Diversify® PCR Random Mutagenesis Kit User Manual
Contents
1. 0 9 73 5 4 6 1 3 2 9 9 8 1 3 9 13 7 Truly Random 0 5 1 0 As Table Il shows a high mutagenesis rate condition 9 and low bias condition 5 are mutually exclusive for a given number of cycles Buffer condition 5 has minimal mutational bias and is the best choice for most directed evolution applications Please note however that despite its mutational bias buffer condition 9 has given useful results in a number of applications Nishiya and Imanka 1994 You and Arnold 1994 Melnikov and Youngman 1999 If you wish to have a higher mutagenesis rate with minimal mutational bias you may perform ad ditional rounds of PCR at buffer condition 5 For example Shafikhani et al 1997 obtained a rate of 29 2 mutations per 1 000 bp using a reaction similar to buffer condition 5 They achieved this high rate by performing six sequential rounds of PCR diluting the product after each round This rate corresponds to 4 9 mutations per 1 000 bp per round equivalent to the rate of buffer condition 5 Protocol No PT3393 1 www clontech com Clontech Laboratories Inc Version No PR812469 Diversify PCR Random Mutagenesis Kit User Manual IV General Considerations continued D Control Reaction To ensure that the mutagenesis reaction is working correctly you should perform the Taq PCR Fidelity Assay Figure 2 in parallel with your experimental reactions In this assay a DNA sequence containing a series of pseudo Taq restriction2. No 5 338 671 GeneAmp is a registered trademark of Applera Corporation Clontech the Clontech logo and all other trademarks are the property of Clontech Laboratories Inc unless noted otherwise Clontech is aTakara Bio Company 2008 Clontech Laboratories Inc Protocol No PT3393 1 www clontech com Clontech Laboratories Inc Version No PR812469 19
3. Protocol No PT3393 1 www clontech com Clontech Laboratories Inc Version No PR812469 7 Diversify PCR Random Mutagenesis Kit User Manual IV General Considerations PLEASE READ ENTIRE PROTOCOL BEFORE STARTING A Template and Primer Design Although the PCR reaction has been optimized for mutagenizing a 1 kb sequence longer templates can be amplified by increasing the extension time as described in SectionV A Dilute template to 1 ng ul before use Primer design is the single largest variable in PCR applications and the single most important factor in determining the success or failure of PCR reactions Always check and recheck your primer design before constructing or ordering primers For the Diversify protocol we rec ommend that primers have the following characteristics e T around 70 C e Length greater than 22 nucleotides 25 to 30 mers are optimal e 45 60 GC content e 10 uM in concentration each Additionally ensure that the 3 terminal ends of the primer pair are not complementary and have alow G C content Furthermore primers should not contain sequences that create stable internal hairpin loops If desired you may incorporate restriction sites into your primers Choosing Buffer Conditions The kit is intended for studying wild type protein function and for di rected protein evolution For studying wild type protein function we suggest creating a single amino acid substitution per protein which cor
4. clontech com Protocol No PT3393 1 Version No PR812469 Diversify PCR Random Mutagenesis Kit User Manual IV General Considerations continued TABLE I MUTAGENESIS PCR REACTION BUFFER CONDITIONS Buffer Condition 1 2 3 4 5 6 7 8 9 Std Mutations per 1 000 bp 2 0 23 2 7 35 46 48 58 72 8 1 0 4 MnSO uM final rxn 0 160 320 480 640 640 640 640 640 0 dGTP uM final rxn 40 40 40 40 40 80 120 160 200 200 Standard PCR reaction using TITANIUM Taq DNA Polymerase C Mutational Bias The mutational bias or tendency of mutagenesis reactions to favor one type of mutation over another varies among the PCR conditions shown inTable I A common method for evaluating mutational bias is to consider the ratio of transitions to transversions Ts Tv Transition mutations comprise purine purine and pyrimidine pyrimidine changes transversions are purine pyrimidine type mutations Another method is to consider the extent to which A orT bases are converted to G or C bases and vice versa AT gt GC GC gt AT The mutational bias for buffer conditions 1 5 and 9 has been determined by sequencing and is shown below inTable Il along with the ideal val ues characteristic of a truly random mutagenesis Detailed information about the types of mutations is provided in the Appendix TABLE II MUTATIONAL BIAS FOR DIVERSIFY MUTAGENESIS Buffer Condition Mutations per Ts AT gt GC from Table I 1 000 bp Tv GC gt AT 1 2 0
