File New Highlight the new project and select File Rename Enter a descriptive name for this project and press Enter Select File Exit to close the Data Manager module Setting up a Sample To set up a sample Yt ce e qw eee SPSS TSE From the Main Menu click the SETUP icon and verify that the Sample Plate HiPRRRE Selection dialog is displayed Select the Create a new sample plate radio button and click OK Set up the sample plates by naming the desired cells Add any associated notes or property information Select a method from the drop down menu at the bottom of the sample set Select the appropriate analysis parameters as well as report and export parameters if needed Enter the barcode in the
145. 4AC Gene Expression Run Samples and Review Results in Fragment Analysis Result Set View Click on Analyze to start the data analysis When the analysis is complete the status column will indicate if the analysis succeeded or failed for each sample in the Study Click on Next to proceed Click Finish to complete the process of creating the new study The data files in this study will be presented in a table under Result Set View From File Save Study As save the new study with a new name For creating a new study with previously analyzed results perform the following steps Click on the circle next to Analyzed Results Click on the OK button to continue Select interested data files from the appropriate project Click the Finish button to complete the process of creating the new study The data files in this study will be presented in a table under Result Set View From File Save Study As save the new study with a new name Review Data in Result Set View In Result Set View double click on one of the data files to view the electropherogram of analyzed fragments Result Set View loe Results Exclusion Filter Set result date analysis paran iNew Result Filter Set 3 ad Appl Ld STDHOT 09022167R 00s 02 23 2009 18 46 04 H pes t DefautG eXPAnalysisParameter Nomi STD HOB 0302231874 1 02 23
146. 54AC Gene Expression Run Samples and Review Results in Fragment Analysis Result Set View pes pani NI pore jp pee pan piii pati Figure 7 3 Exclude data files from the study GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 281 PN B40154AC Gene Expression Set up Locus Tag and Allele IDs 7 4 282 Set up Locus Tag and Allele IDs The fragment results created through default GeXP analysis parameters in the Fragment Analysis module contain information on fragment size peak height and peak area Labeling each gene peak with the gene name makes the results more meaningful to scientists working on gene expression experiments It also facilitates sharing results with coworkers and collaborators Labeling a gene peak with its corresponding gene name can be achieved by setting up locus tag and allele IDs through a process named binning For each multiplex setting up locus tag and allele IDs only needs to be done once on a GeXP system After that the allele IDs can be applied automatically to the the new data generated with the same multiplex by selecting the locus tag as an STR locus tag during analysis Perform the following steps to setup the Locus Tag and Allele IDs l From the Analysis menu select the New Binning Analysis command Refer to Figure 7 4 Feet ky Wes Say esd a 36 SIATATGTSTISTW T8 1 7 File View Results Analysis Reports Window Help le x
147. 7 390 15262 650 52 256 U song LPs 72440530 ND ND 72440530 ND U 50ng Untreated 30470 600 46521 250 49207 030 42066 290 10131 560 24 08 Figure 7 29 Pop up Window from About Button Help Button The Help button displays the instructions for use with the GeXP Data Tool Refer to Figure 7 30 e per ls 37 GeXP Data Tool About Help jl Help ec l ini E Help for GeXP Data Tool F Description System Requirements How To Use The GexP Data Tool Application status Input File Assumptions And Limitations Sample Naming Software Updates Rollback and Uninstall Errors and Error Messages Description The GeXP Data Tool manipulates data exported from the GeXP Fragment Application to be appropriate for input into the GeXP Quant Tool This application collects by Gene the replicate fragment data for Standards and or Samples and computes simple statistics for that replicate data It also allows normalizing the fragment data by one of the genes present in the input Figure 7 30 Instructions Within Help File 302 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Gene Expression GeXP Data Tool Calculation and Formulas Mean The mean is calculated using the normal formulation for arithmetic mean Mean SUM replicate value count of replicate values NOTE Replicate values shown as ND are not included in the Mea
148. 78 seq Test AO4 0603071 Seq lest ADS 06030120 seq TestADS 060301 al seq Test B03 _0603011 seq Test BO3 OBDGUTTE seq Test BO4 DBDGUTTE Seq lest BO4 DBDGUTTE seq Test BUS 060301 al seq Test 605 060301 at seq Test C03 DOBDGUTTE seq Test C03 OBDGUTTE Seq Test CO3 DBOUTTE Figure 5 6 Open Sequence Results Dialog Box 5 If two results are in different projects select none as the Project Name to display all available results files for a given database A new window opens NOTE By default the standard navigator dye color and discrepancy map toolbars appear docked If they are not displayed select View Toolbars and enable the desired toolbar GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC 181 Sequence Investigator Module Sequence Investigator Procedures Numbering Base and codon numbering start at the beginning of the reference sequence The system uses these numbers as a navigational reference point The column position numbering begins at the first base in the comparison This may be a reference base a sample sequence base or a consensus base depending on the alignment of the sequences being compared The selected column number appears in the lower right hand corner of the status bar The History Log records all edits made in the Sequence Investigator and their column number Viewing Reference Amino Acid Translations When the system generates the compa
149. AFLP 06 Exit Use the File menu to create open save import export view properties and print sample plates The following table describes the Sample Setup module s File menu options Table 2 2 File Menu Sample Setup Module Option Description New Opens an empty sample plate Open Select an existing sample plate to open Close Closes the selected sample plate Save Saves the current sample plate Save As Save the sample plate with a new name Import Import a sample plate tab delimited ASCII text TXT format Export Export a sample plate tab delimited ASCII text TXT format Properties Provides an information window concerning the active sample plate Default Report Format Print Preview Print Setup Print Print Screen Define the report formats for new and imported sample plates Displays a facsimile of a hardcopy printout of the active sample plate Define printer properties Displays a sub menu from which you can choose to print a detailed report of the active sample plate the contents of the sample plate the plate summary or the selected method Displays a sub menu from which you can choose to print an image of the computer desktop or application window to the printer GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 25 Sample Setup Module Overview 26 Table 2 2 File Menu Sample Setup Module Option Description Lock Use this option to prevent editing of the currently disp
150. AGTAATTCATAACCATCAGTCCTCA ATGACGATTAAACACCATTGCCTGCGCAATGGTGTTTTTGTTTTTATCTGCTTTATACTTGAGGCCGACGCCCTGGCGGTAAAG CAAAGACGATAAAAGCCCCCCAGGGATGGATATTCAAAAAAGAGTGAGTGACATGGAACCAAXHXHXHXHXHKXXAGCGTTCGCT TTATATCCCTTACGCTGGCCCTGTACTGCTGGAATTTCCGTTGTTGAATAAAGGCAGTGCCTTCAGCATGGAAGAACGCCGTAA CTTCAACCTGCTGGGGTTACTGCCGGAAGTGGTCGAAACCATCGAAGAACAAGCGGAACGAGCATGGATCCAGTATCAGGGATT CAAAACCCGAAATCGACAAACACATCTACCTGCGTAACAT Figure 4 22 Base Sequence and Trace Views after Sequence based Trimming Enable Internal Matches Batch Trimming Enable automatic trimming of a large number of results To perform batch trimming l Open the Sequence Analysis module 2 Select Analysis Batch Trimming 3 Select the Sequence Results or Sample Plate Results tab 4 Select the results to be trimmed 1 40 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Sequence Analysis Using the Sequence Analysis Module 5 Click the right arrow to move the selected results to the selected list box Batch Trimming Selection Ea Sequence Results Sample Plate Results Database 032206 CEG TROLIBLESHOU Filter Start Date 07 21 2005 Enable End Date 72 2005 Refresh Mame D ate Time Sequence Test 403 0603012257 Sequence TesLAUS 03 02 06 03 52 514M sequence Test B03 060301 2252 Sequence Test B05_ 03 02 06 03 52 56AM o D ae Sequence Test CO5_ 03 02 06 03 53 024M iili Test E03 DED3DI 2067 Sequence Test D5 03 02
151. AO1 050327114 03 27 2006 11 18 04 ricco H w H pa Hina H vrp gm F Summary Show Excluded Data G Ready Figure 6 1 Main Window Fragment Analysis Module The following table describes the items called out in Figure 6 1 Table 6 1 Main Window Fragment Analysis Module Option Description A Title Bar Shows the module name Fragment Analysis and the name of the currently open Study B Menu Bar See Menu Bar Options on page 191 C Display Area Graphically displays the opened data D Toolbar See Toolbar Icons on page 196 E Dye Colors Double clicking on a dye color opens the Color dialog box Change the dye color displayed for that particular dye Clicking on the dye name D1 D2 D3 D4 removes that dye trace from all traces F Study Explorer Displays and provides access to all of the parameters available in the selected Study These are divided into the tabbed sections Analyses Data and Reports which you can select at the bottom of the Study Explorer frame G Status Bar Displays information concerning the current selection 190 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC GenomeLab G PN B40154AC Fragment Analysis Module Fragment Analysis Module Overview Menu Bar Options The following example shows the Fragment Analysis modules menu bar options File View Results Analysis Reports Window Help The following topics describe ea
152. Apparent Size Slopejs 1 00087 y intercept 0 2175 0 99999179 inning Lacus Tag Source Data EZR QREMER NrFisMipe PED eee PTT TTT Relative Signal Strength LIN RPLA 23101 7 1 2H 18s ANA 22 ed 22080 01i 18 e LIbcHEB 225 i i i 1 Phase Shift EX Min Rel Peak Height 0 4 Show Phantom Bins Help lt lt Previous Finish Cancel Figure 7 9 Rename Allele IDs During Binning Process A new display window will allow you to create the Locus Tag and Locus Name 286 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Gene Expression Set up Locus Tag and Allele IDs New Binning Analysis coef fmt Steps Parameters Locus Tag Human Ref Binning Project Default Date last modified Locus Tag E Source Data Locus Tag Allele ID Criteria Locus Information Ancillary Information Locus Mame Human Rel Primer set name Dye AM GenBank Accession Fragment length range between oe 220 Repeat unit sequence Repeat unit length 1 nt E Ploidy 2 of repeats in shortest Allele 1 2 2 Primer Label Primer Sequence C Eowad Forward Tod CR eis Reverse 5103 amp None Allele List Comment Help lt lt Previous Einish Cancel Figure 7 10 Enter Locus Tag and Locus Name 12 Select the Locus Tag tab and set the parameters as follows Locus name The Locus Tag and the Locus Nam
153. Brackets and enclosing a set of characters indicates that any of the enclosed characters may match the target character e To search for the text regardless of case select the Ignore Case check box lvl e To search for the exact match for text not the IUB codes select the Exact Match check box Iv e To search for text within a range highlight the range of interest in the base sequence pane and select the Search Highlighted Range check box M GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Sequence Analysis Sequence Analysis Module Overview The following table identifies the IUB codes you can enter to find the corresponding bases when the Exact Match check box is clear Table 4 15 IUB Codes C9 Bases G A T orC G A or C G T or C A T or C G A or T GorT G or C Aor T A or C CorT A or G d zmEim iox Ioirugej izx GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 121 PN B40154AC Sequence Analysis Using the Sequence Analysis Module 4 2 Using the Sequence Analysis Module Run a sequence analysis and set up its parameters result properties and display options then work with report and export sequence analysis results Click the Sequence Analysis icon Viewing Sample Data To view sample data 1 Click on Sequence Analysis then select File Open The Open dialog box opens as shown below Open Ea Opt
154. Control Cover 4 Captive Screw open 2 Plenum Assembly 5 Manifold Access Cover removed 3 Manifold Access Cover 6 Loosen the two plenum assembly captive screws Figure 9 33 pull the plenum assembly straight back and away from the instrument and set it aside CAUTION Slowly remove the plenum assembly as the electrode block may disengage from its mounting posts and become damaged 362 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Maintenance and Diagnostics Direct Control and Replenishment n CENA S A Q a 901713L Al Figure 9 33 Plenum Assembly Removal 1 Captive Screw 3 Plenum Assembly 2 Rubber Latch 4 Captive Screw Lift the plenum assembly Figure 9 33 to release the Array Fitting Grasp the Array Fitting tab Figure 9 33 and then a Pull the fitting approximately one inch out of the manifold b Touch the tip of the fitting to the bottom of the optics base plate c Hold and wait five seconds for the gel strand to dry d Pull the fitting away from the instrument e Wipe gel strands off of the instrument using a damp tissue NOTE Note the number of runs and days on the instrument for this capillary array for reference If this capillary array is to be re installed this information is necessary A label has been provided on the back of the array packaging container so that this information may be recorded GenomeLab Genetic Analysis System User s G
155. Dialog Box 2 Use the Gel Cartridge Buffer Information dialog box Figure 9 30 to view the following information e Part Number Displays the part number of the installed gel cartridge e Lot Number Displays the lot number of the installed gel cartridge The lot number is used to track the gel lot along with the separations that have used the gel Gel Name The name of the gel e Date Installed Displays the date the gel cartridge was installed e Time Installed Displays the time the gel cartridge was installed e Hours on Instrument Displays the number of hours that the gel cartridge has remained on the instrument 3 When finished select OK to close the window Viewing or Changing Buffer Information 1 Select Replenish Gel Cartridge Buffer Information from the Run Module menu bar 2 Use the Gel Cartridge Buffer Information dialog box see the figure above to view or change the buffer lot number NOTE The buffer lot number can only be changed when the instrument is not performing a separation Removing and Replacing the Capillary Array CAUTION Take care when installing removing the capillary array to prevent damage and maintain low background signals Clean all gel residues thoroughly NOTE This procedure assumes that an expended capillary array is being replaced with a new capillary array 360 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC GenomeLab Genetic Analysis Sys
156. Dye D4 Fragment Range 149 to 340 fragments size ranging from 150 338 nt e Maximum Bin Width 1 Maximum Data Points Per Bin 2 e Repeat Unit Length of Allele 1 e Allele Naming Convention Alphabetic 3 Click Next The new parameters will be applied to the scatter plot and the bins will be assigned as specified and the results of the binning analysis will be displayed GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 283 PN B40154AC Gene Expression Set up Locus Tag and Allele IDs New Binning Analysis Steps Bin View Trace Views Nominal Size vs amp pparent Size Slopej 1 00091 yintercept 0 2226 r 0 S9999060 266 606 0 001 Parameters Binning Locus Tag Source Data lt 2 a a m w o 5 PU n Allele List __1D__ Nominal Size nt Apparent Size nt Std Dev nt 154 18 0 15911 i mi icirimimimioioim 4 Phase Shift 0 Min Riel Peak Height 0 01 Show Phantom Bins lt lt Previous Cancel Figure 7 6 New Binning Analysis Window The New Binning Analysis is composed of the following three areas representing the selected results Bin View A scatter plot showing the Fragment Size x axis vs the Relative Signal Strength y axis Trace View Traces to be displayed are selected by clicking on a point in the bin view e Allele List Developed and carried over from previous views When the ana
157. E a aa cal oh 229 C aly ZI RESUS sspe discurrit eo Gitte recte beg beat E Dar run teo Rd 234 6 7 USMO Fragment EISIS ere oss eere rri hr EP LEeRMPEERer eer pruPiee4 E E en Gna Beast 231 Accessing the Fragment List View 0 0 0 0 cc cece RR a 23 Applying Exclusion Filters to the Fragment List 230 Available EXClUSION FIETS oai n x SR eec epe dd E wer EIE XXTR E C do 230 Customizing the Fragment List llle RR RRRRRRRR ee 238 Manually Selecting Peaks for the Fragment List 0 0 0 0 230 Exporting a Fragment List to CSV File isses RR RR RII 238 Showing a Stacked Graph RR n 239 Including Excluding amp Resetting Peaks in the Fragment List 0 008 239 6 0 PeL TOFTROROBITICATERLIVS IS 45e ur Sc aid nasi ose he ee yA ERR Lee iau 239 SOLO upa BI ANGI SS coco ecc itur ea rani acil dioere d steps pa Qe er dead du dide 239 LOT GPA ACTON Sc es fo vicky crete fat d eset d estetico de doti a 240 VIEWNO BITANAIYSI Ss sas Saeco ay hei eros oie aus Boite eoace reu dus tte dee A EA 241 InvesHgatim POIFls essa ders serate e uos diet iran v ees coetu urs e e Sob eds 242 Updating the Locus Tag and Allele List lillsee en RRIRRRRIIR 243 Reviewing the Source Data 0 n RRRRRRRRRRRRRRRRRRR RII 244 5 9 Calculating Peak Hall ss auc nete esr dn ad OSA TED END Reed a eo ord en o t 245 Beginning a Peak Ratio Calculation lisse RRRRRRRRRRRRR IRR 245 selecting a Reference Trace 0
158. F S E L W L W D Iv Ambiguity 7 VII VIIIF 12 2 txt GG AAT CTC CTT ACT GCT CCC ACT CAG TTT CT TTT CTC TGG CTT TGG GA M Disagreement i 15 16 G612 06042419BG GG AAT CTC CTT ACT GCT CCC ACT CAG TTT CT TTT CTC TGG CTT TGG GAI E a un 15 16b G01 06042419BB GG AAT CTC CTT ACT GCT CCC ACT CAG TTT BcT TTT CTC TGG CTT TGG GA Single Loyerage 7 Mutation Hotspot MJ Differences F Low Guality Consensus GG AAT CTC CTT ACT GCT CCC ACT CAG TTT CT TTT CTC TGG CTT TGG GA Manual Edit Consensus AA Translation G T S L L L P L S F L F S G F G T 4 4 gt r Consensus Text Search n jm a Exact Match 15 16 612_06042419BG Reverse F IH 3 ww m Consensus 3 5 Called Base c T Quality Value fig Differences lt Help 4 Rucrescerce S700 5750 S300 S350 5500 555 Mismatch Ambiguity Disagreement Insertion Deletion Mutation Hotspot Low Quality Manual Edit We Figure 5 1 Main Window Sequence Investigator Module The following table describes the items called out in Figure 5 1 Table 5 1 Main Window Sequence Investigator Module item Description A Title Bar Shows the module name the active document name and has the standard minimize maximize El and close icons at the top right of the window Menu Bar See Menu Bar Options on page 173 standard Toolbar See Toolbar Icons on page 177 Display Window Use this area to graphically display the speci
159. Find Match Substings es Find Local Alignment Mo Lett Edge Free Yes Right Edge Free Yes Min Substring Length 30 Figure 4 31 Analysis Tab Properties Dialog Box NOTE This tab is visible only if an alignment has been performed on the sequence result GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 151 PN B40154AC Sequence Analysis Using the Sequence Analysis Module Consumables Tab View the status and identity of the capillary array the gel and the buffer information Select File Properties Consumables Properties Eq General Mate Property Set Method Analysis Alignment Consumables Capillary Array Serial Number 1102050078 Capillary Array Part Number 60808 Total Length of Capillary 33 0 cm Length of Capillary to Detector 30 0 em Internal Diameter of Capilar 75 0 pm Number of Runs 2 Days on Instrument 0 1 days Gel Part Number 60801 0 Gel Lot Number 5601051 Gel Algarithm Type T Hours on Instrument 2 hours Buffer Part Number B0501 2 Buffer Lat Number CEQ Sequencing Separation Butter Figure 4 32 Consumables Tab Properties Dialog Box 1 52 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Sequence Analysis Using the Sequence Analysis Module Setting or Changing Display Options To set or change the graph data display options l Openthe Display Options dialog box using one of these methods e Select
160. For n Vitro Diagnostic Use PN B40154AC Mean Std Dev 96 CV Replicate 1 Replicate 2 Replicate 3 GEQs Normalized to Gene Figure 7 49 GEQ Normalized Values and Bar chart for Gene 1 Performing Fold Change Calculation Gene Expression GeXP Quant Tool As shown in Figure 7 50 fold change for each gene between different samples are performed by dividing the GEQ normalized value for a Treated sample by the GEQ normalized value for a Control sample Alternatively fold change can be calculated by dividing the GEQ normalized value for a Tumor sample by the GEQ normalized value for a Normal sample Fold change Treated GEQnorm value Control GEQnorm value Fold change Tumor GEQnorm value Normal GEQnorm value Figure 7 50 Fold Change Calculation GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC 313 Gene Expression GeXP Quant Tool 314 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC 0 1 Data Manager Module Overview Create save and modify databases These databases can contain any of the following data types Filter Sets Fragment Analysis Parameters Fragment Results Methods Optical Scan Data Sample Data Sample Plates Sample Plate Results Sequence Analysis Parameters Sequence Results SNP Locus Tags Standards STR Locus Tags GenomeLab Genetic Analysis System User s Guide For n Vitro
161. GCATCACOICAr ATCCAGTACTGTTACTGATTTTTTC TTTTTTAJAC CCT CiGGATGTGGTATTCCTAATTGAACTTICCCAGAAGTCTTGAGTTCTCTTATTAAGTTCTICTGAA ATCTACTAATTTTCTCCATTTAGTACTGTCTTTTTTCTTTAT GGCAAAT ACTGGAGTATTGTATGGATTTTCAGGCC CAATTTTTGAAATTTTCCCTTCCTTTTCCATTTCTGTACAAATTTCTACZTAATGCTTTTATTTTTTCTTCTGTCAAT au C ATTGTTTAACTTTTGaGaCCATCCATTOCTGGCTTTAATTTTACTGGT ACAGTTTCAAT AiGACT AAT GGG KNOWN AA MUTATIONS Kl57EQx 612595 AlG60R Ll16l1v L1524A AlG6sEGVv Floe4y Fl65IL P1665 xXl6 IM 21686 P169L Fl lAs L1 2P Dl sL El 4dG Pl75LOG KNOWN BASE MUTATIONS GJEN CABON T492N T493N ASQIM GSLON CS11lN Reference Sequence TGGTGTO Amino Acid Mutations KNOWN AA MUTATIONS Known Amino Acid Notation 2K Base Mutations KNOWN BASE MUTATIONS Known Base Notation 9 Asc Figure 5 4 Sample Reference NOTE The system creates a default Reference folder during software installation You may store your reference files in that location or in any other folder When you create a new comparison navigate to the appropriate folder to select your reference Selecting a Reference and Sequence Results 2 Open the Sequence Investigator module Select File New An Open dialog box appears listing the contents of a reference folder GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Sequence Investigator Module Sequence Investigator Procedures 3 Select the sample reference and cl
162. GCCCCGCTGAAAAGTAATTCATAACCATCAGTCCTCA A TGACGATTAAACACCATTGCCTGCGCAATGGTGTTTTTGTTTTTATCTGCTTTATACTTGAGGCCGACGCCCTGGCGGTAAAG CAAAGACGATAAAAGCCCCCCAGGGA TGGA TATTCAAAAAAGAGTGAGTGACATGGAACCAAAAACAAAAAAACAGCGTTCGCT TTATATCCCTTACGCTGGCCCTGTACTGCTGGAATTTCCGTTGTTGAATAAAGGCAGTGCCTTCAGCATGGAAGAACGCCGTAA CTTCAACCTGCTGGGGTTAC TGCCGGAAGTGGTCGAAACCATCGAAGAACAAGCGGAACGAGCATGGATCCAGTATCAGGGATT CAAAACCCGAAATCGACAAACACATCT Figure 4 20 Base Sequence and Trace Views after Sequence based Trimming NOTE To recover the original sequence after performing Apply Sequence based Trimming select Edit Undo Internal Trimming Select the Enable Internal Matches check box M on the Sequence based Trimming tab to trim subsequences from within the sequence To exclude a subsequence from final removal right click on the subsequence and select Vector Other Subsequences subsequence where subsequence is the subsequence name 138 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Sequence Analysis Using the Sequence Analysis Module NOTE The system removes only the selected subsequences from the sequence when you apply trimming Q9 CD04A G01 02091814NX Analyzed Data Fluorescence 1500 Data Points CTGATAACGACATC C Export Data 7 CPAAACGATCAATTATGTGGTCAGTGGCCAGCACCCTACGCTTTAAGGTGCTA TGCTTGATCGGCAA Import Data ACGTGTTTCTTCGCTACGGCGATGTTGTCCTTAAAACTAGCTACAGGAT TG AGGAGTTAAAATGAJ E EE TCATATTCTTGGACTGGACCATAAAAT T
163. GCGTTCGCT TTATATCCCTTACGCTGGCCCTGTACTGCTGGAATTTCCGTTGTTGAATAAAGGCAGTGCCTTCAGCATGGAAGAACGCCGTAA CTTCAACCTGCTGGGGTTACTGCCGGAAGTGGTCGAAACCATCGAAGAACAAGCGGAACGAGCATGGATCCAGTATCAGGGAT T CAAAACCCGAAATCGACAAACACATCTACCTGCGTAACAT Figure 4 19 Base Sequence and Trace Views after Sequence based Trimming GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 137 PN B40154AC Sequence Analysis Using the Sequence Analysis Module Applying Sequence based Trimming If the trimming is acceptable select Edit Apply Sequence based Trimming to remove the trims from the sequence The following example shows the resulting base sequence and trace view after applying sequence based trimming NOTE When applying sequence based trimming quality based trimming is automatically applied first if quality based trimming was performed Q9 CDU4A G01 02091814NX 15046 40 4 42 Analyzed Data 40 TT TGCCGGA AGT GG TC GAA ACC A TC GA AGAA CA A GCG GA AC GAGC A TGG A TCC AG TA TCA GGG A TT CA A AACCCG A AATC GACA AACACA TC T TM D e ut nda Fluorescence h o 13000 13250 13500 13750 14000 14250 14500 14750 15000 Data Points CTGATAACGACATCCTCAGTGATATCTACCAGCAAACGA TCAAT TATGTGGTCAGTGGCCAGCACCCTACGCTTTAAGGTGCTA TGCTTGATCGGCAACCTAATTTAGGGGTTTAGCACGTGTTTCTTCGCTACGGCGATGTTGTCCTTAAAACTAGCTACAGGATTG AGGAGTTAAAATGAAATCGAACCGTCAGGCACGTCATATTCTTGGACTGGACCATAAAATTTCTAACCAGCGCAAAATAGT TAC CGAAGGTGACAAATCCAGCGTAGTAAATAACCCAACCGGCAGAAAAC
164. GGA 226 AAC CTG TCG TGC CAG CTG CAT TAA TGA ATC GGC CAA CGC GCG GGG AGA GGC GGT TTG CGT ATT GGG CGC TCT TCC 301 GCT TCC TCG CTC ACT GAC TCG CTG CGC TCG GTC GTT CGG CTG CGG CGA GCG GTA TCA GCT CAC TCA AAG GCG GTA 376 ATA CGG TTA TCC ACA GAA TCA GGG GAT AAC GCA GGA AAG AAC ATG TGA GCA AAA GGC CAG CAA AAG GCC AGG 451 ICGT ARA AAG GCC GCG TTG AGG_CTC For Help press F1 Figure 4 1 Main Window Sequence Analysis Module The following table describes the items called out in Figure 4 1 Table 4 1 Main Window Sequence Analysis Module Item Description Title Bar Shows the module name Sequence Analysis and the currently active sample Menu Bar See Menu Bar Options on page 105 Toolbar See Toolbar Icons on page 114 Display Area Graphically displays the opened data molol w 2 Double clicking on a base sequence text letter A C G T in the Dye Colors toolbar opens the Color dialog box which you can use to change the dye color displayed for the selected dye 1 04 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Sequence Analysis Sequence Analysis Module Overview Table 4 1 Main Window Sequence Analysis Module Item Description Analyzed Data Displays the data that has been analyzed for the active sample Base SequenceDisplays a text view of the bases from the analyzed data for the active sample Raw Data Displays the raw data for the active sample Current
165. GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC 6 3 Fragment Analysis Module Working with Studies in the Fragment Analysis Module Database Size Warning If a database is selected that is greater than 1700 megabytes the following warning message will appear if you try to perform additional data analysis steps Run Control e The size of the current working database is greater than 1700ME To maintain system performance it is recommended that vou create a new database before proceeding System is aborting this sample plate operation Figure 6 5 Database Size Warning Working with Studies in the Fragment Analysis Module A Study is a set of multiple sample results together with the results of analyses performed on the group of sample results You can use the Study Wizard to create a new Study easily The Study Wizard guides you through the process of creating a new Study starting from either raw data or previously analyzed fragment results The Study window opens automatically when you start the Fragment Analysis module You can open a new or existing Study immediately from this window or at any time while working within the Fragment Analysis module GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 199 PN B40154AC Fragment Analysis Module Working with Studies in the Fragment Analysis Module To access the Study window select File New Study or Fil
166. Home Page The following table describes the Help menu options Table 5 6 Help Menu Sequence Investigator Module Option Description Help Topics select this option to display the CE system online help By default the help system displays the Contents in the navigation pane located on the left and the introductory topic in the topic pane located on the right You can use the Contents to select and print specific help topics The navigation pane also provides a Search tab and an Index tab These tabs let you search for information by topic index entry and or keyword Using Help select this option to display the Contents window on how to use the Windows Help system 1 76 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Sequence Investigator Module Sequence Investigator Module Overview Table 5 6 Help Menu Sequence Investigator Module Option Description About GenomeLab Select this option to access software instrument and system information system Beckman Coulter Select this option to access the Beckman Coulter Home Page on the Internet Home Page Toolbar Icons The toolbars provide quick and easy access to commonly used menu items Each toolbar contains icons that correspond to commonly used menu items Click the icon to execute the function By default all the toolbars appear when you first open the module Standard Toolbar Icons The Sequence Investigator module standar
167. Instructions For Use GenomeLab GeXP Genetic Analysis System User s Guide For In Vitro Diagnostic Use Rx Only Now sold through SCIEX Separations www sciex com ce SCIEX B40154AC November 2014 Ti B Beckman Coulter Inc ea COULTER Brea CA 92821 U S A User s Guide GenomeLab GeXP Genetic Analysis System For In Vitro Diagnostic Use PN B40154AC November 2014 O 2014 Beckman Coulter Inc All rights reserved Beckman Coulter Inc grants a limited non exclusive license to the owner or operator of a GeXP instrument to make a copy solely for laboratory use of any portion or all of the online help and electronic documents shipped with the GeXP instrument Beckman Coulter and the stylized logo are trademarks of Beckman Coulter Inc and are registered in the USPTO All other trademarks are the property of their respective owners Find us on the World Wide Web at www beckmancoulter com Printed in USA SCIEX Separations SCIEX Instrument sold and serviced through SCIEX Separations a part of AB SCIEX www sciex com ce CE and LC taken to the next level consolidating expertise for more powerful separations Liquid chromatography LC and capillary electrophoresis CE are among the most powerful tools available to scientists today AB SCIEX is expanding the power of these technologies by combining the nano and micro liquid chromatography expertise of our Eksigent solutions and the micr
168. M DATS 93 D2 403_010605226D 6 5 2001 11 43 08 PM DATS 94 D2 B03_010605226D 6 5 2001 11 43 10 PM DATS 96 D2 C03_010605226D 6 5 2001 11 43 11 PM DATS 9 D2 D03_010605226D 6 5 2001 11 49 13 PM DATS 99 D2 E03_010605226D 6 5 2001 11 43 14 PM DATS 100 D2 F03_010605226 6 5 2001 11 49 16 PM DATS 101 D2 G03 10605225 5 5 2001 11 49 17 PM DATS 102 D2 H03_010605226 6 5 2001 11 43 18 PM Finish Cancel lt lt Previous Help Figure 6 7 Select Raw Data Window Selecting the Components of the New Study Use this window to select the raw data to be analyzed from a database of samples that have been run in a particular projects The system includes the selected raw data in your Study and analyzes it as described in the following steps NOTE To view an individual sample electropherogram and other collected parameters prior to adding the sample to your Study right click on a highlighted sample and select Show Single Sample View The List View and Plate View tabs provide you with two ways to select raw data Each selection method provides the same sample information presented in different ways Selecting Raw Data from the List View Tab The List View tab allows you to select from a list of samples contained in a specific database and or collected during a particular time frame l Select the List View tab in the Select Raw Data window 2 Select the project folder that contains the sample data that you wis
169. Main Menu Window Collapse Options Option Description Collapse to Toolbar Select this option to immediately collapse the Main Menu to display the Main Menu toolbar Always Collapse to Select this option v to set the Main Menu to collapse to the Main Menu toolbar Toolbar every time you open a software module from the Main Menu Selecting Always Collapse to Toolbar makes it the default setting instead of Always Collapse to Taskbar Always Collapse to Select this option Y to set the Main Menu to collapse to the Windows taskbar Taskbar every time you open a software module from the Main Menu Selecting Always Collapse to Taskbar makes it the default setting instead of Always Collapse to Toolbar From any application you can access the Main Menu by left clicking the Main Menu button located on the Windows taskbar Main Menu Toolbar Provides access to all CE system modules from any active application window By default the Main Menu toolbar provides a miniature version of software module icons as a horizontal toolbar as shown in the following example GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 13 PN B40154AC Getting Started Operating the System To move the toolbar click the title bar and hold the left mouse button while dragging the toolbar to another location When given enough space the toolbar becomes a two column vertical toolbar as shown in the following example The toolbar res
170. Multiplex Primer Design using NCBI Primer BLAST In Exon Intron selection For Exon junction span select Primer must span an exon exon junction e Check the box for Intron Inclusion and modify Min Intron length as needed For Primer Pair Specificity Checking Parameters e Check mark the box for Specificity check e Select Refseq mRNA as Database select appropriate organism Click on Advanced parameters hyperlink e Check mark the box for Primer binding site may not contain known SNP e Change Salt correction formula to Schildkraut and Lifson 1965 e Change Table of thermodynamic parameter to Breslauer et al 1986 Click on the Get Primers button to submit your search request Within a minute or two the NCBI web site will return search results that contain primer pair s information Assemble a Multiplex I he Start with designing primers for genes that require targeting to a specific region in order to detect desired number of transcript variants or to avoid pseudogene or highly homologous region among gene family members Set PCR product size range as 105 to 350 nt to generate multiple primer pairs Select the best primer pair based on evaluation of primer and amplicon sequences In a Microsoft Excel worksheet record the gene name the primer sequence primer positions the Tm for the forward primer Tm for the reverse primer and the amplicon size without universal tags
171. Murnber Total Lenath of Capillary Lenath af Capillary ta Detector Intemal Diameter of Capillary Purmber af Runs Days on Instrument Gel Part Number Gel Lot Murnber Gel Algorithm Type Hours an Instrument Buffer Part Number Buffer Lot Murnber Thu 6 26 03 10 27 43 Sy ster CEG 8080 Rev 0 Project Default Sy ster CEG 8080 Rev 0 testseq A04 0303051 8NG testSeqLong 234567891000 A4 LFF a CEQ 8080 ver 7 0 26 Defaulthequences nalysisP arameters BO 8087 33 0 em 30 0 em 75 0 um g 2 0 days 391438 CEQ Sequencing Gel 49 hours 60801 2 CEQ Sequencing Separation Buffer Figure 4 37 Sequence Results Report GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC 161 Sequence Analysis Using the Sequence Analysis Module 162 Displaying Quality Parameters in a Report To display the quality parameters in a report l Select File Report Format 2 Inthe Sample Elements section select the Quality Parameters option 3 Click OK Report Format Ea Printer Hame Microsoft Office Document Image Writer Properties Colors Status Ready Type Microsoft Office Document Image Writer Driver Wher Microsoft Document Imaging Writer Port Comment Page Layout Landscape Sample Elements I Header Analysis Log W Raw Data Run Log Result Data Method Summary Result Output Analysis Parameters
172. N B40154AC Run Module Run Module Overview Table 3 1 Main Window Run Module Item Description G Capillary Buttons Letters A through H represent the eight capillaries in the array Selecting one of these buttons displays an associated pane shown in the display area H Status Bar Displays messages such as e Currently active database Displays the name of the active database e Active Plate Displays the side of the active plate left right e Pause To Load If you selected Pause to load this area displays the wait time e Configured 2nd Plate If you loaded a second plate this area displays the name of the plate e Display fields on the right of the status bar indicate which of the following keys are latched down e CAP Caps Lock key is enabled e NUM Num Lock key is enabled e SCRL Scroll Lock key is enabled Menu Bar Options The following example shows the Run Control menu bar options File View Direct Control Tools Run Log Options Replenish Help The following topics describe each of these menus and their options File Menu Click the File menu to display its drop down menu as shown in the following example File Restore Data Monitor Defaults Save Log System Preferences Frink Setup Print Preview Print Log Print Selected Pane Ctri 5 Print Screen Exit Use the File menu to save the log file set system preferences and print the log or an item on the window The following t
173. NOTE To use this feature Edit mode must be enabled Viewing Color Calibrations To view a color calibration for a sequence result l Select File Open 2 Inthe Open dialog box select the Sequence Results tab highlight the desired result name then click OK 3 Select View Parameters Used to Compute Sequence In the Parameters Used dialog box click Color e To view the color calibration prior to the run select the Initial Values radio button e To view the color calibration after the run select the Final Values radio button NOTE This is a read only dialog box To make changes to the color calibrations select Analysis Working Analysis Parameters Edit Color e To add a successful color calibration to the list of available color calibrations click Save As in the Color Calibration Editor dialog box Enter the desired name then click OK Computing a New Color Calibration To compute a new color calibration l Select Analysis Working Analysis Parameters 2 Inthe Working Parameters dialog box click Edit 3 Click Color in the Sequence Analysis Parameters Editor dialog box GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 165 PN B40154AC Sequence Analysis Using the Sequence Analysis Module 166 4 Select the Compute new color matrix check box M 5 Select the Use Final Values as Initial Values check box M to use the final values for the initial values for the computation recommen
174. NOTE You can reduce the chance of finding multiple components in a bin by decreasing the bin width GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 251 PN B40154AC Fragment Analysis Module Performing LOH Analysis Customizing the AFLP Table The components of the cluster analysis are user defined You can modify them using the right click menus These commands allow you to select specific columns for display in the fragment list customize the arrangement of fragment list information and modify several other parameters of the fragment list NOTE See Customizing the Results List on page 254 for details regarding how to use the Column Selector window the Column Sort window and other display parameters Exporting the AFLP Analysis Results To export the AFLP analysis results l Select File Export AFLP The Export AFLP window opens 2 Select a file name and destination folder for the data 3 Click Save Some third party software may require that you export the sample information in a specific format When choosing to display the sample names in rows you can display the alleles in separate columns or in one column You can include the Bin Labels in the file by checking the appropriate boxes in the Export File Format for file export The Dyes parameters determine the dye color the system uses during the cluster analysis If the results list contains samples with fragments that have more than one dye either
175. Note PropetySet Method Dg Sequence Test AO3 050301225Z Type Sequence Result Database CEQ DATABASE Project Default Madified Monday April 24 2006 16 08 35 Sample N ame Sequence Test 403_060301 2252 Sample Plate U33 001 Test 030106 Sample Position A 3 Operator Name DC CEQ System Name CEQ 8000 Firmware Version 6 0 2 Instrument S N 3067033 Data Collection 8 0 52 Software Version Collection D ate Thursday March 02 2006 00 32 34 Sample Subject ID Figure 4 26 General Tab Properties Dialog Box View the item type database and project where the item resides as well as the date and time the item was last modified You may also view the sample name sample plate sample position in the sample plate the instrument and the operator name GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Sequence Analysis Using the Sequence Analysis Module Notes Tab Use the Notes tab to view the note that was entered in the Sample Setup when the sample ID was defined Select File Properties Notes Figure 4 27 Note Tab Properties Dialog Box GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 147 PN B40154AC Sequence Analysis Using the Sequence Analysis Module Property Set Tab Use the Property Set tab to view the selected property set that was entered in the Sample Setup when the sample ID was defined Select File Properties P
176. P Data Tool 0 0 0 n RRRRRRRRRRRRR RII 295 Launching GeXP Data TOOL eoe enni m pedo e E art ee do bere battant a 295 GexP Data Tool Applications apr De exar ep E ER ER RD ER ers 295 Loading Additional Sample Data Files llis RR 301 Additional Features of the GeXP Data Tool 0 n RR RR 302 Calculation and Formulas s acis aie pice Ebo Rede ehe Phe m hee pte ads ess 303 EITOPMeSSQQ8S sa ececaractue aos ERU dnd aa ettet donandi nobit ode iri doasPap d eared utes 303 F GEXP Quant TOO cco acude mani ees e mec A dra bas dci a barum tae eek e 305 Downloading GeXP Quant Tool 2 c ati ero tete e o ee ORE 84 GRE ate 305 Launching GeXP Quant TOOL aui derer a 305 Performing Quantitative Analysis with GeXP Quant Tool 0 0 2 ee eee 306 Performing Fold Change Calculation nananana 313 Section 8 Database Management 0 000 cc eee eee 315 8 1 Data Manager Module Overview 0 0 00 cece n RR 315 MaM MICU WU PENTIUM 316 Ment Sar DD Leo net sa i di cas cc toe obo deb dio datiuo o EO decolor td 316 TOO Dal CONS state cranks ke eee o d s eco RU paca oa ws eco e GU uox PU a aot eee 321 8 2 Data Manager Procedures 0 00 ccc eee eee eee III 323 storing Methods and Parameters 0 00 0 en 323 Creating a Abd ca ECCE TEC UTER TOTO T TETTE 323 setting the Working Database isseseese RR RR 324 Creating and Naming a Project 0 0 0 0 ccc RR eee eee RI 324 Deleting
177. Preheat capillaries to 50 C Perform Manifold Purge with 0 4 mL gel 3 times and Gel Capillary Fill 3 times GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 271 PN B40154AC Gene Expression Run Samples and Review Results in Fragment Analysis Result Set View Perform an Optical Alignment 5 Perform Monitor Baseline Clean the array window if the baseline for any color is above 6000 counts 6 Refresh the wetting tray with Deionized water Start the Sample Run 1 Load sample and buffer plates 2 Select the sample plate set up created in Create a new sample plate on page 277 3 Ensure the sample position in sample plate set up file matches the sample position on the actual sample plate and the buffer well position on the buffer plate 4 Start the sample run Create A New Study A Study is a set of multiple sample results together with the results of analyses performed on the group of sample results A new Study can be created from either e Raw Data e Previously Analyzed Results For creating a new study with Raw Data perform the following steps l Select Raw Data by clicking on the circle next to Raw Data Click on the OK button to continue A display window will allow data file selection from a database of samples that have been run in a particular project The data file selection can be made either through the List View or through the Plate View The L
178. Q cq ESD esd Tab Delimited ASCII Text txt SEQ seq FASTA fasta PHRED scf phd 1 CRV crv oet as Working Database Defines the currently selected database as the default database Closes the Data Manager module Click the Edit menu to display its drop down menu as shown in the following example Exit Edit Menu Edit Cut Cri x Copy Cri c Paste Er HEY Find Ctrl F Find MexE F3 Select All Ckrl A Use the Edit menu to cut copy paste and find items in the database Table 8 3 Edit Menu Data Manager Module Option Cut Copy Paste Find Find Next Select All Description Copies the selected item to the clipboard and removes it from its current location Copies the selected item to the clipboard without removing it from its current location Inserts one or more copied or cut items from the clipboard to other projects or databases Opens a Find dialog box which you can use to locate a specific item project or database Searches for the next occurrence of the item or folder defined in the Find dialog box Selects all items under the selected item GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Database Management Data Manager Module Overview View Menu Click the View menu to display its drop down menu as shown in the following example View w Toolbar wv Status Bar Refresh Filter Bv
179. RR ree 247 selecting a Reference Peak 0 0 0c RR 247 Selecting a Test Peak 2o masc pariter eed odi oun idr pe di du ea eed Anus s en rac es 248 6 10 Petformifig AFLP ANGIVSIS aus n acci acatst amodo e hae waddle ER de aaa tC Faas eae ease 248 Using tue AEBP FOSEIEG cose atau a Es pub rb E che ON RU mat Rob n ette eges ut deseada 248 setting the AFLP Analysis Parameters 0 0 0 0 0c c cece RR 249 Starting a New AFLP Analysis lessen RR eee 250 Viewing the ClUSTerANAIVSIS s sous durata ace a rod OE CENE E E BIOS oed uds 250 setting Cluster Analysis Parameters 0 0 0 0 cc ccc eee RR 251 CUSTOMIZING The AIP Tabli rana hac prc Ao Geet Reads he ee ws ee eS 252 Exporting the AFLP Analysis ResultS 0 0 0 00 0c cc cece n eee eee 202 6 11 Performing LOH ANALY SIS sca iustam det mese ue Etre aio e Re rere E eh Gack E ter etd 252 6 12 Customizing the Results EISE osos dut Sab FORE ER Iu REOR EU EETSTISE 254 selecting Columns for Display ssseseese RR Re 254 SOMONE TRE SUMP Ss BIS Eos eric Dade cy a eerie BH d Geet ene ciara ie terum due 255 5 19 REPONN MC SUING am dans ed ne eh aa SERRE PEE demum ac Re ee eee 25 USING Report TEMP ALCS reae ips Ra Aere sre dar ORE RR OR HE Et abe a s 250 Editing Graph Displays issssese eee eee 259 D pd EXDOFBBO RESUS esteri cokers aad dt din ght ate tee ied rn ED Ee bur eie Ed 262 TEEPE FO Mairau ianuae m o Grex vwd amer pod EUER RE E 264 DEG TIG FORMAL ost 2g a8 ttti
180. Run Sample Toolbar Icon Click this toolbar button to open the Sample Plate Run Confirmation dialog box Sequence Dye Colors Toolbar The following example shows the Sample Setup module s Sequence Dye Colors toolbar For descriptions of the actions that occur when you click a toolbar icon see Table 3 12 AE Ce GU T E Table 3 12 Sequence Dye Colors Toolbar Run Module Icon Description A Red is the default color assigned to the Adenine A nucleotide bases in the analyzed red data pane C Black is the default indicator assigned to the Cytosine C nucleotide bases in the black analyzed data pane G Green is the default color assigned to the Guanine G nucleotide bases in the green analyzed data pane T Blue is the default color assigned to the Thymine T nucleotide bases in the analyzed blue data pane GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Run Module Run Module Overview Fragment Dye Colors Toolbar The following example shows the Sample Setup modules Fragment Dye Colors toolbar For descriptions of the actions that occur when you click a toolbar icon see Table 3 13 or m 02 m 03 m bs m Figure 3 8 Fragment Dye Colors Toolbar Run Module Table 3 13 Fragment Dye Colors Toolbar Run Module Icon Description D1 Red is the default color assigned to Dye 1 in the fragment data pane and D1 is the red default name D2 Black is the default color assigned to Dy
181. Select the database you want to use as the working database The system highlights the selected database in blue 4 Select File Set as Working Database The name of the working database appears in bold to indicate that it is the working database NOTE The database size is limited to approximately 1700 megabytes However we recommend that you work with smaller databases to improve performance Creating and Naming a Project To create and name a project l Inthe Data Manager window select and highlight the database where the project will reside then click File New 2 Highlight the new project and click File Rename 3 Enter a descriptive name for this project and press Enter NOTE Do not use special characters in the file name 2 V 5 I 4 Close the Data Manager module File Exit Deleting a Project or Database l Inthe Data Manager window select and highlight the folder or database to be deleted 2 SelectFile Delete A Data Manager dialog box opens prompting you to confirm deletion 3 Click Yes to delete the folder or database NOTE You cannot delete the working database CAUTION Deleting a folder deletes all data contained within that folder Renaming a Project or Database l Inthe Data Manager window select and highlight the project or database 2 Select File Rename 3 Enter the new name for the database and press the Enter key NOTE Do not use special characters in the file name l
182. Setting the Working Database on page 324 or Set Working Database in the online help for more information 3 Select the plate from the Plates drop down list A visual representation of the plate appears in the Current Plate area of the window To select the samples for your Study click on the well location of the sample of interest The sample ID moves to the Current Plate Selected Wells area of the window indicating that the sample will be included in the Study NOTE See the Raw Data Legend area of the window for information regarding sample well selection e To remove samples from your Study click on the well location of the sample you would like to remove The sample ID moves to the Current Plate Selected Wells area of the window indicating that the sample has been removed from the Study To select or remove entire rows or columns of wells click on the corresponding row letters or column numbers e To select the entire plate to be included in your Study click on the red box in the upper left corner of the plate NOTE You may select Study data from multiple projects and or multiple plates Continue making selections from the list of available projects and plates to add all of the desired samples to the Raw Data Selected area 4 Click Next to proceed to the Analysis Parameters window Selecting an Analysis Parameter Set The second step in creating a new Study from raw data involves defining the parameters to use when an
183. Subject 33 Subject 63 Subject 65 GATA193AD7 A1 GATA193AD7 A2 D iei AT SU E tanni I Nae funi Dein UU Tl Te ere fund ILI iia MR a LL CIEL SUM D145588 A2 D151678A1 0151679 A Figure 6 44 Genotype Summary Report GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Fragment Analysis Module Exporting Results Creating a Genotype Summary Report The Locus List LocusList txt is required to create the Genotype Summary Report GSV and to perform some exports Use the Locus List Editor to customize the LocusList txt file Press the F7 key or select View Locus List Editor The Locus List Editor opens as shown in the following example Edit Locus List iol Laocuslist Est File Date and Time 3 2 T 2006 1 43 26 PM Copy of D 35238 2 Selected Laci Copy of 0952157 Copy of New Locus Tag GATATIS amp O GATATISADY 2 Other Loci 4 ba Cancel Figure 6 45 Edit Locus List Dialog Box Table 6 16 Locus List Editor Legend Loci in Lists the loci from the database that have not yet been moved to the Selected Loci list Database Other Loci Lists the loci to be removed from the LocusList txt file Selected Loci Lists the loci to be added to the LocusList txt file Moves all loci from the Loci in Database and Other Loci list to the Selected Loci list Moves only the selected loci from the Loci in Database and Other Loci list to the Selected Loci list Move
184. System User s Guide For n Vitro Diagnostic Use 297 PN B40154AC Gene Expression GeXP Data Tool e Well coordinates e Result name e Subject ID e Plate ID e Database name e Instrument ID tay GeXP Data Tool Sr ame Normalization File C Projects Gene Expression Main GexP Data Tool Data Clean Data Test csv Gene ea CYP1AI Sample Name Rep 1 Rep 2 Rep 3 Mean Std Dev CV ii Std 015 63n 418 056 1110 745 1414286 981029 510 625 52 050 O TENG Std 031 25ng 6686 150 5686 791 594996 5322646 1577 422 25636 o gren Std 125ng 31045 240 32983 160 3029 280 2970 022 emd oo a EE r e 1 2 USOngConA 8282 097 Welt DOT im U 50ng LPS 79947 400 ND Result Std 250ng D07_07110613US IL 6 U 50ng PI 22306 950 318 Subject ki Std 250ng ens U 50ng Untreated 24062 680 274 Plate kd 071106 Inflammation Plex Std Curve Kanr Database Inflammation Multiplex PPla m Instrument Id amp 220330135 TE W CYPlAl Sample Name Rep 1 Rep 2 Rep 3 Mean Std Dev CV Std 015 63ng 662 ue 395 805 2522 155 S 160 Std 031 25ng rusos fuese pavor Peer isso fna Std 125ng 0 38320 700 3821210 9 972 Std 250nc 47317 390115262 650 32256 USOngConA 2565357 NO ND 2565 357 IND ND U SOng LPS ETE fno pano 72440 530 ND NO U SOng PI 12029427 33541570 28341 960 5242 745 18498 U Song Untreated 30470 600 46523 250 49207 030 42066 290 10131 560 24085 C Figure 7
185. TCTAACCAGCGCAAAATAGTTAC CGAAGGTGACAAAT LAACCGGCAGAAAACGCCCCGCTGAAAAGTAAT TCATAACCATCAGTCCTCA ATGACGATTAAACA V Zoom Mode GTTTTTGTTTTTATCTGCTTTATACTTGAGGCCGACGCCCTGGCGGTAAAG CAAAGACGATAAAAL i BR TCAAAAAAGAGTGAGTGACATGGAACCAAAAACAAAAAAACAGCGTTCGCT TTATATCCCTTACG v Base Synch TTTCCGTTGTTGAATAAAGGCAGTGCCTTCAGCATGGAAGAACGCCGTAA CTTCAACCTGCTGG Base Spacing CGAAACCATCGAAGAACAAGCGGAACGAGCA TGGATCCAGTATCAGGGATT CAAAACCCGAAATC MMEEEEEEMNMEENENMME tie CELLS Nimes Cag ae 1 d v RC pucig sct 2686 0 2686 SCF Unzoom Unzoom v Analyze Stop Properties Figure 4 21 Base Sequence and Trace Views after Sequence based Trimming Enable Internal Matches GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 139 PN B40154AC Sequence Analysis Using the Sequence Analysis Module After you apply sequence based trimming the system replaces the internal matches in the resulting base sequence and trace view with the letter x as shown in the following example ig CD04A G01 02091814NX Analyzed Data Fluorescence 500 750 1000 1250 1500 1750 2000 2250 2500 Data Points CTGATAACGACATCCTCAGTGATATCTACCAGCAXXXXXXXXXTTATGTGGTCAGTGGCCAGCACCCTACGCTTTAAGGTGCTA TGCTTGATCGGCAACCTAATTTAGGGGTTTAGCACGTGTTTCTTCGCTACGGCGATGTTGTCCTTAAAACTAGCTACAGGATTG AGGAGTTAAAATGAAATCGAACCGTCAGGCACGTCATATTCTTGGACTGGACCATAAAATTTCTAACCAGCGCAAAATAGTTAC CGAAGGTGACAAATCCAGCGTAGTAAATAACCCAACCGGCAGAAAACGCCCCGCTGAARA
186. This represents the estimated size in nucleotides that the user expects for fragments belonging to this locus e Ploidy This field is inactive for this system release e Allele ID s for This area provides fields for Allele IDs D1 D2 D3 and D4 Each field accepts 8 character alphanumeric values used to label the Allele ID s in the fragment list The default values are A T G amp C These fields cannot be blank e Accession and Primer Sequence fields are not used for analysis and are for supplementary reporting purposes only These fields are optional Apparent sizes of SNP probe fragments as estimated with SNP reference fragments often differ more from actual sizes than the STR allele fragments do This is due to the effects of primary structure on fragment mobilities Therefore it is important that the apparent size entered into the SNP locus tag definition is a known value This is best determined in preliminary runs as the average apparent size of all of the possible variants that might occur in a Study Because the effects of different dye labels are relatively greater on shorter fragments it is essential that in include the Dye Mobility Calibration in the parameter set for an SNP analysis Result Set Filtering The first steps in creating a Study involve applying a set of fragment analysis parameters to analyze the raw sample data These parameters are specifically configured to process the fragment data for a particular
187. This temperature will be over ridden at the end of each sample plate or when cancelled See Specifying Capillary Temperature on page 356 Initiate the denaturing of samples See Denaturing a Sample on page 356 Align the lasers with the detection windows of the eight capillaries You can save and view the data in the Sequence Analysis module See Performing an Optical Alignment on page 358 Initiate the injection of the sample prior to separation See Injecting a Sample on page 356 Initiate the separation of injected samples The data generated is not saved See Performing a Separation on page 357 Fill all capillaries with fresh gel This forces any gel present in the capillary out to the specified waste position in the buffer plate or wetting tray See Replenishing the Capillaries with Gel on page 357 Clear the manifold of air bubbles and or remaining DNA fragments before the next separation process See Purging the Manifold on page 358 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 91 Run Module Run Module Overview Tools Menu Click the Tools menu to display its drop down menu as shown in the following example Tools wv Autoscroll Autascale Pause Data Display Uneoon Unzoam All Display Options View Last Analysis NOTE A v next to an option indicates that the option is enabled The following table describes the Run module s Tools menu options
