Home

CLONTECH

1. Vil HAT System Protocol Purification continued 7 Repeat steps 5 and 6 8 Add the clarified sample from Section VI to the resin 9 Gently agitate the suspension at room temperature for 20 min on a platform shaker to allow the HAT protein to bind to the resin 10 Centrifuge at 700 x g for 5 min 11 Carefully remove as much supernatant as possible without disturbing the resin pellet 12 Wash the resin protein complex by adding 10 bed volumes of extrac tion loading buffer pH 7 0 13 Gently agitate the suspension at room temperature for 10 min on a platform shaker to promote thorough washing 14 Centrifuge at 700 x g for 5 min 15 Remove and discard the supernatant 16 Repeat the above wash Steps 12 14 2 3 times 17 Optional If more stringent washing is needed to achieve the desired purity add 5 bed volumes of wash buffer 5 mM imidazole in the extraction loading buffer and gently agitate the suspension at room temperature for 10 min Centrifuge at 700 x g for 5 min to pellet resin Remove and discard the supernatant 18 Elute the HAT protein by adding 1 bed volume of elution buffer 100 mM imidazole in the loading buffer or pH 6 0 buffer 19 Gently agitate the suspension at room temperature for 10 min 20 Centrifuge at 700 x g for 5 min 21 Collect supernatant 22 Repeat Steps 17 20 three times collecting four separate 1 bed volume fractions 23 Optional In order to ensure that all HAT tagg
2. Insoluble over Use denaturing extraction and purification condi expressed protein tions or reduce expression levels by lowering the amount of inducer Unsuitable expression Checkcell growth and inducer concentration check conditions for wild type non transformed or contaminant antibiotic resistant cells Protein is secreted Check fermentation liquid for your protein Use fermentation liquid as starting sample for IMAC after proper buffering C Proteolysis Protein is hydrolyzed Use mild extraction conditions in presence of by proteases protease inhibitors 2 mercaptoethanoland EDTA at 4 C Remove EDTA before applying to TALON Purification A Loss of Co Presence of chelators Remove chelators from sample by gel filtration in sample Regenerate adsorbent as described in Section VILE B HAT protein does not bind Use of wrong buffer Check pH presence of imidazole or other weak for loading chelator TALON resin changes color to ruby and switch to appropriate buffer Protein hydrolyzed Use mild extraction conditions in presence of during extraction protease inhibitors 2 mercaptoethanoland EDTA at 4 C Remove EDTA before applying sample to TALON HAT tag not exposed _ If the protein fails to bind under native conditions then treat a small aliquot lt 1 ml with the denatur ing protocol in Section VI B If the target protein binds to the resin under the denaturing conditions Protocol lt 1 www clontech com CLONTECH Lab
3. CLONTECH Laboratories Inc www clontech com Protocol PT3250 1 6 Version PR16705 HAT System User Manual l Introduction continued Native purification of Denaturing purification of Soluble HAT protein Insoluble HAT protein Eguilibrate resin U Load sample Native purification buffer Denaturing purification buffer 50 mM sodium phosphate 50 mM sodium phosphate 300 mM NaCl pH 7 0 Wash nonadsorbed 300 mM NaCl material 6 M Guanidinium HCl pH 7 0 U Apply to TALON resin Wash Elution Imidazole pH elution Imidazole elution buffer at pH 6 0 elution buffer 100 mM followed by buffer 100 mM imidazole buffer at pH 5 0 imidazole Pure soluble HAT protein Pure insoluble HAT protein Figure 1 Overview of purification with the HAT System This flowchart outlines the procedures for native and denaturing purification of HAT tagged proteins Steps denoted with an asterisk involve the indicated buffer the native purification buffer for native HAT protein purification soluble proteins and the denaturing purification buffer for denaturing HAT protein purification insoluble proteins See the protocol for detailed procedures Protocol PT3250 1 www clontech com CLONTECH Laboratories Inc Version PR16705 7 HAT System User Manual ll List of Components Store vectors at 20 9C Store buffers and TALON Resin at 4 C Store columns at room temperature e 5 wg pHAT10 Vector 0 5 ug l 5
4. Nature 258 598 599 Sambrook J Fritsch E F amp Maniatis T 1989 Molecular Cloning a laboratory manual 2nd Edition Ed Cold Springs Harbor Laboratory Press Cold Springs Harbor NY Sulkowski E 1985 Purification of proteins by IMAC Trends in Biotechn 3 1 7 Wong J W Albright R L amp Wang H L 1991 Immobilized metal ion affinity chromatography IMAC chemistry and bioseparation applications Sep Purif Methods 20 1 49 106 Zhao Y J Sulkowski E amp Porath J 1991 Surface topography of histidine residues in lysozymes Eur J Biochem 202 1115 1119 Protocol PT3250 1 www clontech com CLONTECH Laboratories Inc Version PR16705 23 HAT System User Manual IX Related Products For the latest and most complete listing of all CLONTECH products please visit www clontech com TALON Metal Affinity Resin 8901 1 2 3 4 TALON Superflow Metal Affinity Resin 8908 1 2 TALONspin Columns 8902 1 2 3 4 TALON 2 ml Disposable Gravity Columns 8903 1 6xHis Monoclonal Antibody 8904 1 HAT Polyclonal Antibody 8909 1 TALON CellThru Resin 8910 1 2 Glutathione Superflow Resin 8911 1 2 Glutathione Uniflow Resin 8912 1 2 Thiophilic Uniflow Resin 8913 1 2 TALON CellThru 2 ml Disposable Columns 8914 1 TALON CellThru 10 ml Disposable Columns 8915 1 6xHis Monoclonal Antibody albumin free 8916 1 6xHN Polyclonal Antibody 8940 1 pHAT GFPuv Vector
5. 8920 1 pHAT20 Vector 8921 1 HAT Sequencing Primers 6468 1 ProTet 6xHN Bacterial Expression System K1628 1 GST Purification Kit K1251 1 CLONTECH Laboratories Inc www clontech com Protocol PT3250 1 24 Version PR16705 HAT System User Manual Appendix A Vector Information pUC ori pHAT10 11 12 2 8 kb 1 Amp Hind ill HAT A AGC TTG AAG GAT CAT CTC ATC CAC AAT GTC CAC AAA GAG GAG CAC GCT CAT GCC CAC AAC AAG Ser Leu Lys Asp His Leu lle His Asn Val His Lys Glu Glu His Ala His Ala His Asn Lys EK cleavage site ATCGATGACGATGACAAAGTCGACGGATCCCCGGGTACCGAGCTCGTAATTAGCTGAATTC Clal Sal BamHl Smal Kpnl Saci EcoR Figure 2 pHAT10 11 12 Vector Map and MCS Unique restriction sites are in bold The sequence of pHAT10 is shown The asterisk indicates the insertion point of additional bases in pHAT11 G and pHAT12 GG that alter the reading frame of the MCS These vectors encode a novel polyhistidine epitope tag that enables purification of expressed proteins at neutral pH The pHAT Vectors allow protein purification under both native and denaturing conditions The HAT epitope is a naturally occurring 19 amino acid sequence from the chicken lactate dehydrogenase protein This sequence of nonadjacent histidine residues has lower overall charge than tags with consecu tive His residues such as the 6xHis tag As a result HAT protein fusions exhibit solubility that more closely resembles that of wil