5. the PCR reagents pipettors or PCR reaction tubes are contaminated with previously amplified targets If possible set up the PCR reaction and perform the post PCR analysis in separate laboratory areas with separate sets of pipettors Laboratory benches and pipettor shafts can be decontaminated by depurination Wipe surfaces with 1 N HCI followed by 1 N NaOH Then neutralize with a neutral buffer e g Tris or PBS and rinse with ddH O We advise using commercially available aerosol free pipette tips E Mutation rate too high or too low Ifclones resulting from your mutagenic PCR reaction are mostly inactive the mutation rate may be too high Try using a buffer condition with a lower rate of mutagenesis Ifthe mutation rate is stilltoo high using buffer condition 1 Table Ill the error rate of a standard PCR reaction may be sufficientto randomly mutate your gene of interest This technique might be useful for very large proteins that are also hypersensitive to mutation Ifthe error rate is too low for your application at your preferred level of mutational bias see Section IV C you can perform multiple rounds of PCR diluting the product 1 000 fold for each subsequent reaction The optimal dilution factor may vary depending on your specific template and the yield of the PCR reaction Protocol No PT3393 1 www clontech com Clontech Laboratories Inc Version No PR812469 Diversify PCR Random Mutagenesis Kit User Manual VII R
6. Il Mutational bias for Diversify mutagenesis 9 Table Ill Mutagenesis reactions 11 Table IV Diversify mutagenesis sequencing data 18 Protocol No PT3393 1 www clontech com Clontech Laboratories Inc 3 Version No PR812469 Diversify PCR Random Mutagenesis Kit User Manual l Introduction PCR based random mutagenesis is widely used for analyzing wild type protein function and creating proteins with new or improved functions e g directed protein evolution The procedure generally involves performing a PCR reaction under conditions that reduce the fidelity of nucleotide in corporation cloning the resulting PCR fragments and then screening the resulting library for novel mutations which affect protein activity You et al 1994 Wan et al 1998 Melnikov et al 1999 PCR based random muta genesis has gained popularity over chemical methods e g nitrous acid hydroxylamine etc since it produces higher levels and a larger variety of mutations Fromant et al 1995 Additionally PCR based random mutagen esis has advantages over the use of nucleotide analogs because analogs have an increased bias for certain point substitutions and must be removed from PCR products prior to cloning The Diversify PCR Random Mutagenesis Kit offers a variety of buffer condi tions for performing random mutagenesis allowing you to adjust the reac tion for a desired error rate The kit is based on the methods of Leung et al 1989 and Cadw
7. KCI 2 mM 0 1 mM EDTA pH 8 0 2 0 uM 0 25 Tween 20 0 005 0 25 Nonidet P 40 0 005 e 200 ul 10XTITANIUM Taq PCR Buffer Concentration Final rxn in 10X mix Component concentration 400 mM Tricine KOH pH 8 0 at 25 C 40 mM 160 mM KCI 16 mM 35 mM MgCl 3 5 mM 375 ug ml BSA 3 75 ug ml e 30 pl 50X Diversify dNTP Mix e 40 ul 50X dNTP Mix standard dNTP mix 10 mM each of dATP dCTP dGTP and dTTP e 150 ul dGTP 2 mM final concentration variable from 40 to 200 uM e 120 pl Manganese Sulfate MnSO 8 mM final concentration vari able from 0 to 640 uM e 10 pl Control PCR Template 1ng ul e 10 pl Control Primer Mix 10 uM each Forward Primer 5 GAGCCTATGGAAAAACGCCAGCAAC 3 Reverse Primer 5 GCAAAAAAGGGAATAAGGGCGACAC 3 e 10 wl Taqi Restriction Enzyme 20 units ul e 1 25 ml PCR Grade Water Clontech Laboratories Inc www clontech com Protocol No PT3393 1 Version No PR812469 Diversify PCR Random Mutagenesis Kit User Manual Ill Additional Materials Required The following reagents are required but not supplied e optional Mineral oil We recommend Sigma Cat No M 3516 e PCR reaction tubes e Thermal cycler Hot lid or non hot lid thermal cycler e Dedicated pipettors e PCR pipette tips suitable to the above pipettors and preferably equipped with hydrophobic filters e DNA size markers 1 kb ladder or equivalent e 10Xgelloading buffer Sambrook amp Russell 2001 provides several recipes