188. Tool The GeXP Quant Tool can be downloaded from the Beckman Coulter web site Perform the following steps l Launch the Internet Explorer browser and go the Beckman Coulter web site The Beckman Coulter web site is http www beckmancoulter com Click on Support and then select Software Downloads Select search by Software Name and then type in GeXP All available software for GeXP will be displayed Select the GeXP Quant Tool 5 Follow the instructions to install the GeXP Quant Tool software There will be two links to select from for the appropriate version of the Data Tool worded as follows e Install Quant Tool for use with Excel 2010 version 1 1 e Install Quant Tool for use with Excel 2007 or 2003 version 1 0 6 Click on Download To verify a successful download check the download location to make sure the file is where you intended it to be placed Launching GeXP Quant Tool Use the Windows 7 Start menu on the GeXP instrument to find and then launch the GeXP Quant Tool When launched for the first time a window similar to that shown in Figure 7 35 will be displayed z Set Program Access and Defaults Internet a5 Windows Catalog Internet Explorer V Windows Update Je E mail f Microsoft Outlook irm Accessories fai Beckman Coulter Inc iai GexP Quant Tool e GenomeLab System fan iSahiies ET rm GenomeLab System ja Microsoft Excel 2010 irm McAfee wil Microsoft Word 2010 m Microsoft Office f
189. USERTEMPLATE Although you cannot set the USERTEMPLATE database as the working database you can delete it If this database is deleted no template will be used for subsequent databases If you need a new template create a new one named USERTEMPLATE Creating a Database 2 Click Data Manager on the Main Menu In the Data Manager window right click the GENOMELAB DBASE node and select New Database The New Database dialog box opens Enter a name for the database and if desired select the Set As Working Database option Figure 8 3 Data Manager File Edit View Tools Window Help New Database xi Enter Name for New Database M yNewD atabase 150 MB HE CEQBAK2 5 MB FAII B a D1151984 HC 0149599 a4 D151679 a GF 0229683 a GF 0352387 a 0982157 H D95938 Cj Default Gf pxs7132 Gl GATA193A07 GF Test project HHE USERTEMPLATE Figure 8 3 Setting Up New Working Database in the Data Manager Module 4 Click OK GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 323 PN B40154AC Database Management Data Manager Procedures Setting the Working Database Program the database that contains all of the projects and the location where the data are stored until another database is set as the working database Close all modules except for Data Manager module If necessary open the Data Manager module How do they know
190. User s Guide For n Vitro Diagnostic Use PN B40154AC Fragment Analysis Module Customizing the Results List To remove columns from the Selected Columns area highlight the column selection and click the left arrow to move the selection back to the Possible Columns area To remove all columns from the list right click the header and select the Hide Column Arranging the Column Display You can arrange the left to right order of columns in the list by ordering the columns top to bottom in the Selected Columns area of the Column Selector window e Highlight the column selection in the Selected Columns area and click either the up arrow or down arrow buttons to move the column to the selected location e Order the columns top to bottom in the Selected Columns area relative to the left to right order you want the columns to be displayed in the fragment result table Locking the Column Position You can lock selected columns into position so they remain in view as you scroll across the remaining columns in the list This helps when the results list contains multiple columns of data which require left to right scrolling and you want to keep a particular column such as the result name or status always in view e To lock a column highlight the column in the Selected Columns area of the Column Selector window and click Lock A lock icon appears next to the selected column to indicate that the column position is locked NOTE This also loc
191. Vitro Diagnostic Use PN B40154AC Fragment Analysis Module Calculating Peak Ratios 6 9 Calculating Peak Ratios After creating a Study you can begin Peak Ratio calculations Peak Ratio calculations analyze a Study result to quantify the amount of DNA present in a fragment The system calculates the DNA quantity as a relative comparison to a user defined reference peak Beginning a Peak Ratio Calculation When viewing an exiting Study select Analysis New Peak Ratio to calculate peak ratios The Peak Ratios window opens Fragment Analysis GATA193A07_test1 Peak Ratios New Analysis 1 File Yiew Analysis Reports Window Help D snel s E 02 os oa M v Height 2368452 H xwiam pana Peak Ratios New Analysis 1 Reference Result Peaks Fragment Result Set Traces 10 GATA19340 0 25pmol B06_0603271100 4 328 13 94254 GATAI93 407 715 57 571 29 378 01 116 601 2377 022 GATA193A07 Analysis Parameters 373 99 Use Help Peak Height Peak Area Help Reference Peak Known Quantity Highlight Variation 2 Ef 12 LE m I Highlight Variant Ratios A m m GATA192407 Max Bin Width Y Threshold 1 Standard Deviation 361 36 S 359 29 1 00 24 I C 5j Error uw 3652 e D Result Table Show Excluded Result Name R356 H Ref 10 GATA193A07 0 25pmol B06_0603271100
192. a Project or Database ssisssseseseen RR RB 324 Renaming a Project or Database 0 RR RRRRRRRIRRIRRRIRRRR RII 324 Checking the Database Size lisseeesen eee eee ees 325 Reducing the Database Size 1 ee eee eee eens 325 BACKING UP at ald da Se six siete at Sach ceca tiene a Debent Gro ee b B God dotes Ate Bat 326 Restoring the DatdDdSBcrse uo bat theses d bd M bern Mase d hake ee kee 327 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use XV PN B40154AC Converting Individual IDs to Subject IDs issssssseenn n RR 328 Greating New Size Standards u a ct bot roseo aub os ur ester n otia ele oa eee 328 Exporting Database Files from the Data Manager 0 0 cece eee ee 329 IMpPOMTINngG Database FIIes osse rper hh ded aca eB bed Re aon hip ee Rig eed Rak week Ee Es 333 Generating a Sample Run History 0 een 334 POSEE VO TODO acea ad on beet mediterranea ROSE ete caged Sake fent uiui abusu aUe qued 394 Section 9 Maintenance and Diagnostics Lenses 339 ST Boule MaIFIenali68 a ud erac te dtr om QR Een ERU ee RERO ede 399 Cleaning the Capillary Array ice intera aer rn ace S HC on bin c DR pt ope es e cete 340 Replacing the Gel Waste Bottle For Dual Rail System 0 00 00 345 Replacing the Gel Waste Bottle For Single Rail System 0 00 0 00 00008 346 Replacing the Wetting Tray sisse RR ee RRRRRRRcRRR R ees 947 9 2 Direct
193. a multiplex is optimized it is used to study gene expression in different samples For customers who need to perform quantitative gene expression analysis it is recommended that a standard curve be established through serial dilution of a reference RNA sample as described in GeXP Chemistry Protocol A29143 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC 7 3 Gene Expression Run Samples and Review Results in Fragment Analysis Result Set View Run Samples and Review Results in Fragment Analysis Result Set View For various gene expression experiments whether it is for evaluating primers or for creating a standard curve or for comparing gene expression levels in different RNA samples RT PCR reactions are prepared as described in GeXP Chemistry Protocol A29143 Fluorescent dye labeled DNA fragments are separated by capillary electrophoresis on the GeXP instrument A new study is created in Fragment Analysis Module Raw data and analyzed data are reviewed in Result Set View Decision on downstream analysis and or new experiment planning will be made based on the data review Prepare The GeXP System Before The Sample Run Create a new database and a new project l From the main menu launch the DATABASE module 2 Create a new database for the interested multiplex or experiments and make it the Working Database 3 Create a new project in this database and rename it as needed For example
194. a of the window and select Test Peak The system calculates the area and height by comparing it with the reference peak then enters this information into the Peak Ratio Result Table It uses each selected test peak to calculate ratios with the corresponding reference peak of the same trace e Select test peaks in the same manner until all desired peaks are identified e To de select a test peak from the Reference Result Peaks table right click the test peak and select Set Peak As Test to toggle the command to the off position unchecked e To de select a test peak from the Fragment Result Set Traces area right click the test peak and select Peak Test to remove the check mark 6 10 Performing AFLP Analysis 240 Amplified Fragment Length Polymorphism AFLP Analysis is a highly sensitive DNA fingerprinting technique that relies on the selective amplification of restriction fragments from a total digest of genomic DNA The CE system includes AFLP Fingerprint analysis which allows you to rapidly score AFLP fingerprints with output in a text format which is compatible with most statistical and pattern matching system The AFLP analysis tool is a cluster analysis module that scores the presence or absence of a fragment of a given size per sample Using the AFLP Feature The AFLP feature takes all results from the Study and creates bins from fragments with sizes that fall within a user defined bin width For each of the possibl
195. a r al on GCG ETTE CAT GO CTE GAGGT CGACT CT AG AGG AT COCOS GGT ACCGAGCTOS A4TTOGTAAT CAT GT ATA G CT Alores cence A i bna Pss M mW ii SONDA Mateos uA 25 500 rao 1000 1250 1400 rau 2000 Data Pointi ACGGCCAUGTGUCAAGCTTGCA TGCCTTGCAGGTCGAUCTCTAGAGGATUOUCUCCGGGTAUCCGAGCTCGAATT CISTAATCATSOTCATAGCTSOTTTCCOTOTSTOAAATTOTTATCOGCTCACAATTCCACACAACATACGAGCE GIARAGUATAAACTGTAAAUGCCUTGGGGTUGCUTAATGAGTGAGCTAAUCTOACATTAATTGCGTTGCOGUTCALC iIUCCCGCTTICCAGTCGGGAAAUCCUTCTUCGTGCCAGCTGUATTAATGAATCUGGCCAAU GUGUGGGGALmIAGUUCU iGDPITGCGTATIGGGCGCOCTCTTOCCGCTTOUCTOCGCTCAU TGACTCOCGUTGUCGCTCGGTOCGTTOCGGC Tit GC AGUGGTATUCAGUTCACTUOARAGGCUGGTAATACGGTTATCCACAGAATUARGGGGATAACGURGGAAAUAR CATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCETAAAAAGGCCECSTTOCTOSCSTTTTTICCATARL CTCCOGCCCOCCOCTRACGAGCATCACAAAAATCOACGCTCAAGTCAGAGGTROCGAAACCCGACAGGACTAT AAAGATAUCUCAGGCGTITCCCCCTGGAAUGUTCCCTUGTGCGCTCTUCCTGTTCCGACUCCTGCCGUOCTTACCGG ATACCTGTCCGCCTTTCTOCCCTTUGiUGtiARGCGIGGUGUTTTCTUCATAGCTCAUCOGUTGTAGGTATCTCAG Figure 4 18 Base Sequence and Trace Views after Quality based Trimming Quality based Trimming Applied NOTE To recover the original sequence after performing Apply Quality based Trimming select Edit Undo 136 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Sequence Analysis Using the Sequence Analysis Module Performing Sequence based Trimming Setting Up Sequence based Trimming To setup sequence based trimming oe 2
196. able describes the File menu options within the Run Module Table 3 2 File Menu Run Module Option Description Restore Data Monitor Restores the colors of the data monitor to the original default shipped with the Defaults instrument Save Log Saves the system log in a folder you select The log is identified by the date and a unique identifier GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 49 PN B40154AC Run Module Run Module Overview 90 Table 3 2 File Menu Run Module Option Description system Preferences View and modify the System Name Operator Name Project Name and Dye Names for Fragment Analysis and or to activate or deactivate the alarms See Defining System Preferences on page 68 Print Setup Define printer properties Print Preview Displays a facsimile of a hardcopy printout of the system log prior to printing Print Log Prints the system log View Menu Click the View menu to display its drop down menu as shown in the following example view Toolbars w Status Bar wv Status Monitor Working Database NOTE A 7 next to an option indicates that the option is enabled Activate or deactivate window display options The following table describes the Run module s View menu options Table 3 3 View Menu Option Description Toolbars Choose which toolbars to display Select Iv the options that identify the toolbars you want displayed To hide a toolbar clear
197. abs let you search for information by topic index entry and or keyword Context Sensitive Help Click this icon and then on a menu item to open the Help file related to the selection GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 115 PN B40154AC Sequence Analysis Sequence Analysis Module Overview Data Toolbar The following example shows the Sequence Analysis modules Data toolbar For descriptions of the actions that occur when you click a toolbar icon see Table 4 10 alale alale BALA ale si Figure 4 3 Data Toolbar Sequence Analysis Module Table 4 10 Data Toolbar Sequence Analysis Module Icon 116 Description Zoom Mode Magnifies a specific area of data in the display Pan Mode Move analyzed data in the X and Y direction Align Mode Visually aligns bases and peaks in the analyzed data pane Edit Mode Insert change and or delete bases Unzoom Zoom out one level Unzoom All Zoom out all levels Autoscale Scales data to the confines of the pane If autoscaling is disabled the data is scaled to its true values Use this item to turn autoscaling on or off Base Spacing Sets the space between base sequence text in groups of 0 3 5 or 10 Base Synch With both the analyzed data and base sequence panes open synchronizes the analyzed data display with the highlighted base sequence text showing the corresponding peak or peaks between two hairlines for
198. addition to using the Display Options dialog box Colors tab page 154 to set display colors you can change colors used in raw data and heterozygote base displays as described in the following topics Raw Data Colors To display the Raw Data Colors toolbar l Select View Toolbars 2 Select the desired toolbar options 3 Click Close To change the colors of the raw data traces 1 Onthe Raw Data Colors toolbar click on the trace color to change A C G or T The Color palette dialog box opens as shown below Color El x Basic colors EI eee en ee A UL I EEE eee ee EEE ee NM Custom colors JIB BB Eee BE EEE ee Define Custom Colors gt Canes Figure 4 34 Color Dialog Box 2 Select the new color 3 Click OK Heterozygote Display Color The heterozygous bases are bold and red by default To change the color of the heterozygotes in the base sequence pane l Select Tools Heterozygotes Display Color The Color palette dialog box opens 2 Selecta new color 3 Click OK The color of the ambiguity codes changes in the base sequence text NOTE To search for heterozygotes use the Heterozygote Backward Search and the Heterozygote Forward Search icons in the Standard toolbar GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 155 PN B40154AC Sequence Analysis Using the Sequence Analysis Module Pinning Results Several analyses single or batch may be nec
199. agment Analysis Parameters on page 206 5 Select an Analysis Parameter Set 6 Click Next to proceed to the Analyze Data window GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 235 PN B40154AC Fragment Analysis Module Using the SNP Locus Tag Editor Steps Analysis Parameters Analysis Parameter FA600 Time started 4 25 2006 1 55 10 PM Analyze Data Status Date Analyzed DATS 33 D4 A01 10605180Y 6 5 2001 8 23 53 PM 4 25 2006 1 55 17 PM DATS 34 D4 B 1 10605180 6 5 2001 8 23 54 PM 4 25 2006 1 55 24 PM DATS 36 D4 C 1 1060518Y 6 5 2001 8 23 56 PM 4 25 2006 1 55 30 PM DATS 37 D4 D 1 1050518 Y 6 5 2001 8 23 57 PM 4 25 2006 1 55 37 PM DATS 99 D4 E01_010605180 6 5 2001 8 23 58 PM Unanalyzed DATS 100 D4 F 1 10605180Y 6 5 2001 8 24 00 PM Unanalyzed DATS 101 D4 G 1 1050518QY 6 5 2001 8 24 01 PM Unanalyzed DATS 102 D4 H01 1050518QY 6 5 2001 8 24 03 PM nanalyzed Analyze Current Trace End STATUS Data dimensions 10790 points x 4 channels STATUS Data rate 2 0 Hz STATUS Constant velocity migration offset 1 00 min STATUS Capillary lengths 30 0 33 0 cm STATUS Separation Voltage 4800 0 Y PreProcessing Assessing peak widths trial rank map window 22 points PreProcessing Data analysis range 1814 to 7204 eats Final rank map window is 22 points Total Samples 8 Analyzed 4 Passed 4 Failed 0 Figure 6 25 Re Analyzing the Data
200. alysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Fragment Analysis Module Exporting Results For additional information on using Fragment Data in the GeXP Data Tool refer to Chapter 7 for the GeXP Data Tool Format Descriptions and Requirements for Exporting Fragment List and Genotypes Export data along with their export requirements by using one of the following file formats CSV Comma csv Contains the export parameters of a Study s fragment list as selected sorted and ordered Each line in the output file represents a fragment The data in this export are comma delimited suitable for viewing in most third party spreadsheet applications The export format has the csv extension Linkage Pedin pre Contains the export parameters of a Study s pedigrees and genotypes The Pedin file can be imported into a Linkage applications MakePed utility program This file includes the pedigree and genotype information from each result in the Study It supports up to two alleles per locus The export produces three files e pre the Pedin file e og the list of processing steps and errors encountered during the export e debug the text file with column headings and comma separated data to aid in the correction of errors in the pre file The Pedin export requires a list of locus names in a file named LocusList txt You must store this file in the CE system export or root directory This text
201. alyzed Data i 20 au 4i a0 a r a an r WEGGCAGT GCOLAG ETTO GAT GC OTE CAGGT CGACT CT 46 AG GAT COO GGT ACCOA GETOS 44TTOGTAAT COT GT CA T G CT a t fa ER Ta fF rp hM TN pel Ps ont TONTOTCAAACGAUCUGGUCAGTGCCAAGCTTUGCATUGCCTTGCAGUGTCGACTCTAGAGGATCCUCCGGUTACC GAGCTCGAATTCOTAATCATGTCATAGCTOTTTCCTGTOTOASATTSOTTATCCIC TCACAATTCCACACA ACATACGAGCCOGGAAGCATAAAGTGTAAAGCE TGSGSGTSCCTAATGAGTGAGLC TAACTCACATTAATTGC GITGCOGCTCACGCUOCGCTTTCCAGTCGGGAAACCTGTCGTGCCAQGUTGCATTAATGAATCGGUCAACUCUGCUG CoGGiSAGAGUGUGGTTTGCOGTATTGGGUGCTUTTOCCGCTTOCUCTCGUTCAUTGAUCTOGCTGCGCTCGGTCGT TUOGGUTGCGGCGAGUGGTATCAUGUTCACTCAAARGGUGGTAATACGGTTATCCAUCAGAATCAGGUGATAAC C AGUISAAAGARCATGTGAGCAAAAGGUCAGUARAAGGCCAGGAAUCUCGTAARAAUGGCUCGUGTIGCTGGUCGT TITICCATAGGCTUOCGCCOCCCCTGACIAGCATCACAARAATUOGAUCGUTCAARCGTUAGAGUTGGUUGARRAAUCC 3ACAGGOGACTATAAAGATAUCCAGGUGTTTCCOCCOCTGGAAGCTCCCTUCGTGCGCTCTCCTGTTCOCGACCUCTG COGUCTTACCGGATACCTGTCCGUCTTTCTCCCOCTTCOCGGGAAUGCGTUGGCGUTTTOCTCATAGCTCOCACGCOCTUGTA SG TATCTCA c 5 m A Figure 4 17 Base Sequence and Trace Views after Quality based Trimming GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 135 PN B40154AC Sequence Analysis Using the Sequence Analysis Module Applying Quality Trimming If the trimming is acceptable select Edit Apply Quality based Trimming to apply the resulting base sequence and trace view tesLsequenceA12 A11 02012519A1 7 New Analysis Untitled Analyzed Data ju 2l at a i
202. alyzing selected samples Analysis parameters are used to process the fragment data to estimated fragment sizes and to identify alleles Analysis Parameters Ea Steps Raw Data 5 Select Analysis Parameter Set Analysis Parameters Analyze Data New Result Data E dit Parameter Set Summary Project Default Date Modified 3 27 2006 1 55 54 PM Dye Mobility Calibration NoCorrection Size Standard SizeStandard 600 Model Quartic Locus Tags lt lt Previous Cancel GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 203 PN B40154AC Fragment Analysis Module Working with Studies in the Fragment Analysis Module Figure 6 9 Analysis Parameters Window Selecting a Fragment Analysis Parameter Set Use the Analysis Parameters window to create select or edit the analysis parameter set for analyzing the data selected for the new Study Your choice of a particular set of analysis parameters depends on the particular fragments you are attempting to identily The CE system software has a set of default analysis parameters used to estimate unknown fragment lengths The calibration curve is based on the migration times of the size standard fragments The default set of analysis parameters cannot be edited The default parameters are as follows e DEFAULT FRAGMENT ANALYSIS PARAMETERS Used for applications such as STR AFLP etc e
203. an Optical Alignment To align the lasers with the detection windows of the eight capillaries l Select Direct Control Optical Alignment from the Run menu 2 To save the alignment data select the Autosave check box 3 Enter a name in the Name field 4 Select a Work Folder from the drop down menu 5 Select Align IMPORTANT Prior to performing an Optical Alignment it is advisable to purge the Array Manifold and fill the capillaries with fresh gel in that order See Purging the Manifold and Replenishing the Capillaries with Gel Monitoring the Baseline To monitor the system baseline NOTE An optical alignment must be performed before enabling the Monitor Baseline function This will ensure accurate determination of the system baseline l Perform an optical alignment 2 Select Run Monitor Baseline The dialog will open Monitor Baseline Enable Monitor Baseline Baseline Parameters Cancel Autosave i View Injection Instrument Data Help Mame BASELINE Project Default Figure 3 37 Monitor Baseline Dialog Box 3 Inthe Monitor Baseline dialog select Enable Monitor Baseline then click OK 4 Select the Data Monitor tab to view the baseline trace After reviewing the baseline trace disable Monitor Baseline To do this GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 83 PN B40154AC Run Module Using Direct Control 1 Select Run Monito
204. ao eae Te tb eee eae 3 FUNCHONALIDESCHOLION marodar ieia Geek ae aie es hat aes 3 BBC dy eet cette ts bee TT T T TT UU MM 4 ooftWale User Niera B su usos reed E PIE BeEDbRemd e owes onde Ried 11 1 2 Operating the o VIO uaa eke a deberet ex as dust E we ee mama Guedes EUER PES 14 PIC Dalla Sample titer tco etos ace ihr rero tee das dea Priv te dad o Ev ne we eae px 14 Starting UD the Systemi esos struit Reified s avidi tnn arte d Brett O placat Ear d de 14 Creating a Database and Project Folder ilssssseee n RR 15 SOT HD S ANN E cootra E E E E ieee cane aa E cites oe peius Eco 15 Running d SAV Corse Geis ones rset dele died d edet eiat Metus d Card ducet dh rae dL Dun RE itia 16 Section 2 sample Setup Module eee 21 AE Ta c c OO O 21 USING tre Main MIFIOOM sss sett tease sfera oer Duc eRPLIdei en bLeweE eia 21 Meng Bap HO s exce crt A use AUS MI LE E ADM Sue Iu Lee 24 DES ICONS PRECII TT TT Soe ESE EOE eae 29 2 2 Using the Sample Setup Module 0 cen 30 Openind Sample Pilale xad ene oreet att maet d e edebant Soak Eee eye 30 Creating a New Sample Plate 0 0 RR 30 Opening a Sample Plate 0 eee eee eee nes 31 Creating a New Sample Plate 0 RR RR 32 SI TNMs ase fat at a TULIT 32 Using Property Sets cecus purse ibn onte cocer icr de scito iy so ond dele brad odd cir one alee 37 Blue cEE 39 Defining Data Processi
205. aporation Cover on page 351 7 Click Start to begin the Run Starting the Sample Plate Run For Single Rail System 1 Select Run Start Sample Plate from the Run menu 2 Inthe Select Sample Plate To Run dialog box Figure 1 16 select the desired project and sample plate and click OK Select Sample Plate To Run x Database MLEE UNIT 178 Lc Filter Start Date 08 22 2001 T Enable Cancel End Date 08 22 2001 zl Refresh Help Date Time DefaultS amplePlate 12 02 88 17 00 00PM Project Name fgg Figure 1 16 Select Sample Plate To Run Dialog 1 8 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Getting Started Operating the System 3 Inthe Confirm Configuration dialog box Figure 1 17 verify the sample and buffer set locations Confirm Configuration 7 xj Make sure pour sample and buffer plates have sample and buffer at the highlighted locations and that Your wetting tray is Filled with water Click an Start ta confirm configuration and to start the run Wetting Tray Operator Mame Test Operator Project M ame Default Sample Flate EE EL SE Pi NU NM I nmMmo 0U P 258 24 TE JE JE JE L cLiILOL6 8 49S PEE Load Plates Detail Cancel Help Figure 1 17 Confirm Configuration Dialog 4 Click Load Plates The dialog in Figure 1 18 will appear Unload Plates 8 x Please prepare your plates befor
206. ards become available for selection in the Selected Peaks list to the right 2 Select the peaks you want to use in the Selected Peaks list To use all fragments in the selected standard click Select All e To select individual fragments in the selected standard select the check box next to each of the fragment sizes you want to run with the sample e Ifyou do not want to use any of the standard sizes click Deselect All NOTE If you do not use a size standard when analyzing the data the unknown fragments will not be sized 3 Note the parameters provided in the following fields for the selected size standard e Dye displays the dye label on the size standard fragments e Size Standard Fit Coefficient displays the standard deviation of the differences between the actual fragment sizes and the apparent sizes of the standard fragments determined from a large number of repeated runs This parameter is sometimes called the lack of fit 4 Select the empirical model you want to use for generating the curve that best fits the identified standard fragments from the Model drop down list NOTE The relationship between fragment size and mobility or migration time in the CE system with replaceable gels is non linear and is not described with sufficient accuracy with any theoretical model to yield reliable fragment size estimates However polynomials of varying degrees serve as practical empirical models that will accurately account for this no
207. are located further than that specified in the Distance from End setting or if they are an internal match Displays the text results of the alignment between a template sequence and a sequence result The top row of text is the base number the second line is the template sequence the third line is the sample sequence and the last line is the consensus shows the statistical analysis of the accuracy of the sample sequence This section groups the errors in the alignment into 50 base regions and displays the number and type of error for each region To define the report format and content select File Report Format To print the report without previewing or formatting prior to printing select File Print Report e To the view the report select File Print Preview 160 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC The following example shows a sample report Project Sequence Sample testseg 404_ 030515 18HG Result testseq 404 3 030518H G Sequence Results testseq A04 03020518NG Created Isi 05 03 20 33 42 Project System CEQ 8080 Sequence Analysis Using the Sequence Analysis Module Operator Instrument CEQ 8060 Ver 7 0 26 Modified OBOE 20 33 42 Sample Mame Sample Plate Sample Plate Barcode Sample Position Method Instrument Analysis Parameters Mote Properties Consumables Capillary Array Serial Humber Capillary Array Part
208. as been cancelled The capillary temperature will be set to 35 C 3 Click OK Setting or Changing Display Options To set or change the graph data display options l Openthe Display Options dialog box using one of these methods e Select Tools Display Options e While viewing a graph display of sequence data right click the graph and select Display Options The Display Options screen opens as shown in Figure 3 26 Display Options ix Colors Dye Traces Curent Traces Title 2 Axis Options Y Axis Options Title Property Title I Title Color MI Title Font Arial m M Save Customized Setting Save Setting Now ceca Help Figure 3 26 Display Options Dialog Box GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 13 PN B40154AC Run Module Using the Run Module 2 Select the tab that identifies the type of display options you want to change For details see the following topics Title Properties Tab on page 74 X Axis Options Tab on page 74 e Y Axis Options Tab on page 74 Colors Tab on page 74 Dye Traces Tab on page 74 e Current Trace Tab on page 75 NOTE For detailed descriptions while using this dialog box click Help Title Properties Tab Set or change the title of the displayed data panel l Inthe Display Options dialog box select the Title tab 2 Change any item as necessary 3 Click Apply to continue or OK to close the
209. ata in the selected result Displays a description of the size standards and calibration curve used to calculate the sizes of the unknown fragments in the selected result Displays the dye spectra and dye mobility calibration parameters used in generating the selected result Displays a list of system and user generated notes specific to the selected result for example sample name dates database location and hardware information Displays a list of user defined property fields and the values associated with the selected result These parameters may be edited Displays a summary of the separation methods consumable parts and lot numbers that were used with the selected result GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 231 PN B40154AC Fragment Analysis Module Using the SNP Locus Tag Editor Trace Copies To copy a trace as an image to the clipboard right click on the trace and select Copy see Figure 6 22 DATS 101 D4 GU1 05042512765 Fragment Data Haw Data Fragment List Current Inject Current Voltage Analysis Log Hun Log Analysis Parameters Quantital_4 t 100000 Dye Signal 60 70 80 50 81 58 44 P7 1791 53 70 83 o7 g 102 54 B7 1 21 png 97 4 62 51 _ amp 96 41 5478 PEST f WILA RS Ld w Include zoom En Peak Edit Annotation Show Sizes Show Allele IDs Show Locus Labels Show Comments Show Result Mames Show Y Axis Label Show Data P
210. ata was selected from the Batch Analysis Selection dialog box View Results After performing a batch analysis click this icon to view the results of a selected sample in the upper pane of the Batch Analysis window Sample Plate Toolbar To display the Sample Plate toolbar select View Toolbars then select the Sample Plate check box as shown in the following example v Standard lw Data m e IY Sample View UM v Sample Plate Sample Plate x 123 45 G6 FT 6 8 10141 12 v Base Sequence Plate U33 007 Test 030106_060301 5 ample Result Retresh Export Help Figure 4 7 Sequence Analysis Module Sample Plate Toolbar Use this toolbar to specify the samples to open or export Select the desired plate from the Plate drop down list Valid samples appear as filled wells Wells not specified as samples appear dark or empty Click on the samples to open or export e To view the name of a sample and associated result position the cursor over the sample The sample and result names appear in the Sample and Result text boxes To select contiguous samples click on the first sample in the series hold down the Shift key then click on the last sample in the series The selected samples are highlighted GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 119 PN B40154AC Sequence Analysis Sequence Analysis Module Overview 120 Base Sequence Toolbar To display the Ba
211. ay immediately select Replace capillary array To install a manifold plug select Install manifold plug T Help To clean the capillary windows select Clean capillaries Remove Capillan Array Options Replace capillary array C Install manifold plug C Clean capillaries Capillaries exposed to air H Time Remaining min Sec na pa While holding the array fitting tab align the array fitting with the manifold opening and guide pins Push the fitting into the manifold until it is completely seated against the bases of the guide pins Figure 9 3 positions Replace the manifold access cover and tighten the captive screw Lower the capillary temperature control cover and secure the two rubber latches Lower the capillary access cover and sample access cover to their closed locked GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Maintenance and Diagnostics Routine Maintenance 20 Click Done in the Install Capillary Array dialog box Figure 9 6 Please enter the serial number for the capillary array IF pau wish to reset Dee the number of runs for the capillary or number of days it has been on the Instrument enter the new values Cancel Click on Done when you have installed the capillary array and have closed both the capillary access cover and the sample access cover Set to New Help Capilares exposed to air Time Re
212. ays both sequence traces in their entirety Toggle Sequences Displays or hides the sequences in the text view Toggle Reference AA Translation Displays or hides the reference amino acid translation line in the text view Toggle Consensus AA Translation Displays or hides the consensus amino acid translation line in the text view Toggle Differences Displays or hides the differences line in the text view Dye Color Coded Text Displays base text in the specified dye colors when selected Displays the base text in black and white when not selected Dye Color Coded Text block Displays the base text background in the specified dye colors when selected Help Topics Displays the CE system online help By default the help system displays the Contents in the navigation pane located on the left and the introductory topic in the topic pane located on the right You can use the Contents to select and print specific help topics The navigation pane also provides a Search tab and an Index tab These tabs let you search for information by topic index entry and or keyword E E SS S Context Sensitive Help Click this icon and then on a menu item to open the Help file related to the selection m Dye Colors Toolbar The Sequence Investigator modules Dye Colors toolbar identifies the colors assigned to dyes displayed in the trace data view and for the bases in the text view To change any of these color assignments double clic
213. ble the system to increment the sample names on export if it encounters samples with the matching names Click Finish Navigate to the target folder and double click the exported file to open it in Excel Notepad or any other text editor You can view the properties at the beginning of the file 264 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Fragment Analysis Module Exporting Results CEQ File Format The CE system offers the CEQ export option from the Fragment Analysis module You can select cq as an export file type for exporting fragment results from the Fragment Analysis module Export Sample Elements i Header Save in O Export amp m er EB M Raw Data IM Aesult Data EC TEST v Result Output Options IY Remove CEQ Tracking Suffix w Resolve Filename Conflicts File name DEFAU LT save as type CEG eq L ancel Figure 6 42 Fragment Result Export Dialog Box To export fragment results in CEQ cq format from the Export Results Options window 1 Click Save As Use the folder navigation options next to the Save in field to locate and select the folder in which you want to save the export file 2 Enter the desired file name in the File name field NOTE Do not use special characters in the file name V l 3 Select CEQ cq from the Save as type drop down list 4 Click Save The system returns to the Export Results Opti
214. c Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Getting Started System Overview Table 1 1 Gel Pump Gel Cartridge and Gel Pump Plug Component Description Gel Cartridge Contains the fresh DNA separation gel The separation gel is used for both Sequence and Fragment Analysis As an example the 20 ml gel cartridge on the dual rail system is shown below in Figure 1 9 Gel Pump Plug When the gel cartridge is not installed for example during shipping and storage the gel pump plug is inserted into the pump barrel to prevent gel from drying in the system 901635L Al Figure 1 9 Gel Pump 1 Gel Pump Gel Cartridge Access Cover 4 Cartridge Locking Lever 2 Cartridge Locking Lever 5 Cartridge Barrel 3 Cartridge Barrel GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 9 PN B40154AC Getting Started System Overview Status Indicator Lights There are three status indicators PWR power LASER and HV high voltage as shown in the figure below 901652L Al Figure 1 10 CE System Location of Status Indicator Lights Table 1 2 Status Indicator Lights Indicator Description PWR Green light is on when the CE system is powered on The light is off when the CE system is powered off LASER Green light is on when the lasers are turned on during arun The light is off when the lasers are turned off HV Green light is on when
215. ce Troubleshooting Performance Test Condition Radio Frequency Field Interference RFI System exposed to electromagnetic field strengths of greater than or equal to 3 V m at multiple frequency bands Disposal and Recycling A28219 AA A A016608L EPS Effect on Performance May cause temporary degradation of data accuracy In some cases significant noise may appear in the measured results Separation data will return to normal performance once exposure is removed May cause temporary loss of capillary temperature control resulting in lower than expected capillary temperature The system logs the effect in the run log It will return to normal performance once exposure is removed May cause temporary loss of capillary temperature control resulting in run not being initiated because temperature cannot reach desired level Mitigation Always run duplicates and controls Evaluate peaks carefully for anomalous results Re run sample Move location of the product by several meters Change the orientation of the equipment by 90 degrees Avoid using transmitters or cellular phones within 1 meter of the equipment Review the temperatures in the run log for any anomalies and re run as necessary It is important to understand and follow all laws regarding the safe and proper disposal of electrical instrumentation The symbol of a crossed out wheeled bin on the product is required in acco
216. ch allele under the following columns ID Uses the allele naming convention described in the section above Nominal Size Displays the generated fragment lengths as the initial integer values You can modify these values to represent the allele sizes that appear when the data is analyzed The nominal sizes are also displayed in the apparent size column but these will usually be edited or regenerated Apparent Size Displays the fragment lengths which are either entered using the locus tag editor generated by interpolation or regression from an incomplete list or generated from the automatic binning analysis feature see Performing Bin Analysis on page 239 When apparent fragment lengths are user entered or generated by interpolation or linear regression you must enter the nominal sizes When the apparent fragment lengths are generated by binning analysis the nominal sizes are automatically generated Refer to the following pages for more information regarding generation of the allele list using interpolation or linear regression Std Dev and Num Points Describe the number of points included in each bin and the sample standard deviation Both of these columns are generated using the automatic binning feature see Performing Bin Analysis on page 239 and are empty for allele lists not based on a bin analysis Comment Displays any user comments associated with the allele Interpolation and Linear Regression You can generate a
217. ch as the Human ReferencePlex A54657 or with one s own custom multiplex c To monitor the stability of gene expression between samples the peak areas of the reference genes should be normalized to Kan peak area in GeXP Data Tool and the resulting relative expression values compared between samples d Thosereference genes that have the most stable expression between samples should be chosen as normalization genes e The greater the number of normalization genes used the lower the chance of any one of those genes affecting the normalization factor Therefore if there is some fluctuation in expression of one reference gene the effect will be diluted by the presence of the other reference genes 6 Design amplicons with sizes in the range of 105 to 350 nt without universal tags 7 Ensure spacing between amplicons in the same multiplex is at least 5 nucleotides Primer Design using NCBI Primer BLAST l Goto http www ncbi nlm nih gov tools primer blast 2 In PCR Template box enter accession number or FASTA sequence 3 Under Primer Parameters set PCR product size range as 105 to 350 nt NOTE For Primer melting temperatures accept the default settings Ensure that the Max T difference between the forward and the reverse primers is no more than 5 NOTE For FFPE samples set PCR product size range as 63 to 150 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Gene Expression
218. ch of these menus and their options File Menu Click the File menu to display its drop down menu as shown in the following example Eile Mew Study Open Study Close Study Manage Studies Save Study Save Study As Add Raw Data to Study Add Result Data to Study Export Results Export Fragments Genotypes Transfer Fragments Far eP Preferences Print Screen k 1 GATA193A07 Exit Use the File menu to create open manage and save Studies or export edit and transfer Fragment results The following table describes the Fragment Analysis module s File menu options Table 6 2 File Menu Fragment Analysis Module Option Description New Study Starts a new Study from either raw data or analyzed results Open Study Opens an existing Study Close Study Closes the active Study Manage Studies View and select all Studies saved to the database Save Study Saves the new or edited Study Save Study As Saves the current Study with a new name Add Raw Data to Study Select additional data raw data to add to the Study Add Result Data to select additional data previously analyzed result data to add to the Study otudy enetic Analysis System User s Guide For n Vitro Diagnostic Use 191 Fragment Analysis Module Fragment Analysis Module Overview 192 Table 6 2 File Menu Fragment Analysis Module Option Description Export Results Export data in one of the following formats e Text Tab D
219. contaminants These peaks tend to have a different shape than fragment peaks but often fall within the size range of a locus tag and are detected However they generally do not meet the criteria to be identified as known alleles and are therefore labeled as spurious peaks The Spurious Peak Detection area allows you to direct the system to look for spurious peaks in your analysis You can specify a height threshold under which the system identifies a peak as a contaminant and not include it in your allele list To enable this option l Select Detect spurious peaks if you want the system to remove any peaks that are below the maximum height threshold for spurious peaks 2 Inthe Maximum height for spurious peak field enter the percent of the spurious peak relative to the true allele below which detected peaks are considered spurious peaks A Detection A Detection is an allele calling criteria used to compensate for a common DNA polymerase phenomenon of adding a non template directed deoxyadenosine to the ends of PCR products The result is a mixture of PCR products Some of which are template true length called A products while others are one nucleotide longer called A products The ratio of these two types of products can vary greatly between different reactions and primers The result of having different fragment sizes from a single allele complicates the interpretation of fragment analysis data Instead of one
220. ction left click any sample in the grid Figure 2 7 Select the Entire Plate 32 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Sample Setup Module Using the Sample Setup Module Selecting the Entire Row Place the mouse pointer over the row label on the left hand side of the row to be selected A small black arrow will replace the mouse pointer Click once to select the row To remove the selection click any sample in the grid Figure 2 8 Select an Entire Row Selecting the Entire Column Place the mouse pointer over the column label at the top of the column to be selected A small black arrow replaces the mouse pointer see Figure 2 9 Click once to select the column To remove the selection click any sample in the grid Figure 2 9 Select the Entire Column Selecting Contiguous Cells To select contiguous cells l Left click the first cell in the column or row 2 Press and hold the Shift key 3 Left click the last cell in the column or row to be selected 4 Release the Shift key pps oo R1 g1 amp 01 r9 g1 A02 r8 g2 A03 r ga Ang 2 r2 q1 B01 r1 q2 B02 r9 g2 z r8 q3 B04 r3gl cO1 r2g2 c02 r1g3 cos Serep r gf DO or3q2 D02 293 003 riot D04 E el ad Coe ed a En Pe 2 2 ee ead End Figure 2 10 Select Contiguous Cells GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 33 PN B40154AC Sample Setup Module Using the Sample Setup Module
221. cus from property to value and then to the next row and the arrow keys move in the direction selected e Press the Enter key moves the focus down the table one cell at a time within the same column Mate Method Analysis ol x el e ud PROPERTY VALUE Template Source Mo insert Figure 2 13 Property Set Editor 3 To select an entire column for sorting click on its header The selected column becomes highlighted 4 To select a row click on its number As with the column selection the selected row becomes highlighted GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 37 PN B40154AC Sample Setup Module Using the Sample Setup Module 5 To select consecutive rows left click and hold the mouse button while dragging the cursor over table cells 6 To move a selected row up or down one cell at a time click the toolbar arrow icons 7 To delete the contents of the rows select the desired rows and click the Delete icon X A warning message opens prompting you to confirm deletion Click No to return to the editor without deleting the property Click Yes to delete the contents and remove the row from the property set Entering a New Property l i A new row appears into the property table 2 Enter the new property name and value into the cells of the new row e To assign a pre defined property set click and select from the defined property sets as shown below
222. d Raw Data to Study il 04 25 201 4 17 45 05 H pass Locus info modified Default exPAnalysisParameters Add Result Data to Study 04 25 2014 174505 H pass Locus info modified D efaulGexPAnalysisParameters pes pas 04 25 2014 17 45 02 H part Locus info modified DelaultGexPAnaly Parametar ports ey 04 25 2014 17 45 02 H pass Locus info modified DefaultGie lt PAnaly sis Parameters Export Fragments Genotypes H pass 8 H Transfer Fragments for GeXP L 5TD GO04 0902231973 L STD G03 0302231860 G Preferences E Print Screen G cific Exit G ari oc modit CSTI GOB USU223JTHH2 G modified Det l eter L STD GO _090223187T 04 25 201 4 17 45 01 G pass Locus info modified DefaultGexPAnaly sis Parameters L 5T 0 G06_090223187N 04 25 7201 4 17 45 01 pass Locus into mocdilied DefaulGexPAnaly sis Parameters J L5TD GO5 0902231876 04 25 2014 17 45 01 G Paes Locus info modified DefaultGe PAnalysisParameter 1 7 45 00 G pass LST D G02_0902231860 5 00 201 4 17 45 00 G pass LJ L 516 G01_ 0902231866 04 257 Summary A B C D E F G H Total Pal E E la Eme ul Excluded D 2 1 3 D m D Ui 0 Stale 7 13 Show Excluded Figure 7 18 Exporting Fragment Results for Gene Expression Analysis 2 From the Transfer Fragment for GeXP window type a file name study name for the fragment results in a designated direct path GenomeLab Genetic Analysis System
223. d of collected raw data PCR Product Selecting this check box M1 causes analysis to end when a sudden drop off of signal lasting at least two minutes is encountered This prevents the analysis of baseline data 200 Bases oignifies that the sequences generated from PCR are less than 200 nucleotides in length Selecting this check box 1 changes the default values for the Delay and Minimum Duration on the Initial Data Detection tab The default value for Delay is 0 20 minutes and the default value for Minimum Duration is 2 00 minutes NOTE This option is available only when PCR Product is selected Use Default Mobility Select this check box 1 to optimize the analysis results of most short PCR Calib products This stabilizes the data adjustment that accounts for the difference in mobility of fragments due to their respective dye labels This differential mobility has the greatest effect on the shorter fragments and has to be accounted for in the analysis of data that includes short fragments NOTE This option is automatically selected when 200 Bases is selected which is recommended Pre peak Reduction Select this check box L1 if you want the software to identify and reduce the inclusion of pre peaks in the analyzed data Pre peaks are artifacts that may appear one base prior to the significant peak They are usually caused by including primers that are not full length in the sequencing reaction Sometimes they are caused by sl
224. d toolbar contains icons that correspond to common menu options ze allez ss 2 p Figure 5 2 Standard Toolbar Sequence Investigator Module The following table describes the Sequence Investigator standard toolbar icons Table 5 7 Toolbar Icons Sequence Investigator Module Icon Description New Prompts for a reference file from a Windows folder or disk then prompts for one or two sequence results from the current working database Ej e We Open Open an existing compared sequence result save Saves the active document to a Windows folder Print Prints the active document as specified in the Report Format dialog box Print Preview Displays a print preview of the active document using the format specified in the Report Format dialog box Print Desktop Prints the active desktop area as specified in the Preferences dialog box Insert Inserts a space before the currently selected position Delete Deletes the selected position Trim Removes contiguous selected bases that contain an end base in the sample sequence base call text Restore to Original Restores the compared sequence result to its original state removing all changes m GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 177 PN B40154AC Sequence Investigator Module Sequence Investigator Module Overview 178 Table 5 7 Toolbar Icons Sequence Investigator Module Icon Description Unzoom all Displ
225. de of the allele names Then right click on the highlighted area and select Remove Allele s to delete alleles with empty bins 5 New Binning Analysis Apr sisse Bin View Trace Views Parameters Nominal Size vs Apparent Size Slope 1 00087 y intercept 0 2175 P 0 99999179 Binning Locus Tag Source Data Relative Signal Strength Allele List iD Nominal Size nt Apparent Size nt 149 09 E 151 51 22 Add Shorter Allele Add Longer Allele Interpolate Regression Remove Allele s Phase Shift xx Min Rel Peak Height ze M Show Phantom Bins Help lt lt Previous Cancel Figure 7 8 Removing Empty Bins GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 285 PN B40154AC Gene Expression Set up Locus Tag and Allele IDs If peak had a significant shoulder or A peak then there will be a number of data points in the bin before the actual peak These A peaks should be deleted as well Sort by Nominal Size nt to put the alleles list back to the order of fragment size Rename the allele ID name with the corresponding gene name for each specific gene peak Ensure the gene name is no more than 8 characters long 10 After renaming all Allele IDs corresponding to all gene peaks in the multiplex remove extra alleles 11 Click on the Next button to continue New Binning Analysis fama Steps Bin View Trace Views Abg Nominal Size vs
226. ded if the peak resolution is good Exporting Sequence Result To export from the Sequence Analysis module l Launch the Sequence Analysis module an d open a sequence result 2 Select File Export to open the Export dialog box 3 Select a target folder and file name NOTE Do not use special characters in the file name Xa vium 4 Select the desired format in the Save as type drop down list as shown in the following example Export Sample Elements Result Output I Guality Parameters Alignment Results Alignment amp ecuracy Options Remove CEQ Tracking Suffix Resolve Filename Conflicts Iv Apply Trimming File name Figure 4 40 Sequence Analysis Export Dialog Box 5 Click Export Save in Co Export Am I Header M Raw Data Imi Result Data Sequence Test 403 6042415KM Sequence Test A03_06042416KN save as Ippe str ver 3 00 sct L ancel SLE Mer 3 D scf SCF Ver 2 10 sct Text Tab Delimited tet SEQ Sequence Text only seq FASTA FASTA and QUAL Fasta PHRED PHRED and SCF sch phd o E GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Sequence Analysis Using the Sequence Analysis Module Sequence Export File Types The following table describes the available export file types and options Table 4 29 Sequence Export Options Option Description SCF scf U
227. duce high quality base sequences or fragment lists after separation Raw and analyzed data are stored in a database and may also be exported in file formats compatible with common analysis applications GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 3 PN B40154AC Getting Started System Overview Hardware The hardware performs sample handling as well as tasks associated with the separation and detection phases of electrophoresis Figure 1 1 shows the GenomeLab instrument The following sections describe the GenomeLab instruments user accessible hardware components amp LE
228. e Open Study Study Mel E Create a new Study from AS Analyzed Results e GP C Open an existing Study Date Time D1151384 test af2 2006 11 32 33 AM IATATS3AU test 3 27 2005 11 40 28 AM GATATISAO test 3 27 2005 12 44 52 PM Don t show this dialog box again Cancel Figure 6 6 Study Window Creating or Opening a Study You can create a new Study from either Raw Data or previously Analyzed Results Make your selection using one of the option buttons and click OK to continue The Study Wizard guides you through the steps of creating a Study After the system analyzes the samples you may include additional results in the new Study To open an existing Study select it from the list of Study names available under either the Existing Studies tab or the Recent Studies tab The Date Time column indicates when the Study was created or last modified When you have made your selection click OK to open the existing Study Selecting the Components of the New Study The first step in creating a new Study involves manually filtering data from the database by selecting the samples you would like to include in your Study This is first level filtering After the system analyzes these samples you may further filter the sample results second level filtering in the Result Set View 200 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Fragment Analysis Module Working w
229. e 2 in the fragment data pane and D2 is the black default name D3 Green is the default color assigned to Dye 3 in the fragment data pane and D3 is the green default name D4 Blue is the default color assigned to Dye 4 in the fragment data pane and D4 is the blue default name GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 50 PN B40154AC Run Module Run Module Overview 60 Status Monitor The Status Monitor displays the state of the current run Figure 3 9 shows the status monitor and Table 3 14 describes the areas Status R un Sample Plate Event Type Temperature Hamping Progress Event 0 0 Sec Sample Set 1 37 Min Sample Plate 2 228 Min Sample u mp Device Life Active Plate LEFT Sample Plate SHIP Method SNP 1 Project Default Sample Mame Position R1 g1 A01_03062609LF amp 1 291 801 _03062609LF E1 3g1 CO1O3062609LF Cl 4 g1 001_03062609LF D1 5 g1 E01_03062605LF El r5 g1 FO1_O3062609LF F1 m gl G01_03062609LF Gi 8 g1 H01_03062609LF H1 Capillaries exposed to air Gel Cartridge life exceeded Capillary usage exceeded On line Figure 3 9 Status Monitor Displays Run Module GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Run Module Run Module Overview Table 3 14 Status Monitor Displays Run Module Item Description A Progress Indicator This area of the Status Monitor shows the Sta
230. e Naming Alleles on page 219 Click Next The system applies the new parameters to the scatter plot and assigns the bins as specified New Binning Analysis IBI XI Steps ETE 7 p j i Bin View Trace Views iin is Nominal Size vs Apparent Size Slope 0 98685 y intercept 4 9889 f 0 99987068 373 902 937 151 Binning 407 709 0 327 S 750 EGATAI93407 n 4n i Locus Tag SN 100 1 120 089 130 187 160 123 187 18 500 Source Data o 250 035 H o a ty a E A 025 Relative Signal Strength Dye Signal E 320 330 340 350 360 370 380 390 ann Fragment Size nt Allele List jp Rosina Size nil Apperent Size mi S Dev ot Num Points 1 gt Dye Signal 0 0 0 ET Ia 0 a 5 0 in 8 5 3 5 3 0 xn cO n Size nt 4 gt Phase Shift 0 m Min Rel Peak Height 0 01 m Show Phantom Bins v Show Bins lt lt Previous L Net Einish Cancel Figure 6 28 New Binning Analysis Window Bin Analysis View Viewing Bin Analysis After applying the bin analysis parameters to the selected data the system displays the results of the bin analysis This bin analysis view is composed of three areas representing the selected results Bin View The Bin View consists of a scatter plot diagram showing the Fragment Size x axis versus the Relative Signal Strength y axis The points plotted represent the results selec