6. D 6277 in column the sample and loading buffer Protocol PT3250 1 www clontech com CLONTECH Laboratories Inc Version PR16705 29 HAT System User Manual Appendix C Reagent Compatibility A Compatible reagents Table Il shows the maximum concentrations of each reagent tested at CLONTECH Higher levels may be acceptable but they should be tested before use Note that some of these reagents may partially or completely Acceptable Conceniration 10 mM with caution denature your protein Reagent B Mercaptoethanol CHAPS 1 with caution Ethanol 3096 Ethylene glycol 30 HEPES 50 mM Glycerol 20 Guanidinium 6M Imidazoled 200 mM at pH 7 0 8 0 KCI 500 mM MOPS 50 mM MES 20 mM NaCl 1 0M NP 40 1 SDS 1 with caution TRIS 50 mM Urea 8M Resin should be used immediately after equilibrating the resin with buffers containing these reagents Otherwise the resin will change color Resin should not be stored in buffers containing these reagents lonic detergents like CHAPS 3 3 Cholamidopropyl dimethylammonio 1 propane sulfonate SDS sodium dodecyl sulfate and Sarkosyl are compatible at up to 1 However due to their charged nature interference with binding should be anticipated Imidazole can not be used at concentrations higher than 5 10 mM for loading of the HAT tagged proteins due to the fact that it competes with the histidine side chains imidazole groups for binding to the immobilized met
7. containing 6 M guanidinium HCl must be dialyzed overnight against buffer containing 8 M urea before loading on a gel CLONTECH Laboratories Inc www clontech com Protocol PT3250 1 16 Version PR16705 HAT System User Manual Vil HAT System Protocol Purification A General Information Choice of purification conditions The following general guidelines can be used for purification of a HAT tagged protein from transformed E coli cultures The buffers and purification conditions see the Buffers section and Figure 1 should work well for most soluble monomeric proteins expressed in E coli Each different expression system and HAT protein should be tested initially in small scale batch purification to determine expression levels and to opti mize the protocol If you have any difficulties with the procedure please refer to the Troubleshooting Guide Appendix B Choosing the buffers pH gradient versus imidazole gradient TALON purification schemes typically use either a pH gradient or an imidazole gradient for washing and elution The presence of imidazole in the wash and or loading buffer minimizes nonspecific binding and reduces the amount of contaminating proteins Thus purification using an imidazole gradient is the generally preferred procedure and should be tried first However both imidazole and HAT proteins absorb at 280 nm so elution peaks may be difficult to detect spectrophotometrically especially when purify
8. enterokinase to remove HAT tag and rerun IMAC with mixture protein of interest will pass through the column impurities and tag will be adsorbed Use second purification principle Size Exclusion lon Exchange Hydrophobic or Thiophilic Chro matography www clontech com Protocol PT3250 1 Version PR16705 Insufficient wash or low salt concentration Proteolytic product Covalent attachment Cys Cys of impurities to the HAT protein Co purifying histidine rich proteins Co purifying histidine rich proteins CLONTECH Laboratories Inc 28 HAT System User Manual Appendix B Troubleshooting Guide continued Remove chelating ligands metal ions or imidazole if present in the sample by gel filtration before loading the proteolytic mixture on the TALON adsorbent E HAT proteins do not elute Insufficient concen Elute with 100 to 200 mM imidazole or pH 5 0 tration of imidazole in followed by pH 4 0 the elution buffer or insufficiently low pH of the buffer possible if dimers and tetramers of HAT proteins form F High back pressure during load of sample High viscosity due to Use DNase I or dilute sample 5 fold presence of DNA G High back pressure in column Clogged filter from Change top filter of column centrifuge sample subcellular debris extensively 20 30 minutes at 4 C 8 12 000 xg Precipitation of Use mild detergent such as Decanoyl N proteins on the methylglucamide MEGA 10 Sigma
9. expressing a particular recombinant protein we recommend that you estimate the protein s expression level in that host strain To do so perform a small scale purification and then analyze a small portion by SDS PAGE in parallel with known amounts of protein standards to estimate the amount of HAT protein in the clarified sample Once satisfactory expression is observed proceed with the appropriate purification protocol below B Isolation of denatured HAT proteins These are general guidelines for using denaturing conditions with bacterial expression cultures Some modifications may be required for eukaryotic expression systems Sonication buffer volumes may also need to be adjusted according to cell pellet size and anticipated protein yield For scaling up use 2 ml of sonication buffer per 20 25 ml of culture 1 Harvest 20 25 ml of cell culture by centrifugation at 1 000 3 000 x g for 15 min at 4 C 2 Resuspend the pellet in 2 ml of extraction buffer per 20 25 ml of culture 3 Gently agitate or stir the sample until it becomes translucent 4 Centrifuge the sample at 10 000 12 000 x g for 20 min at 4 C to pellet any insoluble material 5 Carefully transfer the supernatant to a clean tube without disturbing the pellet This is the clarified sample 6 Set aside a small portion of the clarified sample at 4 C to analyze by SDS PAGE gel in parallel with the TALON purified sample to estimate yield and purity Note Samples
10. neutral pH The pHAT Vectors allow protein purification under both native and denaturing conditions The HAT epitope is a naturally occurring 19 amino acid sequence from the chicken lactate dehydrogenase protein This sequence of nonadjacent histidine residues has lower overall charge than tags with consecutive His residues such as the 6xHis tag As a result HAT protein fusions exhibit solubility that more closely resembles wild type proteins while still possessing strong affinity for mmobilized metal ions The unigue binding characteristics of the HAT seguence allow both imidazole and pH gradient purification of proteins under native conditions at neutral pH 7 0 as well as under denaturing conditions The HAT seguence and an enterokinase EK cleavage site have been incorporated into the pUC19 backbone The EK site allows for optional removal of the HAT seguence from the purified protein by treatment with enterokinase Restriction sites allow excision of the HAT seguence with or without the EK site for cloning in other vectors CLONTECH Laboratories Inc www clontech com Protocol lt 1 Version PR16705 HAT System User Manual Appendix B Troubleshooting Guide Protein Expression and Isolation A No expression Bad vector construct Check the sequence of the vector Bad transformation Make a plasmid miniprep to confirm sequence No inducing agent Make sure that 1 mM IPTG is added to culture B Apparent low expression