8. R product of buffer conditions 9 and 1 respectively after mock digestion without Taq enzyme Lane M A BstE DNA size markers Clontech Laboratories Inc www clontech com Protocol No PT3393 1 Version No PR812469 Diversify PCR Random Mutagenesis Kit User Manual V Random Mutagenesis Procedure A Setting Up and Running Reactions After deciding which buffer condition s suit your desired level of mu tagenesis set up reactions as shown in Table III At a minimum you should run three reactions one each with buffer conditions 1 and 9 for performing the control Taq PCR Fidelity Assay as well as one for your experimental reaction s 1 Prepare reactions on ice by combining the following reagents in the order shown TABLE Ill MUTAGENESIS REACTIONS Volumes by Buffer Condition ul 1 2 3 4 5 6 7 8 9 Std Mutations per 1 000 bp 20 23 27 35 46 48 58 72 8 1 PCR Grade Water 40 39 38 37 36 35 34 33 32 41 1OX TITANIUM Taq Buffer 5 5 5 5 5 5 5 5 5 5 MnSO 8 mM 0 1 2 3 4 4 4 4 4 0 dGTP 2 mM 1 1 1 1 1 2 3 4 5 0 50X Diversify dNTP Mix 1 1 1 1 1 1 1 1 1 0 50X dNTP Mix 0 0 0 0 0 0 0 0 0 1 Primer mix 1 1 1 1 1 1 1 1 1 1 Template DNA 1 1 1 1 1 1 1 1 1 1 TITANIUM Taq Polym 1 1 1 1 1 1 1 1 1 1 Total volume 50 50 50 50 50 50 50 50 50 50 4Standard PCR reaction using TITANIUM Taq DNA Polymerase bExperimental or Control Primer Mix 10 uM each primer Experimental or Control PCR Template 1 ng ul 2 Mix welland
9. Spring Harbor NY Shafikhani S Siegel R A Ferrari E amp Schellenberger V 1997 Generation of large libraries of random mutants in Bacillus subtilisby PCR based plasmid multimerization Bio Techniques23 2 304 310 Suzuki M Christians F C Kim B Skandalis A Black M E amp Loeb L A 1996 Tolerance of different proteins for amino acid diversity Mol Divers 2 1 2 111 118 Vartanian J P Henry M amp Wain Hobson S 1996 Hypermutagenic PCR involving all four transitions and a sizeable proportion of transversions Nucleic Acids Res 24 14 2627 2631 Wan L Twitchett M B Eltis L D Mauk A G amp Smith M 1998 n vitro evolution of horse heart myoglobin to increase peroxidase activity Proc Natl Acad Sci U S A 95 22 12825 12831 You L amp Arnold F H 1994 Directed evolution of subtilisin E in Bacillus subtilis to enhance total activity in aqueous dimethylformamide Protein Eng 9 1 77 83 Clontech Laboratories Inc www clontech com Protocol No PT3393 1 Version No PR812469 Diversify PCR Random Mutagenesis Kit User Manual Vill Related Products For the latest and most complete listing of all Clontech products please visit www clontech com Products Cat No e TITANIUM Tag DNA Polymerase 639208 639209 e TITANIUM Tag PCR Kit 639211 639210 e Matchmaker Yeast Two Hybrid Systems many Protocol No PT3393 1 www clontech com Clontech Laboratories Inc 17 V
10. T S Z G don f N Diversify PCR Random Mutagenesis Kit User Manual Clontech United States Canada 800 662 2566 Asia Pacific 1 650 919 7300 Europe 33 0 1 3904 6880 roasts Cat No 630703 Clontech Laboratories Inc PT3393 1 PR81 2469 ATakara Bio Compan 1290 Terra Bella Ave Published 23 January 2008 Mountain View CA 94043 Technical Support US E mail tech clontech com www clontech com Diversify PCR Random Mutagenesis Kit User Manual Table of Contents Vi Vil VIII Introduction List of Components Additional Materials Required General Considerations A Template and Primer Design B Choosing Buffer Conditions C Mutational Bias D Control Reaction Random Mutagenesis Procedure A Setting Up and Running Reactions B Taq PCR Fidelity Assay Troubleshooting References Related Products Appendix Mutational Data from DNA Sequencing Clontech Laboratories Inc www clontech com oOo o O NOA 11 11 12 13 16 17 18 Protocol No PT3393 1 Version No PR812469 Diversify PCR Random Mutagenesis Kit User Manual List of Figures Figure 1 The level of Diversify mutagenesis is controlled by varying the concentrations of manganese and dGTP 5 Figure 2 Taq PCR Fidelity Assay 10 Figure 3 Distribution of mutations per clone for different Diversify buffer conditions 18 List of Tables Table I Mutagenesis PCR reaction buffer conditions 9 Table