231. e Locus Tag and Allele List Fragment Analysis Module Performing Bin Analysis After completing the bin analysis the system generates an allele list based on the information gathered during the analysis It updates the list but at this point has saved it to the database The system prompts you for the locus tag to save to the generated allele list K New Binning Analysis Steps Parameters Binning Locus Tag Locus Tag Allele ID Criteria Locus Information Source Data Locus Mame Dye Fragment length range between 4325 and ADO nt Repeat unit length 4 n nt H of repeats in shortest Allele 1 Locus Tag Project Default kd Bik EI Date last modified Ancillary Information Primer set name GenBank Accession Repeat unit sequence Ploidu m Primer Label Primer Sequence Forward Forward 5 bo 3 CB uoo Reverse FY bo 3 f None Comment amp x Previous Finish Cancel Figure 6 29 New Binning Analysis Window Updating Locus Tag You can use this window to select an existing Locus Tag from the drop down list or add any Ancillary Information to the selected locus tag at this time Save the new data to the selected locus tag to update the allele list with Locus Information including Dye Size and Repeat Unit Length NOTE Refer to Locus Tab on page 218 or Using the SNP Locus Tag Editor on page 225 for more information about locus tag parameters The sys
232. e Sample Setup Module 44 Resolving Filename Conflicts Select this option to automatically increment the exported files of the same name with a unique sequence number Export Options Sequencing Results The following options are specific to sequencing results only Apply Trimming Select this option to remove the trimmed data from a sequence before it is exported The ec 2 export replaces all internal trims with the letter x Export Only If Sequence gt X nt After performing the trimming operation the resulting sequence may be too small to be useful Select the Export Only If Sequence X nt option to specify a minimum size for the sequence output when exporting This exports only those sequences greater than the set number of nucleotides See the Online Help for additional Export Sample Elements Importing Sample Plate Information from TXT Files Importing a Sample Plate with Default Run Method and Analysis Parameters Import the sample plate txt file s to the CE System The run default separation method s and analysis parameters that were pre selected in the imported sample plate data sets will be used for running and analyzing the plate Select an appropriate Working Database and Project in the Data Manager module Open the Sample Setup module From the Menu Bar select File Import In the Import dialog navigate to the folder containing the Sample Plate TXT file Highlight the selected sample plate TXT
233. e all properties You can then open the exported file in any text editor or MS Excel to preview the file prior to printing To export results l Open the Fragment Analysis module 2 Select File Export Results The Export Results window opens as shown in the following example W Export Results x Steps Results Options Project AFLP 06 TP2 20 s _ T Fragment Results atart nd pcenam Result Available Selected 8 DATS 93 D4 401_06042513WU 4 25 2006 1 55 16 PM DATS 93 D4 401_060425122M 4 25 2006 12 59 57 PM DATS 3 DATS 94 D4 B01_06042513WW 4 25 2006 1 55 23 PM DATS 94 04 B01_060425122K 4 25 2006 12 59 51 PM DATS 9 DATS 36 D4 CO1 05042513WZ 4 25 2006 1 55 29 PM DATS 36 D4 CO1 050425127 4 25 2006 12 59 45 PM DATS 9 DATS 37D4D01 06042513X1 4 25 2006 1 55 36 PM rz DATS 97 D4 001_060425122F 4 25 2006 12 59 37 PM DATS 3 DATS 99 04 01_06042513x3 4 25 2006 1 55 44 PM zz DATS 99 D4 E01_060425122C 4 25 2008 12 59 27 PM DATS 3 DATS 100 D4 F01 06042513 6 4 25 2006 1 55 51 PM DATS DATS 100 D4 F01 0604251278 4 25 2006 12 59 21 PM DATS 1 DATS 101 D4 G01_06042513X9 4 25 2006 1 55 58 PM DATS 101 D4 GO1 0604251276 4 25 2006 12 59 13 PM DATS 1 DATS 102 D4HO1 06042513 B 4 25 2006 1 56 04 PM DATS 102 D4HO1 0604251224 4 25 2006 12 59 06 PM DATS 1 lt lt Previous ico TN Figure 6 39 Export Results 3 Select the results you want to expo
234. e clicking on Unload You have 15 minutes to change plates once you click on Unload This time limit is critical so that the Cancel capillaries are not adversely affacted by prolonged exposure to air Help The capillaries will automatically be immersed in the Wetting Tray after the plates are loaded Figure 1 18 Unload Plates Dialog 5 Click Unload The Capillaries Exposed dialog Figure 1 19 will appear GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 19 PN B40154AC Getting Started Operating the System 20 Lapillaries Exposed X You may now open the sample access cover to load plates Capillaries exposed to air Cancel Alarm Uff Help Time Hemaining mir Sec fia er Figure 1 19 Capillaries Exposed Dialog 6 Install sample plate buffer plate and wetting tray into their appropriate positions and click Load 7 Click Start to begin the Run GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Sample Setup Module Overview sample Setup Module 2 1 Overview Create save and modify methods and sample plates Methods consist of sequential events needed to perform a DNA separation Sample plates provide a way to name and organize samples The sample plate definition contains the 96 well plate locations of the samples as well as the method assigned to each sample The capillary array must ru
235. e current for the eight capillaries and the voltage level of the instrument for the current run To open this window select the Instrument Data tab d d a Direct Control Log Instrument Data TRA bru NS C ANa ec nemo Amn geet MA d CR ECKE tet e SUM n 8 VOR A Neue Sagen ute n ROGER AGOSTO Oe e re ROS a NAS Ch B Current rricroA 40 Time Minutes 40 Time Minutes Figure 3 13 Instrument Data Window Run Module Table 3 18 Instrument Data Window Run Module Item Description A Current and Voltage Buttons Select panes for display Window Selection Tab Select this tab to access this window C Display Area Displays the current and voltage levels of selected current run 66 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Run Module Using the Run Module 3 2 Using the Run Module Run sample plates and set the display options To open the Run module from the Main Menu click the Run icon Gel Plug Warning When you open the Run module the system initializes and checks the gel cartridge condition If the system detects an installed gel plug the Device Warning Message appears as shown in Figure 3 14 Device Warning Message v Instrument status Gel Plug Installed Loading Gel Cartridge Pleaze install a Gel Cartridge for proper operation Figure 3 14 Device Warning Message Gel Plug Installed In addition to th
236. e dialog NOTE Always note the lot number and the hours on the instrument for a gel cartridge if you are planning to use it for more than one session NOTE The lot number is an alphanumeric text box for your own identification purposes CAUTION If the gel cartridge has been on the instrument for more than 72 hours it is likely that the gel will produce undesirable results Install Gel Cartridge X Gel Cartridge Part Number poeni T Set ta Mew Lot Humber CEG Sequencing Gel Gel Name LPa Cancel Date Installed 08 28 2001 Help Time Installed f 3 15 43 Hours on Instrument fo 4 Figure 3 55 Install Gel Cartridge Dialog Box 12 Dispose of the used tissue and spent gel cartridge in accordance with the procedure Maintenance and Diagnostics on page 339 98 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Run Module Using Direct Control Removing the Manifold Plug The Manifold Plug is installed during shipping and when the instrument is not in use to prevent the gel from drying NOTE This procedure assumes that the Manifold Plug is being removed in preparation for Capillary Array installation l Select Replenish Release Capillary Array from the Run Module main menu 2 Wait for the Remove Manifold Plug dialog box to appear 3 Open the Sample Access Cover and lift it to the vertical locking position 4 Open the Capillary Access Cover and lift it to the v
237. e fragments in the Study the system assigns a 1 if it finds a fragment in that sample and assigns it a 0 if the fragment is absent It then creates a table of 1 s and Os You can export the text to most other statistical analysis and spreadsheet software GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Fragment Analysis Module Performing AFLP Analysis Setting the AFLP Analysis Parameters To start a new AFLP analysis select Analysis New AFLP Analysis The New AFLP window opens NOTE You can also access this from the Analyses tab of the Study Explorer M New AFLP Oy x Analysis Parameters hd asimum Bin width Y Threshold Exclude Fully Populated Bins Exclude Samples w o Qualitying Peaks Cancel Figure 6 32 New AFLP Window ALFP Analysis Parameters The analysis parameters area allows you to set filtering parameters for including or excluding fragment results in your AFLP analysis e Maximum Bin Width Sets the limiting value given to the width of the individual bins The default value is 1 0 nt Enter the value in nucleotides Within each dye label the system clusters the fragments with the sizes that fall within the set bin width and creates a bin with the size rounded to the next integer e Y Threshold Serves as a exclusion filter defining the lowest acceptable value peak height for the y axis The default value is zero RFU Set the y threshold in r
238. e of export The DNA section is composed of the base call always lower case PHRED Quality Value and the Peak Index data point of the analyzed data contained within the associated SCF file Values are separated by spaces Selecting the PHRED format exports the Result Data Result Output Base sequence and Quality Parameters automatically if the sample has been analyzed with a sequence analysis parameter set If the sample has been analyzed with a fragment analysis parameter set nothing is exported The ESD electropherogram sample data format is used to export raw data from the CE system to a third party software package for analysis Selecting this option exports only the raw data and no other information GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Sequence Analysis Using the Sequence Analysis Module Table 4 29 Sequence Export Options Option CEQ cq Remove CEQ Tracking Suffix Resolve Filename Conflicts Apply Trimming Description Selecting the CEQ format the format native to our database exports sample data sequence or fragment results sample plate results sequence or fragment analysis parameters sample plates methods locus tags fragment data only standards fragment data only and optical scan data The sample elements are automatically selected in the Export dialog box such that all of the associated information listed above will be exported This forma
239. e of the compared sequence and the name of the sample sequences as well as the database and project where the sample resides Alignment Prints the reference amino acid translation the reference the sequences the difference codes the consensus and the consensus amino acid translation History Log Prints a history of changes you performed in the alignment Statistics Prints the statistics of the report such as the number of discrepancies before and after editing Mutations Prints all mutations including known and novel bases and amino acids Exporting the Sequence You may export the active compared sequence in either of three formats as described in the following table Table 5 9 Export Formats Format Description text txt Exports the base sequence of the consensus GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 1 87 PN B40154AC Sequence Investigator Module Sequence Investigator Procedures 188 Table 5 9 Export Formats Format Description tab delimited Exports data as a single line and all carriage returns 1 are replaced text txt with tabs 9 protein pro Exports the amino acid sequence To set the protein format select File Preferences and choose one of the following format in the Preferences dialog box Condensed Provides all protein translations in the same text line and designates heterozygotes between brackets Expanded Includes all possible translations
240. e should be the same For example the Locus Tag and Locus Name was set up as Human Ref for GeXP Human ReferencePlex Project Select the project from where the data was selected for this study e Dye 4 Fragment length range between 149 340 nt for GeXP Human ReferencePlex Repeat unit length 1 e of repeats in shortest Allele 1 e Ploidy 2 default e Primer Label None default 13 Select the Allele ID Criteria tab GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 287 PN B40154AC Gene Expression Set up Locus Tag and Allele IDs 288 12 New Binning Analysis Steps Parameters Binning Locus Tag Source Data Locus Tag Human Ref Project Default LocusTag Allele ID Criteria Date last modified Stutter Definition Search for Stutter Stutter detection window width i repeats Maximum relative stutter peak height m 7 E Confidence Interval System generated allele confidence interval 0 21 mit W Overmrite system confidence interval 0 5 nt Spurious Peak Detection Detect spurious peaks Maximum height for spurious peaks E z amp Detection Apparent size includes 4 Detect 4 Use 4 peak to call Allele Allele List Comment Figure 7 11 Parameters for Allele ID Criteria 14 Set up the parameters as follows Previous Finish Cancel For Stutter Definition Spurious Peak Detec
241. eated Lid for 96 Well Plates Vortex Mixer Non Frost Free Freezers 80 C and 20 C 384 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Maintenance and Diagnostics Diagnostics 9 5 Diagnostics This section provides some common diagnostic procedures you may perform as needed on the GenomeLab GeXP system Re Initializing the System To re initialize the system select Run Reset in the Run module Homing the Plates and or Gel Pump To re establish the position of the plates and or gel pump p supe sut BIS de Select Run Diagnostics in the Run module The Diagnostics dialog box opens Select the Home Plate and or Gel Pump check box Click OK Monitor the Tests dialog box and verify that the final results is Test passed Click the Close button Viewing PC Settings To view the computer settings Select Run Diagnostics in the Run module The Diagnostics dialog box opens Click the PC Settings button The PC Communication Settings dialog box opens View the settings the system uses to communicate with the instrument then exit the dialog box Viewing Instrument Status To view the instrument status S sS voe eee ros Select Run Diagnostics in the Run module The Diagnostics dialog box opens Click Status View and or change the settings in the Run Control Monitor dialog box Click OK The dual rail system has a barcode reader To read the barcode on sample plates
242. ed to purge the manifold with fresh gel followed by a capillary gel fill before each plate run If the system has not been used for a long period of time thoroughly purge the manifold and run the condition method before performing a sample separation Performing the condition method fills the capillaries with gel 6 times NOTE Thoroughly clean the wetting tray with D I water before every run to remove old or dried gel Creating or Editing a Method To create and or edit a method Select Edit Method from the Sample Setup main screen Highlight the desired method in the Choose Method to Edit dialog box and click OK When the Method Capillary Temperature dialog box opens enter a temperature between 35 and 60 C a Select the Wait for Cap Temp option if desired b Click OK to exit the Method dialog box or continue with step 4 to make additional changes to the method 4 Select Denature from the Event list a Enter a duration between O and 180 seconds if O is selected there will be no denaturation b Click OK to exit the Method dialog box or continue with step 5 to make additional changes to the method 5 Select Pause from the Event list GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Sample Setup Module Using the Sample Setup Module a Enter a time duration between 0 and 10 minutes b Click OK to exit the Method dialog box or continue with step 6 to make additional
243. een selected as a reference Result Name Displays the result name Ratio R T Displays the ratio of the reference peak to the test peak Ratio T R Displays the ratio of the test peak to the reference peak Timestamp Displays the time the quantitation was performed Sample Name Displays the sample name Reference Peak Height Displays the height of the selected reference peak Test Peak Height Displays the height of the selected test peak Test Peak Quantity Displays the calculated quantity of the test peak based on user supplied reference values Comments Displays any user comments associated with the result Mean Data Points amp Standard Deviation The lower left area of the Peak Ratio window displays system generated values for each of the calculated columns in the Peak Ratio Result Table Based on the reference and test peaks selected the system calculates the Mean the of Data Points and the Standard Deviation GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Fragment Analysis Module Calculating Peak Ratios Selecting a Reference Trace A reference trace is a user selected trace assigned as a reference by the system for comparative analysis of peak height and area You can select the reference trace from either the Peak Ratio Result Table or from the Fragment Result Set Traces areas of the window e To select the reference trace from the Peak Ratio Result Table right click your
244. efault name displayed in the Save As dialog box otherwise the system saves result as a temporary file which it will overwrite in the next LOH Analysis NOTE If more than two alleles are found for a locus the last allele listed for the locus will be followed by an asterisk GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 253 PN B40154AC Fragment Analysis Module Customizing the Results List 6 12 Customizing the Results List 294 The components of the results list are user defined You can modify them using the right click menus These commands allow you to select specific columns to display in the results list customize the arrangement of information add or remove columns and modify several other parameters of the results displayed Customized lists are available in the Result Set View the Fragment List AFLP Analysis and Peak Ratio tables Selecting Columns for Display The Column Selector window contains a list of all possible columns that you can display in the list You can select these columns individually or in groups arrange them in any order and lock them so they always remain in view when scrolling through the fragment list Accessing the Column Selector Window To access the Column Selector window right click the column header area of the list to display then select Select Columns The Column Selector window opens as shown in the following example Column Selector Miel
245. elative fluorescence units RFU The system excludes fragments with heights less than this threshold value from the clustering process e Exclude Fully Populated Bins Select this option to exclude bins represented in all samples such as non polymorphic fragments e Exclude Samples without Qualifying Peaks Select this option to exclude samples that have no qualitying peaks ALFP Dyes The Dyes fields determine the dye colors the system uses during the cluster analysis If the results list contains samples with fragments that have more than one dye either multiple dye labeled fragments pooled in a sample or multiple samples with single dye labeled fragments in each sample you can select the appropriate dyes for export GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 249 PN B40154AC Fragment Analysis Module Performing AFLP Analysis 290 AFLP New AFLP 1 IBEX H A mim ek ek wo e eo 74 74 cCn Molo n3 e nra ccn n ap mami co jm OJo ca ce D4 2n mA Dat n n4 gcn 20429 nn D Sample Bin Fragment Count v Exclude Fully Populated Bins Maximum Bin Width C Sample Bin Binary Presence M Exclude Samples w o Qualifying Peaks C Sample Bin Fragment s Max Y Show Excluded Elements Y Threshold blu Starting a New AFLP Analysis After setting the analysis parameters click OK to generate the New AFLP Analysis XMax XMeanXVa YMean 1 2 3 4
246. elimited txt e CEQ format cq e CRV CRV Export Fragments Export the fragment genotype data in one of the following formats Genotypes CSV Comma Delimited csv e Linkage Pedin pre e Discovery Manager DMPopulation txt e Genotype Summary Report Tab Delimited gsr Transfer Fragments for Export fragment data in a csv file compatible with the GeXP Data Tool GeXP Preferences Set the following preferences e Select whether to display the Study window when the Fragment Analysis module is launched e Specify whether to graph all electropherograms by size or time e oetthe number of egrams to be cached e Select the initial view when selecting the Single Result View of a sample e Specify whether to display a warning message before resetting all manually included or excluded bins during an AFLP analysis e Specify whether to display a warning message before reanalysis if old results in the study will be replaced by new results Print Screen send an image of the computer desktop application window or main window to the printer Recent Studies Lists the most recently opened Studies Exit Closes the Fragment Analysis module View Menu Click the View menu to display its drop down menu as shown in the following example View Fragment List F2 Results Set F4 Lacus List Editor F7 Genotype Summary Fe IM Status Bar IM Study Explorer Toolbars k NOTE A VY next to an option indicates that t
247. emaining Alarm Off min sec ja Bo Eug Figure 3 35 Capillaries Exposed Dialog Loading the Buffer Plate and Evaporation Cover l Align the notched corner of the Buffer Plate with the alignment line on the Buffer Plate Holder Figure 3 31 2 Gently push the Buffer Plate towards the front of the instrument and then set the plate into the transport 3 Atthe rear of the Buffer Plate Holder align the Buffer Evaporation Cover Guide Pin with the Buffer Evaporation Cover Alignment Notch and then gently lower the cover over the Buffer Plate 901599L Al Figure 3 36 Loading the Buffer Plate and Buffer Evaporation Cover GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 81 PN B40154AC Run Module Using Direct Control 1 Front Location 4 Buffer Evaporation Cover Alignment Notch 2 Buffer Evaporation Cover 5 Wetting Tray Retainers 3 Buffer Plate 4 When finished positioning the plate close the Sample Access Cover and then click the Load button of the Capillaries Exposed dialog box Figure 3 35 Setting the Capillary Temperature l Select Direct Control Capillary Temperature from the menu 2 Inthe Capillary Temperature dialog box enter a capillary holding temperature value in degrees centigrade 3 Select Wait for temperature to be reached and then click Start Denaturing a Sample 1 Select Direct Control Denature from the menu 2 Inthe Denature Samples dialog box en
248. ens allele fragments form that differ in length from the true allele by an integral number of repeats such as n 1 n 2 etc The absolute size of a fragment is a function of the variety of repeats for example dinucleotides trinucleotides etc The Stutter Definition area of the window allows you to set the parameters for which the system can identify these peaks as stutter and not as true alleles e Search for Stutter Select this option if you want the system to search for stutter When selected you must also choose at least one of the stutter options below it e Stutter detection window width Select the number of repeats to specify the width of the window around each allele in which the system detects the stutter e Maximum relative stutter peak height Enter the height percent of the stutter relative to the true allele below which detected peaks are considered stutters Peaks above this threshold are considered unknown alleles e Detect stutter shorter than allele Select this option to detect stutters shorter than occurring prior to the allele 222 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Fragment Analysis Module Using the STR Locus Tag Editor e Detect stutter longer than allele Select this option to detect stutters longer than occurring after to the allele Spurious Peak Detection Spurious peaks are generally small trace artifacts detected as a result of sample
249. epresenting the new bin which you should check for consistency Trace Views At the bottom of the Trace Views area select Show Bins J to display the bins with each trace shown in the stacked trace views Investigating Points Position your mouse pointer over any point in the Bin View plot and left click to select it The Trace View displays a trace for the selected point You can use this trace as a visual comparison to other points The visual comparison of the two traces help you confirm assigning a data point to an already defined bin or to a new bin of its own The system assigns a Name and Bin ID using the naming and ID conventions selected in the bin analysis parameters window The ID assigned by the system reflects the bin number with a decimal point and the number of bases over that of the bins For example ID 5 2 indicates a fragment with 5 repeats and 2 extra bases If you prefer a different allele ID you can click the system suggested ID and make changes The final classification is up to you Continue selecting points and viewing their traces until you are satisfied with all the points in the histogram The system stores the information for a new allele or the modified information of an existing one which you can apply in later records The system automatically recalculates the statistics based on the edited results GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Updating th
250. er Open the Standards sub folder in the Default or Project folder Select File New to create a new standard item pu xe a ue Double click on New Standard Item to begin defining the individual size standard fragments d Select the appropriate dye label attached to the size standard fragments Input the sizes of each standard fragment with one fragment per line Select Save As to save the new Size Standard with a new name 328 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Database Management Data Manager Procedures Exporting Database Files from the Data Manager pb de now qe Open Data Manager Open a sequence result Select File Export to open the Export dialog box Browse to the target folder then select and highlight the file name Select the desired format in the Save as type field as shown in Figure 8 9 Sample Elements Header Raw Data Result Data Result Output Quality Parameters Alignment Results Save in E Export a fe ei E Alignment Accuracy Options Remove CEQ Tracking Suffix Resolve Filename Conflicts File name SEG TEST_2006_04_01 Apply Trimmin d i Save as type SCF Ver 3 00 scf L ancel SCF ver 3 00 scf SCF Ver 2 10 scf Text Tab Delimited tet SEQ Sequence Text only seq FASTA FASTA and QUAL fasta FHRED PHRED and SCF sct phd 1 Figure 8 9 Sequence Analys
251. er from the drop down menu enter the lot number and then click OK The system will automatically update the date and time installed and set the Hours on Instrument to 0 b Ifyou are installing the previous gel cartridge do not change the lot number or the hours on the instrument as they will be correct c Ifyou are installing a used Gel Cartridge e Ifitis the previous gel cartridge do not change the lot number or the hours on the instrument as they will be correct e fitis the previously used gel cartridge but it was not the last one on the instrument enter its part number and or lot number and adjust the hours to properly reflect the hours this cartridge has been on the instrument d Click Done on the Install Gel Cartridge dialog NOTE Always note the lot number and the hours on the instrument for a gel cartridge if you are planning to use it for more than one session The lot number is an alphanumeric text box for your own identification purposes CAUTION If the gel cartridge has been on the instrument for more than 72 hours it is likely that the gel will produce undesirable results x Gel Cartridge Part Number onion xl Lot Number CEQ SequencngGel _SettoNew Gel Name LPa Cancel Date Installed 097 2872001 Help Time Installed i3t amp 48 00 Hours on Instrument b 8 Figure 9 46 Install Gel Cartridge Dialog Box Dispose of the used tissue and spent gel cartridge
252. er left corner of the screen then release the mouse button NOTE For details on how to use the search and editing capabilities provided on the navigator toolbar click Help to open its context sensitive help topic Navigator x v Mismatch I ve Ambiguity 7 W Disagreement 7 Insertion Deletion Single Coverage 1 Mutation Hotspot M Low Quality lt Manual Edit C Consensus Text Search Exact Match Consenszue Called B ase Quality Value Differences Figure 5 7 Navigator Toolbar Floating When editing the consensus follow these guidelines Complete all trim operations before performing other types of editing Using any other editing operation disables the trim feature e You may insert and delete spaces in the reference sequence but not change bases e Select a single consensus base if you want to perform base editing NOTE The system adds all editing operations to the history log along with the date time and position of the operation Complementing the Sequence When the system performs a comparison it determines which orientation forward or reverse to provide a better fit with the reference If the system determines that the sequences GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Sequence Investigator Module Sequence Investigator Procedures generate a better comparison in the opposite orientation it a
253. er the migration time of the reference peak minutes for that dye e Window Enter a variable quantity to consider when identifying the reference peak For example if you listed the size of your reference peak as 90 nucleotides you may enter a value of 1 in the Window field This value should compensate for any variability that might arise in identification of the reference peak NOTE The values entered in these fields are based on the ID Standard used either nucleotides for Size or minutes for Time Amount Enter the known quantity of your reference peak EEnter this value as the exponential notation Units Select the units for the quantity entered into the Amount field Values may be any of the following e Moles mol e Grams g e Molarity M e g L STR Locus Tags Tab The STR Locus Tags tab allows you to select the Short Tandem Repeat STR locus tags used for allele identification with the current parameter NOTE Although the STR Locus Tags tab is similar in appearance and functionality to the SNP Locus Tags tab the two types of Locus Tags are used for different purposes STR Locus Tags use size to define allele fragments having a single specified dye label in a specified size range SNP Locus Tags use multiple dye labels for fragments of a single specified size to define specific SNP variants The system uses locus tags to define a particular locus of interest Each available locus tag is conf
254. erozygous bases Table 4 20 IUB Ambiguity Codes Code Mnemonic GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Sequence Analysis Using the Sequence Analysis Module Table 4 20 IUB Ambiguity Codes W Weak 2 H bonds B CGT Not A D AGT Not C H ACT Not G V ACG Not T i M The system reports the heterozygous bases in the analyzed data and in the base sequence data Alignment Reference Tab Use the Alignment Reference tab of the Sequence Analysis Parameters dialog box to enable automatic alignment and to specify the template against which you want to align the active sequence Sequence Analysis Parameters Editor DefaultSequenceAnalysisPar Ea General Initial Data Detection Heterozygote Detection Quality based Trimming Sequence based Trimming Alignment Reference Reference pucl8da pucig C m13 Reference File File Browse Alignment Accuracy Cutoff Accuracy 56 5 E Allowed M 20 Advanced Alignment Parameters Save Az Print Cancel Help Figure 4 13 Alignment Reference Tab Sequence Analysis Parameters Editor NOTE If you opened this dialog box by selecting View Parameters Used to Compute Sequence this dialog box displays the analysis values but disables the fields described below GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 129 PN B40154AC Sequence Analysis Using
255. error rate The range for the quality values is 1 to 99 Edited and inserted bases have a value of 99 You would use this format for instance to export data into PHRAP Selecting the FASTA format exports the Result Output Base Sequence and the Quality Parameters automatically if the sample has been analyzed with a sequence analysis parameter set If the sample has been analyzed with a fragment analysis parameter set nothing is exported NOTE For instance in PHRED a quality value of 10 means 1 error in 10 A quality value of 20 means an error rate of 1 error in 100 A quality value of 30 means an error rate of 1 error in 1 000 A quality value of 40 means an error rate of 1 error in 10 000 etc Normally PHRED would export these quality values into PHRAP In the case of exporting from the CE system we bypass PHRED and export directly into PHRAP The PHRED format produces two files a PHRED file and an SCF file A PHRED file is a text file composed of a SEQUENCE section containing a COMMENT and DNA section The SEQUENCE section also contains the name of the Analyzed Result that was stored The COMMENT section contains the file name of the associated SCF file CHROMAT FILE that was produced along with the PHRED file The values for ABI THUMBPRINT and PHRED VERSION are fixed text N A The values for CALL METHOD and QUALITY LEVELS are fixed as CEQ and 99 respectively for the CE system The TIME stamp is the current time at the tim
256. ertical locking position 5 Unlatch the two rubber latches holding the Capillary Temperature Control Cover and lift it to the vertical locking position Figure 3 56 6 Loosen the Manifold Access Cover captive screw remove the cover and set it aside GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 99 PN B40154AC Run Module Using Direct Control 100 H o o 2 3 t 3 Figure 3 56 Manifold Access Cover 1 Capillary Temperature Control 4 Captive Screw Cover 2 Plenum Assembly 5 Manifold Access Cover removed 3 Manifold Access Cover Lift the Eject Lever to release the Manifold Plug Grasp the Manifold Plug tab Figure 3 57 and then a b C e Pull the plug approximately one inch out of the manifold Touch the tip of the plug to the bottom of the Optics Base Plate Hold and wait five seconds for the gel strand to dry Pull the plug out and set it aside for future use Wipe gel strands off of the instrument using a damp tissue GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Run Module Using Direct Control 901597L Al Figure 3 57 Removing the Manifold Plug 1 Guide Pins 4 Gel Strand 2 Eject Lever 5 Optics Base Plate 3 Array Fitting 6 Array Fitting 9
257. es If a heterozygote occurs the system notes up to two possibilities if more possibilities exist an asterisk appears instead The consensus sequence is editable within the Sequence Investigator Edited bases appear in lower case letters Using Quality Values e If you are using a single sequence the quality value assigned to each base in the consensus match each base in the sequence When using two sequences and the bases agree one of two calculations occur e If the orientation of the two sequences is opposing the system adds two quality values e If the orientation is the same the system uses the higher quality value e If the bases disagree the system performs a calculation to determine the probability of error for that position providing a quality value which is the difference between the higher and lower value To set the value at which bases in the consensus are considered low quality select Edit Quality Threshold Low quality bases are identified in the differences line the navigator toolbar and the discrepancy map Viewing Sequence Investigator Differences The system uses codes to denote the type of discrepancy encountered when performing the comparison These codes are shown in the differences section of the alignment pane To turn the differences line on or off select View Differences The highest level code appears in the differences line in the location where the discrepancy occurred NOTE Any consensu
258. es are nat adversely affected by prolonged exposure to air Figure 1 14 Access Plates Dialog 4 Click Start to continue GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 17 PN B40154AC Getting Started Operating the System 5 Install the plate and select the Plate Loaded option for the Left and or Right plate if applicable and then select the side to immerse the capillaries NOTE Prepare the new plates before proceeding Once the capillaries have been exposed to air you will have 15 minutes to load the plates Lapillaries Exposed Ea Capillaries Exposed PLEASE WAIT ii Do not open sample You may now open the sample door door and load plates Capillaries exposed to air Load Capillaries exposed to air Load o ance Time Remaining Alarm Off Time Remaining Alarm Off mih sec min sec Left Plate Right Plate Left Plate Right Plate Plate Loaded Plate Loaded Plate Loaded Plate Loaded Immerse Capillaries Immerse Capillaries Immerse Capillaries Immerse Capillaries Cancel t EM NE ies requires wetting tray C requires wetting tray on the lett side on the right side requires wetting tray C requires wetting tray on the lett side on the right side Figure 1 15 Capillaries Exposed Dialog Box 6 Click Load to continue NOTE Refer to Installing the Wetting Tray on page 347 Loading the Sample Plate on page 350 and Loading the Buffer Plate and Ev
259. essary before a given result is satisfactory Overwrite a previous result or produce additional result tabs using functions in the CE 156 System To overwrite a previous result click the pin in the left hand corner of the result tab to unpin g the result A reanalysis of that sample overwrites the existing result To produce a new results tab click the pin to pin i the result Upon reanalysis the system creates a new tab containing the reanalyzed results Performing a Batch Analysis To analyze more than one sample simultaneously l Batch Analysis Selection E Figure 4 35 Batch Analysis Selection Dialog Box p d xm ge Select Analysis Batch Analysis The Batch Analysis Selection dialog box dialog box opens sample Data Sample Plate Results Database CEG DATABASE Filter Start Date 07 21 2005 z Enable End D ate 72 2005 Refresh FA Test H02 _06030121L0 Sequence Test H04_0603020 03 02 06 02 10 308M Sequence Test G04 0603020 03 02706 02 10 2847 Sequence Test FO4_ 0603020 03 02 06 02 10 25M Sequence Test EO4 O603020 03 02 06 02 10 244M Sequence Test DO4 0603020 03 02 06 02 10 22M Sequence Test CO4_ 0603020 03 02 06 02 10 214 amp M Sequence Tes B04_0603020 03 02 06 02 10 194M Sequence Test 404 0603020 03 02 06 02 10 174M Sequence TestHOS_O60S012 03 02 06 00 32 394M Sequence Test G03 0603012 03 02 06 00 32 394M Sequence Test FOS_O60S012
260. estigatorCQC Fragment Size StandardCQD Fragment Analysis ParameterCQF Galvo Scan DataCQG Fragment Locus TagsCQL MethodC QM SNP Locus TagCQN Sequence ResultCQR Sample DataCQS Sample TableCQT Fragment ResultCQU Sample Table ResultCQX You may automatically remove the plate position coordinates A01 BO2 etc and the time date stamp from the sample name which is normally generated by the CE system software on export To do so select the Remove CEQ Tracking Suffix check box 1 If the system encounters the same sample name at the destination it usually overwrites the name if you choose to remove the plate position coordinates and the time date stamp which ensures a unique name If you select the Resolve Filename Conflicts check box 1 the system increments the sample names on export when it encounters duplicate names For example if the system encounters the duplicate sample name of Fred on export it renames the file exported to Fred 1 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Database Management Data Manager Procedures Table 8 9 Data Manager Export Options Format Description Apply Trimming Selecting this option removes the trims from the sequence before you export it and replaces internal trims with the letter x CRV crv The CRV export option from the Data Manager module exports the four colors dyes as four separate files When exporting batches the resu
261. evel 35 A Save As Cancel Figure 6 11 Edit Fragment Analysis Parameters Window Creating or Editing a Parameter Set 206 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Fragment Analysis Module Defining Fragment Analysis Parameters General Tab The General tab is the first tab displayed when you first open the Fragment Analysis Parameters window This tab contains general parameter set information and peak identification properties Parameter Set Information Parameter Set information depends on whether you are creating a new parameter set or editing an existing parameter set e Ifyou are creating a new parameter set enter a descriptive name in the Parameter Set Name field and select the project where you want to save the parameter set e Ifyou are editing an existing parameter set you may choose to save the edited parameters under a different name To do this click Save As and enter the new name in the Parameter Set Name field You may also choose to save the edited parameters under the original name The default set of fragment analysis parameters cannot be edited The General tab s Parameter Set area shows the date and time the parameter set was created and modified Peak Criteria You can edit the following Peak Criteria fields e Slope threshold Specify the minimum rate of the signal increase on the leading edge of peaks in order for a peak standard or unknown to be de
262. f Sample Plate Results was selected from the Batch Analysis Selection dialog box While performing a batch analysis use this option to pass over the sample set currently being analyzed This item is not available if Sample Data was selected from the Batch Analysis Selection dialog box While performing a batch analysis use this option to pass over the sample plate currently being analyzed This item is not available if Sample Data was selected from the Batch Analysis Selection dialog box Momentarily stops a batch analysis after the system analyzes the currently running sample Use Resume Batch Processing to continue the analysis Resumes a batch analysis after it has been paused Launches the third party analysis package specified in the Third Party Analysis setup dialog box opecifies the path third party analysis package loaded on your PC and the export format of the data Used to e Align the sequence against puc18dG e Print the alignment report e Export the alignment data as a text file Performs an alignment of the sequence against the current alignment settings Performs a batch alignment Opens the Current Working Parameters dialog box Click Edit to open the Quality based Trimming tab Opens the Current Working Parameters dialog box Click Edit to open the sequence based Trimming tab in the Sequence Analysis Parameters Editor Opens the Batch Trimming dialog box GenomeLab Genetic Analysis System User s
263. f laser is always hazardous to personnel The laser and several other integral components are housed in a sealed container that together comprise the laser assembly The laser assembly has no user serviceable parts Service of the laser assembly is restricted to certified AB SCIEX field engineers During normal operation of the system laser light is not accessible to the user Therefore the overall laser classification of the CE Instrument is Class 1 defined as lasers which are safe under reasonably foreseeable conditions of operation To prevent users from potentially harmful laser light observe all safety warnings see Figure 1 for label locations and NEVER REMOVE THE OUTER CASING OF THE LASER ASSEMBLY viii GenomeLab Genetic Analysis System User s Guide For In Vitro Diagnostic Use PN B40154AC Safety Information f q 5 Co e CAUTION 2 LASER LIGHT ACCESSIBLE WHEN COVER IS OPEN amp n C J OR REMOVED AVOID EXPOSURE TO BEAM approximate location L 4 O S inia i eb hi qi 5 AVOID EXPOSURE
264. fic window or windows associated with the current task This window displays the following panes e Alignment Panes Displays the text alignment results including the following elements Base and codon numbering reference and consensus amino acid translations reference sequence sample sequences consensus sequence and the difference line e Trace Data Panes Displays trace data and base sequence results for the selected Sample sequences E Dye Colors Toolbar Use these user defined colors in the trace data view and the bases in the text view when the text coloring is activated F Navigator Toolbar Offers search and navigation tools within an alignment 1 72 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Sequence Investigator Module Sequence Investigator Module Overview Table 5 1 Main Window Sequence Investigator Module item Description G Discrepancy Map Toolbar Displays color coded locations of any type of attributes selected You may view the coverage of the reference and sample sequences H status Bar Displays information concerning the current selection including the position of the currently highlighted text Menu Bar Options The following example shows the Sequence Investigator module menu bar options File Edit View Window Help The following topics describe each of these menus and their options File Menu Click the File menu to display its drop down menu as sh
265. figured the alleles are still identified but the A and A peaks are frequently categorized as unknown alleles and the system reports Too many alleles in the Comment column of the fragment data table Table 6 13 Apparent Size Adjustments A Detection Use A Peak to Call Allele Not Checked Use A Peak to Call Allele No Size Adjustment Checked Apparent Size Includes A One nucleotide is added to the Not Checked apparent size of the allele in the allele list Apparent Size Includes A Checked One nucleotide is subtracted from the apparent size of the allele in the allele list No Size Adjustment GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Table 6 14 Truth Table for Setting A Allele Identification A Detection Use A Peak to Call Allele Checked Use A Peak to Call Allele Not Checked 6 6 Detect A Checked All fragments assumed to be A The A fragment is identified as the allele in the allele table Fragments without A if any are identified as A peaks or spurious peaks All fragments assumed not to be A Any fragments without A are identified as the allele in the allele table Fragments with A are identified as A peaks or spurious peaks Using the SNP Locus Tag Editor Fragment Analysis Module Using the SNP Locus Tag Editor Detect A Not Checked All fragments assumed to be A The A fragment is identified as the
266. file and click Open in the Import dialog The imported sample plate grid window will appear VN M NM M M E Re confirm the values and properties for all Sample Plate objects the barcode the sample names the separation method s the note the analysis parameters report and export options 8 From the Menu Bar select File Save As 9 Save the Sample Plate to the desired project with a new name 10 Repeat steps 1 through 8 for the second Sample Plate if one is present Importing a Sample Plate Using Non Default Run Method or Analysis Parameters If using non default methods the appropriate run method s and analysis parameters that were pre selected in the Data Sets must be set up in the CE System software before importing the sample plate TXT file s GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC pu m ge de qu oq TN Sample Setup Module Using the Sample Setup Module Launch the Data Manager Setup an appropriate Working Database or create a new Working Database and Project Launch the Sample Setup module Cancel the Sample Plate Selection popup window From the Menu Bar select Edit Method From the Choose Method to Edit dialog confirm the presence of the appropriate or pre selected run method s If not present highlight any existing method and click OK Select the appropriate Event Type and edit the method as explained in Creating or Editing a Method on page 40
267. g box opens Denature Samples Ea Value Cancel Help Sample Plate Position Sample Set E Plates Temperature a0 cle Duration f zl Sec Figure 9 23 Denature Samples Dialog Box 2 Enter atime duration in seconds 3 Identify the position of the Sample Set 4 Click Denature Injecting a Sample l Select Direct Control Inject The Inject dialog box opens Voltage 2 0 E kN Cancel Duration 30 SBC Help Sample Plate Position Sample Set fe EX Plates 356 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Maintenance and Diagnostics Direct Control and Replenishment Figure 9 24 Inject Dialog Box Enter a value for the voltage in kV Enter a time duration in seconds Identify the position of the sample using the Sample Set spin controls jt ie e me Select Inject Performing a Separation l Select Direct Control Separate The Separate dialog box opens Pe _Separate_ Separate Voltage kV Separate Cancel Duration 35 0 min m elp Buffer Plate Position Buffer Set 3 4i Plates Figure 9 25 Separate Dialog Box 2 Enter a value for the voltage in kV 3 Enter a time duration in minutes 4 Identify the position of the buffer using the Buffer Set spin controls 5 Select Separate NOTE Data will not be saved Replenishing the Capillaries with Gel l Selec
268. g plate 2 Dispense the formamide into a hazardous liquid organic waste container 3 After all wells are clear allow the empty plate to sit in the ventilation unit for 24 hours Table 9 3 2 WARNING Dispose of formamide in accordance with all applicable federal state and local environmental regulations concerning hazardous liquid waste Bulk Disposal Table 9 3 3 WARNING When performing this procedure use an exhaust ventilation unit that meets TLV requirements l Using a 1L side arm flask as a trap connect the trap to a vacuum 2 Attach a pipette to the trap using chemical resistant tubing 3 Aspirate the formamide from each well and dispose of it in a hazardous liquid organic waste container 4 After complete removal of all formamide from the plates allow the empty plate to sit in the ventilation unit for 24 hours 5 Dispose of the plate in a solid waste container Table 9 3 4 WARNING Dispose of formamide in accordance with all applicable federal state and local environmental regulations concerning hazardous liquid waste 3 6 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Maintenance and Diagnostics Biological Waste Disposal Disposal of Buffer Gel Mixture from the Buffer Plate Multi Channel Pipettor Table 9 3 5 WARNING Table 9 3 6 WARNING Bulk Disposal Table 9 3 7 WARNING When performing this procedure use an exhaust ventilation unit t
269. g the size of the unknown fragments NOTE Refer to online help for information on creating size standards 208 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Fragment Analysis Module Defining Fragment Analysis Parameters Setting Size Standards To ensure the system finds the standards and makes correct associations between the fragment peaks and the fragment list size standards must meet the following two requirements Fragments in the larger half of the size range should be spaced uniformly For example the peaks in the range of 200 to 400 nucleotides of the SizeStandard 400 are 20 nucleotides apart Fragments in the smaller half of the size range should include a set of at least three fragments that are spaced approximately half the distance of those that are in the larger fragment size range For example in the SizeStandard 400 the peaks in the larger half of the size range are spaced 20 nucleotides apart while some in the smaller half of the size range are spaced 10 nucleotides apart NOTE Custom Size Standards can be created and defined in the Data Manager module See Creating New Size Standards on page 328 Setting the Analysis Method To set the analysis method l Select the standard to run with the sample from the Size Standard drop down list The size standards available are SizeStandard 400 SizeStandard 600 and SizeStandard 80 Your selection determines which size stand
270. gene against the genome before primer design to avoid undesigned peaks See BLAST tool on the NCBI web site http www ncbi nlm nih gov Mutations or repeats can also influence results of primer design e Homologous genes pseudogenes or conserved domains should also be considered when choosing a gene sequence NOTE To aid in identifying a valid accession number additional tools and information are available on the NCBI web site Examples of these include Entrez Nucleotide Entrez Gene Homologene Unigene Blastn or OMIM 3 For genes with transcript variants decide how many variants to detect NOTE Be aware of transcript variants before primer design to avoid undesigned peaks See tools on the NCBI web site http www ncbi nim nih gov gene 4 Select regions that do not have high homology to gene family members or regions without pseudogenes 5 Choose Reference genes NOTE Several reference genes can be used as internal controls for normalizing gene expression level across samples NOTE The ability to choose multiple reference genes and use the calculated geometric mean of expression for these genes to normalize expression in each well is a powerful tool in the XP PCR process a Ideally genes chosen for normalization purposes should be stably expressed in all samples under all conditions b Inorder to determine which genes are stably expressed one can assay the reference genes in experimental samples with a multiplex su
271. grate through a separation matrix Fluorescence emission signal is measured using a detector and interpreted with software The instrument should be operated by qualified personnel only Functional Description The GenomeLab Genetic Analysis System is fully automated and capable of determining the base sequence and fragment length of DNA samples that have been prepared with Beckman Coulter Inc dye labeled reagents Four color dye labeled terminator chemistry kits are used to process samples for base sequence analysis Generation of samples for fragment length analysis is performed using one of two techniques e dye labeled primers for micro satellite gene expression AFLP and other similar applications e four color dye labeled terminator chemistry for the single nucleotide polymorphism application The dual rail CE system incorporates two plate holders and accepts two 96 well plates at one time Each row of eight samples sample set containing labeled DNA fragments is automatically denatured and then separated by capillary electrophoresis The separation gel is automatically replaced in the eight capillaries after each separation The separation gel supply is an easily replaced cartridge with a capacity sufficient for two full microplates The instrument performs detection using laser induced fluorescence in four spectral channels It automatically processes the four channel raw data sets generated by each of the eight capillaries to pro
272. green background shade The Plate Status indicator displays Plate Edited This indicates that the plate must be saved NOTE If you attempt to close the plate before saving it a Save Changes dialog box opens 5 Save the plate to retain the changes GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 35 PN B40154AC Sample Setup Module Using the Sample Setup Module 36 Viewing Cell Coordinates To view or hide cell coordinates select View Cell Coordinates The option will toggle the display of the coordinates off and on Searching for Text in the Sample Plate l 2 Select Edit Find Use the options in the Find dialog to specify the search criteria Enter the desired text in the Search what field Select Down to search down each column beginning at the highlighted or selected cell Select Up to search up each column beginning at the highlighted or selected cell Select the Match whole word only option to locate text that is flanked by spaces If you do not select Match whole word only the system finds the text even if it is part of another word Select the Match case option to find the entered text exactly as typed into the field If Match case is not selected the system will find all occurrences of the text regardless of the case Select the Use wildcards check box M to include wildcard characters in your search The follow table describes the possible wildcards Table 2
273. gure 6 43 Exporting Fragment Lists and Genotypes 3 Use the folder navigation options next to the Save in field to locate and select the folder in which you want to save the export file 4 Enter the desired file name in the File name field NOTE Do not use special characters in the file name 2V l 5 Select one of the four available export formats from the Save as type drop down list e CSV Comma csv Linkage Pedin pre e Discovery Manager DMPopulation txt e Genotype Summary Report tab delimited gsr 6 Click Save to start the process and save the export file using your specified file parameters The export status along with a processing log appears in a status window This window indicates when the export procedure is complete and any export errors that may occur Transferring Fragment Data to GeXP Data Tool Transfer fragment data from the GeXP System to GeXP Data Tool for use with normalization of gene expression results From the Main menu launch the Fragment Analysis module Open a set of analyzed GeXP data Select File Transfer Fragments for GeXP Click Transfer Fragments for GeXP After the dialog box appears name the file and browse to a transfer location oO et a op oz Click Save to save the exported file as a CSV file A message box will display confirming the export process 7 Click OK to confirm the completion of the process and close the message box 266 GenomeLab Genetic An