11. optimal extraction purification conditions the distribution of the protein of interest in soluble and insoluble form must be determined A preliminary SDS PAGE analysis of the protein extracts obtained under native conditions followed by extraction of the residual proteins under denaturing conditions should be performed One should take care to use the same extraction volumes for both the native and denaturing extracts and run the cell extract before induction as a control in one of the lanes in order to identify the protein of interest Use of denaturing conditions is recommended only if the biological activity of the protein of interest has no relevance It is preferable to use native conditions for extraction even if only 5 to 10 of the protein of interest is soluble 5 The volumes given for the extraction buffers in the procedures below have been optimized for purification of the HAT DHFR protein from Protocol PT3250 1 www clontech com CLONTECH Laboratories Inc Version PR16705 11 HAT System User Manual V HAT System Protocol General continued 20 25 ml of an overnight col culture The volume of extraction buffer for overnight culture used may need to be adjusted for other proteins dependent on the expression level and anticipated yield 6 If you are purifying protein from harvested eukaryotic cells lyse the cells in an appropriate lysis buffer containing a mild detergent Sambrook et al 1989 See Appendix C for
12. pH 7 0 final pH Dissolve the 40 1 g of guanidine HCl in 7 ml of Buffer A and 10 ml of deionized water Mix until guanidine HCl is completely dissolved 1 hr Check pH Add deionized water to a final volume of 70 ml Elution Buffer e Imidazole elution 45 mM sodium phosphate 270 mM NaCl 5 4 M Guanidine HCl 100 mM imidazole pH 7 0 final pH Add 0 5 ml of Buffer B to 4 5 ml of the extraction loading buffer for denatured HAT proteins Check pH a All volumes given are calculated for approximately one purification of protein from 25 ml culture using 1 ml of TALON adsorbent 5 f intermediate wash before elution is necessary use the following wash buffers For native purification Mix 1 ml of Buffer A with 50 ul of Buffer B and dilute with 8 95 ml of deionized water Check pH For denaturing purification Mix 50 ul of Buffer B with 9 95 ml of the extraction loading buffer for denatured HAT proteins Check pH CLONTECH Laboratories Inc www clontech com Protocol PT3250 1 14 Version PR16705 HAT System User Manual VI HAT System Protocol Isolation These are general guidelines Some modifications may be required particu larly for eukaryotic expression or fragile enzyme systems Chilling samples on ice before and during extraction may be necessary to preserve protein functionality Extraction buffer volumes may also need to be adjusted accord ing to cell pellet size and anticipated protein yield As astar
13. proteins Porath 1990 Wong et al 1991 Arnold 1991 Andersson 1992 Widespread application of recombinant genetic technologies has fostered the production of recombinant proteins containing polyhistidine tags on their N or C termini Hochuli et al 1987 Hochuli etal 1988 HAT is one such tag The HAT Protein Expression and Purification System is a complete system containing vectors designed for bacterial expression of HAT tagged proteins and reagents for purification of HAT tagged proteins The HAT sequence patent pending is a novel IMAC affinity tag derived from a unique natural protein sequence in chicken lactate dehydrogenase It contains six histidines unevenly interleaved by other amino acid residues see Figure 2 in Appendix A The novel tag does not have the excessive positive charge characteristic of the commonly used 6xHis tag thus HAT fusion proteins have better solubility and similar affinity towards immobilized transition metal ions and zinc HAT fusion proteins can be adsorbed in the absence of imidazole at neutral pH As a result the alkaline proteases present in cell lysates are less active and therefore most proteins are more stable The core of the HAT system is the set of pHAT Vectors for protein expression in CLONTECH Laboratories Inc www clontech com Protocol PT3250 1 4 Version PR16705 HAT System User Manual l Introduction continued Escherichia coli Three vectors pHAT10 pHAT11 and pHA
14. the need for high speed centrifugation With TALON CellThru destabilizing factors are removed more quickly than with other resins because the number of steps are reduced CellThru 2 ml amp 10 ml Disposable Columns have a large filter pore size 90 130 um that allows cellular debris to flow through the column during the purification process The 2 ml columns are suitable for 1 2 ml bed volumes while the 10 ml columns are suitable for 5 10 ml bed volumes TALONspin Columns are ideal for rapidly and simultaneously purifying small amounts of polyhistidine tagged proteins TALONspin Columns are recommended for single use applications or for use as mini gravity flow columns Each column contains 0 5 ml of TALON NX Resin which is optimized for performance in a spin column Each column will yield 2 4 mg of polyhistidine tagged protein exact yields will vary with conditions used and polyhistidine tagged protein characteristics In addition yield and purity will depend upon expression level and lysate concentration Beginning with the clarified sample the entire procedure takes approximately 30 minutes All resins have a capacity of at least 12 umol Co per ml of bed volume and are provided charged with the metal ion for ease of use TALON based adsorbents e e can also be regenerated see Section VII E Used in concert with the HAT tag TALON adsorbents deliver the best possible performance under mild physiological conditions
15. to the adsorbent Alternative salt additives may provide better results for certain HAT proteins Before planning buffer compositions please consult Appendix C Note After storage at 4 C you may observe a precipitate in one or more of the provided 10X buffers If this occurs warm the buffer to room temperature to redissolve the precipitate and continue as indicated below Extraction loading Buffer 50 mM sodium phosphate 300 mM NaCl pH 7 0 final pH Dilute 5 ml of Buffer A with 45 ml of deionized water Check and adjust pH if necessary Elution Buffer e Imidazole elution 50 mM sodium phosphate 300 mM NaCl 100 mM imidazole pH 7 0 final pH Add 1 ml of Buffer B to 1 ml of Buffer A and dilute with 8 ml of deionized water Check and adjust pH if necessary pH elution For monomers 50 mM sodium phosphate 300 mM NaCl pH 6 0 final pH Mix 0 5 ml of Buffer A with 0 5 ml of Buffer C and dilute with 9 ml of deionized water Check and adjust pH if necessary For dimers 50 mM sodium phosphate 300 mM NaCl pH 5 0 final pH Dilute 1 ml of Buffer C with 9 ml of deionized water Check and adjust pH if necessary Protocol PT3250 1 www clontech com CLONTECH Laboratories Inc Version PR16705 13 HAT System User Manual V HAT System Protocol General continued 2 Buffers for denaturing purification of HAT tagged proteins Extraction loading Buffer 50 mM sodium phosphate 300 mM NaCl 6 M Guanidine HCl