11. eferences Cadwell R C amp Joyce G F 1992 Randomization of genes by PCR mutagenesis PCR Methods Appl 2 1 28 33 Don R H Cox P T Wainwright B J Baker K amp Mattick J S 1991 Touchdown PCR to circumvent spurious priming during gene amplification Nucleic Acids Res 19 4008 Fromant M Blanquet S amp Plateau P 1995 Direct random mutagenesis of gene sized DNA fragments using polymerase chain reaction Anal Biochem 224 1 347 353 Leung D W Chen E amp Goeddel D V 1989 A method for random mutagenesis of a defined DNA segment using a modified polymerase chain reaction Technique 1 1 11 15 Melnikov A amp Youngman P J 1999 Random mutagenesis by recombinational capture of PCR products in Bacillus subtilis and Acinetobacter calcoaceticus Nucleic Acids Res 27 4 1056 1062 Mo J Y Maki H amp Sekiguchi M 1991 Mutational specificity of the dnaE173 mutator asso ciated with a defect in the catalytic subunit of DNA polymerase III of Escherichia coli J Mol Biol 222 4 925 936 Nishiya Y amp Imanaka T 1994 Alteration of substrate specificity and optimum pH of sarcosine oxidase by random and site directed mutagenesis Appl Env Microbiol 60 11 4213 4215 Roux K H 1995 Optimization and troubleshooting in PCR PCR Methods Appl 4 5185 5194 Sambrook J amp Russell D W 2001 Molecular Cloning A Laboratory Manual Cold Spring Harbor Laboratory Press Cold
12. ell and Joyce 1992 and has been optimized for use with the Clontech TITANIUM Taq PCR system The primary advantages of the kit are e Controlled random mutagenesis the buffer conditions can be varied to achieve the desired level of random mutagenesis e Amplification of large PCR fragments we have confirmed amplifica tion of fragments up to 4 kb in length Theoretically longer fragments can be mutated and amplified as well e High DNA yields using the TITANIUM Taq PCR system which outper forms other PCR systems underthe stress of error prone PCR conditions TITANIUM Tag includesTaqStart Antibody for automatic hot start PCR e Widemutationaldiversity producetransitionandtransversionmutations e Arapid invitrocontrol reaction patent pending thatallowsyoutoconfirm randommutagenesisofacontroltemplatejust2hrsafteryourPCRreaction Diversify PCR mutagenesis provides control over the level of random muta tion by independently varying the amounts of manganese and dGTP in the PCR reaction Figure 1 The mutagenesis rate is first raised by increasing the amount of manganese in the reaction up to 640 uM Further increases in mutation rate are obtained by increasing the level of dGTP in the reac tion while keeping the concentration of manganese constant The kit has been designed to provide mutation rates from 2 to 8 mutations per 1 000 bp making it applicable to large and small PCR products Higher mutation rates can be produced by perfor
13. enzymesitesis amplified under highly mutagenic buffer 9 Table I or weakly mutagenic buffer 1 conditions These sites contain only three of the four bases TCGA required for Taq cleavage Under mutagenic conditions some of these pseudo sites are converted to Taq sites Digestion of the resulting PCR product with Taq enzyme followed by electrophoretic analysis will verify that mutations have been successfully incorporated We recommend that you perform this control alongside your first mutagenesis reaction to verify that the system is working Subsequently the control can be used for troubleshooting Taq PCR Assay Sequence Primer 47 Reverse Primer Control PCR Template PCR amplify 1 kb fragment under highly mutagenic 9 or weakly mutagenic 1 conditions y Cut with Taq I restriction enzyme Yy PCR fragment with Da no mutations AND ae PCR fragment with random mutations Figure 2 Taq PCR Fidelity Assay Following amplification of the Control PCR template and Taq restriction digest a broad band from 550 750 bp should be apparent in the highly mu tagenic sample buffer condition 9 lane 1 but not in the weakly mutagenic sample buffer 1 lane 2 Additionally a second broad band from 250 450 bp representing the small arm of the amplified fragment can sometimes be seen lane 1 Both samples will show a bright band at 1 kb For comparison lanes 3 and 4 show the PC