274. h the designation 5 3 contains 5 complete repeat units and a partial repeat unit of 3 nucleotides Naming Alleles Select the method in which the system labels the identified alleles in the fragment list For example you can label the alleles the same as their expected fragment size in nucleotides 163 164 167 etc in alphabetic order A B C etc or in simple numeric order 1 2 3 etc Select the method in which to name the alleles in the fragment list e Nominal size Select this option to label the alleles by their nominal fragment size e Alphabetic Select this option to label the alleles in lettered order then select the letter in the Start at field e Numeric Select this option to label the alleles in numeric order then select the number in the Start at field NOTE With the exception of Ploidy the following fields are not required for any part of the analysis They are used for supplementary reporting purposes only Ancillary Information The Ancillary Information area of the window allows you to select any supplementary reporting information to include with the locus tag parameters This area includes the following fields e Primer set name Enter the name of the primer set e GenBank Accession Enter the GenBank Accession Number e Repeat unit sequence Enter the sequence of the repeat unit associated with the locus tag e Ploidy Enter the number of alleles associated with the locus tag Primer
275. h to include in the Study from the Project drop down list NOTE If the desired project is not listed it may be located in a different database To enter a different database you must close all applications and set the working database See Setting the Working Database on page 324 or Set Working Database in the online help for more information GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 201 PN B40154AC Fragment Analysis Module Working with Studies in the Fragment Analysis Module 3 Filter data If the data of interest was run during a particular time period you can filter the data by selecting the Filter by date check box J and choosing a range of dates to be searched When enabled the system displays only those samples that were run during the specified time period 4 Select samples from the Raw Data Available area To select the samples to be included in your Study click to highlight the sample then click the right arrow button to move the selection to the Raw Data Selected area e To select all of the displayed samples to be included in your Study click the double right arrow button to move them to the Raw Data Selected area e To remove samples from your Study click to highlight the samples in the Raw Data Selected area and click either of the left arrow buttons to remove them from your selected samples NOTE You may select data from multiple projects to be included in your Stud
276. hange Base dialog box opens 3 Select the desired base 4 Click OK The screen shows the changed base as a lower case letter in both the analyzed data and the base sequence panes Changing Bases in the Base Sequence Pane To change bases in the base sequence pane l Select Tools Edit 2 Highlight the bases to change in the base sequence text 3 Type in the new bases The screen shows the changed base as a lower case letter in both the analyzed data and the base sequence panes NOTE The left and right arrow keys move the cursor through the data in the base sequence pane To select bases hold the Shift key down while using the left and right arrow keys to select the desired bases Deleting Bases in the Base Sequence Pane To delete bases in the base sequence pane l Select Tools Edit 2 Highlight the bases in the base sequence text to delete 3 Press the Delete key or use the Cut X icon The screen removes the selected bases from both the base sequence and analyzed data panes GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Sequence Analysis Using the Sequence Analysis Module Specifying Base Grouping To specify base grouping in the base sequence pane l Select Tools Base Spacing to open the cascading menu 2 Select the desired group spacing Viewing the Analysis Log The system logs all the steps used in performing the base calling routine on the raw data in
277. hat meets TLV requirements Aspirate 400 pL of buffer gel mixture from the 96 well plate Dispose the buffer gel mixture into a hazardous liquid organic waste container Rinse the plate wells with water and dispose of the rinse in the liquid waste container After all wells are clear allow the empty plate to sit in the ventilation unit for 24 hours Dispose of the plate in a solid waste container Dispose of buffer gel mixture in accordance with all applicable federal state and local environmental regulations concerning hazardous liquid waste When performing this procedure use an exhaust ventilation unit that meets TLV requirements l Using a IL side arm flask as a trap connect the trap to a vacuum 2 Attach a pipette to the trap using chemical resistant tubing 3 Aspirate the formamide from each well and dispose of it in a hazardous liquid organic waste container 4 After complete removal of all formamide from the plates allow the empty plate to sit in the ventilation unit for 24 hours 5 Dispose of the plate in a solid waste container GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 377 PN B40154AC Maintenance and Diagnostics Biological Waste Disposal Table 9 3 8 WARNING Dispose of buffer gel mixture in accordance with all applicable federal state and local environmental regulations concerning hazardous liquid waste Disposal of the Capillary Array Table 9 3 9
278. hat contains G or T The search stops on all ambiguity codes other than M The bases represented by M are A and C Also searching for an A C G or T matches any ambiguity codes containing the base For example searching for A results in any ambiguity code containing A specifically M R W U H D and N Editing the Consensus To edit the base selected by the search type the desired base or select Edit Replace then select the desired base or ambiguity code To automatically jump to the next base that matches your search criteria once you have completed the edit select Forward or Backward on the Edit tab of the Preferences dialog box Displaying the Discrepancy Map The discrepancy map toolbar allows you to look for areas of interest in relationship to the reference You may view the coverage of the consensus and sample sequences You may also view the color coded locations in the experiment of any type of attributes of interest that you specify v Mismatch v Ambiguity v Disagreement m r r2 VII VIIIF 12 2 txt Insertion Deletion Mutation Hotspot wv Low Quality m N E E r E E Manual Edit Figure 5 8 Discrepancy Map Toolbar The top bar E in the discrepancy map represents the reference sequence e The second E and third I bar if two sample sequences were selected displays the coverage of the sample sequences in relation to the reference e The next area I represents the consensus and sho
279. he capillaries in deionized water When properly filled the capillaries can be maintained for approximately seven days in the wetting tray without attention During continuous use of the CE system the wetting tray should be replenished with deionized water after a 96 well microplate has been run or prior to a sample plate run The wetting tray is also used to rinse capillary tips and provide a receptacle for separation medium that was purged from the capillaries GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use T PN B40154AC Getting Started System Overview CAUTION No more than one 96 well plate should be processed for each wetting tray without replenishing the Wetting Tray For details see Replacing the Wetting Tray on page 347 e d 900499e Al Figure 1 7 Wetting Tray Gel Waste Bottle The gel waste bottle Figure 1 8 is used to capture and store the waste gel that is pushed out of the manifold during the purge function The bottle can hold the equivalent of 25 gel cartridges To prevent overflow observe the gel level in the waste bottle 901514L Al Figure 1 8 Gel Waste Bottle Gel Pump Gel Cartridge Access Cover Provides access to the gel pump and gel cartridge Table 1 1 Gel Pump Gel Cartridge and Gel Pump Plug Component Description Gel Pump Used to replenish the capillaries with fresh gel from the cartridge after each sample set and two 96 well plate runs 8 GenomeLab Geneti
280. he data Use the SCF format to transfer data from instrument to instrument or to import data from third party software into the Sequence Analysis module If you use SCF to exchange data between instruments you will lose informational data such as sample plate name capillary array serial number etc If you want to maintain exact copies of data including header information use the CEQ format and import and export these data using the Data Manager The tab delimited format is valid for raw data sequence results and fragment results Select the Raw Data check box to include raw data as well as current and voltage data Select the Results Data and Results Output check boxes to include the sequence results The format expresses the data points as text values which can be viewed in any text editor or in Excel The PHRED format produces two files a PHRED file and an SCF file A PHRED file is a text file composed of a SEQUENCE section containing a COMMENT and DNA section The SEQUENCE section also contains the name of the Analyzed Result that was stored The COMMENT section contains the file name of the associated SCF file CHROMAT FILE that was produced along with the PHRED file The values for ABI THUMBPRINT and PHRED VERSION are fixed text N A The values for CALL METHOD and QUALITY LEVELS are fixed as CEQ SEQUENCING and 99 respectively for the CE system The TIME stamp is the current time at the time of export The
281. he name as it is 6 Click OK Locking a Sample Plate To prevent editing of the currently displayed plate select File Lock The Notes Method and Analysis tabs are disabled when the Sample Plate is locked Viewing the Summary To display a read only window showing the attributes of the currently selected plate select View View Summary 46 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC 3 1 Run Module Run Module Overview Run Module This chapter provides an overview of the Run module including its menu options toolbars and dialog boxes It also shows you how to run sample plates and set the display options using this module Run Module Overview Launch pre programmed sample plates and control individual functions of the instrument Use the Run module for Running a sample plate e Performing all instrument control and operational functions such as denaturing samples injecting and separating samples loading and unloading plates controlling the capillary chamber temperature filling the capillaries with gel GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use AT PN B40154AC Run Module Run Module Overview Using the Run Control Main Window The following illustration identifies the areas on the Run module s main window that are described in Table 3 1 A B C D DATES E System PFEIE File View Direct Control Tools Run Log O
282. he option is enabled GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Fragment Analysis Module Fragment Analysis Module Overview The following table describes the Fragment Analysis module s View menu options Table 6 3 View Menu Fragment Analysis Module Option Description Fragment List Displays the Fragment List The Fragment List contains information for all analyzed fragments included in the Study such as size height area locus and allele ID Results Set Displays the Results Set View The Result Set contains information for all of the analyzed samples included in the Study Locus List Opens a dialog box that create the LocusList txt file used for the Genotype Summary Editor View GSV Genotype Displays a Study s genotype information loci and alleles summary Status Bar Toggles between displaying or not displaying the Status Bar Study Explorer Displays the Study Explorer The Study Explorer provides access to all of the parameters available in the selected Study Toolbars select which toolbars to display See Toolbar Icons on page 196 Results Menu Click the Results menu to display its drop down menu as shown in the following example Results iw Show Excluded Ctrl F IM Show Capillary Summary NOTE This menu is available only when displaying the Result Set View The following table describes the Fragment Analysis module s Results menu options Table 6 4 Result
283. heck box M1 to include wildcard characters in your search The follow table describes the possible wildcards Table 2 10 Wildcard Characters Wildcard Description The asterisk specifies to search for any letters before or after the entered text The question mark represents any single letter The exclamation point within brackets makes the query negative Enter the letter following the within the brackets if you want the system to find anything that is not the entered text For example entering A finds any string that does not start with A NOTE The system will support the following wildcard combinations and The system does not support the combination e Enter the text you wish to replace with in the Replace with text field 3 Choose the desired Search and Replace actions e Click Find Next to find the next occurrence of the entered text e Click Replace to replace the highlighted text with the text in the Replace with field e Click Replace All to automatically replace all occurrences of the search text with the replace text Using Property Sets Property sets are groups of information properties that apply to a sample l To access the sample property sets select View Sample Property Sets or select a sample cell in the sample plate screen and refer to the Note tab 2 Inthe property set table use the Tab or arrow keys to move from cell to cell e Press the Tab key moves the fo
284. his table as either rows or columns of data for easy export to a third party software program for further analysis see sample axis below This table presents the data in rows or columns as follows Bin Displays the bin number It assigns bins with A and B suffixes if two adjacent bins fall in the same integer after rounding the Bin X Mean Dye Displays the dye included Samples Displays the sample count within the bin Fragments Displays the fragment count within the bin X Min Displays the minimum fragment size within the bin X Max Displays the maximum fragment size within the bin X Mean Displays the mean fragment size within the bin X Var Displays the fragment size variation within the bin Y Mean Displays the mean peak height within the bin Numbered headings Show the number of sample components peaks fragments within each bin for each sample GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Fragment Analysis Module Performing AFLP Analysis Setting Cluster Analysis Parameters The selections available at the bottom of the AFLP Cluster Analysis window provides additional settings that affect the values and output format of the fields displayed You can select one of the following Sample Bin options e Fragment Count Displays the number of components within each sample bin as either zero components one component or multiple components e Binary Presence Indicates the b
285. ic Analysis System User s Guide For n Vitro Diagnostic Use 319 PN B40154AC Database Management Data Manager Module Overview Table 8 5 Tools Menu Data Manager Module Option Description Convert Individual ID to Converts all sample data records that use Individual IDs to records that Subject ID use Subject IDs Administrative Tools Add Adds the CEQUSERS group to the SQL login Only members of the CeqUsers Group to SQL Login CEQUSERS group are given access the CEQ databases Window Menu Click the Window menu to display its drop down menu as shown in the following example Window New Window Cascade Tile Arrange Icons Close w 1 2 The following table describes the Window menu options for Data Manager Table 8 6 Window Menu Data Manager Module Option Description New Window Opens a new display window Cascade Cascades the open windows Tile Tiles the windows in a horizontal orientation Arrange Icons Automatically arranges the icons Close All Closes all currently active windows v1 Brings the selected window 1 to the foreground 320 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Database Management Data Manager Module Overview Help Menu The following table describes the Help menu options Table 8 7 Help Menu Data Manager Module Option Description Help Topics Select this option to display the CE system online help By default the help system displays the Conten
286. ical Scan Data Sequence Analysis Parameters Sample Data sequence Results Sample Plate Results Database 032206 CEG TROUBLESHOO OF Filter Start Date 07 21 2005 Enable Cancel End Date e721 2005 Refresh Help Project Name Figure 4 9 Open Dialog Box Sequence Test A03 0603012 03 02706 0 Sequence Sequence Test A04 DBD3O020 03 02706 0 Sequence Sequence TestAQ6 O603020 03 0206 0 Sequence Sequence Test B03 0603014 03 02706 0 Sequence Sequence TestbO4 0603020 03 02706 0 Sequence Sequence Test B05_0603020 03 02706 0 Sequence Sequence Test C03 0603012 O3 02 06 0 Sequence Sequence Test C04 0603020 O5 02 06 0 Sequence Sequence Test C05 UBOS020 03 02706 0 Sequence Sequence Test O03 0603012 03 02706 0 Sequence Sequence Test DO4 0603020 03 02706 0 Sequence Sequence Test O05 OB03020 03 02706 D Sequence Sequence Test E03 0603014 03 02706 0 Sequence Sequence Tes E04 0603020 03 02706 0 Sequence Sequence Test E05_0603020 03 02 06 0 Sequence Sequence Test F03 0603012 03 02706 0 Sequence Sequence TestFO4 0603020 03 02706 0 Sequence 2 Select the appropriate tab Sample Data Sample Plate Results Sequence Results Sequence Analysis Parameters or Optical Scan Data 3 Select the desired item from the list box then c
287. ick Open The Open Sequence Results dialog box opens as shown in the following example pen Look in C3 Heterozygote and Alignment tutorial 4m E Y II VITIF 12 2 Ext pos genomic rc ExE File name PI SVITIETI 2 2 Files of type Reference files st Cancel Zi Figure 5 5 Open Reference Dialog Box 4 Select one or two results and click OK NOTE To select two results left click the first result press and hold the Ctrl key then left click the second result Select 1 or 2 Sequences to Compare Sequence Results Database Filter Start Date i 17 2006 Enable End D ate ri 17 2006 Refresh 15 16 612_0604 MEETS Seq Test AUS Ub Seq Test AUS b SeqTest AU4 Ub Seq Test A04 Ub Seq Test 405 Ub Seq Test 405 Ub Seq Test BUS Ub Seq Test BU Ub Seq Test B 4 Ub Seq Test B 4A Ub Seq est B hb Ub Seq Test BUR Ub Seq Test CU3 b Seq Test CU3 Ub Seq Test CU3 b Project M ame Search 04 26 06 1 04726406 1 03 02 06 1 03 02 06 1 03 02 06 1 03 02 06 1 03 02 06 1 03 02 06 1 03 02 06 1 03 02 06 1 03 02 06 1 03 02 06 1 03 02 06 1 03 02 06 1 03 02 06 1 03 02 06 1 03 02 06 1 CEQ OO TESTING GENESIS Cancel Help 15 176 612_001 0040334 15 76b G01_00110221F seq TestA03_ 0603011 seq TestAD3 DBDUTTE seq Test A04 060307
288. ick and hold the mouse button while dragging the pointer to form a box around the desired area then release the mouse button To unzoom both traces click the Unzoom All icon The traces in both panes revert to a completely unzoomed state displaying the entire range of the sequence results To unzoom one of the two open data traces right click in the desired trace pane and select Unzoom Pane The selected trace displays the entire range of the result You cannot edit sequence traces in the Sequence Investigator However you may edit sequence traces using the Sequence Analysis module If you use an edited result for your comparison your edited bases appear in lower case 182 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Sequence Investigator Module Sequence Investigator Procedures Viewing Consensus Amino Acid Translations When the system generates the comparison it translates the consensus nucleotide sequence into an amino acid sequence and displays it below the consensus sequence The amino acid translation starts at the first base relative to a reference codon The consensus is also segmented into codons which are translated into their amino acids If edits occur in the consensus a re translation of the consensus amino acid translation occurs automatically and the system automatically updates the discrepancy map and the differences line Each codon is shaded to show its boundari
289. ide Right Plate Plate Loaded Immerse Capillaries requires wetting tray on the right side Figure 3 29 Capillaries Exposed Dialogs 3 Wait until the dialog warning turns green 4 Open the Sample Access Cover Figure 3 27 and lift it to the vertical locking position Loading the Sample Plate 1 Make sure the Wetting Station is installed or perform the following procedure Installing the Wetting Tray on page 347 and then return here 2 Align the Sample Plate Guide Pin with the notched corner of the sample plate and gently lower the plate into position Figure 3 30 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC f Run Module Using Direct Control 901600L AI Figure 3 30 Loading the Sample Plate 1 Sample Plate 4 Sample Plate Notched Edge 2 Wetting Tray Retainers 5 ALIGN together 3 Sample Plate Holder 6 Sample Plate Guide Pin Loading the Buffer Plate and Evaporation Cover l Align the notched corner of the Buffer Plate with the alignment line on the Buffer Plate Holder Figure 3 31 2 Gently push the Buffer Plate towards the front of the instrument and then set the plate into the transport 3 At the rear of the Buffer Plate Holder align the Buffer Evaporation Cover Guide Pin with the Buffer Evaporation Cover Alignment Notch and then gently lower the cover over the Buffer Plate 78 GenomeLab Genetic Analysis System User s G
290. igns individual selected traces by size or time Zooming and scrolling on the x axis is synchronous between all plots selected while the y axis of each plot selected is independently scaled based on the available data To access this function right click the selected samples in the fragment list and select the Show Stacked Graph Including Excluding amp Resetting Peaks in the Fragment List You can individually include or exclude peaks from the existing fragment list e To include a peak in the fragment list right click the selected fragments and select the Include Peak To exclude a peak in the fragment list right click the selected fragments and select the Exclude Peak An updated stacked trace view from which you can select the peaks of interest l Left click the peak of interest to select it 2 Right click to display the peak menu e To display all fragments excluded from the fragment list select Show Excluded Fragments e To reset peaks modified in the fragment list to their original configuration select Reset Peak 6 8 Performing Bin Analysis Binning is a one dimensional clustering by size of fragments compiled from multiple samples You can use bin analysis to generate an allele list that represents the population you are studying For example you might want to use this to establish a database of information on alleles and possible anomalies associated with them such as imperfect repeats Binning of a
291. igured with a specific set of parameters that define the manner in which the system identifies detected fragments as allele fragments These parameters include the fragment size range repeat unit length the dye used and an allele list associated with the locus tag When you select a locus tag and perform an analysis the system identifies the alleles present within the locus region using the estimated size of the fragments and the allele list NOTE The system estimates sizes only if you specified a size standard see Analysis Method Tab on page 208 and calls alleles only if an allele list exists for the selected locus tag see Locus Tab on page 218 212 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Fragment Analysis Module Defining Fragment Analysis Parameters You can choose STR locus tags from a list of available STR locus tags previously configured for analysis This tab also gives you access to the STR Locus Tag Editor where you can edit existing or create new STR locus tags to meet the specific requirements of your samples Edit Fragment Analysis Parameters Miel Farameter Set Name GATA193407 Froject Default IATATS3AU 2 1142001 10 07 40 A Edit Locus Hew Figure 6 14 Fragment Analysis Parameters Window Selecting STR Locus Tags Selecting Locus Tags Select one or more locus tags you want included in your parameter set e To select an individual locus select it in
292. in accordance with the procedure See Biological Waste Disposal on page 376 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 373 PN B40154AC Maintenance and Diagnostics Direct Control and Replenishment Removing the Manifold Plug The Manifold Plug is installed during shipping and when the instrument is not in use to prevent drying of gel NOTE This procedure assumes that the Manifold Plug is being removed in preparation for Capillary Array installation l Select Replenish Release Capillary Array from the Run Module main menu 2 Wait for the Remove Manifold Plug dialog box to appear 3 Open the Sample Access Cover Figure 9 1 and lift it to the vertical locking position 4 Open the Capillary Access Cover and lift it to the vertical locking position 5 Unlatch the two rubber latches holding the Capillary Temperature Control Cover and lift it to the vertical locking position Figure 9 47 6 Loosen the Manifold Access Cover captive screw remove the cover and set it aside Figure 9 47 Manifold Access Cover 1 Capillary Temperature Control 4 Captive Screw Cover 2 Plenum Assembly 5 Manifold Access Cover removed 3 Manifold Access Cover 3 4 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Maintenance and Diagnostics Direct Control and Replenishment Lift the Eject Lever to release the Manifold Plug
293. inary presence or absence within each sample bin e Fragments Max Y Displays the absolute peak height of the fragments within each sample bin Select one or more of the following options to modify the displayed details e Exclude Fully Populated Bins Excludes bins that are represented in all samples such as non polymorphic fragments e Exclude Samples without Qualifying Peaks Excludes samples that have no qualifying peaks e Show Excluded Elements Highlights all fragment data that was excluded from the analysis e Sample Axis Arranges the table presentation by either Rows or Columns As an alternative you can switch between these views using the right click menu To do this select the row or column heading then select Transpose The following fields let you make additional adjustments to both the width and threshold e Maximum Bin Width Sets the limiting value given to the width of the individual bins The default value is 1 0 nt Enter the value in nucleotides Within each dye label the system clusters the fragments with the sizes that fall within the set bin width and creates a bin with the size rounded to the next integer e Y Threshold Serves as a exclusion filter defining the lowest acceptable value peak height for the y axis The default value is zero RFU Set the y threshold in relative fluorescence units RFU The system excludes fragments with heights less than this threshold value from the clustering process
294. including Sample Data Sequence Analysis Parameters Optical Scan Data Sequence Results and Sample Plate Results Save Saves existing data Print Prints the report Print Preview Displays a facsimile of a hardcopy printout of the selected sample plate Print Desktop Prints the desktop application or main window as defined in the Preferences dialog box Cut Cuts selected bases from the selected position and copies them to the clipboard Copy Copies selected bases to the clipboard Paste Inserts one or more copied or cut bases to the selected text position Undo Undoes the last action performed Redo Redoes the last undo action Apply Quality based Trimming Commits to the quality based trimming Apply Sequence based Trimming Commits to the sequence based trimming Audio Enable Toggles between enabling or disabling audio When this option is enabled in Edit mode the system audibly announces each base letter typed GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Sequence Analysis Sequence Analysis Module Overview Table 4 9 Standard Toolbar Sequence Analysis Module Icon vi a m I 4 r1 Erg s ix ic 88 is ps Description Audio Playback Audibly announces a series of selected base sequence text Working Analysis Parameters View and or change the analysis parameters to be used for subsequent analyses Analyze
295. ine on the buffer plate holder Figure 9 21 2 Gently push the buffer plate towards the front of the instrument and then set the plate into the transport 3 Atthe rear of the buffer plate holder align the buffer evaporation cover guide pin with the buffer evaporation cover alignment notch and then gently lower the cover over the buffer plate 901599L Al Figure 9 21 Loading the Buffer Plate and Buffer Evaporation Cover 1 Front Location 4 Buffer Evaporation Cover Alignment Notch 2 Buffer Evaporation Cover 5 Wetting Tray Retainers 3 Buffer Plate 4 When finished positioning the sample and buffer plates and close the Sample Access Cover 5 Click Load on the Capillaries Exposed dialog box Figure 9 20 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 355 PN B40154AC Maintenance and Diagnostics Direct Control and Replenishment Specifying Capillary Temperature l Select Direct Control Capillary Temperature The Capillary Temperature dialog box opens as shown in the following example Capillary Temperature Ea Temperature z l Am ut Cancel Wait for temperature to be reached Hel elp Temperature Figure 9 22 Capillary Temperature Dialog Box 2 Enter a capillary holding temperature value in degrees centigrade 3 Select Wait for temperature to be reached 4 Click Start Denaturing a Sample l Select Direct Control Denature Samples The Denature Samples dialo
296. ing Parameters dialog box 2 Click Edit The Sequence Analysis Parameters Editor dialog box opens as shown below Sequence Analysis Parameters Editor DefaultSequenceAnalysisPar Eq Quality based Trimming Sequence based Trimming Alignment Reference General Initial Data Detection Heterozygote Detection N Threshold PCR Product lt 200 Bases Analysis Start 0 0 UH Use Default Mobility zafib Analysis Stop Jao E min Pre peak Reduction Color DefauitColorCalbration Heterozygote Detection Ma Qualty based Trimming Mone Sequence based Trimming Ma Automatic Alignment Ma Save As Print Cancel Help Figure 4 10 Sequence Analysis Parameters Editor Dialog Box 3 Use the tabs on this dialog box to make appropriate changes For parameter descriptions see the following topics General Tab on page 124 Initial Data Detection Tab on page 126 Heterozygote Detection Tab on page 127 Alignment Reference Tab Sequence Analysis Parameters Editor on page 129 Quality based Trimming Tab on page 132 Using Sequence based Trimming on page 133 4 Click Save As to create a new Sequence Analysis Parameter name or click OK to save the changes and exit the editor General Tab Use the General tab of the Sequence Analysis Parameters Editor dialog box to specify the parameters used to perform the basecalling operation on the desired samples whether or not you are perfor
297. ion in the plate or wetting tray e Move the plates to the Load position at the front of the instrument to load or unload plates Inject Inject Initiates injection of the sample prior to separation Separate Separate Initiates the separation of injected samples For procedures on using the Direct Control window to replenish the system see Direct Control and Replenishment on page 349 64 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Log Window Vlew all of the messages and activity for a sample plate run The following example shows the Log window To open this window select the Log tab Data Monitor Date Time 10 12 01 10 12 01 10 12 01 10 12 01 10 12 01 10 12 01 10 12 01 10 12 01 10 12 01 10 12 01 10 12 01 10 12 01 10 12 01 10 12 01 10 12 01 10 12 01 10 12 01 10 12 01 10 12 01 10 12 01 10 12 01 10 12 01 10 12 01 10 12 01 10 12 01 10 12 01 12 20 27 12 20 27 12 37 20 12 38 01 12 38 26 12 38 37 12 38 53 12 33 13 12 33 13 12 33 25 12 33 35 12 33 33 12 33 48 12 33 55 12 33 58 12 40 08 12 40 10 12 40 15 12 40 18 12 40 51 12 42 13 12 42 45 12 43 08 12 43 28 12 43 37 12 43 46 Direct Control Logged Events Run Module Run Module Overview A B C S g r 4Tument Data Freeze Log System configured instrument detected CE quencer s ID Simulator 3 Gel life Capillary
298. ion time in minutes in the raw data corresponding to the called bases Data Point Actual number of the data points in the analyzed data corresponding to the called bases Insert Indicates whether a base has been manually added to the base sequence Edit Indicates whether the base call has been manually changed GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 163 PN B40154AC Sequence Analysis Using the Sequence Analysis Module Magnifying Zooming Data To magnify data NOTE Use the Unzoom i Click on the upper left hand point of the area to be magnified Drag the mouse cursor down to the lower right hand point of the area and then release the mouse button Repeat this procedure to increase magnification or Unzoom All icons to zoom out Panning Data To pan back and forth in the data pane Select Tools Pan Click anywhere in the raw or analyzed data panes and drag the mouse cursor left or right to move the display Deactivate the pan mode by selecting Tools Zoom or by clicking on the Autoscale button Synchronizing Result Data with Result Output To synchronize the analyzed data with the base sequence Access the Sequence Analysis module Open the desired analyzed data Select Tools Base Synch Peak Synch or click the Synch icon Select a base or range of bases in the base sequence pane The corresponding peaks appear between two hairline markers in sequence analysis Alig
299. ippage of the enzyme during the extension reaction in which case the pre peaks are often found starting near the end of a series of the same base GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 125 PN B40154AC Sequence Analysis Using the Sequence Analysis Module Table 4 17 General Tab Sequence Analysis Parameters Editor Option Description Color Click this button to view the color calibration for the analysis parameters The Color Calibration dialog box opens The values in the matrix show the cross talk between the filters and the emissions for A C G and T If you want to select another color calibration click Select Stored Color Calibration select the new color calibration then click OK The name of the selected color calibration appears in the field Informational The lower section of this dialog box displays specific features that are Display enabled disabled from other tabs To change these settings select the appropriate tab and edit the feature Initial Data Detection Tab Use the Initial Data Detection tab of the Sequence Analysis Parameters Editor dialog box to enable the system to detect the start of data to be analyzed The system attempts to detect valid data using the system algorithm and values entered on this tab only if the Analysis Start time on the General tab is set to 0 0 Sequence Analysis Parameters Editor DefaultSequenceAnalysisPar Jualitu based Trimming
300. ir with deionized water and dispose of the rinse into a hazardous liquid organic waste container 3 Dry the lid assembly and reservoir To fill with D I water l Remove the lid of the wetting tray and fill it with D I water to the indicator line 2 Replace the wetting tray lid CAUTION You should process no more than one 96 well plate for each wetting tray without replenishing the wetting tray Periodically check the liquid level in the wetting tray The liquid level should NEVER be allowed to rise into the eight recesses of the wetting tray lid nor drop below the fill level indicator line 9 mL minimum The top surface of the wetting tray lid must remain clean and dry under any and all circumstances Installing the Wetting Tray 1 Select Replenish Replace Wetting Tray 2 Click OK when prompted to verify this action 3 Open the sample access cover Figure 9 1 and lift to the vertical locking position 4 Rotate the wetting tray retainers outward Insert the wetting tray into the receptacle between the Sample and Buffer plates Figure 9 9 and then gently press it down into the well 5 Rotate the wetting tray retainers inwards to lock the wetting tray in place GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 347 PN B40154AC Maintenance and Diagnostics Routine Maintenance NOTE f a sample plate is installed in the system you must remove it before installing the wetting tray to allo
301. ire row 8 wells of a 96 well microplate 8 rows x 12 columns The capillaries pass through and exit the array fitting When the fitting is installed the ends of the capillaries are inserted into the gel buffer manifold reservoir The array fitting contains the detection window and is the outlet side of the array The detection window of the fitting exposes the eight capillaries to laser excitation The external polyimide coating of the capillaries has been removed for this purpose NOTE When the capillary array is not installed for example during shipping and storage the manifold plug is inserted into the manifold array fitting outlet to prevent any gel inside of the CE system from drying 901592 Al Figure 1 2 Capillary Array 1 Capillaries 3 Array Fitting outlet 2 Electrode Block inlet GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 5 PN B40154AC Getting Started System Overview Plenum The CE system is supplied with a capillary heater plenum suitable for use with a 33 cm long capillary array This short plenum assembly has a capillary array routing notch and a conical depression on the back as shown in Figure 1 3 NOTE Refer to the caution label on the front of the plenum assembly for positive identification Figure 1 3 Plenum Assembly Back View 1 Routing Notch 2 Conical Depression Sample Transport and Plate Holders The Sample Transport Figure 1 4 contains the p
302. is Export Dialog Box 6 Click Export GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC 329 Database Management Data Manager Procedures 330 Data Manager Export File Types Table 8 9 describes the available export file types Table 8 9 Data Manager Export Options Format SCF scf Tab Delimited Text txt PHRED scf phd 1 Description The SCF Standard Chromatogram Format format stores analyzed DNA sequence or fragment data for a single sample The format describes both public and private data sections The well defined public data section contains trace data points the called sequence or identified fragments and the positions of each called base or fragment within the trace data A public comment section is also defined The private section stores other information that most software packages ignore The CE system uses the private data section to store sample data including raw data along with current and voltage data This may store sample data from either sequencing or fragment analysis samples can be stored The notes and property sets are stored in the comment section The CE system software supports SCF versions 2 1 and 3 0 You would use this format for instance to export analyzed sequence data into Lasergene s SeqMan from DNASTAR Inc Third party packages cannot currently view raw data current or voltage However custom applications can be written to view t
303. is System User s Guide For n Vitro Diagnostic Use PN B40154AC Sample Setup Module Overview Toolbar Icons The Sample Setup modules toolbar contains icons that correspond to common menu options The following table describes the Sample Setup toolbar icons Table 2 8 Toolbar Icons Sample Setup Module Icon Description New Opens an empty sample plate Open Select an existing sample plate to open Save Saves the current sample plate to the same directory with the same name and format as was used on the previous save Print Sample Plate Print data associated with the active sample plate Print Preview Displays a sample format of a hard copy printout of the active sample plate A toolbar at the top of the window provides options for navigation viewing and printing the display To restore the default screen press the Esc key or click the Close button yl Cut Deletes text selected in one or more cells of the sample plate which you can paste into a different cell or cells Copy Duplicates text selected in one or more cells of the sample plate which you can paste into a different cell or cells i Paste Inserts into one or more cells the text copied to the buffer when using the Copy or Cut function Unlock Indicates that the active plate is available for editing Clicking this icon locks the plate to prevent editing and changes the icon to fal Run Opens the Run module and executes the
304. is left blank Assigning Methods To assign a method 1 Click on and select a cell in the column 2 Click the down arrow to open the method selection list Figure 2 16 and select the method Condition LFR 1 Frag Test LFR a LFR B LFR c amp MP 1 Seq Test Figure 2 16 Method Selection Drop Down List GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 39 PN B40154AC Sample Setup Module Using the Sample Setup Module 40 3 Edit the new method as desired NOTE You must assign a method to each named row before saving the sample plate If any named row is not assigned a method and a save is attempted a warning message appears listing each column that needs a method assigned to it Applying Methods to Multiple Sample Sets To apply a method to multiple sample sets l Highlight the desired sample sets as explained in Selecting Samples on page 32 2 Select Edit Auto Fill Method Name The Choose Method dialog box opens 3 Select a method from the drop down list 4 Inthe Auto Fill area of the dialog box select Selected sample sets only then click OK To apply a method to all sample sets l Select Edit Auto Fill Method Name The Choose Method dialog box opens 2 Select a method from the drop down list 3 Inthe Auto Fill area of the dialog box select All sample sets then click OK To view the selected method click the Method tab Conditioning the System It is recommend
305. is warning message the Device tab indicates the state of the Cartridge When a gel plug is present the Device tab indicates plug in the Cartridge field as shown in Figure 3 15 The plug must be removed and replaced with a gel cartridge before the next run When a cartridge is present the Device tab indicates Gel in the Cartridge field as shown in Figure 5 16 Sample wimp Device Lie Sample wimp Device Lie Plate Position sample 1 Plate Positions Sample 1 Capillary Temperature 35 C Capillary Temperature 35 C Capillary Array Present Capillary Array Present Manifold Plug Mat Present Manifold Flug Mat Present Cartridge Barret Unlocked Cartridge Barret Locked sample Access Lover Closed Sample Access Cover Closed Capillary Access Lover Closed Capillary Access Cover Closed Voltage O 0 kv Voltage O 0 kv Total Current 0 pA Total Current D p Figure 3 15 Device Tab Gel Plug installed Figure 3 16 Device Tab Gel Cartridge installed GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 67 PN B40154AC Run Module Using the Run Module Defining System Preferences To define the system preferences I Defaults Alarms Active Inactive Select File System Preferences The System Preferences dialog box opens as shown in the following example System Preferences System Mame Genomelab System Operator Name Test Operator Project Mame Default m Fig
306. ist View and Plate View tabs provide two methods of making the raw data selection Each selection method contains the same sample information presented in different ways Method to be selected for is based on personal preference When creating a new study on a controller connected to a GeXP instrument that was used to collect the raw data Plate View is used frequently due to the availability of the plate set up information If creating a new study on a laptop computer it is a good idea to use List View since the plate set up information may not have been imported to the laptop from the controller that was used to collect the raw data 2 If using the List View select the appropriate project name from the box next to Project and then highlight the raw data files in the table named Available Use the gt button to move the selected files to the table named Selected on the right hand side 3 Click on Next to continue A minimal of 10 data files is required if downstream analysis includes binning 4 Select Analysis Parameters and click on Next NOTE For samples not including standard curve use the DefaultGeXPAnalysisParameters For samples containing standard curve use Sensitive GeXP Analysis Parameters 2 8 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B4015
307. ith Studies in the Fragment Analysis Module Finally you may filter the generated fragment and allele data third level filtering in the Fragment List This leaves a collection of identified fragments and alleles that exactly match the requirements of your Study Selecting Raw Data for the New Study When you select the Raw Data option and click OK the Study Wizard opens displaying the Select Raw Data window Select Raw Data xi Steps Raw Data List View Analysis Parameters Analyze Data Result Data Vv Filter by date Project AFLP 06 TP2 20 Start 4 25 2001 z End 7 25 2001 Raw Data Raw Data Available DATS 103 D4 402_01060520G 5 5 2001 10 06 30 PM DATS 105 D4 B02_01060520G 6 5 2001 10 06 31 PM DATS 107 D4 C02_01060520G 6 5 2001 10 06 32 PM DATS 110 D4 D02_010605206 6 5 2001 10 06 34 PM DATS 111 D4 E02 010605206 6 5 2001 10 06 35 PM DATS 113 D4 F02_01060520G 6 5 2001 10 06 37 PM DATS 114 D4 G02 1060520G 6 5 2001 10 06 38 PM DATS 115 D4 HO2_01060520G 6 5 2001 10 06 39 PM Selected 8 DATS 102 D4 H01 010605180 DATS 101 D4 G01 t 60518QY DATS 100 D4 F 1 010605180 DATS 33 D4 EU01 1060518 DATS 37 D4 D 1 010605180 DATS 96 D4 C01_010605180 7 DATS 94 D4 B01_010605180 7 DATS 93 D4 401_010605180 7 6 5 2001 8 24 03 PM 6 5 2001 8 24 01 PM 6 5 2001 8 24 00 PM 6 5 2001 8 23 59 PM 6 5 2001 8 23 57 PM 6 5 2001 8 23 56 PM 6 5 2001 8 23 54 PM 6 5 2001 8 23 53 P
308. itor Baseline OF Baseline Parameters Cancel Autosave vw View Injection Instrument Data Name BASELINE Project Default hd Figure 9 49 Monitor Baseline Dialog Box NOTE If you select Autosave on this dialog box the system stores baseline data under the Sample Data node for the selected project in the Data Manager If you do not manually end the Monitor Baseline it collects baseline data until you run a sample plate or until six hours have elapsed from the start of the baseline monitoring process 2 Inthe Monitor Baseline dialog box a Select the Enable Monitor Baseline check box b Click OK 3 Select the Data Monitor tab to view the baseline trace To view the baseline trace l Access the desired analysis module 2 Select File Open 3 Select the Sample Data tab and select the desired baseline data the baseline data is displayed After reviewing the baseline trace disable Monitor Baseline To do this l Select Run Monitor Baseline 2 Inthe Monitor Baseline dialog box a Select the Enable Monitor Baseline check box to clear the check mark b Click OK GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC For in vitro diagnostic use Not available in all countries Contact an AB SCIEX Sales Representative for details 2014 AB SCIEX SCIEX is part of AB SCIEX The trademarks mentioned herein are the property of AB SCIEX Pte Ltd or
309. ization 2 Select one of the genes to be the basis for the normalization from the list of genes on the left side of the border area The default normalization gene is defined as Kan An example is shown in Figure 7 25 IMPORTANT Normalization can be disabled by unchecking the check box next to the Normalization Referto Figure 7 26 Cl Normalization File C Projects Gene Expression MainyGeXP Data Tool Data ong Gene Names Gene 7 I A Long Gene Name d J A Very Very Long Gene Name Sample Name Rep 1 Rep 2 Rep 3 Mean Std Dev 9 amp CV 7 CYPIAL Std 015 63ng 418056 1110 745 1414286 981 029 510 625 52 05 Pi DE Std 031 25ng 1577422 29 6 IL 10 Std 125ng 2970 022 _ 9 772 gt IL 12p40 Std 250ng 3359263051007 920 ND 42300 270 12314 470 29 11 IL 2 US50ng ConA 8282097 ND___ ND_ 8282 097_ ND ND IL 4 USOnglPS 179947400 ND ND 79947400 ND ND 7624473 24 9 IL 6 U 50ng PI EIER U 50ng Untreated 24062 680 27460 720 29707 090 27076 830 2841 720 10 4 Kanr PPla TNFa A Very Very Long Gene Name Sample Name Rep 1 Rep 2 Rep 3 Mean Std Dev CV Std 015 63ng 1595 355 2904 941 3083 294 2527 863 812 485 32 141 Std 125ng 13121 Std 250ng 26136 910 39184 840 ND 32660 880 9226 279 28 24 USOngConA 3264122 ND ND 13264122 ND U 50ng LPS 35586030 ND ND 35586030 ND U 50ng PI 19 644 U 50na Untreated 70945 3201 31 767 7601 343 766 8401 79159 970
310. izes to fit in any location in the active application window To move the toolbar to a more convenient location click the title bar and hold the left mouse button while dragging the toolbar to one of the four edges of the application s window The Main Menu toolbar icons are miniature versions of the ones provided in the expanded Main Menu Clicking one of these icons opens the corresponding software module as described Software Module Descriptions on page 12 1 2 Operating the System Perform the tasks involved in analyzing or managing samples and sample data Although the following procedures are independent from setting up and starting the system perform the procedures below in the sequence provided Before you begin confirm that the Capillary is ready for use See Removing and Replacing the Capillary Array on page 360 Install a new Gel Waste Bottle See Replacing the Gel Waste Bottle For Dual Rail System on page 345 Preparing a Sample Prepare a sample for sequence or fragment analysis in accordance with using the instructions contained in either the CE system DTCS or the Quick Start Chemistry Kits or the PCR Reagent manufacturers kit for Fragment Analysis Starting Up the System l1 Turn on the PC and wait for Windows to start 2 Turnon the instrument 3 From the Windows desktop select Start Programs GenomeLab System Control Center The instrument initializes and after several seconds displays the Main Menu 1
311. just the number of runs and the previous cumulative days on the instrument Then click Done NOTE Note the number of runs and days on the instrument for this capillary array for reference Install Capillary Array Fa Please enter the serial number for the capillary array IF you wish to reset the number of runs for the capillary ar number of days it has been on the Instrument enter the new values Cancel Click on Done when pou have installed the capillary array and have closed both the capillary access cover and the sample access cover Cet ta Mew Help Capilares exposed to air Time Remaining mir E ZEC a Capillary Array Part Humber enaga h Total Length 33 00 cm aerial Number Length to Detector 30 00 cm Date Installed los EFFET Internal Diameter 75 00 um Time Installed 1 6 45 20 Humber of Auns Days on Instrument 13 1 Figure 3 47 Install Capillary Array Dialog Box 18 The Confirm Capillary Array Selection dialog will appear Read it and make the selection Yes to continue or No to abort the capillary installation GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Run Module Using Direct Control Removing and Replacing a Gel Cartridge Gel Pump Plug For Dual Rail System CAUTION Care must be exercised when installing removing a gel cartridge due to the viscosity of the gel mixture NOTE This procedure assumes that an expended gel cartridge i
312. k the desired icon and use the Colors dialog box to choose another color Dye Colors Ea amp 4 6 C HEGET EH E Figure 5 3 Dye Colors Toolbar The following table describes the Sequence Investigator Dye Colors toolbar icons Table 5 8 Dye Colors Toolbar Icons Sequence Investigator Module Icon Description A Red is the default color assigned to the Adenine A nucleotide in the data view red C Black is the default color assigned to the Cytosine C nucleotide in the data view black G Green is the default color assigned to the Guanine G nucleotide in the data view green GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC 9 2 Sequence Investigator Module Sequence Investigator Procedures Table 5 8 Dye Colors Toolbar Icons Sequence Investigator Module Icon Description T Blue is the default color assigned to the Thymine T nucleotide in the data view blue N Gray is the default color assigned to ambiguous nucleotides other than A C G or T gray sequence Investigator Procedures This section shows you how to use this module to investigate and compare sequence analysis results To open the Sequence Investigator module click the Investigator icon from the Main Menu D Creating a Reference File The reference file is a text file you can create using Notepad or any other text editor It may be composed of one or two sections the sequence and optionally specific n
313. ked Graph view To switch between the two modes select the appropriate icon button from the EgramBand toolbar Include Exclude Results You can exclude results automatically using filter sets or manually by selecting the Exclude Results command You can re include any excluded results at any time using the Include Results Peaks command available in the right click menu GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 233 PN B40154AC Fragment Analysis Module Using the SNP Locus Tag Editor To re include results that were excluded in the Study right click the selected samples from any of the data or fragment lists and select Include Results When displaying excluded results the screen uses a color code e Teal shading identifies results excluded automatically using filter sets e Maroon shading identifies results excluded manually Light gray shading identifies previously excluded results that have been re included You can hide both filtered and manually excluded results from view by de selecting the Show Excluded command available in the right click menu NOTE Refer to the online help for detailed descriptions of each of these and other display parameters Re Analyzing Results The Fragment Analysis module contains a Reanalyze Results feature that allows you to select one or more samples from the Result Set view to be re analyzed This allows you to apply a different set of fragment analysis parameters
314. king database is greater than 1700MB To maintain system performance it is recommended that vau create anew database before proceeding System is aborting this sample plate operation Figure 3 18 Run Database Size Warning Message To resolve this problem Click No to dismiss the warning dialog box Exit the Run module and the Sample Setup module Make sure all of the other modules are closed Open the Data Manager module Create a new database For details see Creating a Database on page 323 Copy the sample plate from the previous working database to the new database Click OK All to copy any objects referenced by the sample plate to the new database Exit the Data Manager module and launch the Run module je Qe is E a x x Select Run Start Sample Plate 10 Select the new sample plate and click OK The system processes the plate and stores it in the new database NOTE It is recommended that you archive databases that are larger than about 1700 MB For details see Checking the Database Size on page 325 Gel Re estimation The system determines if the gel cartridge volume is sufficient to safely process the plate Ifthe gel volume is greater that 1 5 mL more than the minimum amount needed to process the plate the plate runs and the system does not re estimate the gel volume e If the system determines that the gel cartridge volume is less than the volume needed to safely process the plate the system displays
315. ks all columns positioned above the lock location in the Selected Columns area and thus to the left of the locked position in the list If this includes columns that you do not want locked use the positioning arrows to move the columns out of the lock range e If the view is filled with locked columns you may not be able to scroll through the grid If this happens reduce the number or widths of the locked columns To move the lock position to a different column location click up arrow lock or down arrow lock in the Column Selector window e To remove the column lock click Unlock in the Column Selector window e To lock and unlock columns directly from the fragment result table right click the column header and select Lock Column or Unlock Column Sorting the Results List You can sort the components of the results list in ascending or descending order for any of the column parameters displayed For example you can sort the results list by ascending bin number descending bin fragment count etc You can sort columns in the Result Set View the Fragment List AFLP Analysis and Peak Ratios tables Sorting an Individual Column e Right click the header of the column you want to sort and select Sort Column The system sorts the column in either ascending or descending order depending on the order in which it was previously arranged e To sort the same column in the reverse order right click the header and select Sort Column again
316. lary Opens the Install Capillary Array dialog box Use this dialog box to install the capillary Array array Verify or change the information then install the array GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Run Module Run Module Overview Table 3 8 Replenish Menu Option Release Capillary Array Gel Cartridge Buffer Information Install Gel Cartridge Release Gel Cartridge Replace Wetting Tray Empty Waste Bottle Toolbar Icons Description Displays the first in a series capillary array dialog boxes that let you remove the currently installed capillary array For details see Removing and Replacing the Capillary Array on page 360 Opens the Gel Cartridge Buffer Information dialog box which provides information concerning the gel cartridge and buffer For details see Viewing Gel Information on page 360 Opens the Install Gel Cartridge dialog box Use this option to remove the gel cartridge or if you are not going to install a working gel cartridge to insert a clean empty cartridge or gel pump plug into the cartridge chamber For details see Removing and Replacing a Gel Cartridge Gel Pump Plug For Dual Rail System on page 367 Displays the first in a series of dialog boxes that let you replace the wetting tray For details see Replacing the Wetting Tray on page 347 Displays the first in a series of dialog boxes that let you empty the waste bottle See