16. ug pHAT11 Vector 0 5 ug l e 5 wg pHAT12 Vector 0 5 ug l 2 ug pHAT DHFR Control Vector 0 5 ug l e 10 ml TALON Resin e 70 ml Buffer A 10X Extraction Buffer pH 7 0 e 10 ml Buffer B 1 M Imidazole e 10 ml Buffer 0 10X Elution Buffer pH 5 0 e 40 1 g Guanidine HCl 10 Disposable Plastic Columns Vector Information Packet PT3251 5 Buffer Compositions Buffer A 0 5 M Sodium Phosphate 3 0 M NaCl pH 7 0 10X Buffer B 1 0 M Imidazole pH 7 0 10X Buffer C 0 5 M Sodium phosphate 3 0 M NaCl pH 5 0 10X The following kit components are also available separately e TALON Metal Affinity Resin 8901 1 2 3 4 e TALON 2 ml Disposable Gravity Columns 8903 1 CLONTECH Laboratories Inc www clontech com Protocol PT3250 1 8 Version PR16705 HAT System User Manual lll Additional Materials Required The following items are required for use with the HAT System but are not included in the kit For Cloning Recombinant Proteins Restriction enzymes DNA polymerase e DNA ligase For Expression Isolation and Purification of HAT Tagged Proteins e Centrifuge Centrifuge tubes e Spectrophotometer Electrophoretic system Imidazole Sigma Cat 10250 for FPLC applications pH meter For care of the TALON Resin e MES Buffer 20 mM 2 N morpholine ethanesulfonic acid MES pH 5 0 Protocol lt 1 www clontech com CLONTECH Laboratories Inc Version PR16705 9 HAT
17. with 2 min pauses on ice for large preparations 200 ml Proceed to step 7 Note Excessive sonication can destroy protein functionality 6 Optional High yield mild extraction method Transfer the cells to a chilled mortar and grind 1 part cells with 2 5 parts of Alumina Sigma A 2039 for 2 3 minutes until paste like composition forms Add chilled 4 C extraction buffer 2 ml per 25 ml culture Proceed to step 7 Note If there is a high level of proteolytic activity in the cell lysate we recommend adding 1 mM EDTA final concentration to the extraction buffer in order to inhibit metalloproteases during the extraction Before application of the sample to the TALON adsorbent EDTA must be removed by gel filtration on a column PD 10 Amersham Pharmacia eguilibrated with the loading buffer for IMAC 7 Centrifuge the cell extract at 10 000 12 000 x g for 20 min at 49C to pellet any insoluble material Protocol lt 1 www clontech com CLONTECH Laboratories Inc Version PR16705 15 HAT System User Manual VI HAT System Protocol Isolation continued 8 Carefully transfer the supernatant to a clean tube without disturbing the pellet This is the clarified sample 9 Set aside a small portion of the clarified sample at 4 C to run on an analytical SDS PAGE gel in parallel with the TALON purified sample to estimate yield and purity 10 If this is the first time you have prepared clarified samples from cells
18. 50 suspension of resin in the storage solution it will settle during shipping and storage TALON resin is shipped as a 20 ethanol suspension 2 Immediately transfer the required amount of resin suspension to a sterile tube that will accommodate 10 20X the resin bed volume Use 2 ml of resin suspension per 3 mg of anticipated HAT protein 2 ml of homogeneously resuspended resin will provide 1 ml bed volume of TALON Resin 3 Centrifuge at 700 x g for 2 min to pellet the resin 4 Remove and discard the 20 ethanol supernatant 5 Add 10 bed volumes of extraction loading buffer and mix briefly to pre equilibrate the resin 6 Recentrifuge at 700 x g for 2 min to pellet the resin and discard the supernatant 7 Repeat steps 5 and 6 8 Add the clarified sample from Section VI to the resin 9 Gently agitate the suspension at room temperature for 20 min on a platform shaker to allow the HAT protein to bind to the resin 10 Centrifuge at 700 x g for 5 min 11 Carefully remove as much supernatant as possible without disturbing the resin pellet 12 Wash the resin by adding 10 bed volumes of extraction loading buffer pH 7 0 Gently agitate the suspension at room temperature for 10 min on a platform shaker to promote thorough washing 13 Centrifuge at 700 x g for 5 min 14 Remove and discard the supernatant 15 Repeat the above wash Steps 11 14 16 Add one bed volume of the extraction loading buffer to the resin a
19. CLONTECH Innovative Tools to Accelerate Discovery HAT Protein Expression and Purification System User Manual PT3250 1 PR16705 Published 01 October 2001 Catalog K6050 1 See List of Components for storage conditions FOR RESEARCH USE ONLY I _ Introduction 4 ll List of Components 8 lll Additional Materials Required 9 IV Cloning Recombinant Proteins Containing HAT 10 A Use of HAT Purification Sequence in Other Vectors 10 B Transformation of Host Cells with HAT Expression Vectors 10 V HAT System Protocol General 11 A General Information 11 B Protein Expression 12 C Buffers for Extraction and Purification of HAT tagged Proteins 3 VI HAT System Protocol Isolation 15 A Isolation of Native HAT Proteins 15 B Isolation of Denatured HAT Proteins 16 VII HAT System Protocol Purification 17 A General Information 17 B Batch Gravity flow Purification 18 C Large Scale Batch Purification 19 D Medium Pressure FPLC Column Purification 21 E Resin Washing Reuse Regeneration and Storage 22 Vill References 23 IX Related Products 24 Appendix A Vector Information 25 Appendix B Troubleshooting Guide 27 Appendix C Reagent Compatibility 30 CLONTECH Laboratories Inc www clontech com Protocol PT3250 1 2 Version PR16705 HAT System User Manual Table of Contents HAT System User Manual Table of Contents continued List of Figures Figure 1 Overview of Purification with the HAT Sys
20. N Resins The following is a list of different formats for various purification needs See Section IX for ordering information e TALONTM Metal Affinity Resin is useful for batch and low pressure chro matographic applications TALON Resin utilizes Sepharose9CL 6B Pharmacia LKB Biotechnology a durable substrate that performs very well under native and denaturing conditions in centrifuge mediated purification schemes The large pore size resin has a high binding capacity e TALON Superflow Resin is useful for a range of applications including medium pressure applications with FPLC systems at back pressures of up to 150 psi 1 MPa and high flow rates up to 5 ml per cm per min This resin is recommended if short purification times are essential or if purification proto cols developed at bench scale will be scaled up for larger volumes TALON Superflow utilizes Superflow M 6 Sterogene Bioseparations Inc an agarose based medium featuring a unigue polysaccharide composition that resists biological degradation Superflow 6 beads are also stabilized by a chemical crosslinking reaction that allows flow rates up to 10 times higher than are possible with regular crosslinked beads TALON CellThru is a novel IMAC resin for purifying polyhistidine tagged proteins from crude cell lysates sonicates and fermentation liquids The larger bead size of TALON CellThru 300 500 um permits cellular debris to flow through the column eliminating