14. ersion No PR812469 Diversify PCR Random Mutagenesis Kit User Manual Appendix Mutational Data from DNA Sequencing A mutagenized library was constructed and sequenced to determine the frequency and type of mutations introduced The results of this sequence analysis are shown in Table IV Additionally the distribution of mutations per clone is shown in Figure 3 TABLE IV DIVERSIFY MUTAGENESIS SEQUENCING DATA Buffer Condition 1 5 9 MnSO uM 0 640 640 dGTP uM 40 40 200 Total bp sequenced 18 414 20 705 15 148 Mutations per 1 000 bp 2 0 4 6 8 1 Total mutations found 36 96 123 Type of Mutation Ts A7 gt GorTOC 33 3 42 7 74 0 Ts GoOAorC73T 8 3 11 5 4 9 Tv A gt T orT gt A 16 7 26 0 13 8 Tu A gt CorT gt G 27 8 8 3 4 1 Tv G gt Corc gt G 0 0 0 0 1 6 Tv G gt T orC gt A 0 0 6 3 0 8 Insertions 2 8 2 1 0 0 Deletions 11 1 3 1 0 8 Ts Transition Tv Transversion A Buffer condition 1 15 4 Buffer condition 5 Buffer condition 9 Number of clones 0 1 2 3 4 5 6 7 8 9 10 Mutations per clone Figure 3 Distribution of mutations per clone for different Diversify buffer conditions Data represent sequencing results from a 490 bp region of the mutagenized DNA sequence Clontech Laboratories Inc www clontech com Protocol No PT3393 1 18 Version No PR812469 Diversify PCR Random Mutagenesis Kit User Manual Notes Notice to Purchaser Clontech products are to be used for research purposes
15. iversify PCR Random Mutagenesis Kit User Manual VI Troubleshooting continued Mg is too low B Multiple products Too many cycles Annealing temp too low Suboptimal primer design Touchdown PCR needed Contamination TITANIUM Taq performs well at a broad range of Mg concentration Therefore as long as you use the included buffer it is unlikely that a lack of product is due to problems with the Mg concen tration However high concentrations of EDTA or other metal chelators in the template stock solution can reduce the effective concentration of Mg to below a minimum level Reducing the cycle number may eliminate non specific bands Increase the annealing extension temperature in increments of 2 3 C Redesign your primer s after confirming the accu racy of the sequence information If the original primer s was less than 22 nt long try using a longer primer If the original primer s had a GC content of less than 45 try to design a primer with a GC content of 45 60 Touchdown PCR significantly improves the speci ficity of many PCR reactions in various applica tions Don et al 1991 Roux 1995 Touchdown PCR involves using an annealing extension tem perature that is several degrees higher than the T of the primers during the initial PCR cycles The annealing extension temperature is then reduced to the primerT for the remaining PCR cycles The change can be performed either in a single
16. ming a second round of PCR using a diluted aliquot of the primary mutagenesis reaction Shafikhani et al 1997 Clontech Laboratories Inc www clontech com Protocol No PT3393 1 4 Version No PR812469 Diversify PCR Random Mutagenesis Kit User Manual I Introduction continued Three of the mutation rates shown in Figure 1 buffer conditions 1 5 and 9 were determined directly by DNA sequencing see Appendix The remain ing intermediate points were determined by correlating mutagenesis levels from a reproducible quantitative in vivo fidelity assay Mo et al 1991 with results from DNA sequencing 10 0 700 Mutations 600 8 0 o M n2 500 m dGTP ee 400 4 0 a IN dL9P 10 zuN 200 Mutations per 1 000 bp 2 0 100 0 0 1 2 3 4 5 6 7 8 9 Buffer Condition Figure 1 The level of Diversify mutagenesis is controlled by varying the concentrations of manganese and dGTP The concentrations of other dNTPs are held constant Protocol No PT3393 1 www clontech com Clontech Laboratories Inc Version No PR812469 Diversify PCR Random Mutagenesis Kit User Manual ll List of Components Store all components at 20 C The following reagents are sufficient for30 mutagenesis reactions of 50 ul each e 30 pl 50XTITANIUM Taq DNA Polymerase includes TagStart Antibody Concentration Final rxn in 50X mix Component concentration 50 Glycerol 10 20 mM Tris HCI pH 8 0 0 4 mM 100 mM