317. late l Make sure the Wetting Tray is installed or perform the procedure Installing the Wetting Tray on page 347 then return here GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 353 PN B40154AC Maintenance and Diagnostics Direct Control and Replenishment 354 2 Align the sample plate guide pin with the notched corner of the sample plate and gently lower the plate into position Figure 9 19 901600L Al Figure 9 19 Loading the Sample Plate 1 Sample Plate 4 Sample Plate Notched Edge 2 Wetting Tray Retainers 5 ALIGN together 3 Sample Plate Holder 6 Sample Plate Guide Pin 3 When finished positioning the sample and buffer plates and close the Sample Access Cover 4 Click the Load on the Capillaries Exposed dialog box Figure 9 20 CAUTION The separation gel within the capillaries will dry out if the capillaries are left exposed to the air for more than 15 minutes Capillaries Exposed X Y ou may now open the sample access cover to load plates Lal Capilares exposed to air E Cancel Time Remaining Alarm OFF Help min sec fia 5o Figure 9 20 Capillaries Exposed Dialog Box GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Maintenance and Diagnostics Direct Control and Replenishment Loading the Buffer Plate and Evaporation Cover l Align the notched corner of the buffer plate with the alignment l
318. late holders used to hold the sample plate the buffer plate with buffer evaporation cover and the wetting tray 901594L Al Figure 1 4 Sample Transport and Plate Holders 1 Plate Holders 2 Part of Sample Transport 6 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Getting Started System Overview Sample Plate The sample plate Figure 1 5 is used to hold the samples for separation The plate is a V bottom thermal cycler compatible polypropylene plate containing 96 wells 8 rows x 12 columns The wells have a 200 pL volume capacity Figure 1 5 Sample Plate Buffer Plate with Buffer Evaporation Cover The buffer plate Figure 1 6 holds the DNA separation buffer used during a sample run The plate is a flat bottom polystyrene non sterile plate containing 96 wells When placed over the buffer plate an evaporation cover maintains the proper buffer level 250 300 pL in the buffer plate by preventing the buffer from evaporating The cover slips over the buffer plate position of the sample transport As the CE system advances through the sample plate during a run the instrument pushes the evaporation cover back far enough to expose the next row of buffer wells to use in the next sample set run 901595L Al Figure 1 6 Buffer Evaporation Cover and Buffer Plate 1 Buffer Evaporation Cover 2 Buffer Plate Wetting Tray The wetting tray Figure 1 7 is used to immerse the ends of t
319. layed plate Exit Closes the Sample Setup module Edit Menu Click the Edit menu to display its drop down menu as shown in the following example Edit Undo Ctrlt z Reda Clear All Ctrl L Select All Ctrl 4 Cut Ctrl x Copy Ctrl C Paste trl Find Alt F3 Replace Ctri F3 Method Selected Method 4uto Fill Method Mame Ctrl F Perform the standard editing operations cut copy paste find and replace It also provides an option for modifying previously defined parameters of a method contained in the active sample plate The following table describes the Sample Setup module s Edit menu options Table 2 3 Edit Menu Sample Setup Module Option Description Undo Use to undo the last action performed Redo Use to redo the last undo action Clear All Empties all cell properties in the active sample plate select All Selects all cells in the sample plate Cut Deletes text in one or more cells of the sample plate and copies it to the clipboard You can then paste the cut text into different cells Copy Copies text or the applied properties selected from one or more cells of the sample plate You can then paste the cut text into different cells Paste Inserts copied or cut items at the cursor insertion point Find Opens the Find dialog box which you can use to search for text within the sample name entered in a sample plate Replace Opens the Replace dialog box which you can use to search and replace text within the
320. le all data to the last 10 minutes of the run on the X axis and confine the display of data to the pane on the Y axis Autoscale On Off By default data displayed on the screen is scaled automatically to the confines of the screen autoscale is on If autoscaling is disabled the data is scaled to its true values Pause Data Update Pause the display of data Pausing data does not stop the stream of data just the display of data Monitor Baseline Displays the baseline data trace For details see Monitoring the Baseline on page 386 Display Options Modifies any or all display parameters See Setting or Changing Display Options on page 73 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 57 PN B40154AC Run Module Run Module Overview 08 Log Toolbar The following example shows the Sample Setup module s Log toolbar For descriptions of the actions that occur when you click a toolbar icon see Table 3 11 ale Figure 3 6 Log Toolbar Run Module Table 3 11 Log Toolbar Run Module Icon Description Print Print the system log at any time the program is active System Logs contain all of the messages and activity from the time the program is opened to the time the program is closed Print Preview Display a print preview of the System Log Run Sample Toolbar The following example shows the Sample Setup module s Run Sample toolbar icon E Hun Sample Plates Figure 3 7
321. lect Tools Shrink Database GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 325 PN B40154AC Database Management Data Manager Procedures Backing Up a Database Periodic backups are essential to reduce the risk of losing data Save backups to any folder on the local drive IMPORTANT Ifa database is deleted or damaged only the data created since the last backup will be lost NOTE Shrink the database before backing up any database For details see Reducing the Database Size on page 325 1 Open Data Manager 2 Left click the GENOMELAB DBASE node at the top of the left pane 3 Select the database to be backed up An example is shown in Figure 8 5 Data Manager Pl fal x File Edit wiew Tools Window Help Bl ol see amp E GENOMELAB DBASE HE CEQ Al D1151984 HHE CEQBAKI G D145599 HHE CEQBAK2 l D151679 Gf p22se83 C D1181984 Gf 0392387 Al D145599 l D992157 a AY D151679 G D95938 a GF 0228683 Cl Default a CY p352387 amp pxs7132 CY p952157 C GATA193A07 H D95938 Cj Test project m E Default a CY Dxs7132 a CY GATA193AD7 ECT Test project HE USERTEMPLATE Filter OFF NUM Ai 11 object s Figure 8 5 Select Database to Back Up 4 Select Tools Backup Database 5 Browse to the location on the local disk where the file will be saved Backup Database HE Save in Dbase e g Eg laqs CEQ 20056 4 29 BAK Filename SEQTEST_2006_05_0
322. let you search for information by topic index entry and or keyword Using Help Select this option to display the Contents window on how to use the Windows Help system About GenomeLab Select this option to access software instrument and system information system Beckman Coulter Select this option to access the Beckman Coulter Home Page on the Internet Home Page GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 113 PN B40154AC Sequence Analysis Sequence Analysis Module Overview Toolbar Icons The Sequence Analysis module provides seven toolbars 1 Standard 2 Data 3 Sample View 4 Sequence Dye Colors 5 Batch Control 6 Sample Plate and 7 Base Sequence Each icon on these toolbars corresponds to a commonly used menu item By default all toolbars except Sample Plate and Base Sequence are displayed when you first open the Sequence Analysis module The following tables describe the function of each of the toolbar icons Standard Toolbar The following example shows the Sequence Analysis module s Standard toolbar For descriptions of the actions that occur when you click a toolbar icon see Table 4 9 E lit s assieme 32 et em H H gie 114 Figure 4 2 Standard Toolbar Sequence Analysis Module Table 4 9 Standard Toolbar Sequence Analysis Module Icon i2 5 e LB es a Zr 4 r1 r r1 Description Open Opens data files
323. lick OK Use the Sample View toolbar icons to display the desired data GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC 122 Sequence Analysis Using the Sequence Analysis Module The following table describes each tab in the Open dialog box Table 4 16 Open Dialog Box Tabs Sequence Analysis Module Tah sample Data sequence Results sample Plate Results sequence Analysis Parameters Optical Scan Data Description Displays the list of raw data and baseline data stored in the selected project On the right hand side of the list box you may view the date and time the sample was run You may want to open a raw data set to analyze it Displays the list of analyzed data that resides in the selected project On the right hand side of the list box you may view the date and time the sample was run as well as the raw data from which the sequence result was derived sequence data consists of analyzed data and its base sequence text When you open sequence data you may also view the associated raw data current and voltage This option is available for sequence analysis only To filter the list select the Enable check box M1 and enter the Start and End dates for the items you wish to view Click Refresh to view the filtered results Displays the list of sample plates run in the selected project Selecting a sample plate result displays the Sample Plate toolbar Click on the desired samples
324. lleles from multiple samples allow you to create a new allele list or update an existing allele list for a locus tag based on the collection of fragment results During bin analysis the system groups fragments by size to form bins characterized by an average apparent size and standard deviation of the fragments in the bin Setting up a Bin Analysis Bin analysis requires an exiting result set either from a previously saved Study or a new Study created exclusively for this purpose To set up a bin analysis l Open the result set you want to analyze 2 Select Analysis New Binning Analysis GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 239 PN B40154AC Fragment Analysis Module Performing Bin Analysis NOTE As an alternative you can access Bin Analysis from the Analyses tab of the Study Explorer The New Binning Analysis window opens as shown in the following illustration PII Es New Binning Analysis Sheps Parameters Dye D3 Binning Fragment Range From 300 To 420 2 Locus Tag Binning Maximum Bin Width HE Minimum Data Points Per Bin 2 E Repeat Unit Length 4 E Source Data s Allele Naming Convention Nominal Size Alphabetic Start At A 2 mera Sema 1 Fai F000 BU S000 4000 3000 Dye Signal RFU 2000 1000 350 355 360 365 370 arm 360 385 390 Fragment Size nt Help x Previous Einish
325. llowing parameters Title X Axis Options Y Axis Options Dye Traces Current Traces Colors and Quality Parameters For details see Setting or Changing Display Options on page 153 or click Help when using the dialog box Heterozygote Opens the Colors dialog box which you can use to change the color of the Display Color heterozygotes in the base sequence pane For details see Changing Display Colors on page 155 Analysis Menu Click the Analysis menu to display its drop down menu as shown in the following example Analysis Analyze Stop Working Analysis Parameters Restore Original Base Sequence Batch Analysis Reanalvze Batch View Selected Batch Sample Result Skip Gurrent Sample Skip Gurrent Sample Set Skip Gurrent Sample Plate Pause After Current Sample Resume Batch Processing Third Party Analysis Third Party Analysis Setup Service Alignment k Align with Template Batch Alignment Trim Based On Quality Trim Based On Sequence Batch Trimming The following table describes the Sequence Analysis module s Analysis menu options Table 4 6 Analysis Menu Sequence Analysis Module Option Description Analyze Analyze active sample data or reanalyze existing sequence results Selecting this option opens the current Working Parameters dialog box Click OK to start the analysis Stop Terminates the analysis currently in progress GenomeLab Genetic Analysis System User s Guide For
326. located on the left and the introductory topic in the topic pane located on the right You can use the Contents to select and print specific help topics The navigation pane also provides a Search tab and an Index tab These tabs let you search for information by topic index entry and or keyword Online Help Click this icon and then on a menu item to open the help topic related to the selection Direct Control Toolbar The following example shows the Sample Setup module s Direct Control toolbar For descriptions of the actions that occur when you click a toolbar icon see Table 3 4 Ales i ke Ele wl a elenl ll Figure 3 3 Direct Control Toolbar Run Module Figure 3 4 Direct Control Toolbar Run Module icon ur oot e cac EE Description Inject Injects sample prior to its separation and detection See Injecting a Sample on page 356 separate Initiates the separation of injected samples See Performing a Separation on page 357 Fill Capillary with Gel Fills all eight of the capillaries with fresh gel See Replenishing the Capillaries with Gel on page 357 Capillary Temperature Specifies the desired temperature for the capillaries See Specifying Capillary Temperature on page 356 Denature Denatures the samples residing in a specific sample set See Denaturing a Sample on page 356 Optical Alignment Performs the alignment of the lasers with the capillary windows See Perfo
327. locks Click the toolbar arrow buttons to move the row up or down one cell e To delete the contents of the rows select the desired rows and click Delete A warning message appears prompting you to confirm deletion Click Yes to delete the contents or No to return to the editor Viewing the Method Tab The Method sub window displays the parameters of the method for the selected samples Click the Edit button to modify one or all of the parameters of the existing method or to create a new method Note Method Analysis Denature Separate Method Name LFA b Temperature 90 C Voltage 6 0 kV Duration 120 sec Duration 60 0 min Capillary Inject Pause 0 min Temperature Br C Voltage 2 0 ky Wait for Temp Yes Duration 15 sec Figure 2 3 Sample Setup Method Sub Window GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 23 PN B40154AC Sample Setup Module Overview Using the Analysis Tab Enable or disable the Perform Analysis mode When enabled M this mode causes the CE system to analyze the sample at the end of the run Set the Perform Analysis option for each sample separately row column or entire plate Select the desired Analysis Parameter Set for each sample from the drop down list Select each sample separately row column or entire plate Enable or disable automatic printing of reports and or edit the print report parameters po M se uer Select Edit Print Format For Plate The Repor
328. log See Defining Fragment Analysis Parameters on page 206 for a description of this dialog When finished click Save As and save the edited parameters to an appropriate Project with the same analysis parameters name as specified in the plate Import file After creating the Non Default Run Method and Analysis Parameters follow the same steps as in Importing a Sample Plate with Default Run Method and Analysis Parameters as listed above GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 45 PN B40154AC Sample Setup Module Using the Sample Setup Module Exporting Sample Plate Data Export the sample plate data to use in compatible equipment or to manually edit the plate information IMPORTANT If a Sample Plate file is already open make sure it has been saved before proceeding To export the sample plate l Open the sample plate file Select File Export Select Resolve Filename Conflicts to prevent the file from overwriting a previous file with the same name If another file with the same name exists the export function increments the new file with a unique sequence number NOTE If you do not select Resolve Filename Conflicts and a file with the same name exists the system displays a warning message asking if you want to replace the old file with the new one Select Yes to overwrite the existing file or No to cancel the export 4 Select a location to save the file 5 Enter a filename or leave t
329. lting four files contain separate dye colors for all the samples You can select CRV as an export file type for exporting fragment results from the Fragment Analysis module Individual files are created representing individual colors FileName D1 crvD1 contains dye 1 red FileName D2 crvD2 contains dye 2 black FileName D3 crvD3 contains dye 3 green FileName DA crvD4A contains dye 4 blue Default dye colors You may reassign the dye colors at any time Batch CRV Exporting More than one result can be exported in a batch If for instance more than one result is exported in a batch the export generates five files one for each dye and one to assist in determining the trace order See the table below FileName D1 crvD1 contains all dye 1 results in the batch FileName _D2 crvD2 contains all dye 2 results in the batch FileName D3 crvD3 contains all dye 3 results in the batch FileName DA crvD4A contains all dye 4 results in the batch FileName CRV TRACE ORDER txtcreated for batch export files to assist in determining trace order in the CRV files See Sequence Export File Types on page 167 for additional information on sample elements or refer to the Online Help Importing Database Files To import files into the database 1 Open Data Manager 2 Inthe Data Manager window browse and select the project where the imported file will reside Select File Import The Import dialog box opens Bro
330. ltiple sample data or sample plate results sequentially Batch Alignment Select sequence results or sample plate results to align sere Batch Trimming Trims multiple sample data or sample plate results sequentially Reanalyze Batch After performing a batch analysis use this option to perform a new analysis on the same data set otop Analysis Terminates the analysis currently in progress analyzed Use Resume Batch Processing to continue the analysis Resume Resumes a batch analysis after it has been paused okip Sample While performing a batch analysis click this icon to pass over the sample currently being analyzed This item is not available if Sample Plate Results was selected from the Batch Analysis Selection dialog box Pause Momentarily stops a batch analysis after the currently running sample has been GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Sequence Analysis Sequence Analysis Module Overview Table 4 13 Batch Control Toolbar Sequence Analysis Module Icon Description okip Set While performing a batch analysis click this icon to pass over the sample set d currently being analyzed This item is not available if Sample Data was selected from the Batch Analysis Selection dialog box okip Plate While performing a batch analysis click this icon to pass over the sample plate EI currently being analyzed This item is not available if Sample D
331. lysis is completed corrections to the allele list can be made 4 Adjust the Minimal Relative Peak Height Min Ref Peak Height to exclude any data points generated from small noise peaks NOTE In Figure 7 6 excluded small peaks are shown as pink colored dots at the bottom of the Bin View 5 Iftoo many small peaks are excluded reduce the Min Ref Peak Height from 0 01 to 0 00 284 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Gene Expression Set up Locus Tag and Allele IDs New Binning Analysis Soy Steps Bin View Trace Views pede Nominal Size vs Apparent Size Slope e 1 00087 y intercept 0 2175 f 0 99999179 Binning Lacus Tag Source Data Relative Signal Strength a E 0 ie E D B 19024 01 16 D aed A eee 15122 EO D D D 152 21 D D E ons b ee NEEL T HT 0 P m MISI IM i TU 19819 ores iE NUN Li sme Oe canned vd aan ri Q 19812 erre ll Bi K 153 11 0 00 n r Phase Shift D a Min Rel Peak Height D E Show Phantom Bins wj Help z Previous Cancel Figure 7 7 Min Ref Peak Height Reduced to 0 00 6 Double click on Num Points in the Allele List table to sort the alleles by number of data points in a bin Bins with zero values in the Num Points column are considered empty bins 7 Select or highlight all alleles with empty bins by clicking on the gray boxes on the left si
332. lysis parameters to meet the specific requirements for your samples You can create or edit parameter sets using the Fragment Analysis Parameters window This window contains a number of tabs in which you define the general parameter set information set locus tag parameters select an analysis method assign quantitation values and define several other factors that affect how your data is analyzed You can access the Fragment Analysis Parameters window either while developing a Study from within the Study Wizard see Selecting Raw Data for the New Study on page 201 You can also access it at any time while working within the Fragment Analysis module by selecting Analysis Analysis Parameters Using either method the Analysis Parameters window opens showing the currently saved parameter sets available for selection e To create a new parameter set click New e To edit an existing parameter set click Edit The following illustration shows the Edit Fragment Analysis Parameters window Edit Fragment Analysis Parameters Pi Parameter Set Mame DefaultaesPAnalusisParameters Project Default Analysis Method STR Locus Tags SNE Locus Tags Parameter Set Date created 12 20 2005 11 04 02 AM Date modified 12 20 2005 11 04 02 4M Peak Criteria Allele Identification Identify STR Alleles Slope threshold 10 SNP Analysis Size Estimation and Allele ID Confidence Relative peak height threshold u Confidence l
333. lysisP arameters 20 3 faultGersPAnalysisParameters 8 2 23 2003 18 45 50 t pass DefaultGexPAnalysisParameters i 02 23 2009 184548 pass DefaulfaeXPAnalysisParameters DefaultGexPAnalysisParameters DefauliGexPAnalysisParameters DefaultersPAnalsisParameters 1 OS02231873 00 02 ORQZSIED 00 s 10302231860 s 4 I D Summary Help Previous he Cancel Figure 7 12 Review Source Data 15 Click on the Next button The source data will be listed in the Results table The Summary area at the bottom of this table lists all of the samples included in the Bin Analysis You may view and compare individual samples manually to include or exclude individual samples or groups of samples from the analysis You can also re analyze selected samples 16 Click on the Finish button to complete the binning process 17 Open the Results Set View window 18 Highlight all files in this study Right click on highlighted area Select Reanalyze Results and then select Using Additional Edited Locus Tags V Reanalyze Results x Steps Locus Tags Analyze Data You must select the Allele Identification Type s STR C SNP STR Locus Tags Available Selected Neme Dae 8 25 2014 12 03 2 8 25 2014 12 00 0 6 11 2014 4 27 22 6 11 2014 4 27 22 6 11 2014 4 26 00 6 11 20
334. maining I min 14 sec n Capillary Array Part Number E0808 Total Length 23 00 cm serial Number Length to Detector 20 00 em Date Installed 04 27 2006 Internal Diameter 75 00 um Time Installed f 6 45 20 Humber of Runs Days an Instrument 13 1 Figure 9 6 Install Capillary Array Dialog Box CAUTION After cleaning the detection windows perform the optical alignment procedure and monitor the baseline If background levels are above 6000 counts repeat the cleaning process Replacing the Gel Waste Bottle For Dual Rail System NOTE This procedure assumes that you are replacing a used full waste bottle with an empty waste bottle Use the Run module to ensure the instrument is ready and follow these procedures to change the bottle l Inthe Run module select Replenish Empty Waste Bottle The following dialog box displays a warning as the instrument prepares for removal Empty Waste Bottle x m l Help Capillaries exposed to air Time Remaining min SEC je 57 Figure 9 7 Empty Waste Bottle Dialog Box Stop GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 345 PN B40154AC Maintenance and Diagnostics Routine Maintenance 346 2 Empty Waste Bottle Open the sample access door and empty the waste Battle Close the sample access door and click on Done Help Capillaries exposed to air Time Remaining min Sec ha pe Wait until the dialog b
335. ment Analysis Module Defining Fragment Analysis Parameters e SNP Analysis Select this option MW to include Single Nucleotide Polymorphism SNP analysis in the parameter set NOTE You may include only one of these options in the same analysis Size Estimation and Allele ID Confidence Confidence level Set this level as required for your analysis The confidence level default value 9596 is equal to one minus the significance level of the built in statistical tests used for allele identification and for computing apparent fragment size confidence intervals Analysis Method Tab Set the size standard and model The model selected should be the best fit for the size standard selected as it is used to generate the size calibration model which estimates sizes for the unknown fragments Edit Fragment Analysis Parameters Id xi Parameter Set M ame FABRI Project Default Size standard SizeStandard 600 m Dype D Size Standard Fit Coefficient 0 57 Model Juartic Y Requires a minimum of 5 selected peaks Migration Variable Migration time Mobility Select All Deselect All Save Ags Cancel Figure 6 12 Fragment Analysis Parameters Window Analysis Method Tab Size standards are sets of DNA fragments of known sizes run with a sample and used to create the size calibration model The system uses this model to relate the known fragment size to either migration time or mobility for estimatin
336. mental sample file for analysis IET GexP Quant Tool 7 Figure 7 38 Selecting Open Samples 3 Once imported the Standard and Sample files are listed in the Files area as shown in Figure 7 39 Figure 7 39 Standards and Samples Files are Imported 4 In the Processing Status area it shows there are a total of twenty five genes present in this data file The Number of Normalization Genes is labeled zero since no normalization gene is selected at this time Refer to Figure 7 39 5 From the Normalize menu choose Select Normalize Genes Refer to Figure 7 40 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 307 PN B40154AC Gene Expression GeXP Quant Tool uu Figure 7 40 Number of genes available for processing shown A Select Normalization Genes window will be displayed listing the genes that can be selected Refer to Figure 7 41 6 Select a normalization gene by clicking on the box next to a gene You may select one or more genes as normalization gene s Click on Ok to continue Select Normalization Genes Figure 7 41 List of genes that can be selected 7 Select Run Quantitative Analysis from the Analyze menu Refer to Figure 7 42 308 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Gene Expression GeXP Quant Tool F GexP Quant Tool LSS Figure 7 4
337. meters used to accurately identify your alleles and to set these true alleles apart from various other anomalies identified in the fragment list A sample fragment represents a particular allele if its apparent size is similar to the size of a particular allele fragment in the allele list However because both the sequence and size of a fragment affects its mobility the nominal allele size will not likely be the same as its apparent size Therefore the system identifies the alleles based on their closeness to an apparent size using a user defined confidence level Confidence Interval You can either enter the confidence interval manually or generate it automatically using the bin analysis When automatically generated the value displayed depends on the overall standard deviation computed in the bin analysis and the user specified confidence level default 2 9596 When you manually enter the confidence interval the system uses the entered value and the confidence level to estimate an overall standard deviation Increasing the confidence interval increases the width of the bins You should set the confidence interval to a value less than 0 5 nt If you enter a value of zero in the Confidence Interval field the system uses only the standard deviation of the estimated sample fragment size in the statistical test used to identify a fragment as corresponding to an allele When you enter the confidence interval the allele identification will
338. ming an alignment NOTE If you opened this dialog box by selecting View Parameters Used to Compute Sequence this dialog box displays the analysis values but disables the fields described below GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Sequence Analysis Using the Sequence Analysis Module The following table describes the options available on the Sequence Analysis Parameters General tab Table 4 17 General Tab Sequence Analysis Parameters Editor Option Description N Threshold opecifies the value for the threshold below which N s are substituted for called bases Enter the desired value in the N Threshold text box The range is 0 00 to 1 00 For example entering e 1 00 calls all bases as indeterminate N s e 0 50 calls all bases with an estimated error of probability of greater than 50 as N s e 0 00 does not call any N s e 0 60 is recommended called bases with an estimated error probability of greater than 40 will be called N s Analysis Start Stop Enter the time in minutes from the start of the raw data where the analysis is to begin and the time in minutes from the start of the raw data where the analysis is to end e Start The default value of 0 for the start time uses the system algorithm to find the start of valid data and the values entered under the Initial Data Detection tab e Stop The default value of 0 for the stop time analyzes to the en
339. mple Setup Module Overview 20 Window Menu Click the Window menu to display its drop down menu as shown in the following example Window Next Ctrl Tab Clase Ctrl F4 1 Untitled Plate w 2 Untitled Plate The following table describes the Sample Setup module s Window menu options Table 2 6 Window Menu Sample Setup Module Option Description Next Toggles between open sample plates Close Closes the active sample plate or sample plate summary Help Menu Click the Help menu to display its drop down menu as shown in the following example The following table describes the Help menu options Table 2 7 Help Menu Sample Setup Module Option Description Help Topics select this option to display the CE system online help By default the help system displays the Contents in the navigation pane located on the left and the introductory topic in the topic pane located on the right You can use the Contents to select and print specific help topics The navigation pane also provides a Search tab and an Index tab These tabs let you search for information by topic index entry and or keyword Using Help Select this option to display the Contents window on how to use the Windows Help system About GenomeLab Select this option to access software instrument and system information system Beckman Coulter Select this option to access the Beckman Coulter Home Page on the Internet Home Page GenomeLab Genetic Analys
340. n numbers A single gene can be represented in the GenBank database by multiple accession numbers such as those that refer to genomic sequences partial sequences mutations mRNA ESTs alternate transcripts splice variants or pseudogenes Ensure the following when selecting an accession number a Correct Gene Many genes have multiple names and aliases Different genes can have similar names e g IL2 IL2 receptor alpha IL2 receptor beta IL2 receptor gamma Verify that the gene is from the species of interest b Valid Sequence Verify that the sequence contains only the letters A T G C or N Verify that the sequence is for mRNA cDNA Avoid genomic DNA sequences with introns Verify that the sequence is still active by reviewing the accession number s revision history using the following page www ncbi nlm nih gov entrez sutils girevhist cgi RefSeq accession numbers starting with NM_ are ideal choices for designing primers because they are from a curated non redundant database of known genes maintained by NCBI The NM_ accession prefix denotes mRNA sequences Each RefSeq accession number correlates to an individual identified transcript variant A gene may have more than one RefSeq identifiers GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 213 PN B40154AC Gene Expression Multiplex Primer Design using NCBI Primer BLAST 274 e Be aware of and avoid pseudogenes by BLASTing the
341. n Description Analysis Parameters e View the current working analysis parameters e Edit the working analysis parameters maintained in memory for the duration of the application session e Select a previously saved parameter set to be used in the analysis New AFLP Analysis Starts a new AFLP Analysis See Performing AFLP Analysis on page 248 New Binning Analysis otarts a new Binning Analysis See Performing Bin Analysis on page 239 New Peak Ratio Analysis Starts a new Peak Ratio Analysis See Calculating Peak Ratios on page 245 Run LOH Analysis Runs a Loss of Heterozygosity Analysis See Performing LOH Analysis on page 252 Reports Menu Click the Reports menu to display its drop down menu as shown in the following example Reports Mew Report Refresh F5 194 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Fragment Analysis Module Fragment Analysis Module Overview The following table describes the Fragment Analysis module s Reports menu options Table 6 7 Reports Menu Fragment Analysis Module Option Description New Report select a template and context type for the report Refresh Refreshes the display of the selected report Window Menu Click the Window menu to display its drop down menu as shown in the following example Window Cascade Tile Horizontally Tile Vertically Close All Arrange Icons IM 1 Fragment List The following table describes the
342. n Quantity Optional If desired enter the known quantity of your reference peak in the field You must enter this value in scientific notation Select the units for the quantity from the drop down list The options are moles grams molarity and g L The system uses this information to calculate the quantity of DNA in the other results Highlight Variation Highlight Variant Ratios Select this option to enable the system to highlight any result ratios that deviate from average values The criteria for variant ratios are specified by either the Standard Deviation about the mean or the Error e Standard Deviation Select this option to base the system criteria for identifying any variant ratios on the number of standard deviations from the mean Enter the standard deviation number as the value a ratio must meet before the system considers the ratio a variant e Error Select this option to enable the system to base its criteria for identifying any variant ratios on the percentage of error Enter the percent value of error the system allows a ratio to reach before it considers the ratio to be variant Peak Ratio Result Table The system performs the analysis based on the selected reference and at least one test peak Show Excluded Select this option if you want the result table to display peaks excluded from the analysis The Peak Ratio Result Table displays details in the following columns Status Displays an R if the result has b
343. n Vitro Diagnostic Use 111 PN B40154AC Sequence Analysis Sequence Analysis Module Overview Table 4 6 Analysis Menu Sequence Analysis Module 112 Option Description Working Analysis View and change the analysis parameters to be used for subsequent analyses For Parameters details see Editing Sequence Analysis Parameters on page 124 Restore Original Base Sequence Batch Analysis Reanalyze Batch View Selected Batch sample Result Skip Current Sample Skip Current Sample Set Skip Current Sample Plate Pause After Current Sample Resume Batch Processing Third Party Analysis Third Party Analysis Setup service Alignment Align with Template Batch Alignment Trim Based on Quality Trim Based on Sequence Batch Trim Returns analyzed data displays and base sequence text back to their original states losing all edits Analyze multiple sample data or sample plate results sequentially Selecting this option opens the following dialog box For details see Performing a Batch Analysis on page 156 After performing a batch analysis use this option to perform the analysis again For details see Reanalyzing a Batch on page 157 After performing a batch analysis use this option to view the results of a selected sample in the upper pane of the batch analysis window While performing a batch analysis use this option to pass over the sample currently being analyzed This item is not available i
344. n a Batch To skip the current sample plate during a batch analysis select Analysis Skip Current Sample Plate Restoring the Original Sequence Data With a Results file open select Analysis Restore Original Base Sequence to return the result data to its original state losing all edits Using Compare Mode Select up to 15 results to compare against the open result enabling the comparison of a maximum of 16 sequence results at one time while within the Sequence Analysis mode IMPORTANT If you select more than 16 results from the Compare dialog box a message box opens displaying the following warning The maximum number of results allowed for comparison with the open result is 15 Please select again Comparing Sequence Results To compare sequence results Launch the Sequence Analysis application Select File Open Select the Sequence Results tab and select one sequence result Click OK to open the result poe e menu Click on the Compare button on the Sample View toolbar The Compare dialog box opens 6 Select up to fifteen results 7 Click OK The system processes all fifteen results and the original result and displays the results on the screen NOTE The originally opened sequence result appears in the top pane To enable Compare Synch select Tools Compare Synch Zooming Results Click on the Zoom Mode icon and zoom in on a region in the original sequence result and the other fifteen resul
345. n allele list from a list of nominal sizes and a partial list of apparent sizes using Interpolation and Linear Regression Interpolation calculates the apparent fragment sizes between two selected points Linear Regression calculates the line of best fit for the selected alleles The system uses this line to determine the apparent sizes for all points not selected This option requires you to select more than two apparent fragment sizes GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Fragment Analysis Module Using the STR Locus Tag Editor To generate an allele list using one of these methods l Individually edit the apparent fragment sizes within the allele list from which you want to generate interpolation or a linear regression line 2 Select the alleles you want to use for generating the allele apparent sizes e To select the rows within the allele list click the row header of the allele list e To select multiple consecutive alleles press and hold the Shift key while dragging through the headers To select non consecutive rows press and hold the Ctrl key while selecting each of the rows with the left mouse button 3 Right click your selection and select Interpolate or Regression The Interpolation or Linear Regression function replaces existing or missing apparent fragment sizes or supplies the generated values Allele ID Criteria The Allele ID Criteria tab contains the para
346. n calculation Standard Deviation The standard deviation is calculated using the normal formula for corrected sample standard deviation SD SQUARE ROOT SUM replicate value Mean 2 count of replicate value 1 NOTE Replicate values shown as ND are not included in the Standard Deviation calculation CV The 96CV calculated using the following formula CV standard deviation mean 100 Error Messages If there is an error opening the input file or if the file is not in the expected format an error message will be given and no further processing of the file will take place E GeXP Data Tool Sse About Heip File C Projects Gene Expression Main GeXP Data Tool Data Bad Format Heading Names Test csv The file format is incorrect Columns are missing CEQ Result Name Peak Area rfuxmm AllelelD Figure 7 31 Incorrect Format Error Message If there are any sample names which have more than 10 replicates an error message will be given and no further processing of the file will take place If there are multiple values for a gene from the same replicate data i e result an error message will be given and no further processing of the file will take place Samples with no replicate data will be highlighted as errors with a red background It will have a tool tip explaining the error and will be excluded from the export file GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic U
347. n linearity Based on the selected standard you can use one of these following models e Linear Fit is a straight line model which is useful only for a set of size standards spanning a very small range GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 209 PN B40154AC Fragment Analysis Module Defining Fragment Analysis Parameters 210 Quadratic Fit adequately accounts for the non linear dependence of mobility on size under some conditions but usually over relatively short size ranges that are well separated from the size limits of the separation system Cubic Curve generally represents the curvature in a time or mobility versus size plot well enough that errors in estimated sizes are dominated by other factors such as effects of primary structure on mobility This is usually the best choice for routine use with the SizeStandard 400 set Quartic Curve is a fourth degree polynomial that provides more accurate size estimates than a cubic curve when used for calibrations that span a long size range or extend into size areas where the size selectivity of the separation system is very non linear This is usually the best choice for routine use with the SizeStandard 600 set Local Southern method estimates the size of a sample fragment from its mobility and that of the four standard fragments closest in size If you select this method the X Variable options are grayed out and mobility is automatically selected
348. n the same separation parameters across eight samples one column at a time Each column that contains samples is called a Sample Set The separation parameters applied to each sample set are specified in the Method Method parameters can be changed to create new methods Using the Main Window The portions of the Sample Setup module s main window are described in Table 2 1 A B C D Sample Setup DefaultSample late e d Xx File Edit View Run Window Help Diea ale aelel dl m 3E p ra amp Run Sample Plates E iu MySamplePlate a view by M View by Sample Name MyS ample A01 Subject ID Plate Saved A A11 A B B B DO z T F D MySample D01 mr cu ies NOE TT i TE i E MySample EO1 EN F2 F F4 F FB F7 F F9 Fit F F12 F uySample FO1 BE TTTS 4 E G7 j 10 11 G M i ySample G01 i Cay H H H4 H E H7 H Hg H10 H11 H1 H MySample H01 e 4 d d d d d 4 d 3 3 3 Note Method Analysis Legend Cl Seved OC sEdted PROPERTY Template Source Sample Prep 3 Forward Primer Hi Ready Working Database GEXP MODULE 2006 View by Sample Name INUM Figure 2 1 Main Window Sample Plate Module GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 21 PN B40154AC Sample Setup Module Overview The following table describes the items called out in Figure 2 1 Table 2 1 Main Window
349. nalysis System User s Guide For n Vitro Diagnostic Use 223 PN B40154AC Fragment Analysis Module Using the STR Locus Tag Editor 224 e If the Use A peak to call allele box is checked the system identifies the A peak as the true allele in the fragment list when the Detect A box is also checked It designates the other peak as either A or A accordingly e If the Use A peak to call allele box is not checked the system identifies the A peak as the true allele in the fragment list when the Detect A box is also not checked The other peak will be included in the fragment list as an unknown allele Ifthe Detect Spurious Peaks check box is selected and the peak falls below the maximum height designation for spurious peaks the other peak will be included in the fragment list as a spurious peak NOTE The only time that Use A peak to call allele is checked while the Detect A is not checked is when there is complete conversion of the PCR product to A When neither Use A peak to call allele nor Detect A are checked no A labeling can occur In general the reproducibility of size estimates is better for higher peaks than for lower peaks Therefore it is good practice to direct the system to use the higher of the peaks associated with the allele to identify the allele Additionally it is generally a good idea to check the Detect A option so the system correctly categorizes peaks If the option is incorrectly con
350. nalysis looks the same as those produced by an STR analysis Fragments identified as alleles of a locus are labeled as such in the fragment list No more than one fragment labeled with a given dye can belong to the same locus up to four peaks can be labeled as alleles of the same locus but each must be labeled with a different dye You can choose SNP locus tags from a list of available SNP locus tags previously configured for analysis This tab also gives you access to the SNP Locus Tag Editor where you can edit existing or create new SNP locus tags to meet the specific requirements of your sample Edit Fragment Analysis Parameters Iof x Parameter Set Mame Ga amp TAT33A L7 Project Default Edit Locus Mew Locus Save Ag Cancel Figure 6 15 Fragment Analysis Parameters Window Selecting SNP Locus Tags GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Fragment Analysis Module Defining Fragment Analysis Parameters Selecting Locus Tags Select one or more locus tags you want included in your parameter set e To select an individual locus select it in the Available list then click the right arrow gt to move the selection to the Selected list e Toselect all available locus tags click the double right arrow gt gt to move all of them to the Selected list e To remove locus tags from your parameter set select each locus tag in the Selected list and click either
351. nalyze Data Window analysis currently in progress When the analysis is complete the status column indicates if the analysis succeeded or failed for each sample included in the Study To review the analysis log highlight a sample in the upper samples list and scroll through the analysis information in the lower analysis log area of the window Click Next to proceed to the Select Result Data window Selecting Additional Results to add to the Study Add result data to your new Study in this fourth step Additional result data may include samples that were previously analyzed under a different set of analysis parameters than those analyzed in the preceding steps of the Study currently being developed The Select Result Data window is identical to the Select Raw Data window displayed in the first step of the Study Wizard NOTE Refer to the Selecting Raw Data for the New Study on page 201 for an explanation of the features available in the Select Result Data window Select any additional results that you would like to add to the new Study and click Finish to complete the Study To save your new Study select File Save or File Save As GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 205 PN B40154AC Fragment Analysis Module Defining Fragment Analysis Parameters 6 4 Defining Fragment Analysis Parameters The following sections describe how to edit a parameter set or create an entirely new set of ana
352. name of the samples in the Sample Name field and then press Enter Enter the barcode for the plate in the Barcode field A E Apply sample specific information in the Note window of the Note tab and apply property sets and values 6 Assign a method to each sample set To edit the method or create a new method see Creating or Editing a Method on page 40 e To automatically analyze data after a sample set run select the Analysis tab then select the Automatic Analysis check box The system will analyze the sample data using the parameter set selected from the drop down list For details see Defining Data Processing Conditions on page 41 e To automatically print a report after a sample set run see Printing the Plate Report or Specifying Sample Plate Print Options on page 42 e To automatically export data after a sample set run see Specifying Sample Plate Export Options on page 43 7 Select File Save As In the Save As dialog box a Selecta Project Name from the drop down list b Enter a name for this plate in the name field c Click OK to save the plate Selecting Samples Select individual samples positions In addition select the entire plate row or column using a single click Use the Shift or Ctrl keys to select contiguous and non contiguous cells Selecting the Entire Sample Plate Select the entire sample plate by left clicking the grid box on the upper left corner of the plate grid To remove the sele
353. nces The following table describes the Sequence Analysis modules File menu options Table 4 2 File Menu Sequence Analysis Module Option Description Open Open Sample Data Sequence Analysis Parameters Optical Scan Data Sequence Results and Sample Plate Results Close Closes the open sample Close Tab Closes the active tab save Saves existing data save As save data to a new name Import Locate and select data to import The system can import data in Standard Chromatogram Format scf or Electropherogram Sample Data esd format 106 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Sequence Analysis Sequence Analysis Module Overview Table 4 2 File Menu Sequence Analysis Module Option Export Export from Plate Preferences Properties Report Format Print Preview Print Report Print Selected Pane Description Export data in one of the following formats e Standard Chromatogram Format Ver 3 00 scf e Standard Chromatogram Format Ver 2 10 scf e Tab Delimited ASCII Text txt e SEQ Sequence Text seq e FASTA and Quality fasta e PHRED and SCF scf phd 1 e ESD esd e CEQ cq Opens or exports samples from a specific sample plate To select multiple samples press the Shift key while selecting samples The Sample Plate toolbar must be open to use this menu option Used to e View or change the panes displayed when you first open a sam
354. nd days on instrument will revert to 0 e If you are installing the previous capillary array do not change the serial number number of runs or the number of days on the instrument as they will be correct e If you are installing a capillary array that was previously used but not the last capillary array on the instrument enter its part number if applicable serial number and adjust the number of runs and the previous cumulative days on the instrument Then click Done GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Maintenance and Diagnostics Direct Control and Replenishment NOTE Note the number of runs and days on the instrument for this capillary array for reference Install Capillary Array Ea Please enter the serial number Far the capillary array IE vou wish to reset the number of runs For the capillary or number of days it has been on the Instrument enter the new values Cancel Click on Done when you have installed the capillary array and have closed bath the capillary access cover and the sample access cover Get la New Capillaries exposed to air Time Remaining Heb B min 14 SEC E Capillary Array Part Number BOS08 v Total Length 33 00 cm serial Number Length to Detector 20 00 em Date Installed 04 27 2006 Internal Diameter 75 00 prm Time Installed f 7 11 18 Number of Runs jo Days an Instrument 0 0 Figure 9 38 Install Capilla
355. nd samples may be present in the same file The opened data file is displayed in a scrollable list of tables ordered alphabetically by gene name similar to that shown in Figure 7 23 296 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Gene Expression GeXP Data Tool C Normalization Gene ACTb CYP1A1 sample Name Rep 1 Rep 2 Rep 3 Mean Std Dev 6CV GAPDH Std 015 63ng 418 056 1110 745 1414 286 981 029 510 625 RS Std031 25ng 6686 150 5686 791 3594 996 5322 646 1577422 29 636 e Std 125ng 31045 240 32983 160 27151 440 30393 280 2970 022 9 772 IL 12p40 Std 250ng 33592 630 51007 920 ND 42300 270 12314470 29 112 IL 2 U 50ng ConA 8282097 ND ND 8282097 ND IL 4 U 50ng LPS 79947 400ND ND 79947 400 IL 6 U 50ng PI 22306 950 31992 220 37349 800 30549 660 7624473 24958 U SOng Untreated 24062 680 27460 720 29707 090 27076 830 2841 720 F10495 Kanr PPla CYP1A1 Sample Name Rep 1 Rep 2 Rep 3 Mean Std Dev 96CV Std 015 63ng 1936 662 2776 998 2852 805 2522 155 508 467 Std 03125ng 9135 354 10861 800 7232 097 9076417 1815 569 20003 Std 125ng 35398 470 38320 700 3821 210 9972 Std 250ng 36525 070 58109 720 ND___ 47317 390 15262 650 32 256 U 50ng ConA 12565357 ND ND 52565357 ND ND USOnglPS 72440530ND ND 72440530ND ND USOngPI 23057 2028427 80 33541 570 28341 960 5242745 18498 U SOng
356. nes 2 Status Success Figure 7 45 Accessing Help for GeXP Quant Tool 11 If the quantitative analysis is completed without any error a Microsoft Excel file or workbook similar to the one shown in Figure 7 46 will be generated and displayed 31 0 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Gene Expression GeXP Quant Tool EAN SIRE GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC 1 GeXP Quant Tool version 1 0 3078 25088 2 Analysis generated an 06 15 2006 5 52 15 PM 3 Analysis created from standards file C oexP Quantitation Method Multiplex Standard Curve file Genes txt 4 Analysis created fram samples file C oexP Quantitation Method Multiplex Experimental Samples file Genes txt 5 b Normalization Genes t Gene 2 B Gene B g 10 Genes Curve Fit R2 11 Gena 1 1 0000 12 Gene 2 0 9995 13 Gene 3 1 0000 14 Gene 4 0 9992 15 Gene 5 0 9999 16 Gene 5 0 9997 17 Gene 7 0 9999 16 Gene 6 0 9955 19 Gene 3 0 9995 20 Gene A 0 9997 21 Gene B 0 9999 22 Gene C 0 9999 23 Gene 0 9919 24 Gene_E 0 9998 25 Gene F 0 9996 26 Gene G 0 9996 2 Gene H 3835 20 Gene 0 9996 24 Gene d 0 9999 M 4 k Hf Summar alal Figure 7 46 Summary Worksheet in the Excel Workbook 12 All genes and curve fit R2 values for the standard curves are listed in the Summary worksheet Refer to Figure 7 46 As
357. ng Conditions slseeese RR RRRRRRRRRRIS 41 Printing the Plate Report or Specifying Sample Plate Print Options 42 specifying Sample Plate Export Options 0 000 00 43 EXDOLDS DIOS eate ac Ren espe oe ase Fa eo te hee he eee ee eee 43 Export Options Sequencing ResultS 0 0 0 ccc ce RR RR 44 Importing Sample Plate Information from TXT Files 00 0 000 00 c IRR 44 Exporting Sample Plate Dala 4 me pbRER eR ERR EDULIRET awedaadaweedaade ERE 46 LOCKING ad OOD IG Pali cuoco oae EROR e DUREE E ODER a AOE D rend aane aides 46 Viewing the Summary esc eec Sa cetus wrasse arta man cte Dee reet aot eir aad I ES pid 46 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use xi PN B40154AC Section 3 Run Module ee RI ee 47 3 1 RUN Module OVelIVIBW s 2s secesuls eese ebrei as peer EM er bsec EE ELE 47 Using the Run Control Main Window s sse RR RR 40 Men Bak ODEHOIS s eodeni eee cere Pe b eie due be du etd deiiut suns 49 KOODI CON scnr cota hime UN A SIUE UU ey Oe M E E EIL 55 Salus MONOT e etude tesa eth ado dob Deep Gee aa a dabat Ox aaa i 60 Window SelecHon TdDS sabes ure Eu etc o tren bb endete atrae ade deed 62 3 2 Using the Run Module tetas sx et atten oak eee aoe der rint eani Oded ure aro 67 STAR eie BU EI ERECTO TT IT ITERUM 67 Defining System Preferences sss RRRRRRRRRRRRRIRRR IIR Rr 68 RUNNING Sample Platas seriearen
358. ng the Consensus for Specific Attributes To search the consensus for specific attributes l Select the Consensus Attribute Search radio button Select the attributes that you want to define as the search criteria Click on the forward gt gt or reverse lt lt button to search the consensus in the specified direction NOTE You may also press the Ctrl and the arrow lt keys to perform the search When the search finds consensus bases that conform to the search criteria it highlights them Searching the Consensus for Specific Bases To search for a specific base or contiguous multiple bases 1 Select the Consensus Text Search radio button 2 Enter the bases in the text box 3 Specify the search criteria GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 185 PN B40154AC Sequence Investigator Module Sequence Investigator Procedures 186 e To search for the exact match for text select the Exact Match check box MJ Use the forward and back arrow buttons or press the Ctrl and arrow lt keys to search backwards and forwards through the base sequence for more text searches e To search for a base without requiring an exact match clear the Exact Match check box The search result includes all exact matches as well as all IUB codes with an overlapping base For example a search for the ambiguity code K not only results in the bases G or T but also result in any ambiguity code t
359. nge is 1000 0 to 1000 0 A value of 2 0 is the default value e insert start Sets the value of an insertion of a base in the sequence that does not exist in the alignment sequence The range is 1000 0 to 1000 0 A value of 4 0 is the default value e Insert extend Sets the value of a consecutive insertion of a base in the sequence that does not exist in the alignment sequence The range is 1000 0 to 1000 0 A value of 3 0 is the default value e Delete start Sets the value of a deletion of a base in the sequence that does not correspond to the alignment sequence The range is 1000 0 to 1000 0 A value of 4 0 is the default value e Delete extend Sets the value of a consecutive deletion of a base in the sequence that does not exist in the alignment sequence The range is 1000 0 to 1000 0 A value of 3 0 is the default value Alignment Controls To optimize the alignment to find matching substrings first then run the alignment algorithm only on the bases remaining outside the substrings reducing execution time and storage space select Find matching substrings 1 This check box is selected by default e o use only substrings with the highest score and ignore the rest as opposed to using every character from both strings to compute the similarity score select Find Local alignment v e o specify that overhanging bases on the template or sequence will not be counted in the alignment score select Left