21. System User Manual IV Cloning Recombinant HAT Proteins A Use of the HAT Purification Sequence in Other Vectors The HAT sequence can be easily transferred to any other vector using the Hind Ill and Clal sites surrounding the HAT sequence If desired the HAT and enterokinase cleavage sites can be excised together using the Hind Ill site and a site in the MCS If these sites are not convenient the primers below can be used to amplify the HAT sequence with any desired terminal restriction sites incorporated in the primers at the X 5 primer 5 X AGCTTGAAGGATCATCTCAT 3 3 primer 5 X TCTTGTTGTGGGCATGAGCG 3 To amplify the HAT sequence and EK site use the 3 primer below 3 primer 5 AAACAGTAGCAGTAGCTAGA 3 B Transformation of Host Cells with HAT Expression Vectors The following protocol is only an example for chemically induced transforma tion of E colicompetent cells Any standard procedure including electropora tion can be used for transformation Perform control transformations with the Control Vector and without vector DNA in parallel Note Use JM109 or another lac inducible cell line to see induction of expression For tighter control of expression levels use CLONTECH s PROTet 6XHN Bacterial Expres sion System especially recommended for expression of cytotoxic proteins 1 On ice thaw a tube containing 100 ul of 0 5 M 2 mercaptoethanol 2 ME and one 50 ul tube of frozen E coli competent cells for
22. T12 contain the multiple cloning site MCS in all three frames to allow easy cloning of the cDNA of interest for fusion to the HAT tag Another vector pHAT20 provides alternative restriction sites The presence of a conveniently located enterokinase proteolytic site between the HAT sequence and the MCS provides the means for removal of the affinity tag and obtaining the wild type protein See Appendix A for more information Properties of the HAT Protein Expression and Purification System Evenly distributed charge throughoutthe affinity tag No excessive positive charge and therefore easier to elute from the column Affinity tag based on unigue natural seguence lower risk of toxicity of the recombinant proteins to the host cell Loading and purification at physiological pH 7 0 using imidazole Purification in one chromatographic step with two buffers load wash 8 elute Elution at pH 6 0 mild change in pH from the loading conditions at pH 7 0 HAT tag does not contribute to protein insolubility and or aggregation Cloning in the pHAT Vectors The successful expression of HAT tagged proteins in E coli with the pHAT vectors is accomplished through use of the lacZ promoter The pHAT Vectors are derived from the pUC19 vector and fully utilize its promoter translation system The HAT amino acid sequence derives from the N terminus of chicken muscle lactate dehydrogenase a sequence that is unique among reported p
23. al ions 4 Ethanol may cause precipitation of proteins It is not recommended unless used for regeneration and storage of resin B Incompatible reagents The following reagents are not compatible with TALON in any concentration e DTT dithiothreitol and DTE dithioerythritol e EDTA ethylenediaminetetraacetic acid and EGTA ethylene glycol bis B amino ethyl ether Note Although you can use EDTA at indicated points it must be removed from the sample by gel filtration or dialysis prior to applying the sample to TALON Resins www clontech com Protocol PT3250 1 CLONTECH Laboratories Inc 30 Version PR16705 HAT System User Manual Notes Protocol PT3250 1 www clontech com CLONTECH Laboratories Inc Version PR16705 31
24. cation buffer may improve the structural stability of fragile proteins during sample preparation See Appendix C for compatibility information Note Depending on the concentration and volume of additive you wish to use you may need to remake the buffers to preserve the recommended concentration of NaCl and buffering agent DTT and DTE are not compatible with this TALON protocol in any concentration 3 If there is a high level of proteolytic activity in the cell lysate we recommend adding 1 mM EDTA to the extraction buffer to inhibit metalloproteases during the extraction Before application of the sample to the TALON resin EDTA must be removed by gel filtration on a column PD 10 Amersham Pharmacia equilibrated with the loading buffer In some cases the host cell produces low molecular weight chelators that also must be removed by gel filtration prior to application of the sample to the TALON column The presence of such chelators can be detected easily by application of your sample to a small column packed with the TALON adsorbent If you observe that the top of the column is losing its characteristic pink color and the colorless front moves in the direction of the flow or if you obtain pink colored fractions during batch adsorption the sample needs to be equilibrated with a gel filtration column 4 Overexpression of some recombinant proteins can lead to their accu mulation in insoluble form as inclusion bodies In order to determine
25. compatible buffer addi tives Note that EDTA and EGTA are not compatible with the TALON protocol because these reagents strip the cobalt from the resin 7 Carefully check the appearance of the sample after lysis or sonication Bacterial samples often remain viscous from incomplete shearing of genomic DNA Complete DNA fragmentation improves the HAT protein recovery and allows efficient removal of cellular debris during centrifu gation Itis possible to decrease the viscosity of the sample by digestion for 20 30 min at room temperature with 2 5 ug ml of DNase remem ber that proteolytic activity is much higher at room temperature An alternative method is to dilute the sample 5 fold with loading buffer before applying it to the resin This should not significantly affect recovery B Protein Expression 1 Grow an overnight culture of E coli transformed with the plasmid encoding the HAT protein of interest If the amount of the protein that can be isolated from this culture is sufficient proceed to step 3 after taking a 1 ml sample for electrophoretic analyses Centrifuge the 1 ml sample at 1 000 3 000 x g for 15 min at 4 C and store the cell pellet at 20 C after removal of the supernatant Note If there is a need for a large scale preparation of the protein proceed to step 2 2 Use the overnight culture to inoculate a larger volume of medium if you need a greater quantity of the protein of interest use 20 ml of overnight cultur
26. d type proteins while still possessing strong affinity for immobilized metal ions The unique binding characteristics of the HAT sequence allow both imidazole and pH gradient purification of proteins under native conditions at neutral pH 7 0 as well as under denaturing conditions The HAT sequence and an enterokinase EK cleavage site have been incorporated into the pUC19 backbone The EK site allows for optional removal of the HAT sequence from the purified protein by treatment with enterokinase Restriction sites allow excision of the HAT sequence with or without the EK site for cloning in other vectors Protocol PT3250 1 www clontech com CLONTECH Laboratories Inc Version PR16705 25 HAT System User Manual Appendix A Vector Information continued Hind lll 141 HAT MCS 221 256 EcoR 262 Apal Apal 481 2224 Apal 978 60 170 180 190 200 Hind Al be HAT A AGC TTG AAG GAT CAT CTC ATC CAC AAT GTC CAC AAA GAG GAG CAC GCT CAT GCC CAC AAC AAG Ser Leu Lys Asp His Leu lle His Asn Val His Lys Glu Glu His Ala His Ala His Asn Lys 204 230 240 250 EK cleavage site ATC GAT GAC GAT GAC AAA GTT AAC CGG TCC CCG GGT ACC GGG CCC GGC CGG CC Clal Hpal Agel Smal Kpnl Nael Eagl Fsel Figure 3 pHAT20 Vector Map and MCS Unigue restriction sites are in bold The seguence of pHAT20 is shown This vector encodes a novel Histidine Affinity Tag HAT that enables purification of expressed proteins at