17. nealing temperature inincrements of 2 4 C Redesign your primer s after confirming the accu racy of the sequence information If the original primer s was less than 22 nt long try using a longer primer If the original primer s had a GC content of less than 45 try to design a primer with a GC content of 45 60 Repeat PCR using a higher concentration of DNA after trying more cycles Check template integrity by electrophoresis on a standard TBE agarose gel If necessary repurify your template using methods that minimize shear ing and nicking Optimizedenaturationtemperature bydecreasingor increasing it in 1 C increments A denaturation temperature that is too high can lead to degra dation of the template especially for long target sequences Optimize denaturationtimebydecreasingorincreas ing it in 10 sec increments A denaturation time that is too long can lead to degradation of the template especially for long target sequences Especially with longer templates Increase the extension time in 1 min increments TITANIUM Taqis supplied at an optimized 50X con centration Therefore try to optimize the cycle pa rameters as described above before increasing the enzyme concentration In rare cases the yields can be improved by increasing the concentration ofthe enzyme mix However increasing the concentra tion gt 2X is likely to leadto higher background levels www clontech com Clontech Laboratories Inc D
18. only They may not be used for any other purpose including but not limited to use in drugs in vitro diagnostic purposes therapeutics or in humans Clontech products may not be transferred to third parties resold modified for resale or used to manufacture commercial products or to provide a service to third parties without written approval of Clontech Laboratories Inc Use of this product is covered by one or more of the following US patents and corresponding patent claims outside the US 5 079 352 and 6 127 155 The purchase of this product includes a limited non transferable immunity from suit under the foregoing patent claims for using only this amount of product for the purchaser s own internal research No right under any other patent claim such as method claims in U S Patents Nos 5 210 015 5 487 972 5 994 056 and 6 171 785 and no right to perform commercial services of any kind including without limitation reporting the results of purchaser s activities for a fee or other commercial consideration is hereby conveyed by the purchase of this product expressly by implication or by estoppel This product is for research use only Diagnostic uses require a separate license from Roche Further information on purchasing licenses may be obtained by contacting the Director of Licensing Applied Biosystems 850 Lincoln Centre Drive Foster City California 94404 USA TaqStart and other Hot Start Antibodies are licensed under U S Patent
19. oth reaction mutagenesis conditions should show a bright band at 1 kb The 1 kb band will typically be brighter in con dition 1 In condition 9 a broad band from 550 to 750 bp indicates that random mutations were successfully introduced After verifying that the control reaction was successful you may proceed to construct a mutagenized library by cloning the PCR products of your experimental mutagenesis into the vector of your choice For TA cloning we recommend the AdvanTAge PCR Cloning Kit Cat No 639507 Clontech Laboratories Inc www clontech com Protocol No PT3393 1 12 Version No PR812469 VI Troubleshooting Diversify PCR Random Mutagenesis Kit User Manual A No product observed PCR component missing or degraded Too few cycles Annealing temp too high Suboptimal primer design Not enough template Poor template quality Denaturation temp too high or low Denaturation time too long or too short Extension time too short Too little enzyme Protocol No PT3393 1 Version No PR812469 Use achecklist when assembling reactions Always perform the Taq PCR Fidelity Assay to ensure that each component is functional If this positive control does not work repeat the positive control only If the positive control still does not work repeat again replacing individual components to identify the faulty reagent Increase the number of cycles 3 5 additional cycles at a time Decrease the an