360. ning Bases and Peaks To align the bases in the base sequence pane with the peaks in the analyzed data pane 164 Select File Open In the Open dialog box select the Results tab highlight the desired sequence results then click OK Click the Align Mode 4x icon to visually align the peak with the base call Click on the apex of the peak for which you want to view the alignment A hairline cursor is displayed through the apex of the peak to its corresponding base Click the Zoom Pan or Edit button to exit from the Align mode GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Sequence Analysis Using the Sequence Analysis Module Specifying the Base Call Location To specify the base call location l Open a sequence results file 2 Select Tools Bases on Top to toggle the bases from the top to the bottom of the analyzed data pane or vice versa Using Audio Enable To enable the audio feature 1 With a sequence results file open select Edit Audio Enable 2 Enter text into the base sequence pane to hear the letter bases announced as they are typed NOTE To enter text in the base sequence pane Edit mode must be enabled Using Audio Playback To enable the audio playback feature 1 With a sequence results file open highlight a series of base sequence text 2 Select Edit Audio Playback to hear the announcement of the highlighted base sequence text
361. nomeLab GeXP Human ReferenceP ex Kit Thermo Start Tag DNA Polymerase Description Includes reagents for 100 RT and PCR reactions e RT Buffer 5X e Reverse Transcriptase e PCR Buffer 5X e KAN RNA with RI e DNase RNase Free H50 e DNA Size Standard 400 e Mineral Oil e GenomeLab Sample Loading Solution Includes primers and control RNA for 100 RT and PCR reactions e RT Rev Primer Plex Human Reference Plex e PCR Fwd Primer Plex Human Reference Plex Control RNA Templates Human Reference P ex Includes Thermo Start Taq DNA polymerase and MgCl for 100 PCR reactions e hermo Start Taq DNA Polymerase e 25 mM MgCl GenomeLab Human STR A20100 Includes Human STR primer mixtures for 48 reactions Primer Set sample Loading Solution SLS 608082 sample Loading Solution SLS 6 0 mL Buffer Plates 609844 Box Package of 100 flat bottom polystyrene plates non sterile without lids Required for use as the CE system separation buffer plate sample Plates 609801 Box Package of 25 V bottom thermal cycler compatible polypropylene plates with 200 uL volume capacity Required for use as the CE system sample plate 25 Plates Box 382 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Maintenance and Diagnostics Consumable Items List The following table identifies the materials that are required for either Sequence Analysis or Fragment Analysis but do not come
362. nt 10 From the Remove Capillary Array dialog box Figure 3 40 select the Replace Capillary Array option and click OK GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 89 PN B40154AC Run Module Using Direct Control 901602 Al Figure 3 44 Removing Replacing the Electrode Block 2 Electrode Block 1 Guide Block Pins CAUTION Always grip the capillary array fitting near the end during removal or installation of the tip cap to prevent flexing and possible breakage of the capillary array as shown below Figure 3 45 900654L AI GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC 90 Run Module Using Direct Control Figure 3 45 Array Fitting 11 12 13 While holding the Array Fitting tab of the new capillary array align the Array Fitting Figure 3 43 with the manifold opening and guide pins Push the fitting into the manifold until it is completely seated against the bases of the Guide Pins Make sure that the fitting tab is placed downward when inserting the capillary array into its slot While holding the Electrode Block tab align the Electrode Block Figure 3 44 with the guide block pins and gently push it in until resistance is met The resistance is from the spring loaded contacts When installing the capillary array carefully route the capillaries through the hole in the Plenum Assembly Figure 3 46 and straight across
363. nts in locus Human Ref Identify Alleles End Operation AllelelD succeeded Total Results 19 Analyzed 19 Passed 19 Failed 0 4 r Summary v Show Excluded Figure 7 15 Re Analysis Is Complete When the re analysis is complete Figure 7 15 the Status column will indicate pass or fail for each sample data selected for re analysis 23 Click the Finish button to return to the Result Set View window When reanalysis is completed the initial selected results are removed from the study and replaced with the re analyzed results To view the reanalyzed sample data highlight a sample data file in the sample list and double click it to open the data file Refer to Figure 7 16 Results Exchasion Fiker Set Resul Fite Set 3 a i dai a EA Ipai Mew Resul Fikes S LSTD RU DAUNE Mae 17 4505 H pate Locust ndo ected Dela disexP rajyes Patatas iD Mane E L 5TD 06 04 75 2014 174505 H pars Lons nfo modified Def eutiieXPunalpric sarees Y lt select L STD HOS 2014 17 4502 H pass Loos nip moiied Delia a PAradera Patarneheis LTO 7 2014 17 4502 H part Lona no moddwd Delphia Pinapa Pataretere e LSTD Ho3 hc 4 25 2014 17 45 07 H pars Lone nio modified DelaukGa e Panaypa ganea 04 25 2014 174502 H pars Lona nis maiot Danit e P ralgiuPatermeter T T r o modded zT Hr nm ied Datat Pirna pepr m FANA 17 45 0
364. nu Click the View menu to display its drop down menu as shown in the following example V jeu Toolbars w Status Bar w Analvzed Data w Base Sequence Raw Data Current Volkage Alignment Alignment Accuracy Quality Parameters Trimming Report Analysis Log Parameters Used bo Compute Sequence Run Lag Working Database NOTE A VY next to an option indicates that the option is enabled The following table describes the Sequence Analysis module s View menu options Table 4 4 View Menu Sequence Analysis Module Option Description Toolbars Used to select which toolbars to display Select 1 the options that identify the toolbars you want displayed To hide a toolbar clear its check box See Toolbar Icons on page 114 otatus Bar Toggles between displaying or not displaying the status bar Analyzed Data Base Sequence Displays the data that has been analyzed for the active sample Displays a text view of the bases from the analyzed data for the active sample Raw Data Displays the raw data for the active sample Current Displays the current data for the active sample Voltage Displays voltage data for the active sample Alignment Displays the alignment data for the active sample Alignment Displays the alignment accuracy data for the active sample Accuracy Quality shows a graphical representation of the quality values for the active sample Parameters Trimming Toggles the trimming report pane on or
365. o determine whether to display by size or by time If you do not specify the XScaleType attribute it defaults to Default GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 250 PN B40154AC Fragment Analysis Module Reporting Results In the DisplayOptions section of the alternative text box enter by size or time as follows DisplayOptions XScaleType BySize gt OR lt DisplayOptions XScaleType ByTime X Axis X axis values specify either the size or the time depending on the XScaleType If either or both are not specified they take on the minimum and maximum values from Unzoom all graph In the DisplayOptions section of the alternative text box enter minimum and maximum values as follows DisplayOptions XScaleType BySize MinX 100 MaxXz 300 Y Axis In the DisplayOptions section of the alternative text box enter minimum and maximum values as follows DisplayOptions XScaleType BySize MinX 100 MaxXz 300 MinY 0 MaxY 10000 gt If you do not specify either or both MinY and MaxY they take on the minimum and maximum values from Unzoom all graph Pane Count or the Pane Width You may specify either PaneCount or PaneWidth e If you specify PaneCount it represents the number of panes in which to break the graph If you do not specify either PaneCount or PaneWidth the system uses the default PaneCount of 1 PaneCount is an integer e Ifyou specify PaneWidth it
366. oceed with the run 12 Specify the sample sets to run 13 Select Replace Gel Cartridge to replace the gel cartridge before the run if necessary GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Run Module Using the Run Module Gel Volume Notification If you attempt any operation that requires gel and there is not enough gel in the cartridge to perform the operation a warning message appears For example if you attempt to perform a capillary gel fill when the cartridge does not have enough gel the system displays the message shown in Figure 3 22 Run Control Fa uj There is not enough gel to perform capillary Fill The gel cartridge reserves 1 0 ml of gel for system operation margin Figure 3 22 Gel Warning Dialog Box If you attempt to run a sample plate and the gel cartridge does not have enough gel to process any sample sets in that plate the system displays the message shown in Figure 3 23 Sample Plate Gel Usage Confirmation There iz only enough gel in the system ta fully process the first of the 3 requested sample sets Do you want to continue Figure 3 23 Gel Usage Confirmation Dialog Box To end the run and return to the Run main window click Abort Pausing a Sample Plate Run To pause the currently executing sample plate click the Pause ul icon The system pauses at the next executable step of the sample plate e To resume the run click the Pau
367. odule Overview Edit Menu Click the Edit menu to display its drop down menu as shown in the following example Edit Undo Reda faut Copy Paste Apply Quality based Trimming Apply Sequence based Trimming w Audio Enable Audio Playback Ctrl Z Ctrl Er Ckrl2 i Er pv The following table describes the Sequence Analysis module Edit menu options Table 4 3 Edit Menu Sequence Analysis Module Option Undo Redo Cut Copy Paste Description Cancels the last action performed Reverses the last undo action Cuts selected bases and copies them to the clipboard To activate inactivate this function select Tools Edit See Tools Menu on page 110 Copies selected bases to the clipboard Inserts one or more copied or cut bases from the clipboard to the selected text position To activate inactivate this function select Tools Edit See Tools Menu on page 110 Apply Quality based Trimming Commits to the quality based trimming Apply Sequence based Trimming Audio Enable Audio Playback 108 Commits to the sequence based trimming Toggles between enabling or disabling audio If enabled while in Edit mode the system audibly announces each letter as you type a base letter Audibly announces a series of selected base sequence text GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Sequence Analysis Sequence Analysis Module Overview View Me
368. of the windows with compressed gas Texwipe Microduster III PN TX2511 10 Using a water moistened swab Texwipe Swab PN TX754B gently wipe the detection window by stroking in one direction only as shown in Figure 9 4 342 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Maintenance and Diagnostics Routine Maintenance VE Lf Figure 9 4 Cleaning the Detection Window 1 Detection Window 3 Array Fitting 2 Stroke in one direction ONLY 11 With a new water moistened swab repeat wiping on the other side of the window 12 With a dry swab gently wipe the windows to remove excess water again repeating on the backside with a new dry swab 13 Blow compressed gas on the windows to remove all excess water CAUTION Make sure not to invert the compressed gas bottle otherwise propellant will contaminate the capillary windows 14 If dried gel or other debris remains on the window repeat this procedure GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 343 PN B40154AC Maintenance and Diagnostics Routine Maintenance 344 15 In the Remove Capillary dialog box Figure 9 5 select the Clean Capillaries radio Remove Capillary Array Fa e You may now open sample capillaries Figure 9 5 Remove Capillary Array Dialog Box 16 17 18 19 button and click OK access doors to change capillaries To replace the capillary arr
369. off Report Parameters Displays the sequence analysis parameters used to produce the analyzed data This Used to dialog box provides the same information displayed when editing these parameters Compute however the fields in this dialog box are read only and are not editable This item is sequence not available for data that has not yet been analyzed For parameter descriptions see GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use Editing Sequence Analysis Parameters on page 124 or click Help when using the dialog box 109 Sequence Analysis Sequence Analysis Module Overview 110 Table 4 4 View Menu Sequence Analysis Module Run Log Working Option Description Displays the messages received from the instrument during the sample run Displays the name of the database in use Database Tools Menu Click the Tools menu to display its drop down menu as shown in the following example Tools wf 4 Zoom Pan Align Edit Unzoorn Unzoom All Autoscale Base Spacing id Base Synch Bases on Top Compare Gompare Synch lign Gompare views Display Options Heterozygotes Display Color Option Zoom Pan Align Edit Unzoom Unzoom All Autoscale Base Spacing Base Synch Bases on Top Compare NOTE A VY next to an option indicates that the option is enabled The following table describes the Sequence Analysis modules Tools menu options Table 4 5 Tools Menu
370. oints zoom In zoom Cue Unzoor Full Screen View A blu Ib NL Figure 6 22 Copying a Trace to the Clipboard 232 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Fragment Analysis Module Using the SNP Locus Tag Editor The system copies subtitles with the image as shown in Figure 6 23 To paste the image in other software use the Paste command DATS 101 D4 G01 06042512Z6 100000 90000 80000 70000 60000 50000 40000 30000 20000 10000 b ll Dye Signal Figure 6 23 Trace with Labels Stacked Graph The Stacked Graph function aligns the electropherograms of selected results by size or time Zooming and scrolling on the x axis is synchronous between all plots selected while the y axis of each plot selected is independently scaled based on the available data To access this function right click the selected results from any of the results or fragment lists and select Show Stacked Graph Overlay Graph The Overlay Graph function superimposes the electropherograms of selected results on a single x y plot To access the Overlay Graph right click the selected results from any of the results or fragment lists and select Show Overlay Graph This function has two different modes The default mode Zoom allows you to draw a rectangular box around a selected area to zoom into The second mode Subset Selection allows you to select a group of peaks and add them to a Stac
371. ol Cover 11 Gel Pump Gel Cartridge Access Cover 6 Rubber Latches GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Run Module Using Direct Control Loading the Sample Plate and Buffer Plate For Dual Rail System 1 Select Direct Control Access Plates from the menu Access Plates x Start IF vau are going to load new plates please prepare your plates before clicking on Start You have 15 minutes to change plates once wou click on Start This time limit is critical sa that the capillaries are nat adversely affected by prolonged exposure to air Help Figure 3 28 Access Plates Dialog Box 2 Click Start The Capillaries Exposed dialog opens as shown below Capillaries Exposed x PLEASE WAIT Gag Do not open sample door Capillaries exposed to air Load i Cancel Time Remaining Alarm Off min sec ua 53 Help m Left Plate Right Plate Plate Loaded Immerse Capillaries requires wetting tray on the left side Plate Loaded Immerse Capillaries requires wetting tray on the right side Capillaries E posed Capillaries exposed to air You may now open the sample door and load plates H Time Remaining min sec fis sa Left Plate Cancel Alarm Off Help Plate Loaded Immerse Capillaries requires wetting tray on the left s
372. olor assigned to Dye 73 in the fragment data pane and D3 is the green default name D4 Blue is the default color assigned to Dye 4 in the fragment data pane and D4 is the default blue name Table 6 11 EgramBand Toolbar IMPORTANT Portions of this toolbar are only available when viewing Sample Results in Single Result stacked Graph and Overlay Graph View modes Displaying the selected sample results in one of these modes will automatically display the appropriate EgramBand components for the selected display mode Table 6 12 EgramBand Y Axis Scale the Y axis Y Height 52215 45 EgramBand X Axis Scale the X axis Width 96 90042 EgramBand Zoom tool Allows you to zoom in ona w selected area of the Overlay Graph electropherogram display This option is the default selection when in Overlay Graph mode EgramBand Subset Selection tool Allows you to select a subset of data to be displayed in Stacked Graph mode This option is only available when in Overlay Graph mode GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 197 PN B40154AC Fragment Analysis Module Fragment Analysis Procedures 6 2 Fragment Analysis Procedures To open the Fragment Analysis module from the Main Menu click the Fragment Analysis icon Fragment Analysis New Study Eile View Results Analysis Reports Window Help o suelos ov Bil o2 I os Mill
373. on channels The system calculates these values during each analysis and uses them to transform the four electropherogram channels to dye signal traces for each of the dye labels present in the sample When unable to calculate a dye spectrum from the sample the analysis process terminates unless system dye spectra are available The Dye Spectra options allow you to select an existing set of dye spectra to use instead of estimating the dye spectra from each sample NOTE This option can shorten the analysis time by up to 50 The system stores only one set of system spectra used automatically when the system cannot estimate one or more of the needed spectra from the sample data Select one of these Dye Spectra options e Use calculated dye spectra This default setting specifies using the set of dye spectra obtained from the sample data e Use system dye spectra When you select this option you must also select each Dye check box for the dye traces you want generated This setting applies the system dye spectra to the data instead of estimating the dye spectra from the current sample being run NOTE The system dye spectra is established when running the Fragment Analysis Test Sample during installation when viewing the Dye Matrices window for a sample result in which spectra for all four dye labels were estimated After you run a Fragment Analysis Test Sample the system displays a Spectral Matrix of this sample in the single result vie
374. on the Main Menu and describes the module that opens when you click the corresponding shortcut icon Table 1 3 Software Module Descriptions Icon Module Description Sample Setup Module Create save and modify sample plates Use sample plates to assign methods to control sample sets and determine the sequence of methods used to produce data Run Module Run sample plates and control individual functions of the instrument Sequence Analysis Module View analyze compare manipulate and print base sequence data produced by sample runs Sequence Investigator Module Compare sequences and create a consensus to compare against a reference Fragment Analysis Module View analyze compare manipulate and print fragment data produced by sample runs Data Manager Module Modify and print database files Exit Closes the CE system software GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Getting Started System Overview Main Menu Collapse Options After opening the Main Menu you can set its collapse features using the pop up menu To do this right click the Main Menu s title bar and select your option from the pop up menu as shown in the following illustration Collapse to Toolbar Move Minimize Close Alt F4 Always Collapse To Toolbar w Always Collapse To Taskbar Figure 1 12 Main Menu Window Pop Up Menu The following table describes the collapse options Table 1 4
375. ons screen displaying the file path to the specified CEQ file in the Export results as field 5 d desired modify the fields that apply to the CEQ file a Select Remove CEQ Tracking Suffix to automatically remove the plate position coordinates A01 BOI etc as well as the time date stamp from the sample name These are generated by the CE system software b Select Resolve Filename Conflicts to enable the system to increment the sample names on export if it encounters samples with the matching names 6 Click Finish to export the Result Data and the Result Output Exporting Fragment Lists or Genotypes from a Study This feature allows you to export the opened Study fragment list or genotype data The pedigree and genotype data included in the export come from the results included in the opened Study To export the properties with a fragment result l Open the Fragment Analysis module and open a Study GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 265 PN B40154AC Fragment Analysis Module Exporting Results 2 Select File Export Fragment Genotypes The Export Fragments Genotypes As window opens as shown in the following example Export Fragments Genotypes As 21 xi Save in c Export e 5 ex Ee Fe EC TEST My Recent Documents Desktop My Documents My Computer SECUN Filename Yew Study Save as type csv Comma delimited csv Cancel Fi
376. ons window provides the following fields and options Export result as Displays the selected export file including its file path file name and extension which identifies the file format This is a read only field To change this selection click Save As and enter the required details to save the file using the application s format extension For details see Text File Format on page 264 or CEQ File Format on page 265 Header Select this option to include general information regarding the sample and run conditions with the exported results Raw Data Select this option to include raw data with the exported results Result Data Select this option to include dye traces and data points with the exported results Result Output Select this option to include a fragment list with the exported results Remove CEQ Tracking Suffix Select this option to remove the sample plate and date from the exported file name Resolve Filename Conflicts Select this option to automatically append a unique sequence number to exported files of the same name 6 Click Finish to complete the export application GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC 263 Fragment Analysis Module Exporting Results Text File Format You can export the results file in a text file format The data in this file are tab delimited and the export format has the extension txt Export HEI Sample Elements
377. open sequence result View the name of the parameter set used as well as all of the parameters and color calibration used to perform the analysis Select File Properties Analysis Properties General Hote Property Set Method j Analysis Alignment Consumables Analysis Parameter Set OC Method for Sequence Analysis M Threshold 0 00 Analysis Start Time 0 0 minutes Analysis End Time 0 0 minutes PCR Product Ma Color Calibration D efaultCalarCalibratian Threshold 40 00 Delay 0 8 minutes Signal to Moise 00 Minimum Duration 5 0 minutes Pre peak Reduction Mo Detect Heterazygotes Mo Base Range Before Last Called Base Average Peak Spacing Height R atio Sensitivity Automatic Alignment es Figure 4 30 Analysis Tab Properties Dialog Box 1 50 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Sequence Analysis Using the Sequence Analysis Module Alignment Tab View the alignment template information and the alignment parameters used to create the alignment of the currently open result Select File Properties Alignment Properties E General Note Property Set Method Analysis j Alignment E Consumables Alignment Template Template Hame puc1 amp 8dia Cutoff Accuracy 96 0 x Allowed N 2 0 Alignment Parameters Match Score 1 0 Mismatch Score 2 Insert Start T Insert Extend 3 Delete Start T Delete Extend 3 0
378. or Gene 1 are displayed on the Gene 1 worksheet On the upper left corner data for the standard curve is listed Note that the GeXP Quant Tool can accommodate up to 10 replicates for the same sample or the same standard concentration On the upper right area the curve fitting information is provided From the coefficient values the standard curve equation can be deduced as y Coeff3 x 3 Coeff2 x 2 Coeffl1 x Coeff0 In the middle of each gene worksheet in the Samples section the relative signal level of each sample replicate imported from the sample file is displayed Also provided here are the statistics mean values standard deviation and 96CVs Right below the Samples section is the GEQs section listing the GEQ values derived from the sample replicates interpolated from the standard curve Coefficients Standards Concentration ng Mean Std Dev CV Replicate 1 Replicate 2 Replicate 3 Replic Replicate 10 F quare d order polynomia 1 562 0079 0012 152 0 066 0 095 0 076 3 125 0 154 0018 118 0 134 0 150 0 178 08549155 0692802723 1 230988785 amp N A 625 0376 0014 36 0 364 0 369 0 395 R 0999955157 1 262695819 MWA N A 125 0672 003 48 0 704 0 639 44598 35544 6 V A VA 25 1095 0086 79 1 012 1 214 1 060 2133229516 9566404387 VA N A 50 1696 004 27 1 704 1 748 1 635 100 2545 0064 25 2 552 2 619 2 463 200 3872 0084 22 3914 3 946 3 755 400 5664 0127 22 5615 5 539 5 839 Concentra
379. or in 100 A quality value of 30 means an error rate of 1 error in 1 000 A quality value of 40 means an error rate of 1 error in 10 000 etc Normally PHRED would export these quality values into PHRAP In the case of exporting from the CE system we bypass PHRED and export directly into PHRAP GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 331 PN B40154AC Database Management Data Manager Procedures Table 8 9 Data Manager Export Options Format CEQ cq Remove CEQ Tracking Suffix Resolve Filename Conflicts 332 Description Selecting the CEQ format the format native to our database exports sample data sequence or fragment results sample plate results sequence or fragment analysis parameters sample plates methods locus tags fragment data only standards fragment data only and optical scan data The sample elements are automatically selected in the Export dialog box which would export all of the associated information listed above This format essentially takes a snapshot of the file and can retain all of the information belonging to that file This format is available only when importing data into the Data Manager This format can also be used when exporting data from the Sequence and the Fragment Analysis modules and the Data Manager When exporting as CEQ data the various data types are exported to files with the following extensions sequence Analysis ParameterCQA Sequence Inv
380. or lot number and adjust the hours to properly reflect the hours this cartridge has been on the instrument d Click Done on the Install Gel Cartridge dialog NOTE Always note the lot number and the hours on the instrument for a gel cartridge if you are planning to use it for more than one session The lot number is an alphanumeric text box for your own identification purposes Install Gel Cartridge Ea Gel Cartridge Fart Number 391438 Lot Number Cancel Gel Name LPa Help Date Installed 04 27 2006 Time Installed f 71500 C New Used Hours on Instrument 7 Figure 9 42 Install Gel Cartridge Dialog Box 12 Dispose of the used tissue and spent gel cartridge in accordance with the procedure See Biological Waste Disposal on page 376 370 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Maintenance and Diagnostics Direct Control and Replenishment Removing and Replacing a Gel Cartridge Gel Pump Plug For Single Rail System CAUTION Care must be exercised when installing removing a gel cartridge due to the viscosity of the gel mixture NOTE This procedure assumes that an expended gel cartridge is being replaced with a fresh gel cartridge or that a used gel cartridge is being removed for storage purposes and being replaced with the gel pump plug 1 Select Replenish Release Gel Cartridge When the system is ready to release the gel cartridge the Release Gel Ca
381. orts Ready A Figure 6 37 New Report Dialog Box All of the reporting features available in the Fragment Analysis module are located under the Reports tab of the Study Explorer In addition you can generate a new report using the Reports menu located on the menu bar The New Report window allows you to select the type of report you would like to generate from a list of available report templates see Using Report Templates on page 258 and saved data You can access the New Report window from either the Report menu or the Study Explorer To create a New Report from the Report menu Select Report New Report to display the New Report window 2 Select the type of report you would like to generate from the Template drop down list The selections available depend on the data contained in the open Study 3 Select the saved data from which you want to generate a report from the Context drop down menu 4 Click OK to display the new report containing the selected information To create a New Report from the Study Explorer 1 Select the Reports tab available at the bottom of the Study Explorer frame of the window GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 257 PN B40154AC Fragment Analysis Module Reporting Results 2 Right click to highlight the type of report you would like to generate from the list of those available in the Reports tab and select New The New Report window opens displaying
382. orward universal tag sequence at the 5 end of gene specific forward primer sequence Save the changes to the Microsoft Excel worksheet NOTE Contact AB SCIEX Technical Support for sequences of universal tags GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 215 PN B40154AC Gene Expression Multiplex Primer Design using NCBI Primer BLAST 2 6 Evaluating Primer and Amplicon Sequences using NCBI BLAST Searches l Perform BLAST with each primer sequence to ensure it does not have significant homology to amplicon sequences for other genes in the multiplex 2 Ifa primer has significant homology to a region of an amplicon of another gene in the multiplex re design the primer 3 Use NCBI BLAST with species specific searches to determine if the amplicon for each primer set contains homologous regions and if so where those regions lie BLASTing against the RefRNA database is helpful for homology e If the homologous regions are within the reverse primer sequence redesign the primer to target a region of low homology particularly at the 3 end of the primer e If there is extensive homology between two genes within the same multiplex be sure to design primers to unique regions of each gene in order to prevent cross amplification 4 If primers were designed using primer 3 not using NCBI Primer BLAST evaluate primer and amplicon sequences by performing the following Examine each primer for nucleo
383. oscale separation expertise from Beckman Coulter Life Sciences to create the business unit known as SCIEX Separations The goal to create a new generation of separation systems and techniques that incorporate nano LC micro LC analytical flow LC CE and MS in new and more innovative ways Our advances in these areas will lead to complementary and orthogonal solutions that will help drive breakthroughs by enabling scientists to address a wider range of analytical challenges SCIEX Separations Be part of it For contact details and additional information please visit http www sciex com ce B40154AC Ii Revision History Revision History Third Revision B40154AC November 2014 Change made to Table 4 in Section 9 4 Second Revision B40154AB August 2014 AB SCIEX branding boiler copy added to Front Cover and Back page AB SCIEX consolidation with Beckman Coulter insert added for SCIEX Separations Beckman Coulter changed to AB SCIEX in some instances except for Cover Copyright SCIEX Separations insert and Revision History pages Numerous changes made throughout the manual due to the GeXP software being updated to work with Windows 7 B40154AC Safety Information Safety Information This section provides safety information and instructions for the hardware and accessories of the system It includes the following topics e Safety Symbols on page vi e Chemical and Biological Safety on page vii e Electrical Safet
384. ottom of the screen displaying the following details Result Name Original Sequence Length e Length after Quality based Trimming e Vector Other Subsequence Name e First Base Trimmed ast Base Trimmed e Enabled e Length after Sequence based Trimming e Exported From the Trimming Report pane you can format the grid print the grid data and export the data as comma separated csv or tab delimited txt text files To access these options right click over the Trimming Report then select the desired option from the pop up menu The following table describes these options Table 4 25 Trimming Report Right Click Menu Option Description Print Grid Data Select this option to print the entire grid as it is represented on the screen Export Grid Data Select this option to save the grid data as a comma separated csv or tab delimited txt text file Format Grid Select this option to open a cascading menu with formatting options as shown in the following example Print Grid Data Export Grid Data Freeze Rows Unreeze Rows Freeze Golunmns UnFreeze Columns Resize Rows Resize Columns Hide Rows Hide Cals Unbide A Styles Use this menu to customize the look of the data grid If you hide rows or columns using this menu the Print Grid Data option omits them however this does not affect the Exported Grid Data this exports all data GenomeLab Genetic Analysis System User
385. oves the sequence trace shown in the top trace pane and exchanges its position with the bottom trace GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Sequence Investigator Module Sequence Investigator Module Overview View Menu Click the View menu to display its drop down menu as shown in the following example View Toolbars w Status Bar LInzeom All History Ckri H Base Numbering CEriz 5hifE2 B w Codon Numbering CEriz 5hifE2 O w Sequences CEri 5hifE4 5 v Reference Amino Acid Translation Ctrl Shift R v Consensus Amina Acid Translation CErla ShifE C wv Differences Ckri Shift D Show Colors working Database Cri w NOTE A VY next to an option indicates that the option is enabled Use the View menu to display data as desired The following table describes the Sequence Investigator module s View menu options Table 5 4 View Menu Sequence Investigator Module Option Toolbars otatus Bar Unzoom All History Base Numbering Codon Numbering Sequences Reference Amino Acid Translation Consensus Amino Acid Translation Differences Show Colors Working Database Description select the toolbars that will be displayed Selecting one of these options toggles between showing and hiding the corresponding toolbar See Toolbar Icons on page 177 Toggles between showing and hiding the status bar Shows each sequence in its entirety Opens the history log
386. ow opens Batch Analysis3 oj Xx f Batch 04724706 16 34 41 Start Analysis 04 24 06 16 34 45 Sequence Test A03 06042416KN Completed Result stored 04 24 06 16 34 49 Sequence Test B03 065042416K0 Completed Result stored 04 24 06 16 34 53 Sequence Test C03 065042416KQ Completed Result stored 04 24 06 16 34 57 Sequence Test D03_06042416KR Completed Result stored 04 24 06 16 35 01 Sequence Test EO3 06042416KS Completed Result stored 04 24 06 16 35 05 Sequence Test F03_06042416KU Completed Result stored 04 24 06 16 35 09 Sequence Test GO03 06042416KV Completed Result stored 04 24 06 16 35 12 Sequence Test H03 060424165KX Completed Result stored 04 24 06 16 35 12 Analysis Completed 04 24 06 16 35 11 Analyzed Data Computation Completed 04 24 06 16 35 11 Base Sequence Computation Start 04 24 06 16 35 11 Base Sequence Compute Base Number Curve 04 24 06 16 35 12 Base Sequence Convert X Axis to Base Numbers 04 24 06 16 35 12 Base Sequence Compute Initial Base Sequence 04 24 06 16 35 12 Base Sequence Compute Final Base Sequence 04 24 06 16 35 12 Base Sequence Compute Initial Confidence Values 04 24 06 16 35 12 Base Sequence Refine Multiplets 04 24 06 16 35 12 Base Sequence Compute Final Confidence Values Rl 04 24 06 16 35 12 Base Sequence Perform Probability Analysis 4s Sequence Test 403_06042416KN i2 Sequence Test B03 06042416KO 3 Sequence Test C03 06042416KQ Sequence Test D03_06042416KR
387. own in the following example File Mew Ctrl M Open ctio Close Save Chri4 5 Save As Ctri 4 Export Preferences Ctrl F Properties Report Format Print Preview Print Ctrl F Print Desktop 0 CACEQ SystemiResults Investigate cgc Exit Use the File menu to create open save export set preferences view properties and print a document The following table describes the Sequence Investigator module s File menu options Table 5 2 File Menu Sequence Investigator Module Option Description New Prompts for a reference file from a Windows folder or disk and then prompts for one or two sequence results from the current working database Open Opens an existing compared sequence result Close Closes the document Save Saves the active document to a Windows folder Save As Save the current document to a new name and or folder Export Exports the current document as a text txt or a protein file pro GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 1 73 PN B40154AC Sequence Investigator Module Sequence Investigator Module Overview 174 Table 5 2 File Menu Sequence Investigator Module Option Preferences Properties Report Format Print Preview Print Print Desktop Recent Objects Exit Edit Menu Description sets the preferences for the Sequence Investigator Displays the properties of the current document Set the format options used to print reports and adjust
388. ox displays the GO message in green text At this time it is safe to open the sample access door Leave this dialog box open Tou may now open the sample access door and empty the waste bottle Figure 9 8 Empty Waste Bottle Dialog Box Go po Xu coim ES 10 11 Change the waste bottle as described in the following steps Remove the cap from the new empty waste bottle Open the sample access cover Figure 9 1 and lift to the vertical locking position With the gel waste bottle 80 90 full remove the cap and pull the bottle out of the instrument Place the cap from the new bottle over the full waste bottle and secure Thread the new bottle onto the cap attached to the instrument and set the bottle into position Close the sample access cover Dispose of the full waste bottle according to procedures found in Disposal of the Gel Waste Bottle on page 379 In the Empty Waste Bottle dialog box click Done Replacing the Gel Waste Bottle For Single Rail System NOTE This procedure assumes that you are replacing a used full waste bottle with an empty waste bottle Replacing the gel waste bottle on the single rail system is performed through the Replenish Replace Wetting Tray function Use the Run module to ensure the instrument is ready and follow these procedures to change the bottle ov bue 2e Remove the cap from the new empty waste bottle Select Replenish Replace Wetting Tray
389. p plug into the barrel and lock it into position by aligning the cartridge wings with the cartridge holder and pushing in 8 Push the cartridge locking lever towards the back of the instrument approximately a 90 angle into its locked position 9 Close the Gel Pump Gel Cartridge Access Cover 10 In the Remove Gel Cartridge dialog box Figure 9 45 Click Install Cartridge to indicate that a gel cartridge was installed OR e Click Install Plug to indicate that the gel pump plug or empty cartridge was installed GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Maintenance and Diagnostics Direct Control and Replenishment Y ou may now open the gel pump gel cartridge access cover and remove the gel Install Cartridge cartridge Cancel If you are not going to install a working gel cartridge please insert the gel pump plug or Help clean empty cartridge to prevent any remaining gel from drying in the system Then click on Install Plug Please check the waste bottle to ensure that the bottle will not overflow in future runs Figure 9 45 Remove Gel Cartridge Dialog Box 11 IfInstall Plug was selected in step 10 proceed to step 12 If Install Cartridge was selected in step 10 use the Install Gel Cartridge dialog box Figure 9 46 to enter the following information a If you are installing a new gel cartridge click the Set to New button select the part numb
390. party analysis package accepts the data transferred using a command line and that it is compatible with the file types provided by the CE system software before attempting to perform this procedure To export sequence data to a third party analysis package Select File Open 2 In the Open dialog box select the appropriate tab highlight the desired data then click OK 3 Select Analysis Third Party Analysis Setup In the Third Party Analysis Setup dialog box a Specify the path and executable file of the third party analysis package b Select the appropriate Export Data Format radio button c Click OK 5 Select Analysis Third Party Analysis In the Export dialog box enter the filename then click OK The system exports the data and launches the third party package displaying the exported data GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Sequence Investigator Module Sequence Investigator Module Overview sequence Investigator Module This chapter provides an overview of the Sequence Investigator module including its menu options toolbars and dialog boxes It also shows you how to use this module to investigate and compare sequence analysis results 5 1 Sequence Investigator Module Overview Compare sequences to known reference sequences For each comparison you can use one or two new sequence results in either orientation to form a consensus for the comparison The sof
391. peak for one allele there may be two that represent the same allele spaced one nucleotide apart The A Detection area of the window allows you to specify how the system will differentiate between the true allele and the A allele product NOTE You can select more than one of these check boxes at a time Read through the following descriptions or refer to the tables below to see how these selections affect A Detection and the allele peak assignments e Apparent size includes A Selecting this check box indicates that the sizes entered into the Apparent Size column of the allele list were for the A fragments The parameter affects where the system looks for peaks when identifying alleles e Detect A Selecting or clearing this check box determines When Detect A is checked the system identifies in the fragment list either the A or A peaks The system then identifies one of them as the true allele based on your selection in the Use A peak to call allele check box It designates the other peak as either A or A accordingly e When Detect A is not checked the system identifies one of the two alleles as the true allele based on the Use A peak to call allele check box It considers other peaks on the fragment list as unknown alleles e Use A peak to call Allele Select this check box if the A form is expected to be the higher peak and leave it unchecked if the A form is expected to be the higher peak GenomeLab Genetic A
392. peak nearby meets the Spacing and Height Ratio criteria specified If one or more nearby peaks meet the criteria the system merges their identities with the called base to produce an ambiguity code NOTE If you specify the Detect Heterozygote option N s are not called The N Threshold text box is grayed out to disable calling N s Of Average Peak Enter a value to determine how far to look on either side of each called base to opacing look for other peaks This value is centered over the peak for the called base for instance a value of 50 looks 25 on either side of the peak for secondary peaks The range is 0 100 Height Ratio Enter the height ratio of the secondary peak relative to called base peak The range is 0 1009 Sensitivity Enter the value that specifies the minimum sharpness of detected secondary peaks The higher the value the higher the sensitivity used to detect smaller less visually defined peaks The range is 0 00 to 1 00 Range Enter the range in the called sequence where the system looks for heterozygotes within a called sequence Also provide the number of bases prior to the last called base you want heterozygote detection to end in the case of short PCR samples that may vary in length The range is 0 length of the sequence If a value is outside of an expected range a message box opens requesting you to enter a valid value The system uses the IUB ambiguity codes shown in the following table to represent het
393. pillaries expased to air l B Cancel Time Remaining Alarm OFF min SEC a a7 Heb Figure 3 33 Capillaries Exposed Dialog 3 Open the Sample Access Cover Figure 3 27 and lift it to the vertical locking position e If Sample Plate was selected skip to Loading the Sample Plate If Buffer Plate was selected skip to Loading the Buffer Plate and Evaporation Cover Loading the Sample Plate 1 Make sure the Wetting Station is installed or perform the following procedure Installing the Wetting Tray on page 347 and then return here 2 Align the Sample Plate Guide Pin with the notched corner of the sample plate and gently lower the plate into position Figure 3 34 901600L Al Figure 3 34 Loading the Sample Plate 1 Sample Plate 4 Sample Plate Notched Edge 2 Wetting Tray Retainers 5 ALIGN together 3 Sample Plate Holder 6 Sample Plate Guide Pin 80 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Run Module Using Direct Control 3 When finished positioning the plate close the Sample Access Cover and then click the Load button of the Capillaries Exposed dialog box Figure 3 35 CAUTION The separation gel within the capillaries will dry out if the capillaries are left exposed to the air for more than 15 minutes Capillaries Exposed xj ou may now open the sample access cover ta load plates Capilares exposed to air TOME I Cancel Time R
394. ple e Show the Report Format dialog box selecting Filel Print Report e Open all associated results that belong to a sample when a samples is opened e Open export the most recent results from a sample plate e Show the Analysis Log during analysis e Print the entire desktop e Print the application window including all toolbars e Print only the displayed panes e Select audio playback speed View the general properties of the currently selected item You can view the item type database and project where the item resides as well as the date and time the item was last modified You may also view the sample name sample plate sample position in the sample plate the instrument and the operator name You can also view the Property Set run Method Analysis Alignment Consumables and Note of the currently selected sample Specify the format of the report to be generated for the active sample Displays a facsimile of a hardcopy printout of the selected sample plate Prints the report Prints the selected pane Print Prints the desktop application or main window as defined in the Preferences Desktop dialog box Recent Objects Lists the most recently opened objects The first set of four is sample data and the second set of four is sequence results Exit Closes the Sequence Analysis module GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 1 07 PN B40154AC Sequence Analysis Sequence Analysis M
395. possible dye labeled SNP fragments use the Advanced tab of the Analysis Parameters window to select the SNP Dye Mobility Calibration see Advanced Tab on page 216 NOTE The SNP Ver 1 Dye Mobility Calibration is for use with the GenomeLab SNP Primer Extension Kit and the SNP Ver 2 calibration is for use with the GenomeLab SNPStart Primer Extension Kit GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 215 PN B40154AC Fragment Analysis Module Defining Fragment Analysis Parameters Advanced Tab Set additional fragment analysis parameters From this window you can assign dye mobility correction values to compensate for the varying effects of different dyes on fragment mobility select a standard mobility reference and indicate whether to use the dye spectra from sample data or from saved system spectra Edit Fragment Analysis Parameters IDE x Parameter Set Name 3A T193ALU7 Project Default Analysis Method STA Locus Tags SNE Locus Tags Advanced Mobility Dye Mobility Calibration NoCorection Standard mobility reference None Dye Spectra f Use calculated dye spectra f Use system dye spectra kO few O2 FF OS fe DS Save As Save Cancel Figure 6 16 Fragment Analysis Parameters Window Advanced Tab Mobility Set up the mobility parameters for the current analysis e Dye Mobility Calibration specifies the calibration from the options available in the list Based on your
396. procedures It provides a list of the consumable materials used in the system It also includes some diagnostic procedures performed as needed 9 1 Routine Maintenance NOTE Use Figure 9 1 to locate hardware components referenced in this section 901632L Al GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 339 PN B40154AC Maintenance and Diagnostics Routine Maintenance Figure 9 1 User Accessible Hardware Components 1 Sample Access Cover extended 7 Manifold Access Cover 2 Capillary Access Cover extended 8 Gel Waste Bottle 3 Status Indicators 9 Power Switch 4 Plate Holders Sample Transport 10 Gel Pump 5 Capillary Temperature Control Cover 11 Gel Pump Gel Cartridge Access Cover 6 Rubber Latches Cleaning the Capillary Array CAUTION The capillary array windows must kept free of any contaminants Otherwise high backgrounds and or drifting baselines will occur All background levels should be below 6000 counts Water used during this procedure must be fresh distilled deionized water 18 Mohm cm water Select Replenish Release Capillary Array in the Run module Wait for the Remove Capillary Array dialog box to appear Open the sample access cover Figure 9 1 and lift it to the vertical locking position Open the capillary access cover and lift it to the vertical locking position pr oge we pex Unlatch the two rubber latches holding the capillary temperature control
397. ptions Replenish Help e t e 2 7 es ac An Cm GN T Di D2 NB D E D4 E Status Configuring Data Monitor Direct Control Log Instrument Data Event Type 0 14 0 78 uw Progress Event 0 60 Min Sample Set 0 60 Min Sample Plate 0 60 Min Sample Amp Device Life Ti Active Plate Sample Plate Method cnts Project feo Jf fem fee fe Jf fs Sample Name Position 2 jz amp Capillaries exposed to air Gel Cartridge life exceeded 2 0 3 0 2 5 Capillary usage exceeded Time Minutes Off line H For Help press F1 Active Plate LEFT Pause To Load Inactive IConfiqured 2nd Plate Not Available INUM Figure 3 1 Main Window Run Module The following table describes the items called out in the image above Table 3 1 Main Window Run Module Item Description A Title Bar Displays the name of the module Run Control and the user defined system name Menu Bar See Menu Bar Options on page 49 Toolbars See Toolbar Icons on page 55 Window Selection Tabs Toggle between windows see Window Selection Tabs on page 62 E Display Area Graphically displays the raw data of the selected capillary or capillaries F Status Monitor Displays the current state of the run capillary and gel cartridge status and system on line off line status 48 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use P
398. qu EER a Gard andre dnb Car ec a S Ae ot Jine qu 265 Exporting Fragment Lists or Genotypes from a Study ills 265 Transferring Fragment Data to GeXP Data Tool sisssssssee ee 266 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Section 7 Gene Expression zu uem pex nU xU CX eg ded Ew 211 7 1 Gene Expression Overview lesse eee eee II 211 7 2 Multiplex Primer Design using NCBI Primer BLAST 0 000 000 nn n 213 Pre Design ConsiderationS 0 0 0 0 ccc eee eee RII III 213 Primer Design using NCBI Primer BLAST 0 00 0 ccc cece eee 2 4 Assemblea MUDIO a acad tet boo edF ood ay att hota Qt tout oto dieto dubai dut op es 2 5 Evaluating Primer and Amplicon Sequences using NCBI BLAST Searches 2 6 7 3 Run Samples and Review Results in Fragment Analysis Result Set View 2 1 Prepare The GeXP System Before The Sample Run 0 0 0 cc n RR 21 1 Crede ANW SUU earen ar aa a r a aaar oe ae seen gs ad 218 Review Data in Result Set View 0 0 a 2 9 7 4 Set up Locus Tag and Allele IDs llsssesee RR m II 202 5 Apply Exclusion Filter and Export Fragment ResultS 0 0 00 cece eee 293 ADDIVEXEIBSIORSEIEBI scu icio sobttos e ec tina aides erat ack esce acide eot oct asus ERE dd e 293 EXPO Fragment RESUS a miarana ace NV ics PRU Qc URN cos eee catt eet ee a 293 axe M Data OO E 295 Downloading GeX
399. r Baseline 2 Inthe Monitor Baseline dialog select the Enable Monitor Baseline option then click OK Viewing Capillary Information l Select Replenish Capillary Information from the Run module menu bar 2 Use the Capillary Information dialog box Figure 3 38 to view the following information Capillary Part Number E0807 Serial Number Dmto50128 Date Installed 04 27 2006 Time Installed f T A Number of Runs EE Cancel Print Advanced iket Help Days on instrument f 3 1 Figure 3 38 Capillary Information Dialog 3 View the following information Part Number Displays the part number of the installed capillary array Serial Number Displays the serial number of the installed capillary array The serial number is used to track the capillary array along with the samples that have used the array Date Installed Displays the date the capillary array was installed Time Installed Displays the time the capillary array was installed Number of Runs Specify the desired number using the spin control Set more than the recommended number of separations to be performed before the system alerts you that the recommended number of runs has been exceeded Days on instrument Specify the number of days on the instrument using the spin control This allows the capillary array to reside on the instrument longer than the recommended length of time before the system alerts you that the
400. race peak you select from the reference result trace The system compares the reference peak to the test peak calculates a relative length height and area then adds the results to the Peak Ratio Results Table To select the reference peak right click an individual peak from the selected Result Set Trace located at the top of the Fragment Result Set Traces area of the window and select Reference Peak The system then calculates the length area and height of the test peaks by comparison and enters this information into the Quantitation Result Table e To de select the reference peak from the Reference Result Peaks table right click the reference peak and select Set Peak As Reference again to toggle the command to the off position unchecked e To de select the reference peak from the Fragment Result Set Traces area right click the reference peak and select Peak Reference to remove the check mark GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 247 PN B40154AC Fragment Analysis Module Performing AFLP Analysis Selecting a Test Peak A test peak is a trace peak that you select from the reference result trace The system compares the test peak to the reference peak calculates a relative height and area then adds the results to the Peak Ratio Results Table e To select the test peak right click an individual peak from the selected Result Set Trace located at the top of the Result Set Traces are
401. rdance with the Waste Electrical and Electronic Equipment WEEE Directive of the European Union The presence of this marking on the product indicates that the device e was put on the European Market after August 13 2005 e is not to be disposed via the municipal waste collection system of any member state of the European Union For products under the requirement of WEEE directive please contact your dealer or local AB SCIEX office for the proper decontamination information and take back program which will facilitate the proper collection treatment recovery recycling and safe disposal of the device GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Table of Contents Safety Information zuus acce Rosas Dec DE de ee hee De dee teen CREE dd V Notes and VV IAN RERO TRENDS V system Operation and Electromagnetic Interference llli X DISPOSal and RCCV CNG auto e ach a e Eb weed tian wr wk oe MaKe ole e bears X FOFGWOLFIT 2 oio uide ew he ecu 3 hw da ew alt We a cd Oe e 1 PO UMA SG a scatet die eue det a tarder ae patie du EE MIU EM dpa 1 MOGI CA OO DOME cucucen e dercarbt ute si A eiie A uii e eir 2 Section 1 Getting Started sseiess Rm RR 3 WV OV SECT OVE EW sudes edid og atic deen e a ped Ges be E Repas 3 Purpose of this System uos een tae dst anoo ated daa Gea ed cade ao Geel fe ito quse aod Be Gs 3 ROEM Viro Dagos iC WSC 2 254 ut onda actress tidie eee bc