27. e eluant at 280 nm the baseline should be stable after washing with 5 10 column volumes 6 Apply the clarified sample to the column after filtering it through a 0 22 um filter and wash with Extraction loading Buffer until the baseline 280 nm is stable Monitor column backpressure during sample application Start collecting fractions Note If the sample is very viscous the column pressure may exceed the recommended value 150 psi 1 0 MPa Reduce the flow rate or dilute the sample to bring the pressure into an acceptable range Load the sample at a flow rate of 0 5 1 0 ml min cm to ensure binding of the HAT tagged protein to the resin If the protein does not bind the flowrate should be reduced further The flow rate can be increased later for washing and protein elution If the protein of interest is not very stable at room temperature the chromatography can be performed at 4 C Also higher flow rates of up to 5 ml min cm can be used to wash and elute the protein Recovery may decrease by 10 15 but a chromatography run will take less time 15 20 min average elution 7 Wash column with Extraction loading Buffer followed by wash buffer 5 10 mM imidazole in extraction loading buffer until the baseline at 280 nm is stable usually 10 20 column volumes 8 Elute the protein using the Elution Buffer 100 200 mM imidazole gives best results Five column volumes are usually sufficient for elution The HAT protein usually el
28. e per 1 L of medium Incubate with shaking for another 1 to 2 hr until the culture has an absorbance of approximately 0 6 ODgqg mea sured against the starting medium Remove a 1 ml sample of the culture centrifuge at 1 000 3 000 x g for 15 min at 4 C remove the supernatant and store the cell pellet at 20 C for electrophoretic analysis 3 Induce expression by addition of an appropriate inducer the lac promoter in the pHAT vectors can be induced with 1 mM IPTG Continue the incubation for another 3 5 hours 4 Remove a 1 ml sample of the culture centrifuge at 1 000 3 000 x g for 15 min at 4 C remove the supernatant and store the cell pellet at 20 C for electrophoretic analysis CLONTECH Laboratories Inc www clontech com Protocol PT3250 1 12 Version PR16705 HAT System User Manual V HAT System Protocol General continued C Buffers for Extraction and Purification of HAT tagged Proteins 1 Buffers for native purification of HAT tagged proteins We suggest the following buffers for the purification of HAT recombi nant proteins under nondenaturing conditions however other compat ible buffers may be used Imidazole based purifications performed at pH 7 0 are generally recommended eluted material is less diluted especially when the HAT protein of interestcannottolerate pH changes We recommend adding 300 mM NaCl to reduce electrostatic interac tions that result in nonspecific binding of unwanted proteins
29. each ligation transformation 2 Dispense 2 ul of 0 5 M 2 ME into each tube of competent cells and mix 3 Dispense 2 ul of each ligation reaction directly into the mixture from step 2 Incubate the tubes on ice for 30 min Heat shock for exactly 30 sec in the 42 C water bath Remove the tubes from the 42 C water bath and place on ice for 2 min Add 250 ul of SOC medium at room temperature to each tube Shake the tubes horizontally at 37 C for 1 hr at 225 rpm in a rotary shaking incubator 9 Spread all the transformation mixtures onto LB ampicillin 50 ug ml agar plate containing X gal 75 ug ml and IPTG 1 mM Incubate the plates at 37 C overnight 10 Pick up colonies make a small plasmid preparation and sequence the region of the plasmid containing the HAT sequence and the sequence of interest use the M13 pUC Reverse Sequencing Primer 48 24 mer New England BioLabs Cat 1233 o NOOA CLONTECH Laboratories Inc www clontech com Protocol PT3250 1 10 Version PR16705 HAT System User Manual V HAT System Protocol General PLEASE READ ENTIRE PROTOCOL BEFORE STARTING A General Information 1 All manipulations as well as the centrifugation for removal of the cell debris should be carried out at 4 8 C in order to improve the protein stability and yield 2 The addition of a reducing agent such as upto 10 mM B2 mercaptoethanol or a protease inhibitor such as PMSF to the soni
30. ed protein is recovered elute with 4 bed volumes of stronger elution buffer 200 mM imidazole in the loading buffer or pH 5 0 buffer for pH type elution by repeating steps 18 through 20 24 Use spectrophotometric and SDS PAGE analyses to determine which fraction s contains the majority of the HAT protein CLONTECH Laboratories Inc www clontech com Protocol PT3250 1 20 Version PR16705 HAT System User Manual Vil HAT System Protocol Purification continued D Medium Pressure FPLC Column Purification for TALON Superflow only 1 Consult the manufacturer s instructions for FPLC column assembly 2 Thoroughly resuspend the TALON Superflow resin to achieve a homo geneous 50 suspension of resin in the storage buffer Slowly pour the slurry into the column taking care to avoid the introduction of air bubbles 3 Allow the resin to settle This process can be accelerated by allowing the buffer to flow through the column with a peristaltic pump Do not exceed a flow rate of 5 ml min cm Do not allow the resin to dry out If this occurs resuspend the resin in Extraction loading Buffer and repack the column 4 Insert and adjust the top adaptor and connect the column to the chromatography system according to FPLC system specifications Note Avoid trapping air between the adaptor and the resin surface 5 Equilibrate the column with Extraction loading Buffer Do not exceed a 5 ml min cm flow rate Monitor th
31. er with this method compared to using gravity flow columns However batch washes are somewhat less efficient at removing impurities than are gravity flow columns Therefore larger wash buffer volumes are needed to get pure HAT protein Very little unwanted protein should bind to TALON at pH 7 0 It is generally sufficient to wash the resin bound HAT protein complex 3 4 times with 10 bed volumes of pH 7 0 loading buffer and proceed with elution If additional stringent washes are needed to achieve the desired purity level include Step 17 1 Thoroughly resuspend the TALON Resin to achieve a homogenous 50 suspension of resin in the storage solution it will settle during shipping and storage TALON resin is shipped as a 20 ethanol suspension 2 Immediately transfer the required amount of resin suspension to a sterile tube that will accommodate 10 20X the resin bed volume Use 2 ml of resin suspension per 3 mg of anticipated HAT protein 2 ml of homogeneously resuspended resin will provide 1 ml bed volume of TALON Resin 3 Centrifuge at 700 x g for 2 min to pellet the resin 4 Remove and discard the 20 ethanol supernatant 5 Add 5 bed volumes of extraction loading buffer pH 7 0 and mix briefly to pre equilibrate the resin 6 Recentrifuge at 700 x g for 2 min to pellet the resin and discard the supernatant Protocol PT3250 1 www clontech com CLONTECH Laboratories Inc Version PR16705 19 HAT System User Manual