20. responds to approximately 1 5 mutations per gene Vartanian et al 1996 This level of mutagenesis allows you to independently charac terize the effect of each amino acid substitution on protein function For directed protein evolution mutagenesis rates that average 2 to 6 mutations per gene are regarded as most effective for creating mutant libraries to find proteins with enhanced activity Shafikhani etal 1997 Mutational levels beyond 6 mutations per gene usually result in the complete loss of protein activity Suzuki et a 1996 however there have been exceptional cases where proteins tolerate extremely high levels of mutation Vartanian et al 1996 To choose the appropriate buffer conditions you must consider the size of your target gene and the level of mutagenesis required Table shows the mutations created per 1 000 bp for given PCR conditions First determine how many mutations you require per 1 000 bp then use Table to find PCR conditions which approximate your requirements For example if your PCR fragment is 500 bp long and you wish to have an average of 2 to 3 mutations in each fragment you need a mutagenesis rate between 4 and 6 mutations per 1000 bp Condition 6 in Table is the best choice to approximate this level of mutagenesis The buffer composition of a standard PCR reaction is also included inTable if you need to optimize other PCR parameters priorto performing random PCR Clontech Laboratories Inc www
21. spin briefly to collect all liquid atthe bottom ofthe tubes Note If you are not using a hot lid thermal cycler overlay contents with mineral oil 3 Commence thermal cycling using the following parameters for either hot lid or non hot lid thermal cyclers e 94 C for 30 sec e 25 cycles 94 C 30sec 68 C 1 min e 68 C for 1 min e 4 C soak For experimental mutagenesis reactions with templates longer than 1 kb add 1 min of extension time per additional kb Protocol No PT3393 1 www clontech com Clontech Laboratories Inc Version No PR812469 Diversify PCR Random Mutagenesis Kit User Manual V Random Mutagenesis Procedure continued Taq PCR Fidelity Assay When the PCR reaction is complete examine the results of the control mutagenesis reactions by performing a Taq restriction digest and agarose gel electrophoresis 1 Prepare a 20 ul digest for each of the control reactions buffer conditions 1 and 9 as follows 15 ul PCR mutagenesis reaction 1 or 9 4 ul distilled HO 1 ul Taq l Restriction Enzyme 2 units 20 ul Total volume 2 Incubate at 65 C for 1 hr 3 Add 3 ul of 10X gel loading buffer to each digest Electrophorese 15 ul of each reaction on a 1 agarose EtBr gel along with 1 kb ladder DNA size markers or equivalent Stop electrophoresis when dye front has migrated three quarters of the length of the gel Photograph the gel and compare its band pattern to the pattern in Figure 2 B
22. step or in increments over several cycles See Section D C Products are smeared on gel Too many cycles Denaturation temp too low Extension time too long Poor template quality Touchdown PCR needed Clontech Laboratories Inc Reduce the cycle number by 3 5 cycles to see if non specific bands go away PRIDE OSS NaI Ne Celia ad Ome mi per atten a ments of 1 C Decrease the extension time in 1 2 min increments Checktemplate integrity by electrophoresis on a de denaturing agarose gel Repurify your template if necessary See Touchdown PCR needed under previous section www clontech com Protocol No PT3393 1 Version No PR812469 Diversify PCR Random Mutagenesis Kit User Manual VI Troubleshooting continued Too much enzyme TITANIUM Taq is supplied at an optimized 50X concentration however a 1X final concentration of the enzyme mix may be too high for some applica tions If smearing is observed first try optimizing the cycle parameters as described above then try reducing the enzyme concentration to 0 5 0 2X Too much template Try a lower concentration of DNA template in the PCR reaction Contamination See Section D D Dealing with contamination Contamination most often results in extra bands or smearing It is im portant to include a negative control a control that replaces the DNA template with PCR grade H O but still includes the primers in every PCR experiment to determine if
Download Pdf Manuals
Related Search