402. riana Rache et oS en RR eo AEREE 68 setting or Changing Display Options iiis RR RR 73 Viewing the Last Analysis Performed 0 0 00 ccc cece eee eee eee ees 19 2 9 USING DeC CONO suot in eared Hania Antes inka aan oe Masaka waked awed Sheba amp 76 Loading the Sample Plate and Buffer Plate For Dual Rail System 004 Tf Loading the Sample Plate and Buffer Plate For Single Rail System 004 79 setting the Capillary Temperature a n naana 02 Performing an Optical ATNODNIeBE 2252 22708 oh ucwe Shek E endete Sore d ER PES Yo t 03 Monitoring Ihe Baseli aue t rate d PR ar ele Sit ar Ree a eppure dut ber etes 83 Viewing Capillary Information sss n eee eee eee 84 Viewing Gel Information 0 0 0 0 0 RRRRRRRRRRRRRRRRRRRRR a 05 Viewing or Changing Buffer Information lssssee RR IRRRRRIR 05 Removing and Replacing the Capillary Array 0 RR 06 Removing and Replacing a Gel Cartridge Gel Pump Plug For Dual Rail System 93 Removing and Replacing a Gel Cartridge Gel Pump Plug For Single Rail System 96 Removing the Manifold Plug 0 0 0 0 ce ee eee eee ees 99 Section 4 Sequence Analysis een 103 4 1 Sequence Analysis Module Overview lselsee RR RII 103 DUO VION eee Since dy aset tuos Dass Say eee ho alee A Ade Minds Se etait ee Rete E C EHE E 103 Menu Bar QOUONS s eee sr ottlen eed enine reee on cal ead s 105 OO
403. ridge Locking Lever open 2 Gel Cartridge or Gel Pump Plug 4 Cartridge Barrel 6 Remove any air pockets from the gel cartridge by grasping the cartridge wings between your first two fingers and pressing the plunger with your thumb until a small amount of gel is pushed out of the cartridge tip 7 Insert the new cartridge or the gel pump plug into the barrel and lock it into position by aligning the cartridge wings with the cartridge holder and pushing in 8 Push the cartridge locking lever towards the back of the instrument approximately a 90 angle into its locked position 9 Close the Gel Pump Gel Cartridge Access Cover 10 In the Remove Gel Cartridge dialog box Figure 3 50 Click Install Cartridge to indicate that a gel cartridge was installed OR e Click Install Plug to indicate that the gel pump plug or empty cartridge was installed 94 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Remove Gel Cartridge access door PLEASE WAIT qfi Do not open gel Releasing gel cartridge E Run Module Using Direct Control Remove Gel Cartridge You may now open gel access door and change gel cartridge IF vou are nat going to install a working gel cartridge please insert the gel pump plug or clean empty Install Cartridge i 3 M Install Plug Time Elapse cartridge to prevent any remaining gel from drying in the system Then click min sec on Install Plug
404. ries Immerse Capillaries Right Flate Left Flate Plate Loaded Plate Loaded Immerse Capillaries Immerse Capillaries requires wetting tray requires wetting tray requires wetting tray requires wetting tray on the left side on the right side on the lett side on the right side Figure 9 13 Capillaries Exposed Dialog Box 3 Wait until the dialog box message displays GO with a green text message 4 Open the sample access cover Figure 9 1 and lift to the vertical locking position Loading the Sample Plate l Make sure the Wetting Tray is installed or perform the procedure Installing the Wetting Tray on page 347 then return here 350 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Maintenance and Diagnostics Direct Control and Replenishment 2 Align the sample plate guide pin with the notched corner of the sample plate and gently lower the plate into position Figure 9 14 901600L Al Figure 9 14 Loading the Sample Plate 1 Sample Plate 4 Sample Plate Notched Edge 2 Wetting Tray Retainers 5 ALIGN together 3 Sample Plate Holder 6 Sample Plate Guide Pin 3 When finished positioning the sample and buffer plates close the Sample Access Cover and then select the position from which the plates were loaded left or right 4 Click the Load on the Capillaries Exposed dialog box Figure 9 15 CAUTION The separation gel within the capillarie
405. rison it translates the nucleotide sequence of the reference file into an amino acid sequence and displays it above the reference base sequence line From the beginning of the reference the bases are separated into groups of three nucleotides codons Each group is translated into an amino acid which is displayed above the codon Each codon is shaded to show its boundaries If an inserted space exists signified by a dash the space is included in the codon The amino acid designation is left justified above the codon If two amino acids are possible the letters designating the possible amino acids appear If the system detects more than two possible amino acids at any location it displays an asterisk instead To show or hide the reference amino acid sequence select View Reference Amino Acid Translation The screen displays or hides the reference amino acid translation depending on whether the item is checked or unchecked Viewing Sequence Traces When you first perform a comparison select one or two sequences to form the consensus After performing the comparison the system displays the traces for these sequences When you click on any position in alignment view the corresponding peaks in the traces move to the center of the trace view framed by two vertical lines When you first open or create a comparison the system scales the traces to improve readability e To zoom each sequence pane individually and repeatedly left cl
406. rming an Optical Alignment on page 398 Plate Position Selects where you want to position and immerse the capillaries Load Unload Plates Selects the position where the capillaries are immersed in the plate or wetting tray and moves the plates to the Load position at the front of the instrument for loading unloading plates GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Run Module Run Module Overview Figure 3 4 Direct Control Toolbar Run Module Icon B Description Release Gel Cartridge Removes the gel cartridge See Removing and Replacing a Gel Cartridge Gel Pump Plug For Dual Rail System on page 367 Install Gel Cartridge Installs a gel cartridge Release Capillary Array Removes the current capillary array See Removing and Replacing the Capillary Array on page 360 Install Capillary Array Installs the capillary array Replace Wetting Station Replaces the wetting tray See Replacing the Wetting Tray on page 347 Data Monitor Toolbar The following example shows the Sample Setup module Data Monitor toolbar For descriptions of the actions that occur when you click a toolbar icon see Table 3 10 Figure 3 5 Data Monitor Toolbar Run Module Table 3 10 Data Monitor Toolbar Run Module Icon w E EMI Description Unzoom Undoes one zoom level Unzoom All Undoes all zoom levels Autoscroll Sca
407. rol window When you click a selectable area the system initiates a unique Direct Control task Table 3 16 lists the tasks available in this window Table 3 16 Direct Control Window Selectable Areas Item Description A Capillary Temperature Change the capillary temperature B Gel Capillary Fill Fill all capillaries with fresh gel Any gel present in the capillary is forced out to the specified waste position in the buffer plate or wetting tray C Optical Alignment Align the lasers with the detection windows of the eight capillaries Data can be saved and viewed in the Sequence Analysis module GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 63 PN B40154AC Run Module Run Module Overview Table 3 16 Direct Control Window Selectable Areas Item Description D Manifold Purge Clears the manifold of air bubbles and or remaining DNA fragments before the next separation process E Install Release Gel Cartridge Releases and or installs a gel cartridge Denature Samples Initiates the denaturing of samples G Plate Position Select the plate or tray position where the capillaries will be immersed H Wetting Tray Replace or refill the wetting tray Install Release Capillary Installs the capillary array Verify or change the information requested and then install the array Access Plates Load Unload Plates Displays the Unload Plates dialog box and e Select the position for capillary immers
408. roperty Set Properties Ea Analysis Alignment Consumables General Mate Property Set Method Property Set Static Property Value Figure 4 28 Property Set Tab Properties Dialog 148 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Method Tab View the method associated with the result and the steps used to perform the separation as well as their associated values Properties Analysis General Mote Method Seg Test Capillary Temperature Walt for Temperature Denature Temperature Denature Duration Fause Duration Inject Voltage Inject Duration Separate Stage 1 Primary Voltage Stage 1 Ramp Duration Stage 2 Separation Voltage Stage 2 Start Time Stage 2 Ramp Duration Total Separation Duration Select File Properties Method Alignment Property Set B2 0E Yes 30 0 C 120 sec 1 sec 2 0 ky 15 sec 4 2 ky 5 min 4 5 ky 5 min 0 0 min 85 0 min Figure 4 29 Method Tab Properties Dialog Box GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Sequence Analysis Using the Sequence Analysis Module In addition view the parameters for the first part and the second part of the separation as well as the total separation time 149 Sequence Analysis Using the Sequence Analysis Module Analysis Tah View the analysis parameters used to produce the
409. rrel 4 Grasp the wings of the gel cartridge gel pump plug and pull it out of the barrel Figure 3 53 NOTE Always note the lot number and the hours on the instrument for a gel cartridge if you are planning to use it for more than one session 96 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC 5 Run Module Using Direct Control If necessary use a tissue to wipe gel strands off of the instrument Figure 3 53 Removing Replacing the Gel Cartridge Continued 9 1 Cartridge Wings 3 Cartridge Locking Lever open 2 Gel Cartridge or Gel Pump Plug 4 Cartridge Barrel Remove any air pockets from the gel cartridge by grasping the cartridge wings between your first two fingers and pressing the plunger with your thumb until a small amount of gel is pushed out of the cartridge tip Insert the new cartridge or the gel pump plug into the barrel and lock it into position by aligning the cartridge wings with the cartridge holder and pushing in Push the cartridge locking lever towards the back of the instrument approximately a 90 angle into its locked position Close the Gel Pump Gel Cartridge Access Cover 10 In the Remove Gel Cartridge dialog box Figure 3 54 Click Install Cartridge to indicate that a gel cartridge was installed OR e Click Install Plug to indicate that the gel pump plug or empty cartridge was installed GenomeLab Genetic Analysis System User s Guide For n
410. rt from a list of available results located in various projects a Select the Project that contains the sample data that you want to export from the Project drop down list b In the Available list select the samples to export then click the right arrow gt to move the selection to the Selected list NOTE The functionality of this window is very similar to that of the Select Raw Data window described in selecting the Components of the New Study on page 200 4 When you have finished making your selections click Next to proceed to the Export Options window 262 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Fragment Analysis Module Exporting Results 5 Define the export parameters and options including the file name and location using the Export Options window as shown in the following example Steps Results Options Export results as CACEQ System Expor Result Name tbe Save As r Elements m Options M Header v Remove CEQ Tracking Suffix M Raw Data w Resolve Filename Conflicts V Result Data v Result Output Use the Save As button to change the export file name format or directory Specifying a file name of Result Name assigns the actual result name to the exported file Note Result Name is not a valid file name for CRY export lt lt Previous Cancel Figure 6 40 Export Options The Export Results Opti
411. rtridge dialog box will be displayed Wait until the lead screw is completely disengaged 2 Open the Gel Pump Gel Cartridge Access Cover by gently pushing in on the top of the cover The cover is spring loaded and will pop open 3 Pull on the Cartridge Locking Lever The barrel will swing outwards to approximately a 90 angle from its locked position Figure 9 43 Removing Replacing the Gel Cartridge 1 Gel Pump Gel Cartridge Access Cover 4 Cartridge Locking Lever open 2 Cartridge Locking Lever closed 5 Cartridge Barrel 3 Cartridge Barrel GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 3 1 PN B40154AC Maintenance and Diagnostics Direct Control and Replenishment 3 2 4 Grasp the wings of the gel cartridge gel pump plug and pull it out of the barrel NOTE Always note the lot number and the hours on the instrument for a gel cartridge if you are planning to use it for more than one session 5 If necessary use a tissue to wipe gel strands off of the instrument Figure 9 44 Removing Replacing the Gel Cartridge Continued 1 Cartridge Wings 3 Cartridge Locking Lever open 2 Gel Cartridge or Gel Pump Plug 4 Cartridge Barrel 6 Remove any air pockets from the gel cartridge by grasping the cartridge wings between your first two fingers and pressing the plunger with your thumb until a small amount of gel is pushed out of the cartridge tip 7 Insert the new cartridge or the gel pum
412. run log and more To access this information right click on the highlighted sample or multiple samples from any of the data or fragment lists and select Show Single Result GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 229 PN B40154AC Fragment Analysis Module Using the SNP Locus Tag Editor 230 DATS 101 D4 G01_06042512776 dr T8 82 UD UA I r7 8 81 06 81 53 Br 85 an g5 100 105 110 115 120 125 13 135 Size nt Figure 6 21 Single Result View The top of the Single Result window displays the name of the individual data sample selected All of the information pertaining to the data sample is distributed under several different tabs within this window Table 6 15 provides a brief description of the components of each of the tabs in the Single Result View NOTE Refer to the online help for detailed descriptions of each of the available tabs in the Single Result View Table 6 15 Information Available in the Single Result View Tab Fragment Data Raw Data Fragment List Current Inject Current Voltage Description Displays a plot of the dye signal traces Displays a plot of the raw four channel electropherogram Displays a list of all fragments that meet the minimum relative height criterion set in the parameter set This view displays all available fragment properties Displays a graph of the separation current versus time for the duration
413. ry 3 Click Apply to continue or OK to close the Display Options dialog box Y Axis Options Tab To define the Y Axis properties of the displayed data panels l Inthe Display Options dialog box select the Y Axis Options tab 2 Change any item as necessary 3 Click Apply to continue or OK to close the Display Options dialog box Colors Tab To define the color options of the window the current traces the voltage trace or the optical scan trace l Inthe Display Options dialog box select the Colors tab 2 Change any item as desired 3 Click Apply to continue or OK to close the Display Options dialog box Dye Traces Tab To set or change the dye trace properties l Inthe Display Options dialog box select the Dye Traces tab Select the traces to display or not display under Show Dye Traces To change a color of any dye trace click on the appropriate Dye Colors dye select a color from the Color dialog box then click OK 4 When finished with Dye Traces click Apply to continue or OK to close the Display Options dialog box Current Trace Tab To set or change the current trace options l Inthe Display Options dialog box select the Current Traces tab 2 Select the radio button for the current type to display under Data 3 Click OK GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Sequence Analysis Using the Sequence Analysis Module Changing Display Colors In
414. ry Array Dialog Box 18 The Confirm Capillary Array Selection dialog will appear Read it and make the selection Yes to continue or No to abort the capillary installation Removing and Replacing a Gel Cartridge Gel Pump Plug For Dual Rail System CAUTION Care must be exercised when installing removing a gel cartridge due to the viscosity of the gel mixture NOTE This procedure assumes that an expended gel cartridge is being replaced with a fresh gel cartridge or that a used gel cartridge is being removed for storage purposes and being replaced with the gel pump plug l Select Replenish Release Gel Cartridge When the system is ready to release the gel cartridge the Release Gel Cartridge dialog box will be displayed Wait until the lead screw is completely disengaged 2 Open the Gel Pump Gel Cartridge Access Cover by gently pushing in on the top of the cover The cover is spring loaded and will pop open 3 Pull on the Cartridge Locking Lever The barrel will swing outwards to approximately a 90 angle from its locked position GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 307 PN B40154AC Maintenance and Diagnostics Direct Control and Replenishment BEKMAN cours 1 901635L Al Figure 9 39 Removing Replacing the Gel Cartridge 1 Gel Pump Gel Cartridge Access Cover 4 Cartridge Locking Lever 2 Cartridge Locking Lever 5 Cartridge Barrel 3 Cartridge Barrel
415. s Menu Fragment Analysis Module Option Description Show Excluded Shows fragment results that were excluded from the Fragment Results Grid show Capillary Displays a table that identifies the number of samples that are included and excluded summary in the Result Set within each capillary Fragments Menu Click the Fragments menu to display its drop down menu as shown in the following example Fragments Show Excluded Manually Select Peaks Save Fragment Grid 45 CSV GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 193 PN B40154AC Fragment Analysis Module Fragment Analysis Module Overview The following table describes the Fragment Analysis module s Fragments menu options Table 6 5 Fragments Menu Fragment Analysis Module Option Description show Excluded Shows fragments that were excluded from the Fragment List Manually Add Provides an option to manually select peaks to be included in the fragment list Peaks oave Fragment Save the Fragment Grid as a comma delimited file csv Grid As CSV Analysis Menu Click the Analysis menu to display its drop down menu as shown in the following example Analysis Analysis Parameters Mew AFLP Analysis Mew Binning Analvsis Mew Peak Ratio Analysis Run LOH Analysis The following table describes the Fragment Analysis module s Analysis menu options Table 6 6 Analysis Menu Fragment Analysis Module Optio
416. s all loci from the Selected Loci list to the Loci in Database or Other Loci list If the loci exist in the database moves the loci to the Loci in Database list Moves the selected loci from the Selected Loci list to the Loci in Database or Other Loci list If the loci exist in the database moves the loci to the Loci in Database list E D S ee Use to rearrange the list order Select an item and click the appropriate arrow to move it up or down the list Ed GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 209 PN B40154AC Fragment Analysis Module Exporting Results 2 0 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Gene Expression Gene Expression Overview Gene Expression 7 1 Gene Expression Overview The GenomeLab GeXP Genetic Analysis System GeXP System uses a patented highly multiplexed PCR approach to efficiently examine the expression of multiple genes with sensitivity and speed Perform a multiplex gene expression analysis by completing the following procedures e Design a custom multiplex using the NCBI Primer BLAST e Perform the Reverse Transcription RT reactions e Perform the PCR reactions e Run the PCR products on the GeXP System Analyze the data using the GeXP Fragment Analysis Module GeXP Data Tool and GeXP Quant Tool The flowchart on the next page depicts the Gene Expression workflow GenomeLab Genetic Analysis System User s
417. s being replaced with a fresh gel cartridge or that a used gel cartridge is being removed for storage purposes and being replaced with the gel pump plug l Select Replenish Release Gel Cartridge from the Run Module menu bar When the system is ready to release the gel cartridge the Release Gel Cartridge dialog box will be displayed Wait until the lead screw is completely disengaged 2 Open the Gel Pump Gel Cartridge Access Cover Figure 3 48 by gently pushing in on the top of the cover The cover is spring loaded and will pop open 3 Pull on the Cartridge Locking Lever The barrel will swing outwards to approximately a 90 angle from its locked position 901635L AI Figure 3 48 Removing Replacing the Gel Cartridge 1 Gel Pump Gel Cartridge Access Cover 4 Cartridge Locking Lever 2 Cartridge Locking Lever 5 Cartridge Barrel 3 Cartridge Barrel 4 Grasp the wings of the gel cartridge gel pump plug and pull it out of the barrel Figure 3 49 NOTE Always note the lot number and the hours on the instrument for a gel cartridge if you are planning to use it for more than one session GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 93 PN B40154AC Run Module Using Direct Control 5 If necessary use a tissue to wipe gel strands off of the instrument 901603L Al Figure 3 49 Removing Replacing the Gel Cartridge Continued 1 Cartridge Wings 3 Cart
418. s position may have multiple difference codes associated with it The codes have a hierarchy the system displays the code with the highest precedence To view all difference codes associated with any position display the navigator toolbar by selecting View Toolbars Navigator The differences text box in the navigator toolbar displays the difference codes in order of precedence Navigation and Editing The navigator toolbar allows you to search for locations of interest in the consensus based on attributes as well as search for specific bases and view their associated quality values and difference codes If the navigator toolbar is hidden from view select View Toolbars Navigator The system displays the navigator toolbar Figure 5 7 When docked the toolbar appears to the left of the screen display GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 183 PN B40154AC Sequence Investigator Module Sequence Investigator Procedures 184 If you need more space for your screen display you may move the navigator toolbar so it floats over the screen display e To reposition a docked toolbar select any background area of the dialog box press and hold the left mouse button while dragging the toolbar to a convenient position on the screen then release the mouse button e To re dock a floating toolbar left click the toolbar s title bar press and hold the left mouse button while dragging the toolbar to the low
419. s to be performed before the system alerts you that the recommended number of runs has been exceeded Days on instrument Specify the number of days on the instrument using the spin control This allows the capillary array to reside on the instrument longer than the recommended length of time before the system alerts you that the recommended number of days on the instrument has been exceeded Advanced Click this button to display the Capillary Advanced Information dialog box This dialog box displays the length and diameter of the installed capillary array based on the part number entered in the New Capillary Array dialog box The fields are read only and cannot be edited Click OK to enter the information and close the dialog box 3 When finished click OK to close the windows GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 359 PN B40154AC Maintenance and Diagnostics Direct Control and Replenishment Viewing Gel Information 1 Select Replenish Gel Cartridge Buffer Information The Gel Cartridge Buffer Information dialog box opens Gel Cartridge Butter Information Gel Part Number i38 oo Lot Number S602066 Gel M ama p Date Installed p 27 2008 Time Installed mons ooo Hours on Instrument 520 Buffer Part Number 608012 M OF Cancel Print dle Help Lot Number CEG Sequencing Separation Buffer Figure 9 30 Gel Cartridge Buffer Information
420. s will dry out if the capillaries are left exposed to the air for more than 15 minutes Capillaries Exposed You may now open the sample door and load plates Capillaries exposed to air B Cancel Time Remaining Alarm Off min sec a 26 Help Left Plate Right Plate Plate Loaded Plate Loaded Immerse Capillaries Immerse Capillaries C requires wetting tay requires wetting tray on the left side on the right side Figure 9 15 Capillaries Exposed Dialog Box Loading the Buffer Plate and Evaporation Cover 1 Align the notched corner of the buffer plate with the alignment line on the buffer plate holder Figure 9 16 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 351 PN B40154AC Maintenance and Diagnostics Direct Control and Replenishment 2 Gently push the buffer plate towards the front of the instrument and then set the plate into the transport 3 Atthe rear of the buffer plate holder align the buffer evaporation cover guide pin with the buffer evaporation cover alignment notch and then gently lower the cover over the buffer plate Figure 9 16 Loading the Buffer Plate and Buffer Evaporation Cover 1 Front Location 4 Buffer Evaporation Cover Alignment Notch 2 Buffer Evaporation Cover 5 Wetting Tray Retainers 3 Buffer Plate 4 When finished positioning the sample and buffer plates close the Sample Access Cover and then select
421. sample names entered in a sample plate GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Sample Setup Module Overview View Menu Click the View menu to display its drop down menu as shown in the following example View v Toolbar w Status Bar w Cell Coordinates Sample Property Sets Summary View by Subject ID Working Database Activate or deactivate window display options The following table describes the Sample Setup module s View menu options Table 2 4 View Menu Sample Setup Module Option Description Toolbar Toggles between displaying not displaying the toolbar otatus Bar Toggles between displaying not displaying the status bar Cell Coordinates Toggles between displaying not displaying the coordinates of the plate cells Sample Property Sets Create delete or modify the property set summary Displays a summary of the currently selected plate View by Subject ID Toggles the sample plate cell labels between Sample Name and Subject ID Working Database Displays a dialog box showing the database in use Run Menu Click the View menu to display its drop down menu as shown in the following example Run Start This menu provides one option Table 2 5 Run Menu Sample Setup Module Option Description Start Invokes the Run module and loads the active sample plate GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 27 PN B40154AC Sa
422. sample or set of samples The outcome of this analysis is a result set of data consisting of characterized fragments and identified alleles You can then use specific filters to scrutinize and selectively isolate results based on the parameters of the applied filters In other words the types of exclusions that you apply to the data filter out all unwanted results from your Study This process is known as result set filtering 226 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Fragment Analysis Module Using the SNP Locus Tag Editor Accessing the Result Set View You can view the Result Set View while working with a Study using one of these methods e Select View View Result Set e Click the Results Set A toolbar icon Fragment Analysis New Study Eile View Results Analysis Reports Window Help Result Set View i Binnings j Peak Ratios Results Exclusion Filter Set New Result Filter Set 1 v Apply m DATS 93 D4 401_060425122M 04 25 2006 12 59 56 d Operator Value s DATS 94 D4 B01_060425122K 04 25 2006 12 59 50 i E n DATS 96 D4 C01_0604251 221 04 25 2006 12 59 44 DATS 97 D4 D01_060425122F METATA AE DATS 99 D4 E01_0604251 22C 04 25 2006 12 59 26 DATS 100 D4 F01 0604251279 04 25 2006 12 53 20 DATS 101 D4 G01 0504251276 04 25 2006 12 59 12 DATS 102 D4 H01 0604251224 04 25 2006 12 59 06 IV Show Excluded
423. se ul icon again Pause to Load To pause a current run so you can load another plate GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use T1 PN B40154AC Run Module Using the Run Module 1 Select Run Pause to Load to pause the system and load another plate The Pause To Load Plates dialog box opens as shown in the following example Pause To Load Plates Load plate after current sample set Cancel Stop current sample set now to load plate Stop current sample plate now to load plate Help Options Save Collected Data Perform Shutdown Method I Audible Alarm The current mas wait time is 30 minutes Modify wait Time Figure 3 24 Pause to Load Plates Dialog Box 2 Select one of the following load options e Load plate after the current sample set This option delays loading of plates until after immediate sample run After completion of sample separation the system enters the Access Plates condition After loading the new plate the system runs the next sample set from the original sample plate NOTE If the plate has not been loaded by the time set in Modify Wait Time max 30 minutes the run resumes with the next sample set e Stop current sample set now to load plate This option immediately stops the run to allow for plate loading If selected the Save Collected Data option becomes available allowing the previously collected data to be saved e Stop current
424. se 303 PN B40154AC Gene Expression GeXP Data Tool File C Projects Gene Expression Main GeXP Data Tool DataXNo Replicate Data Rows Test csv E Sample Name Rep 1 Rep 2 Rep 3 Mean std Dev 9 6CV i std 000 98ng ND ND ND ND ND ND V pU UE SS SS PP PEE std 015 63ng This row does not contain any useful data This will not be included in the export file Std 031 25ng T6585TSU 3686 791 359 996 9322 OFS TST AZZ 29 536 CRH 190 na SINAC 24 l270002 TEAM WIC AAA BAIS 9n 70 00271 n 777 Figure 7 32 Sample with no replicate data highlighted red If a sample is named according to the Quant Tool convention for a Standard sample then it will be subject to further error checking Valid Standard sample names must be Std followed by a space followed by an integer or real number representing the concentration and followed by ng nanograms If a sample Standard has no data in one gene the corresponding standard row for all genes will be highlighted as warnings with a yellow background will have a tool tip explaining the warning and will be excluded from the export file File C Projects Gene Expression Main GeXP Data Tool Data No Replicate Data Rows Test csv U DUNG untrearea o053866 U4U O9Z3Z7 41U 6132U U4U LIYU LOU 633U D63 LLose Kanr Sample Name Rep 1 Rep 2 Rep 3 Mean Std Dev CV std 015 63ng gans has no data for this Standard concentration This will not be included in the export file
425. se Sequence toolbar select View Toolbars then select the Base Sequence check box as shown in the following example Base Sequence z W Standard v Data Hel JY Sample View __ Heb v Sample Plate wv Base Sequence wv Dye Colors 11 00 WE ae Base 1 G Call 0 EREET Migration 22 dd S A C 0 Edited Inserted A mo IY Ignore Case ExactMatch Search Highlighted Range Selected Bases Quality Scores Help E p Figure 4 8 Sequence Analysis Module Base Sequence Toolbar Use this dialog box to search for specific base sequences and to view quality parameters Enter the desired string of bases and click the arrow buttons to search backwards and forwards through the base sequence text To use regular expressions to locate the desired text use the characters described in Table 4 14 Table 4 14 Characters Used in Expressions Character Description The pipe character I allows either expression on its side to match the target string The expression alb will match a as well as b The dot will match any character The asterisk indicates that the character to the left of the asterisk in the expression should match 0 or more times The plus is similar to the asterisk but there should be at least one match of the character to the left of the sign in the expression The question mark matches the character to its left O or 1 times
426. se the SCF Standard Chromatogram Format format to store analyzed DNA sequence data for a single sample The format describes both public and private data sections The well defined public data section contains trace data points the called sequence the positions of each called base within the trace data and the call scores for each called base It also includes a public comment section The private section may store other information that most software packages ignore The CE system uses the private data section to store sample data including raw data along with current and voltage data You can store sample data from either sequencing or fragment analysis samples The notes and property sets for the sample are stored in the comment section The CE system software supports SCF versions 2 1 and 3 0 You would use this format for instance to export analyzed sequence data into Lasergene s SeqMan from DNASTAR Inc Third party packages cannot currently view raw data current or voltage However custom applications can be written to view the data Use the SCF format to transfer data from instrument to instrument or to import data from third party software into the Sequence Analysis module Using SCF to exchange data between instruments removes information such as sample plate name capillary array serial number etc To maintain exact copies of data including header information use the CEQ format and import and export these data using the
427. selection and select Set Result As Reference The system highlights the result trace with a dark background and moves the trace to the top of the Result Set Traces area of the window to distinguish it as the reference result trace It marks the fragment result with an R in the left most column to distinguish it as the reference trace e To de select the reference result right click the reference result and select Set Result As Reference again to toggle the command to the off position unchecked The system removes the R from the de selected trace and returns it to its original highlight status and position in the Fragment Result Set Traces area of the window e To select the reference peak from the Result Set Traces area right click your selection and select Reference The system highlights the result trace with a dark background and moves the trace to the top of the Result Set Traces area of the window to distinguish it as the reference result trace It marks the corresponding result with an R in the left most column to distinguish it as the reference peak To de select the reference result right click the reference result trace and select Reference again to toggle the command to the off position unchecked The system removes the R from the de selected trace returns it to its original highlight status and position in the Fragment Result Set Traces area of the window Selecting a Reference Peak A reference peak is a t
428. selection this option adjusts migration times or mobility to compensate for the varying effects of different dyes on fragment mobility To choose a value select any of the following options from the drop down list e PAver 1 Select this option when analyzing samples made from primers labeled with the phosphoramidite dyes D2 PA D3 PA or D4 PA e AE ver 2 Select this option to improve calibration and size estimates for primers labeled with the active ester dyes D1 D2 D3 or D4 e AE ver 1 Select this option for the Fragment Analysis test sample e SNP ver 1 Select this option when performing an SNP analysis using the GenomeLab SNP Primer Extension The SNP analysis can proceed if you do not select this mobility correction but the values obtained may vary slightly e SNP ver 2 Select this option when performing a SNP analysis using the GenomeLab SNPStart Primer Extension Kit 216 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Fragment Analysis Module Defining Fragment Analysis Parameters e No Correction Keep this default value when you do not want the system to make any compensation for dye effects on fragment mobility NOTE When performing a Fragment Analysis Test Sample you must use the AE ver 1 dye mobility calibration for correct sizing of the fragments Dye Spectra Dye Spectra values are calculations of the relative emission intensities of each dye in each of the four detecti
429. sequence Advanced Alignment Parameters x Alignment scoring Match Insert start Insert extend i 40 3 0 zl 4 0 3 0 1 0 Mismatch 20 Delete start l Delete entend i Alignment controls If Find matching substrings v LeftEdge Free Minimum substring Find Local alignment v Right Edge Free length po ES es dee Figure 4 14 Advanced Alignment Parameters Dialog Box NOTE If you opened this dialog box by selecting View Parameters Used to Compute Sequence this dialog box displays the analysis values but disables the fields described below The system uses a scoring matrix to perform the alignment and displays the alignment that produces the highest total score In general matches should be given higher scores than non matches GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Sequence Analysis Using the Sequence Analysis Module The following table describes the options available on the Advanced Alignment Parameters dialog box Table 4 22 Advanced Alignment Parameters Sequence Analysis Module Option Description Alignment Scoring Match Sets the value of a match between a base position of the sequence and the reference template The range is 1000 0 to 1000 0 A value of 1 is the default value e MisMatch Sets the value of a mismatch between a base position of the sequence and the alignment sequence The ra
430. ser s Guide For n Vitro Diagnostic Use 3 9 PN B40154AC Maintenance and Diagnostics Consumable Items List 9 4 Consumable Items List Table 1 provides a list of the required consumable items for the Sequence Analysis System Table 1 Required Consumbables for Performing Sequence Analysis DNA Separation Capillary Array 33 5B 608087 Item P N QTY Description Methods Development Kit 608000 1 Dye Terminator Cycle Sequencing Kit for 96 reactions Includes e DNA polymerase e Dye Terminators ddUTP ddGTP ddCTP ddATP e dNTP Mix Solutions e Sequencing Reaction Buffer or e pUC18 Control Template e 4 Sequencing Primer e Glycogen e Mineral Oil e Sample Loading Solution SLS DTCS Quick Start Kit 608120 1 Dye Terminator Cycle Sequencing Kit for 96 reactions Includes e DTCS Quick Start Master Mix e pUC18 Control Template e 4 Sequencing Primer e Glycogen e Mineral Oil e Sample Loading Solution SLS Separation Gel LPA 391438 1 20 mL of gel in CE system compatible container Sufficient to run two 96 well plates separation Gel LPA 608010 1 10 mL gel that is used for GeXP single rail systems Sufficient to run one 96 well plate separation Buffer 608012 1 Each container has a screw top and pour tip The container has enough buffer 30 mL to fill a CE system 96 well flat bottom Buffer Plate Each well being 3 4 full 4 Pack Eight capillaries 75 um i d 33 cm long 200
431. sing the Fragment List View To access the Fragment List view use one of these methods Select View View Fragment List e Click the Fragment List 5 7 toolbar icon The Fragment List window opens as shown in the following example Fragment List Fragments Exclusion Filter Set M size stg Std frag estfrag pkarea pk height New Fragment Filter Set 1 v Apply e 2 size nt size nt rfuxmm rfu ECT ENTER D AB 15383 E NH Show Excluded Figure 6 26 Fragment List Window The Fragment List displays a table of all analyzed fragments included in the Study You can modify the columns displayed to show different system variables and information You can use the Filter Set area to define and select exclusion filters you want applied to the fragment data Create modify and save filter sets Each Filter Set column provides a right click menu of parameters you can use to apply as exclusion filters NOTE The Filter Sets applied to the Result Set data second level filtering are different from the Filter Sets applied to the Fragment List data third level filtering You can apply filters to the Result Set to filter an entire sample that may contain numerous fragments You can also apply filters to the Fragment List to filter individual fragments identified within the various samples GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 23 PN B40154AC Fragment Analysis Module
432. sion Firmware Version Dealer Name Dealer Phone Number Mail SCIEX Headquarters 500 Old Connecticut Path Framingham MA 01701 U S A Customer Technical Service 1 977 740 2129 Support in the United States Customer Technical Service www sciex com Support in All Other Countries 2 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC 1 1 Getting Started System Overview Getting Started This chapter discusses the purpose and functional description of the system provides an overview of the three main components chemistry hardware and software comprising the system and details the safety features relevant to the system It also provides step by step procedures for operating the system system Overview This section describes the purpose and function of the CE system provides an overview of the main components comprising the system and details the safety features relevant to the system Purpose of this System The purpose of the Capillary Electrophoretic CE Genetic Analysis System is two fold e To determine the nucleotide sequence of any given DNA sample To estimate sizes of DNA fragments For n Vitro Diagnostic Use This GenomeLab GeXP is an electrophoresis instrument intended to detect laser induced fluorescent dye labeled DNA fragments signal to estimate the DNA fragment size These dye labeled DNA fragments are separated by size and charge as the fragments mi
433. substring length Only the subsequences that meet or exceed this length will be trimmed Set the distance from the end of the sequence and contaminant for automatic removal You may set the Left 5 independently from the Right 3 end Select this check box Iv1 to allow trimming within the sequence GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Sequence Analysis Using the Sequence Analysis Module Performing Quality based Trimming Setting Up Quality based Trimming To setup quality based trimming 9 pee o Jor dU iie dee te e Open the Sequence Analysis module Open a result and select Analysis Working Analysis Parameters Click Edit to open the Sequence Analysis Parameters Editor Select the Quality based Trimming tab Select Ends To Be Trimmed and Trimming Stringency Click Save As and save the new parameters Click OK Select Analysis Trim Based on Quality The analysis parameters created in the steps above should be listed If not click Use Stored Parameters and select the appropriate analysis parameters Click OK The resulting base sequence and trace views display the base letters if poor quality as strike through after performing a quality based trim NOTE When performing quality based and sequence based trimming quality based trimming is always performed first Hueresceree i9 test sequenceA12 A11 02012519AI New Analysis Untitled 1632 06 7 63 An
434. sult set by the exclusion filters they are moved from this row to the excluded row The number of results that have been excluded from the result set by the exclusion filters e The total number of all samples both included and excluded that are part of the result set Customizing the Result Set View You can define the fragment result components available in the Result Set View You can also modity them using right click commands These commands allow you to select specific columns to display in the fragment results customize the arrangement of fragment results information and modify several other parameters of the fragment results For details on using the Column Selector window the Column Sort window and other display parameters see Customizing the Results List on page 254 Viewing Electropherogram Data You can view individual sample traces at any time either individually or in selected groups along with the parameters used or collected during the separation and analysis steps Sample traces can also be stacked or overlaid on top of one another for comparison purposes All of these features are available through the right click menus whenever a single or collection of samples is highlighted single Sample View Single Sample View displays all of the available information for an individual data sample including the collected trace views fragment data separation and analysis parameters the calibration curve the
435. system can then calculate the quantity of each of the remaining peaks in the sample ID Standard In the ID Standard area of the window select one of the following options as the method the system uses to identify your reference peak e Size Select this option to identify your reference peak based on the fragment size specified in the Size field listed for each of the four dyes e Time Select this option to identify your reference peak based on the migration time specified in the Time field listed for each of the four dyes Calculate Using In the Calculate Using area of the window select the method the system uses to calculate the quantity of your reference peak GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 211 PN B40154AC Fragment Analysis Module Defining Fragment Analysis Parameters e Height Select this option to calculate the quantity of your reference peak based on its peak height e Area Select this option to calculate the quantity of your reference peak based on its peak area Quantitation Values Set the parameters for each dye Enter values for each dye selection e Size Time These fields depend on the selected ID Standard e If you selected Size as the ID Standard the first field next to the dye requires you to enter the size of the reference peak nucleotides for that dye f you have selected Time as the ID Standard the first field next to the dye requires you to ent
436. system software by using Studies A Study represents a collection of quality sample results used for locus tag generation genotyping quantitation or AFLP profile generation Ultimately a Study contains a common group of sample results that are analyzed and exported together This chapter provides an overview of the Fragment Analysis module including its menu options toolbars and dialog boxes It shows how to use this module to work with Studies to run a fragment analysis to set up parameters to use result properties and to display options It also describes how to work with report and export fragment analysis functions Fragment Analysis Module Overview The Fragment Analysis module processes fragment data from the CE system platform and provides size and allele information for detected peaks The system organizes parameters that identify alleles as locus tags that you can customize You can then view export and print the analysis results Analysis parameter sets provide parameters specific to an experiment allowing size calibration and locus tag assignment as necessary when processing data Data analysis can be a manual function or set to run automatically Edit and re analysis functions provide the capability to verify the accuracy of the data Graphically view analyze edit compare and print data of the following drop down listing types e Raw Data Fragment Data Fragment Lists e Information about locus tags and
437. t gt 1 324 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Database Management Data Manager Procedures Checking the Database Size Check the size of each database Click Data Manager on the Main Menu 2 Left click the GENOMELAB DBASE node at the top of the left pane The size for each database is shown in the right pane as shown in Figure 8 4 Data Manager ME xi File Edit View Tools Window Help New Database xi Enter Name for New Database M yNewDatabase CE CE CEC Cancel 15 MB FAII 150 MB USE 5 MB HE CEQBAKT HE CEQBAK2 HHE FAII B ES D1181984 D148599 D181579 D225683 D382387 D982157 D95938 Default DX57132 GATA193AD7 Test project HE USERTEMPLATE n Oe D t 3 9 s n EE HEEHEEHEEHEEHEE HE HE H C E Os Ds Os D D D D Figure 8 4 Checking the Database Size NOTE If you recently removed data from the database the size shown may not be accurate See Reducing the Database Size on page 325 for more information Reducing the Database Size Manually reduce the size of the database to its new smaller size After removing studies or results from the database the size of the database does not immediately reduce in size NOTE Always reduce the database size before backing it up The database size cannot be reduced during database back up l Open the Data Manager 2 Select and highlight the database that will be reduced 3 Se
438. t Direct Control Gel Capillary Fill The Gel Capillary Fill dialog box opens Gel Capillary Fill Ed Buffer Plate fe Cancel Wetting Tray Plates Help Waste Position Figure 9 26 Gel Capillary Fill Dialog Box 2 Select the Buffer Plate or Wetting Tray radio button to identify the position where waste will be expelled from the capillaries e Ifyou select Buffer Plate use the Buffer Plate spin controls to identify the waste position in the buffer plate then click Fill Ifyou select Wetting Tray click Fill GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 357 PN B40154AC Maintenance and Diagnostics Direct Control and Replenishment Purging the Manifold l Select Direct Control Manifold Purge The Manifold Purge dialog box opens FP Volume 0 40 ml Cancel Cycles f Help Figure 9 27 Manifold Purge Dialog Box 2 Enter a volume in milliliters mL 0 1 mL default 3 Enter the number of cycles 4 Click Purge Performing an Optical Alignment To align the lasers with the detection windows of the eight capillaries l Select Direct Control Optical Alignment The Optical Alignment dialog box opens Optical Alignment x Scan Data M Autosave Alin Mame SCAN Cancel Project Default Help Figure 9 28 Optical Alignment Dialog Box 2 Save the alignment data a Select the Autosave check box b Enter a name in
439. t Format dialog box appears showing the current report settings for the sample plate The Print Format applies to all samples Print Report applies to individual samples m Enable disable automatic exporting of data and or change export options Click Edit Export Options For Plate The Export dialog appears showing the current settings for the sample plate The Export Format applies to all samples Export Report applies to individual samples NOTE New Sequence or Fragment Analysis Parameters must be created in their respective analysis modules Note Method Analysis Analysis Reporta Export v Perform Analysis Parameter Set Print Report Export Data equence4nalysisParameters Edit Print Format For Plate Edit Export Options For Plate Figure 2 4 Sample Setup Analysis Tab Menu Bar Options The following example shows the Sample Setup menu bar options File Edit View Run Window Help 24 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Sample Setup Module Overview The following topics describe each of these menus and their options File Menu Click the File menu to display its drop down menu as shown in the following example File Mew Ctrl M Open Close Chri o Save Girls Save 45 Import Export Properties Default Report Format Print Preview Frink Setup Print Print Screen Lock 0 DefaultSamplePlate 1
440. t GenomeLab Select this option to access software instrument and system information System Beckman Coulter Select this option to access the Beckman Coulter Home Page on the Internet Home Page Toolbar Icons The Fragment Analysis module provides three toolbars that activate some of the most commonly used commands Figures 6 2 identifies these toolbars Study Toolbar Dye Colors Toolbar jose for M oz M os BN os NN View Toolbar EgramBand Toolbar A Y Height 5221549 H x width 96 90082 Figure 6 2 Toolbars Fragment Analysis Module The following table describes these toolbar icons Table 6 10 Toolbar Icons Fragment Analysis Module Icon Description E New Create a new Study from either raw data or result data zx Open Open an existing or recent Study Save Saves the new or edited Study Study Explorer Displays the Study Explorer Fragment List Opens the Fragment List a 196 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Fragment Analysis Module Fragment Analysis Module Overview Table 6 10 Toolbar Icons Fragment Analysis Module Icon Description rum Result Set Opens the Result Set View A D1 Red is the default color assigned to Dye 1 in the fragment data pane and D1 is the default red name D2 Black is the default color assigned to Dye 2 in the fragment data pane and D2 is the default black name D3 Green is the default c
441. t essentially takes a Snapshot of the file and can retain all of the information belonging to that file This format can only be used when importing data into the Data Manager This format can also be used when exporting data from the Sequence and the Fragment Analysis modules and the Data Manager When exporting as CE system data the various data types are exported to files with the following extensions e Sequence Analysis ParameterCQA e Sequence InvestigatorCQC e Fragment Size StandardCQD e Fragment Analysis ParameterCQF e Galvo Scan DataCQG e Fragment Locus TagsCQL e MethodsCQM e SNP Locus TagsCQN e Sequence ResultCQR e Sample DataCQS e Sample TableCQT e Fragment ResultCQU e Sample Table ResultCQX You may automatically remove the plate position coordinates A01 B02 etc and the time date stamp from the sample name which is normally generated by the CE system software on export To do so select the Remove CEQ Tracking Suffix check box 1 If the system encounters the same sample name at the destination it usually overwrites the name if you choose to remove the plate position coordinates and the time date stamp which ensures a unique name If you select the Resolve Filename Conflicts check box L the system increments the sample names on export when it encounters duplicate names For example if the system encounters the duplicate sample name of Fred on export it renames the file exported to Fred
442. tabase name Figure 8 8 Database Exists Warning Message 5 If this occurs click OK and either e Delete the database in the Data Manager NOT recommended or e Rename the database being restored This is done by entering a new name in the Database To Restore field GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 327 PN B40154AC Database Management Data Manager Procedures Converting Individual IDs to Subject IDs Converts all sample data records with Individual IDs to records that use Subject IDs Before you begin confirm that the present database is the Working Database See Setting the Working Database on page 324 for more information The Suhject ID attribute applies to the sequence and fragment records that were generated from the converted sample data record Performing this action removes the Individual ID column and adds a new Subject ID column to all existing studies within the database 1 Open Data Manager NOTE The working database cannot be changed while other modules are open 2 Select and highlight the database to convert and ensure that it is the Working Database NOTE This option is available only for the working database 3 Select Tools Convert Individual ID to Subject ID After the IDs are converted the following message is displayed in the status bar Conversion Completed Successfully Creating New Size Standards 1 Open Data Manager Select the Default or Project fold
443. tected e Enter a value between 1 1000 The default value is 10 e The slope is proportional to the height of the peak and depends on the width of the peak You can set this parameter to detect peaks of interest while eliminating smaller or broader peaks that may not be of interest e The slope threshold is set relative to the baseline noise as the baseline noise varies for each dye trace Although you can define only one slope threshold value the system adjusts for each dye depending on the noise detected for that dye trace Relative peak height threshold Set a minimum height criterion that unknown peaks must meet before being displayed in the fragment list or annotated in an electropherogram e Enter a value between 0 100 The default value is 1 e The unknown peaks above this set value 96 relative to the second highest peak in each dye trace will be displayed in the fragment list and the sizes will be displayed in the electropherogram e This value does not apply to standards e To size the peaks only clear the Allele Identification check boxes Allele Identification The Allele Identification check boxes let you add either of the following parameters e Identify STR Alleles Select this option MI to include allele identification as specified in the allele lists of the selected Short Tandem Repeat STR locus tags GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 207 PN B40154AC Frag
444. ted when you created the Study The bins are defined and visible with the majority of the result points within their borders Allele List The system develops the initial Allele List from information provided in the first window of the Bin parameters plus the data from the fragment list see previous After completing the analysis you can correct the allele list using the following options e Phase Shift Enter an integer value nucleotide in either direction to move all identified bins This overrides the system determined position of perfect repeat alleles GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 241 PN B40154AC Fragment Analysis Module Performing Bin Analysis 242 Minimum Relative Peak Height Enter a value to exclude any data points generated from small noise peaks The relative peak height is calculated in the color and size range specified in the initial binning parameters window e Show Phantom Bins Select Show Phantom Bins 1 to highlight the area of all system generated phantom bins The system generates phantom bins at all intervening positions for whole number nominal sizes not already assigned to a bin Phantom bins encompass expected fragment sizes based on other observed sizes that may or may not be present in the data set To convert phantom bins to real bins alleles right click the desired bin location and select Create Allele The system adds a line to the Allele List r