32. general conditions The HAT Sequence is one such purification tag It is a histidine rich sequence that confers to the protein an affinity for immobilized di metal ions such as cobalt nickel and zinc Immobilized Metal Affinity Chromatography IMAC Immobilized Metal lon Affinity Chromatography IMAC was introduced in 1975 by Porath et al Porath et al 1975 as a group specific affinity principle for separating proteins The principle is based on the reversible interaction between some amino acid side chains and immobilized metal ions Depending on thetype of immobilized metal ion different side chains can be involved in the adsorption process Most notably histidine cysteine and tryptophan side chains have been implicated in the binding of proteins to immobilized transition metal ions and zinc Porath 1985 Sulkowski 1985 Hemdan amp Porath 1985a Hemdan amp Porath 1985b Zhao et al 1991 The chelating ligand used for immobilization of the metal ions can influence the selectivity capacity and strength of immobilization of the metal ions to the matrix Chelating ligands such as iminodiacetate IDA and dipicolylamine DPA forming three coordination bonds with the metal ion TALON and nitrilotriacetate NTA forming four coordination bonds with the metal ion and tris carboxymethyl ethylenediamine TED forming five coordination bonds with the metal ion have found numerous applications for the purification of native
33. ing small amounts of HAT protein In these cases the leading edge of the imidazole breakthrough peak should be collected and checked for the presence of HAT protein by a protein specific assay Bradford 1976 and SDS PAGE analysis Alternatively a pH gradient may be used instead of imidazole for purification of HAT proteins that are stable in the pH range of 6 0 7 0 Buffers containing EDTA or EGTA will elute all HAT proteins but will also strip the metal off the resin Thus the purified protein will contain cobalt in addition to EDTA or EGTA which can inhibit protein function and lead to precipitation Elution strategy linear versus step gradients In most cases step gradients are preferred over linear gradients because linear gradients lead to broad elution peaks which can dilute the product and make detection difficult Reusing TALON Resin Used TALON Resin may be stored and reused up to 3 4 times before discarding or complete regeneration Section VIII E the exact number of uses varies dependent on the applications To avoid possible cross contamination use a particular aliquot of resin only for the purification of a single type of HAT protein Protocol PT3250 1 www clontech com CLONTECH Laboratories Inc Version PR16705 17 HAT System User Manual Vil HAT System Protocol Purification continued B Batch Gravity Flow Column Purification 1 Thoroughly resuspend the TALON Resin to achieve a homogeneous
34. nd resuspend by vortexing 17 Transfer the resin to a 2 ml gravity flow column with an end cap in place and allow the resin to settle out of suspension 18 Remove the end cap and allow the buffer to drain until it reaches the top of the resin bed making sure no air bubbles are trapped in the resin bed 19 Wash column once with 5 bed volumes of extraction loading buffer CLONTECH Laboratories Inc www clontech com Protocol lt 1 18 Version PR16705 HAT System User Manual Vil HAT System Protocol Purification continued 20 Optional If necessary the wash may be performed under more stringent conditions using 5 mM imidazole in the extraction loading buffer see Section V footnotes 21 Elute the HAT protein by adding 5 bed volumes of elution buffer 100 mM imidazole in the loading buffer or pH 6 0 buffer to the column Collect the eluate in 500 fractions Note Under most conditions a majority of the HAT protein will be recovered in the first two bed volumes 22 Optional In order to ensure that all HAT tagged protein is recovered elute with 5 bed volumes of stronger elution buffer 200 mM imidazole in the extraction loading buffer or pH 5 0 buffer for pH elution Collect the eluate in 500 ul fractions 23 Use spectrophotometric and SDS PAGE analyses to determine which fraction s contains the majority of the HAT protein C Large Scale Batch Purification Pure HAT protein is obtained much fast
35. oratories Inc Version PR16705 27 HAT System User Manual Appendix B Troubleshooting Guide continued then try to move the tag to the other terminus of the protein where it may be more exposed See Appendix C for reagent compatibilities If reagent is not listed you can check binding using a small scale procedure Normally due to the presence of Chelators e g EDTA EGTA that bind Cobalt You may need to fully regenerate resin Section VII E in order to re introduce Cobalt to the resin Indicates presence of guanidinium in the resin This does not indicate a change in the binding properties of the resin nor does it indicate a problem TALON overexposed to reducing agents Completely remove reducing agents such as DTE or DTT or substitute 2 mercaptoethanol if possible Decrease 2 mercaptoethanol concen tration by dilution to 1 5 mM Binding interference C Resin changes color Loss of Pink Color Purple or blue color Grey or brown color D High amount of co eluted impurities Use larger volume of loading wash buffer elevate the salt concentration of the loading buffer at least 0 3 M NaCl use low concentration of imida zole 5 10 mM at pH 7 0 to remove contami nants Use mild extraction conditions in presence of protease inhibitors 2 mercaptoethanol and EDTA at 4 C Remove EDTA before applying to TALON Use low concentration of 2 mercaptoethanol 1 5 mM in the extraction buffer Use
36. rotein sequences This sequence has remarkable affinity towards transition metal ions and zinc a property that has been utilized for the successful purification of chicken lactate dehydrogenase in one chromatographic step from crude cell extract The sequence responsible for binding was identified after cleavage ofthe enzyme and subsequent purification of the peptide mixture under the conditions used for purification of the native enzyme TALON IMAC Resins CLONTECH s TALON resins are agarose based IMAC resins utilizing the high specificity of immobilized Co ions for purification of polyhistidine recombinant proteins Adsorption selectivity in IMAC increases in the following order Cu gt Ni gt Zn gt Co Porath 1992 The ligand used for immobilization of the metal ion is a tetradentate chelator that retains 002 ions strongly thus eliminating problems stemming from metal ion leakage that could be detrimental to the biological activity of the proteins being purified in stark contrast to IDA based adsorbents Since immobilized Co ions possess the highest possible specificity for polyhistidine tagged proteins while adsorbing very low amounts of unwanted proteins unlike Ni based adsorbents TALON is the best tool for purification of polyhistidine tagged proteins Protocol PT3250 1 www clontech com CLONTECH Laboratories Inc Version PR16705 5 HAT System User Manual l Introduction continued Overview of TALO