445. tem User s Guide For n Vitro Diagnostic Use PN B40154AC l Figure 9 31 Remove Capillary Array Dialog Box Maintenance and Diagnostics Direct Control and Replenishment Select Replenish Release Capillary Array After the system prepares for release of the capillary array the Remove Capillary Array dialog box opens Remove Capillary Array Ea To replace the capillary array immediately select Replace capillary arap To install a manifold plug select Install manifold plug M Help To clean the capillary windows select Clean capillaries Remove Capillary Array Options Replace capillary array C Install manifold plug C Clean capillaries Capillaries exposed to air L Time Remaining min sec na pae Open the Sample Access Cover Figure 9 1 and lift to the vertical locking position Open the Capillary Access Cover and lift to the vertical locking position Unlatch the two rubber latches holding the Capillary Temperature Control Cover and lift to the vertical locking position Loosen the Manifold Access Cover captive screw Figure 9 32 remove the cover and set it aside 361 Maintenance and Diagnostics Direct Control and Replenishment 901633L Al Figure 9 32 Manifold Access Cover 1 Capillary Temperature
446. tem saves the following information e Observed Size bin mean e Bin Minimum amp Maximum e Standard Deviation e i of Data Points Minimum Peak Height e Xand Y coordinates of all the data points in the plot stored as additional information GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC 243 Fragment Analysis Module Performing Bin Analysis The system automatically updates the allele list with the new information obtained during the bin analysis Reviewing the Source Data After applying the Bin Analysis parameters to the data selecting the reference and trace points and updating the locus tag and allele list you can review the source data for all included samples before completing the Bin Analysis The Fragment Results table and Summary area list all of the data samples included in the Bin Analysis You may view and compare individual samples manually to include or exclude individual samples or groups of samples from the analysis and re analyze selected samples K New Binning Analysis Steps lel Es result date analysis analysis parameters outcome y p 3 27 2006 11 41 35 HGATATSSAU Parameters Binning Locus Tag Source Data amp x Previous Hent gt gt Cancel Figure 6 30 New Binning Analysis window Reviewing the Source Data Click Finish to add the Bin Analysis to your Study 244 GenomeLab Genetic Analysis System User s Guide For n
447. ter a time duration in seconds 3 Identify the position of the Sample Set and click Denature Injecting a Sample l Select Direct Control Inject from the menu 2 Inthe Inject dialog box enter the Voltage in kV and enter a Time Duration in seconds 3 Use the Sample Set option to set the position of the samples and then click Inject Performing a Separation l Select Direct Control Separate from the menu 2 IntheSeparate dialog box a Enter a value for the voltage in kV b Enter a time duration in minutes c Identify the position of the buffer using the Buffer Set spin controls and then select Separate NOTE Data will not be saved Replenishing the Capillaries with Gel 1 Select Direct Control Gel Capillary Fill from the menu 2 From the Gel Capillary Fill dialog box select the Buffer Plate or Wetting Tray option to identify the position where waste will be expelled from the capillaries e If Buffer Plate was selected use the Buffer Plate spin controls to identify the waste position in the buffer plate and then select Fill 02 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Run Module Using Direct Control e If Wetting Tray was selected click Fill Purging the Manifold 1 Select Direct Control Manifold Purge from the menu 2 Inthe Manifold Purge dialog box enter a volume in milliliters mL 3 Enter the number of cycles and then select Purge Performing
448. the Name field c Select a Project from the drop down menu 3 Select Align NOTE Prior to performing an Optical Alignment it is advisable to purge the Array Manifold and fill the capillaries with fresh gel in that order See Purging the Manifold on page 358 and Replenishing the Capillaries with Gel on page 357 Viewing Capillary Information To view or change capillary information 358 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Maintenance and Diagnostics Direct Control and Replenishment l Select Replenish Capillary Information The Capillary Information dialog box opens Capillary Fart Humber Eo Serial Number amo Date Installed 04 27 2006 Time Installed 17 01 47 Number of Runs b Cancel Print Advanced Help didi Dave on instrument 13 1 Figure 9 29 Capillary Information Dialog Box 2 View the following information Part Number Displays the part number of the installed capillary array Serial Number Displays the serial number of the installed capillary array The serial number is used to track the capillary array along with the samples that have used the array Date Installed Displays the date the capillary array was installed Time Installed Displays the time the capillary array was installed Number of Runs Specify the desired number using the spin control Set more than the recommended number of separation
449. the Sequence Analysis Module 130 The following table describes the options available on the Sequence Analysis Parameters Alignment Reference tab Table 4 21 Alignment Reference Tab Sequence Analysis Parameters Editor Option Description Perform Alignment Select this check box L1 to perform an alignment automatically when running an analysis The alignment uses the alignment template and parameters specified below and in the Advanced Alignment Parameters dialog box Reference Select the desired alignment template by clicking on its corresponding radio button puc18dG puc 18 or m13 To select a different template click Reference File Click Browse and navigate to the folder that contains the reference file then select it and click OK The text box displays the name of the selected reference file Cutoff Accuracy Enter the desired Cutoff Accuracy The alignment detects the base number in the called sequence at which the accuracy falls below this Cutoff Accuracy value The range is 0 0 to 100 0 Allowed N s Enter the percentage of N s allowed to occur before they are counted as errors when determining the alignment accuracy The range is 0 0 to 100 0 Advanced Alignment Click this button to open the Advanced Alignment Parameters dialog box Parameters Advanced Alignment Parameters Use the Advanced Alignment Parameters dialog box to define the Advanced Alignment Parameters used to perform alignments with the active
450. the high voltage is applied during the injection or Separation The light is off when the high voltage is turned off 1 0 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Getting Started System Overview Software User Interface The software provides the interface for manual or automatic pre programmed control of the system and for data capture and basic data analysis Combine with sentence below The CE system provides a graphical user interface GUI that enables you to open programs and initiate commands by clicking buttons or selecting menu options To open the Main Menu double click the CE system icon on your computer s desktop GenomeLab System The Main Menu opens as shown in the following example To access a module click its icon on the Main Menu as described in Software Module Descriptions on page 12 After opening a software module the Main Menu collapses either to the Windows taskbar or as a shortcut toolbar as described in Main Menu Collapse Options on page 13 nmnospso5nns GenomeLab GeXP Genetic Analysis System SEQUENCING M gt BECKMAN gii COULTER x FRAGMENTS Figure 1 11 GenomeLab Genetic Analysis System Main Menu GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 11 PN B40154AC Getting Started System Overview 12 Software Module Descriptions The following table shows the shortcut icons available
451. the minimum duration and the threshold above which data are considered peaks Fragment Analysis Parameter Sets including SNP analysis are used to process the fragment data to estimated fragment sizes and to identify alleles Fragment sizes are estimated by generating a calibration curve from a set of size standards run with the unknown samples The Fragment Analysis Parameter set defines the analysis model used to generate the calibration curve dye label mobility corrections allele identification criteria locus tags quantitation values and other factors that will affect how your data are analyzed GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 41 PN B40154AC Sample Setup Module Using the Sample Setup Module Assigning Analysis Parameter Sets e Fora Sequence Analysis select a Sequence Analysis as the Parameter Set For Fragment Analysis select a Fragment Analysis as the Parameter Set Performing an Analysis on a Sample To perform an analysis on a sample 1 Select the cell cells as described in Selecting Samples on page 32 2 Select the Analysis tab at the bottom of the window 3 Select the Perform Analysis option 4 Select the parameter set from the Parameter Set drop down list see Figure 2 17 Note Method Analysis Analysis Reporta E sport vw Perform Analysis Parameter Set equencednalysisParameters Edit Print Format For Plate Edit Export Options For Plate Defa
452. the printer settings Displays a print preview of the active document using the format specified in the Report Format dialog box Prints the active document as specified in the Report Format dialog box Prints the active desktop area as specified in the Preferences dialog box Provides a short cut to open previously opened documents Exits the Sequence Investigator module Click the Edit menu to display its drop down menu as shown in the following example Edit Insert Delete Replace Trim Search Restore Ta Original Quality Threshold Flip Traces Insert Delete GET Ctrl F Ctra Use the Edit menu to edit displayed data The following table describes the Sequence Investigator module s Edit menu options Table 5 3 Edit Menu Sequence Investigator Module Option Insert Delete Replace Trim Search Restore To Original Quality Threshold Flip Traces Description Inserts a space before the currently selected position Deletes the selected position Replaces the highlighted position with a selected IUB code Removes contiguous selected bases that contain an end base in the sample sequence base call text Searches forward and backward for the attributes or text specified in the navigator toolbar Restores the compared sequence result to its original state removing all changes Changes the quality threshold below which bases in the consensus are identified as having low quality M
453. the project can be named as Primer evaluation for Human breast cancer multiplex or Standard curve for Human breast cancer multiplex 4 Close the DATABASE module Create a new sample plate l From the main menu launch the SET UP module 2 Create a new sample plate for the sample run 3 Name the samples NOTE For standard curve experiments follow the instructions for naming standard and experimental samples Standard names must start with Std followed by a space character and the standard concentration in nanograms in the following format Std xxxng where xxx is any whole or decimal number Sample names must start with U followed by a space character and other information in the following format U HuBCRNA 4 Select Frag 3 as the Separation Method 5 Select Analysis parameters For samples not including standard curve use the DefaultGeXPAnalysisParameters For samples containing standard curve use Sensitive GeXP Analysis Parameters The Sensitive GeXP Analysis Parameters are generated by making the following modification of the DefaultGeXPAnalysisParameters Slope threshold 1 Relative peak height threshold 096 6 Save the sample plate to the new project created in Create a new database and a new project above Prepare the GeXP instrument l Install capillary array and gel cartridge Ensure the array S N and gel lot number are entered into the system during installation
454. the selected base Bases on Top Toggles the base sequence text between displaying on the top or bottom in the analyzed data pane Compare Synch Synchronizes scaling Zooming and panning of two analyzed data sets while in the Compare mode Align Aligns selected points of each of the displayed analyzed data sets while in the Compare mode Display Options Opens the Display Options dialog box GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Sequence Analysis Sequence Analysis Module Overview Sample View Toolbar The following example shows the Sequence Analysis modules Sample View toolbar For descriptions of the actions that occur when you click a toolbar icon see Table 4 11 Figure 4 4 Sequence Analysis Module Sample View Toolbar Table 4 11 Sample View Toolbar Sequence Analysis Module Icon Description C Analyzed Data Displays the data that has been analyzed for the active sample acer mt Base Sequence Displays a text view of the bases from the analyzed data for the active sample Gc Raw Data Displays the raw data for the active sample Current Displays the current data from the capillary arrays for the active sample Voltage Displays the voltage data from the instrument for the active sample Compare Data Compare the active analyzed data set against another analyzed data set Quality Parameters Displays a graphical representation of the quality
455. tide polymorphisms SNP with BLAST SNP especially at the 3 end which can lead to the preferential amplification of one allele over another If a polymorphism is found redesign the primer to a more conserved region Examine the amplicon sequence generated by each set of primers for repeat sequences e Repeat sequences can lead to Taq polymerase slippage and result in stutter peaks e If5 or more consecutive single or di nucleotide repeats or a series of such repeats in close proximity to each other are present redesign the primers to target an amplicon without repeats e BLASTing against a genomic database will help determine if any pseudogene expression may be detected Any set of primers that has the potential to generate an undesigned peak UDP within the size range of multiplex should be redesigned to prevent the production of a UDP Once the primer and amplicon sequences have been reviewed update the Microsoft Excel worksheet for the multiplex Proceed with ordering and testing the multiplex primers Order the primers with the appropriate universal tag sequence IMPORTANT Do not order the KAN primers They are included in the GeXP Start Kit Chemistry After primer multiplex is designed various RT PCR reactions are performed with a reference RNA to evaluate the primers in the multiplex Refer to detailed instructions on setting up RT and PCR reactions and on optimizing multiplex in GeXP Chemistry Protocol A29143 Once
456. til it is completely seated against the bases of the Guide Pins Make sure that the fitting tab is placed downward when inserting the capillary array into its slot 12 While holding the electrode block tab align the electrode block Figure 9 35 with the guide block pins and gently push it in until resistance is met The resistance is from the spring loaded contacts 13 When installing the capillary array carefully route the capillaries through the hole in the plenum assembly Figure 9 33 and straight across into the guide block pins Figure 9 35 CAUTION N USE THIS FRONT PLENUM ONLY WITH A 33 CM CAPILLARY ARRAY 8542 AA 900697L Al Figure 9 37 Plenum Assembly Capillary Routing Hole NOTE When reinstalling the plenum assembly gently gather the capillaries between your thumb and forefinger to make sure they pass through the hole in the plenum assembly without any constriction 14 Replace the plenum assembly and tighten the two captive screws Figure 9 37 15 Replace the manifold access cover and tighten the captive screw Figure 9 32 16 Lower the capillary temperature control cover and secure the two rubber latches 17 Lower the capillary access cover and sample access cover to their locking positions e If you are installing a new capillary array in the Install Capillary Array dialog box Figure 9 38 select the correct part number enter the serial number click Set to New then click Done The number of runs a
457. tion and A Detection make no modifications For Confidence Interval click the check box to enable Overview system confidence interval and set the value to 0 5 At this point the allele list can be either exported or printed To export the allele list right click on the ID header in the Allele List table and select Export Grid and save it as a csv file To print the allele list right click on the ID header in the Allele List table and select Print Grid GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Gene Expression Set up Locus Tag and Allele IDs Sa Steps analysis Y Parameters Results Binning DefaultesPAnalpsisParameters result Locus Ta Dr OSZI OTA Css LUe 22005 18 46 04 H D H05 USU223187M sss A2 2009 18 46 02 7 pass H05 0S0223167F amp B102 23 2008 18 46 00 H pass D4 0902277 Ce fe 2003 LH U3 0902231662 izar 2008 H 0502231 005 H Source Data i DefaulexP nalssParameters DefautGexPAnalysis Parameters 5 DefautGesPAnalysi Parameters Default esPAnalysisP arameters DefaultGeXPAnalysisP arameters 5 090227682 00000 ss DG07 09022387T 0000000 0G 03022318 2 009 18 46 T 0902231876 3 U 0 02 23 2009 184504 G ipass 02723 2009 18 46 00 G DefautGexPAnalpsis Parameters 2009 18 45 56 E Defaultae amp xPAna
458. tion dialog will open Sample Plate Selection x Create a new sample plate Open an existing sample plate Sample Plates Database GEXP MODULE 2006 Filter Start Date 02 14 2006 E Enable Cancel End Date 0214 2008 E Hefresh Help Project Hame Find Barcode Figure 2 5 Sample Plate Selection Dialog Box Creating a New Sample Plate l To create a new sample plate select the Create a new sample plate radio button 2 Click OK The Sample Plate window opens 30 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Sample Setup Module Using the Sample Setup Module Opening a Sample Plate l To open an existing sample plate select the appropriate plate from the list 2 To help in the search filter the plates by their displayed date Selecting the Enable option 3 Use the Up and Down scroll arrows to change the Start Date and End Date 4 Click OK to open the selected sample plate Find Barcode Use the Find Barcode option to search for a sample plate using its barcode 1 From the drop down list select the Project Name that contains the sample plate barcode 2 Click Find Barcode and type the sample plate barcode exactly as it was saved If the sample plate barcode exists it will open the plate You may also use the wildcards and in your search If the search finds more than one match the Barcode Selection dialog box opens allowing you to select
459. tion minimum 0 079 Concentration maximum 5 664 Standard curve equation Curve Fit R2 1 0000 y Coeff3 x 3 Coeff2 x 2 Coeff1 x CoeffO Samples U S136 1271 0 009 0 7 1 284 1 263 1 265 U 137 1 448 0 027 1 9 1 414 1 449 1 481 U 138 1400 0 027 1 9 1 433 1 401 1 367 U 139 109 000 04 1 096 1 105 1 095 U S140 0723 0004 05 0 721 0 719 0 728 U S141 1074 0 014 1 3 1 086 1 081 1 054 U 142 1497 0014 09 1 516 1 494 1 482 JU 143 0 253 0029 115 0 294 0 228 0 238 jU 5144 0846 0 020 2 4 0 840 0 825 0 874 IU S145 0546 0 004 0 8 0 543 0 543 0 552 U S146 1460 0 018 1 3 1 458 1 483 1 438 MN Summary Description Gene 1 Gene 2 Gene 3 Gene 4 Gene S Gene 6 Gene 7 G we 6 Gene 7 G Figure 7 48 Gene 1 worksheet in Excel Workbook As shown in Figure 7 49 near the bottom of the Gene 1 worksheet the GEQ Normalized values are listed The GEQ normalized value can be derived from either one reference gene or a geometric mean of multiple reference genes depending on how many reference genes are selected during GeXP Quant Tool analysis In the example shown in Figure 7 49 the GEQ normalized value were derived from two reference genes Gene 2 and Gene B The mean GEQ Normalized values are used to create a bar chart on the worksheet These values are the final quantitation values and are used to calculate fold change between samples GenomeLab Genetic Analysis System User s Guide
460. to a previously analyzed data set to pick up missed peaks or to avoid picking up unwanted peaks The data resulting from the re analysis automatically replaces the older Result Set data allowing you to quickly continue with your Study To re analyze the results Select one or more results from the Result Set View 2 Right click the selected results and select Reanalyze Results Reanalyze presents the following options e From Sample Data replaces the previous analysis result with a complete new analysis from raw data e Using New Parameters allows you to modify the analysis parameters previously used e Using Additional Edited Locus Tags does not change the basis analysis but allows you to modify allele identification 3 When selected a message box opens prompting you to verify that you want to replace the selected results with re analyzed results 234 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Fragment Analysis Module Using the SNP Locus Tag Editor 4 Click Yes to proceed with the re analysis The appropriate Fragment Analysis Parameters dialog window opens allowing you to select a new or edited set of parameters to use for re analyzing the data Analysis Parameters LI X IETEVIGUS Inm Figure 6 24 Selecting a Parameter Set to be used for Re Analysis NOTE For details on selecting creating editing and saving Fragment Analysis Parameter Sets see Defining Fr
461. to install the GeXP Data Tool software Launching GeXP Data Tool Use the Windows 7 Start menu on the GeXP instrument controller to find and then launch the GeXP Data Tool A window similar to that shown in Figure 7 21 will be displayed 8 GeXP Data Tool Open Figure 7 21 GeXP Data Tool GeXP Data Tool Applications An input data file for GeXP Data Tool must have the following characteristics Input date files for the GeXP Data Tool must be a valid GeXP Fragment Application file that is exported via the Transfer Fragments for GeXP selector Refer to Figure 7 22 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 295 PN B40154AC Gene Expression GeXP Data Tool Aninput data file allows up to 10 replicates of data per Standard Concentrations or Samples D LITITITCEEMMNNNNNN loj x Date modifed 8 28 2014 1 41 PM 6 2 2014 8 08 AM 7 13 2013 8 46 AM 8 26 2014 3 28 PM 4 22 2014 4 27 PM 4 11 2014 2 19 PM 8 19 2013 10 59 AM 8 28 2014 12 48 AM aS HumanBC csv 4 Test 1 Csv 8 6 2014 6 43 PM Microsoft Exc Z Test 2 csv 8 6 2014 8 54 AM Microsoft Exc 4 Test 3 csv 8 6 2014 6 57 PM j4 U File name HumanBC csv M NN 4 Figure 7 22 Select and Import a Data File To display the input data file perform the following steps 1 Click the Open button Refer to Figure 7 22 2 Select the Transfer Fragments for GeXP file with the desired standards and or samples NOTE Standards a
462. ts in the navigation pane located on the left and the introductory topic in the topic pane located on the right You can use the Contents to select and print specific help topics The navigation pane also provides a Search tab and an Index tab These tabs let you search for information by topic index entry and or keyword Using Help Select this option to display the Contents window on how to use the Windows Help system About GenomeLab Select this option to access software instrument and system information System Beckman Coulter Select this option to access the Beckman Coulter Home Page on the Internet Home Page Toolbar Icons The Data Manager module provides one toolbar with icons that correspond to common menu items Figure 8 2 shows this toolbar j Oja 53 i ex Ele r Figure 8 2 Toolbar Data Manager Module Table 8 8 Toolbar Data Manager Module Icon Description Up One Level Moves the directory structure tree up one level New Create a new project or database Open Opens and edit standards a Cut Deletes selected items projects and databases Copy Copies a selected item project or database to the clipboard Paste Inserts one or more copied or cut items from the clipboard to selected project or database E Print Prints a report of the selected item GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 321 PN B40154AC Database Management
463. ts o Y oa edens 179 Selecting a Reference and Sequence ResultS 0 0 cece eR 180 VIN FAVED THINGY ENTER ERE EE ORT TIT EE E N E 182 Viewing Reference Amino Acid Translations lsle BR 182 Viewing Sequence TA6BS aosano ats tarte re hd Set toS a 182 Viewing Consensus Amino Acid Translations llis RI 183 FPEIBIEETOE SD OVE Si ccs et ih sts a en ete nen coe pd XE Er Ana th oe qP Nx Deets 187 Exporting the be QUOI Bs uo sotto ree dE PE REC EDEReS EPheciMh eed Sabie a 187 Savino Me Dala eaea uM EUM cave aes a aia anne a MEAM UC ML EIU Se 188 Section 6 Fragment Analysis Module eese 189 6 1 Fragment Analysis Module Overview lsslses eee eee eee 189 MAIM WINGO PORE T 10 LOTES PCR 190 Meni Bar ODON cone tu E upusapbaducn quies d dicen ea Run aM eee eas 191 FOOD CONS x nca stie innr ear EE a taedet eee berg t pte ars Ba pce adt mE 196 6 2 Fragment Analysis Procedures 0 0000 ccc ec eee RR 198 Performance Safeguards 0 0 eee aes 198 6 3 Working with Studies in the Fragment Analysis Module 0 00005 199 selecting the Components of the New Study 0 0 0 0 ccc eee eee eee 200 selecting Raw Data for the New Study 0 0 0 ccc eee eee eee 201 selecting an Analysis Parameter Set nananana eee eee eee 203 Aa ZIng edaldosd ts emu doe ei as stade eee eater ra dtu ad re soa dto 4 E 204 Selecting Additional Results to add to the Study
464. ts zoom into the same region Select Tools Unzoom All and all sixteen results zoom out so you can view the entire result GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Sequence Analysis Using the Sequence Analysis Module Panning Results To pan results click the Pan Mode icon e Pan through the data in the original sequence and all sixteen results pan together e Pan through the data in a result other than the original one and all sixteen results pan together Use the horizontal scroll bar to move the data along the X axis The data panes scroll synchronously Aligning Results To align results click the Align Mode 4 icon e Select a point in the original result Select points in the other results you want to align with the point in the original result e Access the Display Options dialog box by double clicking in the original result pane If you choose the X axis or the Y axis range the range changes in all of the panes e Disable Compare Synch by selecting Tools Compare Synch e Check zoom align and pan and the panes function independently of each other Close the Compare tab by selecting File Close Tab Sequence Result Report The sequence result report includes additional information when certain Sample Elements are selected in the Report Format dialog box The following table describes what each sample element includes Table 4 27 Sequence Result Report
465. tus Event Type and Progress of a running sample plate or process Status F un Sample Plate Event Type Denature Sample T Pragress Event L 20 20Min I Sample Set 2 128 Min Sample Plate 3 136 Min NOTE Times displayed are approximations B Information Tabs oelect any of four tabs to display the corresponding status details e Sample Lists the sample plate sample names and the method being used e Device Displays the condition or value of devices or parameters e Amp Shows the approximate overall microamperes uA and voltage used during the separation e Life Displays the remaining gel capillary usage and laser hours C Capillary Status Indicates certain capillary usage gel cartridge life and on line status When the life of the gel or capillary array is exceeded the associated indicator turns red When the system is on line the indicator is green GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 61 PN B40154AC Run Module Run Module Overview Window Selection Tabs View data on the Data Monitor Direct Control Log and Instrument Data The following topics describe these windows Data Monitor Window The following example shows the Data Monitor window To open this window select the Data Monitor tab This window displays information associated with a sample s analysis A B Data Monitor Direct Control Log Instrument Data 24 23 25668 G4 2
466. tware automatically determines and matches the orientation of the sequences forms the consensus aligns the consensus with the reference sequence and provides a detailed report of the differences The Sequence Investigator provides a number of tools you can use to inspect and edit the data before generating the final report The navigator toolbar allows you to jump to points of interest from specific base sequences to a variety of discrepancies in the aligned data set The discrepancy map provides an overview of the coverage of the reference sequence by the sequences and indicates the locations of the discrepancies Together these alignment inspection editing and reporting features make Sequence Investigator an ideal tool for identifying mutations or polymorphisms in DNA Main Window Figure 5 1 shows the Sequence Investigator screen layout This consists of a title bar menu bar several toolbars the display window and the status bar GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 171 PN B40154AC Sequence Investigator Module Sequence Investigator Module Overview A B C D MM Sequence Investigator lt Untitled gt m dE xi QO File Edit View Window Help 81 x Dam slale Axa alle ez aga etna E RENE UE Me C Codon Number 5 76 77 78 79 80 81 82 83 84 5 86 87 88 89 90 391 Consensus Attribute Search KZ HMienatehTl Reference AA Translation N L L T A B T Q
467. ucleotide or amino acid mutations To create the file enter the text of the sequence starting in the first line of the text editor You may break the sequence text into several lines NOTE To create a reference file from the Sequence Analysis module export the data in seq format or choose txt with only Result Output checked To enter known protein or nucleotide mutations l On the line below the reference sequence type an open bracket followed by KNOWN AA MUTATIONS and or KNOWN BASE MUTATIONS then type a closed bracket 2 Onthe next line type the current reference amino acid or base the position number using the amino acid or base number then the expected amino acid or base change The following example shows a sample reference GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 179 PN B40154AC Sequence Investigator Module Sequence Investigator Procedures 180 F referencel Ext Notepad Id x File Edit Format wiew Help TCATTGACAGTCCAGCTGTCTTTTTCT6GGC AGCACT AT AGGSCTGTACTGTCCATTTATCAGGATGUGAGTTCAT AACC CATCCABAC GAARTGGA RGSTTCTTTCTGATGTTTTTTaOTCTGaTGTGGoTAAGTCCCCACCTCOCAARCAGATGOGTTGTCTCA GUCTCCTCTATTTTTGTTCTATGCTGCCCTATTTCTAAGTGCAGATUCCT AC AT ACABATCATCCATGTATTGAT AGATA ACTATGTCTGGATTTTGTTTTCTAAAAGGCTCTAAGATTTTTGTCATGCTACTTTGGAATATTGCTGGTGATCCTTT COATCOCC TOT GSOA4RCACATTOTACTGATATCTAATCOCOTOSTSTCTCATTOTTTATACTAGSTATGORT AAA TCA TATACTTCCTGAAGTCT TATCT A AGO GA AC TO AA B AAT AT
468. uide For n Vitro Diagnostic Use PN B40154AC Run Module Using Direct Control Figure 3 31 Loading the Buffer Plate and Buffer Evaporation Cover 1 Front Location 4 Buffer Evaporation Cover Alignment Notch 2 Buffer Evaporation Cover 9 Wetting Tray Retainers 3 Buffer Plate When finished positioning the sample and buffer plates close the Sample Access Cover and then select the position from which the plates were loaded left or right 4 The Capillaries Exposed dialog will display and click Load CAUTION The separation gel within the capillaries will dry out if the capillaries are left exposed to the air for more than 15 minutes Loading the Sample Plate and Buffer Plate For Single Rail System l Select Direct Control Unload Plates from the menu Unload Plates x Please prepare your plates before clicking an Unload You have 15 minutes to change plates ance you click an Unload This time limit is critical sa that the Cancel capillaries are not adversely affacted by prolonged exposure to air Help The capilares will automatically be immersed in Ehe Wetting Tray after the plates are loaded Figure 3 32 Unload Plates Dialog Box GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 79 PN B40154AC Run Module Using Direct Control 2 Click Unload The Capillaries Exposed dialog will appear Capillaries Exposed x ou may now open the sample access cover to load plates Ca
469. uide For n Vitro Diagnostic Use 363 PN B40154AC Maintenance and Diagnostics Direct Control and Replenishment 901597L Al Figure 9 34 Removing Replacing the Array Fitting 1 Guide Pins 4 Gel Strand 2 Eject Lever 5 Optics Base Plate bottom 3 Array Fitting 6 Array Fitting 9 Grasp the electrode block tab Figure 9 34 and pull the block out and away from the instrument If removal of the block tab is difficult use the eject lever to assist 10 From the Remove Capillary Array dialog box Figure 9 31 select the Replace Capillary Array option and click OK 364 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Maintenance and Diagnostics Direct Control and Replenishment 901602 Al Figure 9 35 Removing Replacing the Electrode Block 1 Guide Block Pins 2 Electrode Block CAUTION Always grip the capillary array fitting near the end during removal or installation of the tip cap to prevent flexing and possible breakage of the capillary array as shown below 900654L Al Figure 9 36 Array Fitting 365 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Maintenance and Diagnostics Direct Control and Replenishment 366 11 While holding the Array Fitting tab of the new capillary array align the Array Fitting Figure 9 36 with the manifold opening and guide pins Push the fitting into the manifold un
470. ults equence amp nalusizParame DefaultFragment4nalysisParamet DefaultShPAnalsisParameters Print Report Export Data DefaultGexPAnalysisP arameters Figure 2 17 Analysis Tab Selecting a Parameter Set Printing the Plate Report or Specifying Sample Plate Print Options Define the print options and report format for the currently open sample plate With a cell highlighted select the Analysis Tab 2 Select the Print Report check box M to print a report immediately after completion of the run 3 Click Edit Print Format For Plate The Report Format dialog box opens Verify or select the Printer and Page Layout options e If desired click Colors and verify or modify the trace colors of the Raw Data and or Analyzed Data then click OK 5 Inthe Sample Elements area of the Report Format dialog box select each element to be printed e If desired click Options and verify or change the Raw Data Sequence Analysis Result Data Fragment Analysis Result Data Base Sequence Grouping and Current Trace Options selections in the Print Options dialog box then click OK 6 Click OK on the Report Format dialog box to save the changes and close the dialog box 42 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Sample Setup Module Using the Sample Setup Module Report Format E Printer Properties Status Ready Colors Type Microsott Office Document Image Writer Driver
471. ure 3 17 System Preferences Dialog Box Ot ae e Enter the System Name and Operator Name Select the Project Name Define Dye Names for the Fragment Analysis module if desired Enable or disable the alarms Click OK Running Sample Plates To run two sample plates once plate information has been created and saved for both plates 6 ra 8 Select Run Start Sample Plate The Sample Plate Run Configuration dialog box opens Select the name of the sample plate from the Sample Plate Name drop down list for the Left and Right Plates Click Load Plates The Access Plates dialog box opens Click Start The Capillaries Exposed dialog box opens Follow the screen instructions in Capillaries Exposed dialog boxes to load the wetting tray sample plate and buffer plate by following the instructions Click Load to finish loading plates Verify the sample position in the plate Click Start to initiate the run NOTE If the working database exceeds 500 MB an error message appears If this happens follow then troubleshooting procedures described in Database Size on page 69 then return to these steps 68 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Run Module Using the Run Module Database Size If you select a database that is greater than 1700 megabytes the following warning message appears when you create and run a sample plate Run Control Ea e The size of the current wor
472. ure that the wall outlet receptacle is properly wired and earth grounded e DO NOT use a three to two wire plug adapter e DO NOT use a two wire extension cord or a two wire multiple outlet power strip e Disconnect power to the system before performing maintenance GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use Vii PN B40154AC Safety Information e DO NOT remove any panels panels should be removed only by qualified service personnel WARNING A high voltage power supply is used with this instrument Safety interlocks disable high voltage output while the capillary access cover is open and remove the risk of shock while performing routine instrument functions However removal of any panel may expose an individual to the possibility of severe electrical shock and or mechanical injury For this reason any service requiring removal of a panel or otherwise overriding or disabling safety interlocks must be done by AB SCIEX personnel only Moving Parts Moving parts are limited to the sample handling system Plate movement is safety interlocked through the sample access cover To avoid injury due to moving parts observe the following e Keep loose clothing and hair away from the plate area e Never attempt to physically restrict movement of the plate assembly Laser Safety WARNING The GenomeLab Instrument uses a Class 3B laser The 3B classification means that direct intrabeam viewing of this type o
473. utomatically reverse complements the sequences To manually reverse complement a sample right click the desired trace data pane then select Reverse Complement The trace and associated bases are reverse complemented Flipping the Traces You may want to switch the order of sequence displayed To move the sequence trace shown in the top trace pane and exchange its position with the bottom trace select Edit Flip Traces or right click in one of the trace data panes and select Flip Traces This exchanges the position of the sequences in both the alignment pane and the trace panes Trimming the Bases When you first open or create a compared sequence result the sequences used in the comparison appear in the alignment pane You can then trim the ends of the sequences If sequences are not shown select View Sequences to display the sequences in the alignment pane To trim the sequence l Selecta group of sequence bases at either end of the sequence 2 Click the Trim icon to remove unwanted bases from the alignment This deletes the bases from the text and trace data views NOTE You may only trim at either end of the sequence You may not trim within the sequence After each trim the system automatically aligns and redisplays the alignment text and traces NOTE The system adds trim operations to the history log along with bases trimmed with date and time of trim operation To access the history log select View History Searchi
474. utton As the system proceeds with the re analysis the progress bar will be active and the lower dialog box will record and display the analysis log for each sample as it is re analyzed GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Gene Expression Set up Locus Tag and Allele IDs S Result Set View r Results SY SS Exclusion Filter Set result 5 Reanalyze Data Steps Locus T ags Time started 4 25 2014 5 45 00 PM Analyze Data Status LSTD GUS 030223188 2 23 2009 6 46 10 PM 4 25 2014 5 45 01 PM L STD G10 030223188P 2 23 2009 6 46 14 PM 4 25 2014 5 45 01 PM LSTD G11 902231882 2 29 2008 6 46 16 PM 4 25 2014 5 45 01 PM LSTD G12 0902231898 2 23 2008 6 46 20 PM 4 25 2014 amp 4502 PM LSTD H l n3p2o3iSbF 2 23 2008 6 45 48 PM 4 25 2014 amp 4502 PM L STD H 2 0902231 86N 2 23 2008 6 45 50 PM 4 25 2014 5 45 02 PM L5TD H 3 0902231867 2 23 2008 amp 45 54 PM 4 25 2014 5 45 02 PM PM 4f 2 23 2008 6 46 00 PM 4 25 2014 5 45 05 PM 2 23 200 02 PM 4 25 2014 5 45 05 PM L STD HO lt 96 46 04 PM pass 4 25 2014 5 45 05 PM Dye 3 QuantStdat 0 00 2 0 00 min amp mt s O 000g Dye 4 QuantStdat LOO 4 O00 min amp mt 0 000 g exec PreLoad completed successfully Operation PreLoad succeeded Identify Alleles Stark Identify Alleles Processing locus Human Ref Identify Alleles 71 fragme
475. vel to rise into the eight cannula recesses of the wetting tray lid nor drop below the fill level indicator line The top surface of the wetting tray lid must remain clean and dry under any and all circumstances GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Getting Started Operating the System Starting the Sample Plate Run For Dual Rail System l Select Run I Start Sample Plate The Sample Plate Run Confirmation dialog box is displayed Sample Plate Run Confirmation Ea Left Flate Right Flate Operator Hame Operator M ame Save ta Project Default Save to Project Default Plate Loaded C Run this plate first Plate Loaded C Run this plate first Sample Plate Barcode Sample Plate Barcode Sample Plate Name Sample Plate Name Mite Edit thie sample plate contiguration Wie Edit this sample plate contiguration Load Plates Replace Gel Cartidge Details Cancel Help Figure 1 13 Sample Plate Run Confirmation Dialog Box 2 Select the desired project on the appropriate side left or right for each prepared sample plate and click OK 3 Click Load Plates The Access Plates dialog box is displayed Access Plates Ea IF vau are going to load new plates please Start prepare your plates before clicking on Start You have 15 minutes to change plates once you click on Start came This time limit is critical sa that the Help capillari
476. vidual fragments that have been identified within the various samples See Using Fragment Lists on page 237 for more information Applying Exclusion Filters to the Result Set Data A Filter Set is a collection of any number of filters that are either pre defined by the system or user defined The purpose of the Filter Set is to exclude any results that do not meet the criteria of the Study and to include results that do For example suppose that your result set contains multiple samples collected under two different sets of fragment analysis parameters One of these parameter sets used the SizeStandard 400 to determine the fragment sizes while the second parameter set used the SizeStandard 600 to make the determination To exclude any data that were analyzed with the SizeStandard 600 1 Open the drop down list in the Name column of the Filter Set area and select SS Size Standard Open the drop down list in the Operator column of the Filter Set area and select z Open the drop down list in the Values column of the Filter Set area and type in SizeStandard 600 4 Click Apply at the top of the Filter Set area All samples in the fragment results table that used the SizeStandard 600 are highlighted in teal visible by selecting this parameter for display This indicates that they have been excluded from the Study The Excluded column in the Summary area has increased by the number of samples using the SizeStandard 600 There are man
477. w movement of the wetting tray retainers Figure 9 9 Replacing the Wetting Tray 1 Front Location 2 Wetting Tray Well 3 Wetting Tray Lid 6 Close the sample access cover 901598L Al 4 Wetting Tray 9 Wetting Tray Retainers 6 Sample Plate Holder 7 Click Done on the Replace Wetting Tray dialog box Figure 9 10 Replace Wetting Tray Ea You may now open the sample access door and replenish the wetting tray Done Open the sample access cover and remove the Wetting Tray Close the sample access cover and select the location where you wish the capillaries to be immersed after you click on Done Capillaries exposed to air JU Time Remaining min sec fia far Capillary Array Location Position Ser Plates Location C Sample Plate C Buffer Plate f Wetting Tray Figure 9 10 Replace Wetting Tray Dialog Box 348 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Maintenance and Diagnostics Direct Control and Replenishment 9 2 Direct Control and Replenishment The following procedures provide system replenishment procedures using the Run module s Direct Control functions To access these functions use the Run module s Direct Control menu the Replenish menu and the selectable areas of the Direct Control window NOTE Use Figure 9 1 to locate hardware components referenced in this section
478. w under the Dye Matrices tab which provides a Save as System Dye Spectra option GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 217 PN B40154AC Fragment Analysis Module Using the STR Locus Tag Editor 6 5 Using the STR Locus Tag Editor The STR Locus Tag Editor allows you to create a new Short Tandem Repeat STR Locus Tag or edit an existing one to be used for STR analysis You can access this editor from the STR Locus Tag tab of the Analysis Parameters window see STR Locus Tags Tab on page 212 Locus Tag Editor IP xi Locus Tag a4 T TS3AU Save As Project aA T TS3AU Date last modified 4 18 2001 3 22 06 PM Allele ID Criteria Locus Information Ancillary Information Locus Mame GATA S3ALT Primer set name GATA J3407 Dye x GenBank Accession Fragment length range between 310 E 3 15 n Repeat unit sequence gata Repeat unit length 4 nt zaj Ploidy of repeats in shortest Allele 1 Allele Naming Convention Primer Label Primer Sequence fe amimelace Shortest Allele size Forward Forward FT te 3 EN Alphabetic Start at ATEM 340 d so Reverse 5 ta 3 f None Numeric Start at 1 Generate Allele List Comment Figure 6 17 Locus Tag Editor The Locus Tag Editor contains two tabs for creating or editing locus tags the Locus Tag tab and the Allele ID Criteria tab The top of the window displays the locus name and project
479. ws the color coded regions of interest associated with the specified attributes A red marker behind the reference sample and consensus bars corresponds to the selected area in the trace data view and the selected base in the trace text view You can use this toolbar to navigate to desired areas by clicking on any point of interest The alignment and trace data panes refresh and display the area GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Sequence Investigator Module Sequence Investigator Procedures For a global view of the desired attributes select the corresponding check boxes located on the right side of the map For each selected attribute the system adds a new bar to the consensus area showing the locations where selected attributes exist To change the color code of the attribute display l Click on the color well at the left of the attribute The color palette for the selected well opens Select a new color Click OK The discrepancy map uses the newly selected color Printing Reports You may print a report for the active compared sequence result To set up a report Select File Report Format Select the default printer from the Printer Name down down list Set your preferred page layout by selecting Portrait or Landscape pr M we Select the option elements you want displayed in your report Table 5 9 Element Description Header Prints information such as the nam
480. wse to locate the folder where the file resides Select the import format from the Files of type drop down list Select the filename pu uen e gi Click Import GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 333 PN B40154AC Database Management Data Manager Procedures Generating a Sample Run History 1 Select View Sample Run History The Sample Run History dialog box opens Select a Project name from the drop down list Select Enable and enter a filtering start and end date Click Compute pe xv n de View the total number of runs during the specified dates in the Total Sum of Samples Run field 6 Ifdesired print a report of all samples run during the specified dates by clicking the Print button Administrative Tools The System Administrator can access the database without logging onto the computer as an Administrator Before using the Administrative Tools an Administrator must first set up a group and assign to it the users to have access to the CE system databases Users and Groups Adding Users and Groups is done outside of the CE system After creating the CEQUSERS group and adding users to it you must activate the group within the Data Manager module Adding Users 1 Select Start Settings Control Panel Administrative Tools Computer Management The Computer Management console opens see Figure 8 10 m Computer Management E m File Action View Window Help zm me
481. xt This file must be stored in the CE systems export or root directory This text file must have only one locus name per line The order of the loci included in this file determines the order of the loci in the DMPopulation file The DMPopulation export also requires that pedigree information at least the Individual ID be included in every result in the Study Additionally at least one result per individual must have a complete pedigree Population ID PopID Pedigree ID KinID Individual ID SubID Mother ID MID Father ID FID and Gender Sex Pedigree information is associated with samples through the sample plate editor using the sample property sets Pedigree template As an alternative you can associate the pedigree information with results using the single result view s property set tab Genotype Summary Report tab delimited gsr Accommodates Subject IDs the occurrence of more than two alleles and the absence of alleles as shown in the following illustration Use the Locus List Editor to customize the LocusList txt file before exporting a Genotype Summary Report For details see Creating a Genotype Summary Report on page 260 The report layout is described below e Column Row Individual headings are replaced with the heading of Subject ID e If the number of alleles is greater than two the cell will indicate Too many When an allele is not found the empty cell is replaced with Unknown Allele
482. y Description Includes the trace associated with the voltage output of the system during the sample set run Contains all of the steps used to perform the base calling routine on the raw data Contains all of the actions performed and instrument messages for the sample run Contains the details of the method used to perform the sample run This is the information found on the Method tab of the Properties dialog box shows the parameters used to produce result data and output for a given sample including heterozygote detection and alignment If the data has been analyzed using a sequence analysis parameter set the sequence analysis parameter set will be printed In addition the alignment template and the alignment parameters information will be included in this section when applicable This information is available on the Analysis and Alignment tabs of the Properties dialog box It includes alignment information only if an alignment was performed Includes the parameters that indicate that any given base is an A C G or T along with a value to indicate the likelihood that the call is correct Shows the parameters used in quality based and sequence based trimming It includes the original sequence length the length after quality based sequencing the length after sequence based trimming the vectors trimmed and the base sequence in its original and trimmed forms For sequence based trims an x replaces the trimmed bases that
483. y To install a manifold plug select Install Cancel manifold plug Help To clean the capillary windows select Clean capilares Remove Capillary Array Options Replace capillary array C Install manifold plug C Clean capillaries Capillaries exposed to air L Time Remaining min sec pna fie Figure 3 40 Remove Capillary Array Dialog Box Open the Sample Access Cover Figure 3 41 and lift it to the vertical locking position Open the Capillary Access Cover and lift it to the vertical locking position Disconnect the two rubber latches holding the Capillary Temperature Control cover and lift the cover to the vertical locking position 5 Loosen the Manifold Access Cover captive screw Figure 3 41 then remove the cover and set it aside 86 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Run Module Using Direct Control H o o 2 z i m Figure 3 41 Manifold Access Cover 1 Capillary Temperature Control Cover 4 Captive Screw open 2 Plenum Assembly 5 Manifold Access Cover removed 3 Manifold Access Cover 6 Loosen the two Plenum Assembly captive screws Figure 3 42 then pull the Plenum Assembly straight back and away from the instrument and set it aside CAUTION Slowly remove the Plenum Assembly as
484. y on page vii e Moving Parts on page viii e Laser Safety on page viii Notes and Warnings GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC The following information describes the notes and warnings used in this document NOTE Contains supplemental or explanatory information concerning the current topic or procedural step IMPORTANT Used whenever an action or circumstance may potentially cause personal injury Mechanical damage may also result Also can contain information about a possible software program failure draw attention to a specific software setting or point out that a loss of data may occur if information stated within the paragraph is not adhered to or if procedures are executed incorrectly CAUTION Used to prevent equipment damage To disregard that caution may cause mechanical damage however personal injury is not likely WARNING If the equipment is used in a manner not specified by AB SCIEX the protection provided by the equipment may be impaired Safety Information Safety Symbols The symbols displayed below and on the instrument should remind you to read and understand all safety instructions before attempting installation operation maintenance or repair to this instrument N N 4A HIGH VOLTAGE Paragraphs marked by this symbol indicate that a potential hazard to your personal safety exists from a high voltage source ATTENTION SAFETY SYMBOL This symbol
485. y as long as they are located in the same database Multiple results from multiple databases may not be combined into the same Study Continue making selections from the list of available projects and data until all of the desired samples have been added to the Raw Data Selected area 5 Click Next to proceed to the Analysis Parameters window Selecting Raw Data from the Plate View Tab The Plate View tab allows you to make your selections from a visual representation of the sample plate 1 Select the Plate View tab in the Select Raw Data window Steps Haw Data Plate View Project AFLP 06 TP2 20 Haw Data Legend Ii No Data Avaicbie Analysis Parameters o Selected For Analysis e Data Available e Selected For Re Analysis o Data Already Analyzed Analyze Data Result Data Selected Wells Name Dae 12 3 4 5 6 7 8 9 10 11 12 A B C D E E G H Previous Einish Cancel Figure 6 8 Selecting Raw Data from the Plate View Tab 202 GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Fragment Analysis Module Working with Studies in the Fragment Analysis Module 2 Select the project folder that contains the sample data that you want to include in the Study from the Project drop down list NOTE If the desired project is not listed it may be located in a different database To enter a different database you must close all applications and set the working database See
486. y filters available You must apply each one using an operator and a value You can apply any number of filters to a result set and save the filter sets for future use You can assign filter sets to filter out samples with excessive baseline noise excessively broad peaks no size standard out of calibration range etc This second level filtering leaves only the results you are sure of and saves you the time of removing unwanted fragment data later Finding Exclusion Filters You can find all of the exclusion filters in the drop down list available in the Name column of the Filter Set area Once you have selected the name of the filter to use you must select an operator usually lt gt etc and a value to be applied to the filter Refer to the online help for detailed descriptions of the available exclusion filters and their use GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use PN B40154AC Fragment Analysis Module Using the SNP Locus Tag Editor Viewing the Summary The Summary area displays a table that identifies the number of samples that have been affected by the application of exclusion filters As you manipulate the result set you can view the number of samples excluded from your Study based on your filter set parameters The Summary displays the following The number of results that are included in result set within each sample capillary A H As samples are filtered out of the re
487. ys ambiguity codes where appropriate Sequence Analysis Parameters Editor DefaultSequenceAnalysisPar E3 Quality based Trimming Sequence based Trimming Alignment Reference General Initial Data Detection Heterozygote Detection z of Average Peak Spacing ro r Height Ratio fao r Sensitiity 0 25 Range From so nt to faso nt or to fio nt before the last called base oe Ad El Save As Print Cancel Help Figure 4 12 Heterozygote Detection Tab Sequence Analysis Parameters Editor NOTE Ifyou opened this dialog box by selecting View Parameters Used to Compute Sequence this dialog box displays the analysis values but disables the fields described below GenomeLab Genetic Analysis System User s Guide For n Vitro Diagnostic Use 127 PN B40154AC Sequence Analysis Using the Sequence Analysis Module 128 The following table describes the options available on the Sequence Analysis Parameters Heterozygote Detection tab Table 4 19 Heterozygote Detection Tab Sequence Analysis Parameters Editor Option Description Detect Heterozygotes Select this check box 1 if you want heterozygotes detected When selected the N Threshold on the General tab is disabled and N s will not be called The system detects heterozygotes after it determines the final basecall It detects peaks that meet the sensitivity criterion and examines each called base to determine if another

GeXP User Manual - Beckman Coulter

Contents

Download Pdf Manuals

Related Search

Related Contents