37. tem 7 Figure 2 pHAT10 11 12 Vector Map and MCS 25 Figure 3 pHAT20 Vector Map and MCS 26 Notice to Purchaser The use of TALON products are covered under U S Patent 5 962 641 HAT TALON TALONspin TALON NX and ProTet are trademarks of CLONTECH Laboratories Inc Sepharose is a registered trademark of Pharmacia LKB Biotechnology Triton is a registered trademark of Rohm and Haas Co Superflow and Uniflow are trademarks of Sterogene Bioseparations Inc This product is intended to be used for research purposes only It is not to be used for drug or diagnostic purposes nor is it intended for human use CLONTECH products may not be resold modified for resale or used to manufacture commercial products without written approval of CLONTECH 2001 CLONTECH Laboratories Inc All rights reserved Protocol PT3250 1 www clontech com CLONTECH Laboratories Inc Version PR16705 3 HAT System User Manual l Introduction In order to perform such a diverse array of functions proteins have evolved very complex structures As a result their physicochemical properties vary greatly posing difficulties for the development of purification protocols with wide applica bility One way to circumvent this problem is to incorporate a purification tag into the primary amino acid seguence of a protein of interest thus constructing a recombinant protein with a general binding site that allows purification under
38. th J 1985a Development of Immobilized Metal Affinity Chromatography ll Interaction of amino acids with immobilized nickelimionodiacetate Journal of Chromatography 323 255 264 Hemadan E S amp Porath J 1985b Development of Immobilized Metal Affinity Chromatography Ill Interaction of oligopeptides with immobilized nickelimionodiacetate Journal of Chromatogra phy 323 265 272 Hochuli E Bannwarth W Doebeli H Gentz R amp Stueber D 1988 Genetic approach to facilitate purification of recombinant proteins with a novel metal chelate adsorbent Bio Technology 6 11 1321 5 Hochuli E Dobeli H amp Schacher A 1987 New Metal Chelate Adsorbent Selective for Proteins and Peptides Containing Neighboring Histidine Residues Journal of Chromatography 411 177 184 Porath J 1985 Immobilized Metal lon Affinity Chromatography a Powerful Method for Protein Purification In H Tschelsche Ed Modern Methods in Protein Chemistry pp 85 95 Berlin amp NY Walter de Gruyter amp Co Porath J 1990 Amino acid side chain interaction with chelate liganded crosslinked dextran agarose and TSK gel A minireview of recent work J Mol Recognit 3 3 123 7 Porath J 1992 Immobilized Metal lon Affinity Chromatography Protein Express Purif 3 263 281 Porath J Carlsson J Olsson amp Belfrage G 1975 Metal chelate affinity chromatography a new approach to protein fractionation
39. ting pointfor scaling up use 2 ml of extraction buffer per 20 25 ml of culture A Isolation of native HAT proteins 1 Harvest the cell culture by centrifugation at 1 000 3 000 x g for 15 min at 4 C Remove the supernatant If yield is low use the mild extraction method described in step 6 2 Resuspend the cell pellet by vortexing in 2 ml of chilled extraction buffer 4 C per 25 ml of culture for small preparations less than 100 ml Use 1 2 of the volume of the culture for large preparations 1 L or more 3 Steps 3 and 4 may be omitted if lysozyme treatment interferes with the functionality of your protein Add lysozyme to the extraction buffer to a concentration of 0 75 mg ml To reduce the chance of introducing proteases use the highest purity lysozyme available 4 Incubate at room temperature for 20 30 min Incubations at room temperature result in elevated proteolytic activities Alternatively lysozyme can be used at 4 C with lower efficiency If the protein of interest is hydrolyzed by this treatment use the method described in step 6 Alternatively disrupt the cells by repeated freeze thaw cycles i e flash freezing the cell suspension in a dry ice ethanol bath and thawing in chilled H O 5 Thoroughly sonicate the cells using a series of short repetitive bursts Use the minimum time necessary to disrupt the cells 3 x 10 seconds with 30 second pauses on ice for small preparations lt 50 ml or 3 x 30 seconds
40. uffered ethanol containing 0 02 azide 3 Regeneration of TALON Superflow Columns Purification of polyhistidine tagged proteins using imidazole gradients will cause the column to take on a purplish hue Washing the column with 5 10 column volumes of 20 mM MES buffer pH 5 0 will restore the normal pink color and bring the absorbance at 280 nm back to the original baseline level After eguilibrating the column with Extraction Wash Buffer the column is ready for reuse 4 Complete Regeneration Strip the resin of cobalt ions by washing with 10 bed volumes of 0 2 M EDTA pH 7 0 Wash excess EDTA with an additional 10 bed volumes of Milli Q HO Charge the resin with 50 mM CoCl solution 10 bed volumes Again wash with 10 bed volumes of Milli Q H O to remove excess cobalt metal ions Eguilibrate the resin with extraction wash buffer 10 bed volumes CLONTECH Laboratories Inc www clontech com Protocol lt 1 22 Version PR16705 HAT System User Manual Vill References Andersson L 1992 New developments in protein isolation purification and characterization Cancer Invest 10 1 71 84 Arnold F H 1991 Metal Affinity Separations A New Dimension in Protein Processing Biotech nology 9 151 156 Bradford M 1976 A Rapid and Sensitive Method for the Quantitation of Microgram Quantities of Protein Utilizing the principle of Protein Dye binding Analytical Biochemistry 72 248 254 Hemdan E S amp Pora
41. utes in the second and third column volumes 9 Use spectrophotometric and SDS PAGE analyses to determine which fraction contains the majority of the HAT protein Protocol PT3250 1 www clontech com CLONTECH Laboratories Inc Version PR16705 21 HAT System User Manual Vil HAT System Protocol Purification continued E Resin Washing Reuse Regeneration and Storage Generally reuse TALON Resins 3 4 times before discarding or fully regenerating The exact number of uses varies among preparations be cause of differences in redox potential organic complexity and debris content To avoid possible cross contamination use a particular aliquot of resin to purify a single type of polyhistidine tagged protein Important precautions e Do not store TALON Resin in denaturants such as 6 M guanidinium Do not store TALON Resin with bound imidazole the resin should be washed with 2 N morpholine ethanesulfonic acid MES buffer pH 5 0 before reuse to remove the bound imidazole 1 Stringent Wash optional A Wash resin with four bed volumes of 6 M guanidinium pH 5 0 1 nonionic detergent B Rinse resin with five bed volumes of distilled HO C Store resin at 4 C in 20 nonbuffered ethanol containing 0 02 azide 2 Removing Imidazole A Wash resin with five bed volumes of 20 mM MES buffer pH 5 0 containing 0 1 M NaCl B Rinse resin with five bed volumes of distilled H O C Store resin at 4 C in 20 nonb

CLONTECH

Contents

Download Pdf Manuals

Related Search

Related Contents